Science.gov

Sample records for phosphatidic acid synthesis

  1. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  2. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  3. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  4. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth

    1985-01-01

    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  5. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  6. Synthesis of dehydroepiandrosterone analogues modified with phosphatidic acid moiety.

    PubMed

    Smuga, Damian A; Smuga, Małgorzata; Swizdor, Alina; Panek, Anna; Wawrzeńczyk, Czesław

    2010-12-12

    Dehydroepiandrosterone (DHEA) and its metabolite 7α-OH DHEA have many diverse physiological, biological and biochemical effects encompassing various cell types, tissues and organs. In in vitro studies, DHEA analogues have myriad biological actions, but in vivo, especially in oral administration, DHEA produces far more limited clinical effects. One of the possible solutions of this problem is conversion of DHEA to active analogues and/or its transformation into prodrug form. In this article, the studies on the conversion of DHEA and 7α-OH DHEA into their phosphatides by the phosphodiester approach are described. In this esterification, N,N-dicyclohexylcarbodiimide (DCC) was the most efficient coupling agent as well as p-toluenesulphonyl chloride (TsCl).

  7. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Synthesis of lyso(bis)phosphatidic acid in rabbit alveolar macrophages

    SciTech Connect

    Thornburg, T.; Roddick, V.; Wykle, R.L.; Waite, M.

    1987-05-01

    Reported here are studies on the biosynthetic pathway used by normal and BCG elicited alveolar macrophages for the synthesis of lyso(bis)phosphatidic acid (L(bis)PA). Earlier observations by this laboratory have shown that although L(bis)PA is abundant in these cells, there is little de novo synthesis of this lipid. Diaceyl phosphatidylglycerol (PG) labeled with either (1,2,3-/sup 3/H) glycerol or /sup 32/P demonstrated that PG is used as an exogenous substrate for L(bis)PA formation; both glycerol moieties are incorporated. Other phospholipids do not have this capacity. BCG-elicited macrophages are capable of only one-quarter the synthesis of L(bis)PA seen with normal cells, and also show a decreased amount of cell associated substrate. In addition, (/sup 3/H) 1-0-alkyl PG was used as a substrate to test the importance of the sn-1 acyl linkage in the synthetic pathway. This substrate produced less L(bis)PA while dramatically increasing the amounts of labelled phosphatidylethanolamine and phosphatidylcholine within the cell. The alkyl substrate also showed increased uptake by the cell. They conclude that the hydrolysis of the acyl group at the sn-1 position of PG is essential in the synthetic pathway leading to the production of L(bis)PA. They further suggest that the PG used by these cells as an exogenous substrate in vitro is obtained from the PG-rich surfactant surrounding the alveolar macrophage.

  9. Polyamines are essential for the synthesis of 2-ricinoleoyl phosphatidic acid in developing seeds of castor.

    PubMed

    Tomosugi, Mitsuhiro; Ichihara, Ken'ichi; Saito, Kazumi

    2006-01-01

    The major fatty acid component of castor (Ricinus communis L.) oil is ricinoleic acid (12-hydroxy-cis-9-octadecenoic acid), and unsaturated hydroxy acid accounts for >85% of the total fatty acids in triacylglycerol (TAG). TAG had a higher ricinoleate content at position 2 than at positions 1 and 3. Although lysophosphatidic acid (LPA) acyltransferase (EC 2.3.1.51), which catalyzes acylation of LPA at position 2, was expected to utilize ricinoleoyl-CoA preferentially over other fatty acyl-CoAs, no activity was found for ricinoleoyl-CoA in vitro at concentrations at which other unsaturated acyl-CoAs were incorporated rapidly. However, activity for ricinoleoyl-CoA appeared with addition of polyamines (putrescine, spermidine, and spermine), while polyamines decreased the rates of incorporation of other acyl-CoAs into position 2. The order of effect of polyamines on LPA acyltransferase activity was spermine > spermidine > putrescine. At concentrations of spermine and spermidine of >0.1 mM, ricinoleoyl-CoA served as an effective substrate for LPA acyltransferase reaction. The concentrations of spermine and spermidine in the developing seeds were estimated at approximately 0.09 and approximately 0.63 mM, respectively. These stimulatory effects for incorporation of ricinoleate were specific to polyamines, but basic amino acids were ineffective as cations. In contrast, in microsomes from safflower seeds that do not contain ricinoleic acid, spermine and spermidine stimulated the LPA acyltransferase reaction for all acyl-CoAs tested, including ricinoleoyl-CoA. Although the fatty acid composition of TAG depends on both acyl-CoA composition in the cell and substrate specificity of acyltransferases, castor bean polyamines are crucial for incorporation of ricinoleate into position 2 of LPA. Polyamines are essential for synthesis of 2-ricinoleoyl phosphatidic acid in developing castor seeds.

  10. Adrenocorticotropin and adenosine 3',5'-monophosphate stimulate de novo synthesis of adrenal phosphatidic acid by a cycloheximide-sensitive, CA++-dependent mechanism

    SciTech Connect

    Farese, R.V.; Sabir, M.A.; Larson, R.E.

    1981-12-01

    We tested further our postulate that enhanced de novo synthesis of phosphatidic acid is responsible for ACTH- and cAMP-induced increases in adrenal phospholipids in the phosphatidate polyphosphoinositide pathway. During incubation of adrenal sections or cells in vitro, ACTH and cAMP increased the concentrations of and incorporation of (3H)glycerol and (14C)palmitate into phosphatidylcholine and phosphatidylethanolamine, two major phospholipids which are derived from phosphatidic acid, but are extrinsic to the inositide pathway. Thus, it is unlikely that ACTH and cAMP increase inositide phospholipids at the expense of other phospholipids. Similar to previously reported effects on phosphatidic acid and inositide phospholipids, cycloheximide blocked the effects of ACTH and cAMP on phosphatidylcholine and phosphatidylethanolamine. In addition, Ca++ was required for these effects, as well as for cAMP-induced increases in phosphatidic acid, inositide phospholipids, and steroidogenesis. Our findings strongly suggest that ACTH, via cAMP, stimulates de novo phosphatidate synthesis by a cycloheximide-sensitive, Ca++-dependent process, and this stimulation causes a rapid generalized increase in adrenal phospholipids. Moreover, the increased incorporation of labeled glycerol and palmitate into phospholipids suggests that ACTH and cAMP may stimulate the glycerol-3'-PO4 acyltransferase reaction. This stimulatory effect may play a central role in the steroidogenic and trophic actions of ACTH and cAMP.

  11. Lyso(bis)phosphatidic acid: a preferred donor of arachidonic acid for macrophage-synthesis of eicosanoids

    SciTech Connect

    Cochran, F.; Roddick, V.; Connor, J.; Waite, M.

    1986-05-01

    In order to dissect mechanisms of arachidonic acid (20:4) metabolism, two cell populations were investigated, resident (AM) and Bacillus Calmette-Guerin-activated (BCG-AM) rabbit alveolar macrophages. After purified AM were labeled overnight with (/sup 3/H)20:4, radioactivity was localized primarily within lyso(bis)phosphatidic acid (L(bis)PA) (13.1%), phosphatidylethanolamine (PE) (22.8%) and phosphatidylcholine (PC) (26.7%), with lesser amounts recovered in phosphatidyl-serine (PS) plus phosphatidylinositol (PI) (9.2%). By contrast, analysis of the phospholipid classes from prelabeled BCG-AM revealed that the mass of L(bis)PA as well as its (/sup 3/H)20:4 content was profoundly decreased while other BCG-AM phospholipids remained unchanged. When (/sup 3/H)20:4-labeled AM were stimulated with 1 ..mu..M 12-0-tetradecanoyl-phorbol-13-acetate (TPA), a loss of (/sup 3/H)20:4 was observed from L(bis)PA, PE, PC, and PS/PI with a corresponding increase in eicosanoid synthesis. BCG-AM exposed to either TPA or 3.8 ..mu..M Ca/sup +2/ ionophore A23187 liberated (/sup 3/H)20:4 solely from Pe and PC. BCG-AM, which exhibited depressed eicosanoid formation, consistently failed to deacylate (/sup 3/H)20:4 from L(bis)PA or PI. Their evidence suggests that the diminution of eicosanoid synthesis by BCG-AM may be due to the reduction of 20:4 contained within specific phospholipid pools, namely L(bis)PA.

  12. PHOSPHATIDIC ACID PHOSPHOHYDROLASE1 and 2 Regulate Phospholipid Synthesis at the Endoplasmic Reticulum in Arabidopsis[W

    PubMed Central

    Eastmond, Peter J.; Quettier, Anne-Laure; Kroon, Johan T.M.; Craddock, Christian; Adams, Nicolette; Slabas, Antoni R.

    2010-01-01

    Phospholipid biosynthesis is essential for the construction of most eukaryotic cell membranes, but how this process is regulated in plants remains poorly understood. Here, we show that in Arabidopsis thaliana, two Mg2+-dependent phosphatidic acid phosphohydrolases called PAH1 and PAH2 act redundantly to repress phospholipid biosynthesis at the endoplasmic reticulum (ER). Leaves from pah1 pah2 double mutants contain ~1.8-fold more phospholipid than the wild type and exhibit gross changes in ER morphology, which are consistent with massive membrane overexpansion. The net rate of incorporation of [methyl-14C]choline into phosphatidylcholine (PC) is ~1.8-fold greater in the double mutant, and the transcript abundance of several key genes that encode enzymes involved in phospholipid synthesis is increased. In particular, we show that PHOSPHORYLETHANOLAMINE N-METHYLTRANSFERASE1 (PEAMT1) is upregulated at the level of transcription in pah1 pah2 leaves. PEAMT catalyzes the first committed step of choline synthesis in Arabidopsis and defines a variant pathway for PC synthesis not found in yeasts or mammals. Our data suggest that PAH1/2 play a regulatory role in phospholipid synthesis that is analogous to that described in Saccharomyces cerevisiae. However, the target enzymes differ, and key components of the signal transduction pathway do not appear to be conserved. PMID:20699392

  13. The influence of charge on phosphatidic acid bilayer membranes.

    PubMed

    Eibl, H; Blume, A

    1979-06-02

    A complete titration of phosphatidic acid bilayer membranes was possible for the first time by the introduction of a new anaologue, 1,2-dihexadecyl-sn-glycerol-3-phosphoric acid, which has the advantage of a high chemical stability at extreme pH values. The synthesis of the phosphatidic acid is described and the phase transition behaviour in aqueous dispersions is compared with that of three ester phosphatidic acids; 1,2-dimyristoyl-sn-glycerol-3-phosphoric acid, 1,3-dimyristoylglycerol-2-phosphoric acid and 1,2-dipalmitoyl-sn-glycerol-3-phosphoric acid. The phase transition temperatures (Tt) of aqueous phosphatidic acid dispersions at different degrees of dissociation were measured using fluorescence spectroscopy and 90 degrees light scattering. The Tt values are comparable to the melting points of the solid phosphatidic acids in the fully protonated states, but large differences exist for the charged states. The Tt vs. pH diagrams of the four phosphatidic acids are quite similar and of a characteristic shape. Increasing ionisation results in a maximum value for the transition temperatures at pH 3.5 (pK1). The regions between the first and the second pK of the phosphatidic acids are characterised by only small variations in the transition temperatures (extended plateau) in spite of the large changes occurring in the surface charge of the membranes. The slope of the plateau is very shallow with increasing ionisation. A further decrease in the H+ concentration results in an abrupt change of the transition temperature. The slope of the Tt vs. pH diagram beyond pK2 becomes very steep. This is the result of reduced hydrocarbon interaction energy, which was demonstrated by differential scanning calorimetry (Blume, A. and Eibl, H., unpublished data).

  14. The discovery of the fat-regulating phosphatidic acid phosphatase gene

    PubMed Central

    CARMAN, George M.

    2011-01-01

    Phosphatidic acid phosphatase is a fat-regulating enzyme that plays a major role in controlling the balance of phosphatidic acid (substrate) and diacylglycerol (product), which are lipid precursors used for the synthesis of membrane phospholipids and triacylglycerol. Phosphatidic acid is also a signaling molecule that triggers phospholipid synthesis gene expression, membrane expansion, secretion, and endocytosis. While this important enzyme has been known for several decades, its gene was only identified recently from yeast. This discovery showed the importance of phosphatidic acid phosphatase in lipid metabolism in yeast as well as in higher eukaryotes including humans. PMID:21785579

  15. The discovery of the fat-regulating phosphatidic acid phosphatase gene.

    PubMed

    Carman, George M

    2011-05-01

    Phosphatidic acid phosphatase is a fat-regulating enzyme that plays a major role in controlling the balance of phosphatidic acid (substrate) and diacylglycerol (product), which are lipid precursors used for the synthesis of membrane phospholipids and triacylglycerol. Phosphatidic acid is also a signaling molecule that triggers phospholipid synthesis gene expression, membrane expansion, secretion, and endocytosis. While this important enzyme has been known for several decades, its gene was only identified recently from yeast. This discovery showed the importance of phosphatidic acid phosphatase in lipid metabolism in yeast as well as in higher eukaryotes including humans.

  16. Accumulation of phosphatidic acid mass and increased de novo synthesis of glycerolipids in platelet-activating-factor-activated human neutrophils.

    PubMed Central

    Tou, J; Jeter, J R; Dola, C P; Venkatesh, S

    1991-01-01

    Incubation of human neutrophils with 100 nM-platelet-activating factor (PAF) but without cytochalasin B resulted in a rapid (5 s) accumulation (1.6-fold) of phosphatidic acid (PtdOH) mass. The increased PtdOH mass reached a maximum (2.8-fold) at 1 min and remained elevated (1.7-fold) at 10 min. No methylamine-stable lyso-PtdOH was detectable in the total lipid extract from control or from PAF-activated cells, suggesting that diacyl-PtdOH was the predominant species. In PAF-activated cells, changes in 1,2-diacylglycerol (DG) mass were not detectable at 5 or 15 s. Increased DG mass (1.7-fold) was detected between 30 s and 2 min, but then it declined to basal levels by 10 min. PAF enhanced [3H]glycerol incorporation into PtdOH and DG by 2- and 3-fold respectively during 1-10 min incubations. PAF also increased the radioactivity but not the mass of phosphatidylinositol and of choline glycerophospholipid by 8-fold and 4-fold respectively at 10 min. In addition, PAF-activated cells showed increased (2-fold) glycerol incorporation into triacylglycerol. These results demonstrate that PAF enhances rapid accumulation of diacyl-PtdOH mass, and that increased de novo synthesis may contribute to PtdOH mass accumulation. Images Fig. 2. PMID:1662484

  17. Acetal phosphatidic acids: novel platelet aggregating agents.

    PubMed

    Brammer, J P; Maguire, M H; Walaszek, E J; Wiley, R A

    1983-05-01

    1 Palmitaldehyde, olealdehyde and linolealdehyde acetal phosphatidic acids induced rapid shape change and dose-dependent biphasic aggregation of human platelets in platelet-rich plasma; aggregation was reversible at low doses and irreversible at high doses of the acetal phosphatidic acids. The palmitaldehyde congener elicited monophasic dose-dependent aggregation of sheep platelets in platelet-rich plasma.2 The threshold concentration for palmitaldehyde acetal phosphatidic acid (PGAP)-induced platelet aggregation was 2.5-5 muM for human platelets and 0.25-0.5 muM for sheep platelets. PGAP was 4-5 times as potent versus human platelets as the olealdehyde and linolealdehyde acetal phosphatidic acids, which were equipotent.3 PGAP-induced irreversible aggregation of [(14)C]-5-hydroxytryptamine ([(14)C]-5-HT)-labelled human platelets in platelet-rich plasma was accompanied by release of 44.0+/-2.4% (s.e.) of the platelet [(14)C]-5-HT; reversible aggregation was not associated with release. In contrast, PGAP-induced release of [(14)C]-5-HT-labelled sheep platelets was dose-dependent.4 The adenosine diphosphate (ADP) antagonist, 2-methylthio-AMP, and the cyclo-oxygenase inhibitor, aspirin, abolished PGAP-induced second phase aggregation and release in human platelets but did not affect the first, reversible, phase of aggregation. Both the first and second phases of PGAP-induced aggregation were abolished by chlorpromazine, by the phospholipase A(2) inhibitor, mepacrine, and by nmolar concentrations of prostaglandin E(1) (PGE(1)); these agents abolished the second, but not the first phase of ADP-induced aggregation.5 The related phospholipids, lecithin, lysolecithin and phosphatidic acid, at <100 muM, neither induced aggregation of human platelets in platelet-rich plasma, nor modified PGAP-induced aggregation; 1-palmityl lysophosphatidic acid elicited aggregation of human platelets at a threshold concentration of 100 muM.6 It is concluded that the acetal phosphatidic acids

  18. Accumulation of Phosphatidic Acid Increases Vancomycin Resistance in Escherichia coli

    PubMed Central

    Sutterlin, Holly A.; Zhang, Sisi

    2014-01-01

    In Gram-negative bacteria, lipopolysaccharide (LPS) contributes to the robust permeability barrier of the outer membrane, preventing entry of toxic molecules such as antibiotics. Mutations in lptD, the beta-barrel component of the LPS transport and assembly machinery, compromise LPS assembly and result in increased antibiotic sensitivity. Here, we report rare vancomycin-resistant suppressors that improve barrier function of a subset of lptD mutations. We find that all seven suppressors analyzed mapped to the essential gene cdsA, which is responsible for the conversion of phosphatidic acid to CDP-diacylglycerol in phospholipid biosynthesis. These cdsA mutations cause a partial loss of function and, as expected, accumulate phosphatidic acid. We show that this suppression is not confined to mutations that cause defects in outer membrane biogenesis but rather that these cdsA mutations confer a general increase in vancomycin resistance, even in a wild-type cell. We use genetics and quadrupole time of flight (Q-TOF) liquid chromatography-mass spectrometry (LC-MS) to show that accumulation of phosphatidic acid by means other than cdsA mutations also increases resistance to vancomycin. We suggest that increased levels of phosphatidic acid change the physical properties of the outer membrane to impede entry of vancomycin into the periplasm, hindering access to its target, an intermediate required for the synthesis of the peptidoglycan cell wall. PMID:24957626

  19. Phosphatidate phosphatase regulates membrane phospholipid synthesis via phosphatidylserine synthase.

    PubMed

    Carman, George M; Han, Gil-Soo

    2017-08-16

    The yeast Saccharomyces cerevisiae serves as a model eukaryote to elucidate the regulation of lipid metabolism. In exponentially growing yeast, a diverse set of membrane lipids are synthesized from the precursor phosphatidate via the liponucleotide intermediate CDP-diacylglycerol. As cells exhaust nutrients and progress into the stationary phase, phosphatidate is channeled via diacylglycerol to the synthesis of triacylglycerol. The CHO1-encoded phosphatidylserine synthase, which catalyzes the committed step in membrane phospholipid synthesis via CDP-diacylglycerol, and the PAH1-encoded phosphatidate phosphatase, which catalyzes the committed step in triacylglycerol synthesis are regulated throughout cell growth by genetic and biochemical mechanisms to control the balanced synthesis of membrane phospholipids and triacylglycerol. The loss of phosphatidate phosphatase activity (e.g., pah1Δ mutation) increases the level of phosphatidate and its conversion to membrane phospholipids by inducing Cho1 expression and phosphatidylserine synthase activity. The regulation of the CHO1 expression is mediated through the inositol-sensitive upstream activation sequence (UASINO), a cis-acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. Consequently, phosphatidate phosphatase activity regulates phospholipid synthesis through the transcriptional regulation of the phosphatidylserine synthase enzyme. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Cyclic phosphatidic acid - a unique bioactive phospholipid.

    PubMed

    Fujiwara, Yuko

    2008-09-01

    Cyclic phosphatidic acid (CPA) is a naturally occurring analog of the growth factor-like phospholipid mediator, lysophosphatidic acid (LPA). The sn-2 hydroxy group of CPA forms a 5-membered ring with the sn-3 phosphate. CPA affects numerous cellular functions, including anti-mitogenic regulation of the cell cycle, induction of stress fiber formation, inhibition of tumor cell invasion and metastasis, and regulation of differentiation and survival of neuronal cells. Interestingly, many of these cellular responses caused by CPA oppose those of LPA despite the activation of apparently overlapping receptor populations. Since the early 1990s, studies on CPA actions gradually developed, and we are now beginning to understand the importance of this lipid. In this review, we focus on the current knowledge about CPA, including enzymatic formation of CPA, unique biological activities and biological targets of CPA, and we also explore metabolically stabilized CPA analogs.

  1. Purification, characterization, and bioinformatics studies of phosphatidic acid phosphohydrolase from Lagenaria siceraria

    USDA-ARS?s Scientific Manuscript database

    Phosphatidic acid phosphohydrolase (PAP), EC 3.1.3.4, is the penultimate step in the Kennedy pathway of triacyl glycerol (TAG) synthesis leading to the formation of diacyl glycerol (DAG), which is a key intermediate in TAG synthesis. We partially purified a soluble PAP from mid maturing seeds of bot...

  2. Purification, characterization, and bioinformatics studies of phosphatidic acid phosphohydrolase from Lagenaria siceraria

    USDA-ARS?s Scientific Manuscript database

    Phosphatidic acid phosphohydrolase (PAP), EC 3.1.3.4, is the penultimate step in the Kennedy pathway of triacyl glycerol (TAG) synthesis leading to the formation of diacyl glycerol (DAG), which is a key intermediate in TAG synthesis. We partially purified a soluble PAP from mid maturing seeds of bot...

  3. Angiotensin II induces phosphatidic acid formation in neonatal rat cardiac fibroblasts: evaluation of the roles of phospholipases C and D.

    PubMed

    Booz, G W; Taher, M M; Baker, K M; Singer, H A

    1994-12-21

    Phosphatidic acid has been proposed to contribute to the mitogenic actions of various growth factors. In 32P-labeled neonatal rat cardiac fibroblasts, 100 nM [Sar1]angiotensin II was shown to rapidly induce formation of 32P-phosphatidic acid. Levels peaked at 5 min (1.5-fold above control), but were partially sustained over 2 h. Phospholipase D contributed in part to phosphatidic acid formation, as 32P- or 3H-phosphatidylethanol was produced when cells labeled with [32P]H3PO4 or 1-O-[1,2- 3H]hexadecyl-2-lyso-sn-glycero-3-phosphocholine were stimulated in the presence of 1% ethanol. [Sar1]angiotensin II-induced phospholipase D activity was transient and mainly mediated through protein kinase C (PKC), since PKC downregulation reduced phosphatidylethanol formation by 68%. Residual activity may have been due to increased intracellular Ca2+, as ionomycin also activated phospholipase D in PKC-depleted cells. Phospholipase D did not fully account for [Sar1]angiotensin II-induced phosphatidic acid: 1) compared to PMA, a potent activator of phospholipase D, [Sar1]angiotensin II produced more phosphatidic acid relative to phosphatidylethanol, and 2) PKC downregulation did not affect [Sar1]angiotensin II-induced phosphatidic acid formation. The diacylglycerol kinase inhibitor R59949 depressed [Sar1]angiotensin II-induced phosphatidic acid formation by only 21%, indicating that activation of a phospholipase C and diacylglycerol kinase also can not account for the bulk of phosphatidic acid. Thus, additional pathways not involving phospholipases C and D, such as de novo synthesis, may contribute to [Sar1]angiotensin II-induced phosphatidic acid in these cells. Finally, as previously shown for [Sar1]angiotensin II, phosphatidic acid stimulated mitogen activated protein (MAP) kinase activity.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. The Coffin-Lowry syndrome-associated protein RSK2 regulates neurite outgrowth through phosphorylation of phospholipase D1 (PLD1) and synthesis of phosphatidic acid.

    PubMed

    Ammar, Mohamed-Raafet; Humeau, Yann; Hanauer, André; Nieswandt, Bernard; Bader, Marie-France; Vitale, Nicolas

    2013-12-11

    More than 80 human X-linked genes have been associated with mental retardation and deficits in learning and memory. However, most of the identified mutations induce limited morphological alterations in brain organization and the molecular bases underlying neuronal clinical features remain elusive. We show here that neurons cultured from mice lacking ribosomal S6 kinase 2 (Rsk2), a model for the Coffin-Lowry syndrome (CLS), exhibit a significant delay in growth in a similar way to that shown by neurons cultured from phospholipase D1 (Pld1) knock-out mice. We found that gene silencing of Pld1 or Rsk2 as well as acute pharmacological inhibition of PLD1 or RSK2 in PC12 cells strongly impaired neuronal growth factor (NGF)-induced neurite outgrowth. Expression of a phosphomimetic PLD1 mutant rescued the inhibition of neurite outgrowth in PC12 cells silenced for RSK2, revealing that PLD1 is a major target for RSK2 in neurite formation. NGF-triggered RSK2-dependent phosphorylation of PLD1 led to its activation and the synthesis of phosphatidic acid at sites of neurite growth. Additionally, total internal reflection fluorescence microscopy experiments revealed that RSK2 and PLD1 positively control fusion of tetanus neurotoxin insensitive vesicle-associated membrane protein (TiVAMP)/VAMP-7 vesicles at sites of neurite outgrowth. We propose that the loss of function mutations in RSK2 that leads to CLS and neuronal deficits are related to defects in neuronal growth due to impaired RSK2-dependent PLD1 activity resulting in a reduced vesicle fusion rate and membrane supply.

  5. Effects of oral phosphatidic acid feeding with or without whey protein on muscle protein synthesis and anabolic signaling in rodent skeletal muscle.

    PubMed

    Mobley, C Brooks; Hornberger, Troy A; Fox, Carlton D; Healy, James C; Ferguson, Brian S; Lowery, Ryan P; McNally, Rachel M; Lockwood, Christopher M; Stout, Jeffrey R; Kavazis, Andreas N; Wilson, Jacob M; Roberts, Michael D

    2015-01-01

    Phosphatidic acid (PA) is a diacyl-glycerophospholipid that acts as a signaling molecule in numerous cellular processes. Recently, PA has been proposed to stimulate skeletal muscle protein accretion, but mechanistic studies are lacking. Furthermore, it is unknown whether co-ingesting PA with other leucine-containing ingredients can enhance intramuscular anabolic signaling mechanisms. Thus, the purpose of this study was to examine if oral PA feeding acutely increases anabolic signaling markers and muscle protein synthesis (MPS) in gastrocnemius with and without whey protein concentrate (WPC). Overnight fasted male Wistar rats (~250 g) were randomly assigned to four groups: control (CON, n = 6-13), PA (29 mg; n = 8), WPC (197 mg; n = 8), or PA + WPC (n = 8). Three hours post-feeding, gastrocnemius muscle was removed for markers of Akt-mTOR signaling, gene expression patterns related to skeletal muscle mass regulation and metabolism, and MPS analysis via the SUnSET method. Compared to CON rats, PA, WPC and PA + WPC resulted in a significant elevation in the phosphorylation of mTOR (Ser2481) and rps6 (Ser235/236) (p < 0.05) in the gastrocnemius though there were no differences between the supplemented groups. MPS levels in the gastrocnemius were significantly (p < 0.05) elevated in WPC versus CON rats, and tended to be elevated in PA versus CON rats (p = 0.08), though MPS was less in PA + WPC versus WPC rats (p < 0.05) in spite of robust increases in mTOR pathway activity markers in the former group. C2C12 myoblast data agreed with the in vivo data herein showing that PA increased MPS levels 51% (p < 0.001) phosphorylated p70s6k (Thr389) levels 67% (p < 0.001). Our results are the first in vivo evidence to demonstrate that PA tends to increases MPS 3 h post-feeding, though PA may delay WPC-mediated MPS kinetics within a 3 h post-feeding window.

  6. Dilinoleoyl-phosphatidic acid mediates reduced IRS-1 tyrosine phosphorylation in rat skeletal muscle cells and mouse muscle.

    PubMed

    Cazzolli, R; Mitchell, T W; Burchfield, J G; Pedersen, D J; Turner, N; Biden, T J; Schmitz-Peiffer, C

    2007-08-01

    Insulin resistance in skeletal muscle is strongly associated with lipid oversupply, but the intracellular metabolites and underlying mechanisms are unclear. We therefore sought to identify the lipid intermediates through which the common unsaturated fatty acid linoleate causes defects in IRS-1 signalling in L6 myotubes and mouse skeletal muscle. Cells were pre-treated with 1 mmol/l linoleate for 24 h. Subsequent insulin-stimulated IRS-1 tyrosine phosphorylation and its association with the p85 subunit of phosphatidylinositol 3-kinase were determined by immunoblotting. Intracellular lipid species and protein kinase C activation were modulated by overexpression of diacylglycerol kinase epsilon, which preferentially converts unsaturated diacylglycerol into phosphatidic acid, or by inhibition of lysophosphatidic acid acyl transferase with lisofylline, which reduces phosphatidic acid synthesis. Phosphatidic acid species in linoleate-treated cells or muscle from insulin-resistant mice fed a safflower oil-based high-fat diet that was rich in linoleate were analysed by mass spectrometry. Linoleate pretreatment reduced IRS-1 tyrosine phosphorylation and p85 association. Overexpression of diacylglycerol kinase epsilon reversed the activation of protein kinase C isoforms by linoleate, but paradoxically further diminished IRS-1 tyrosine phosphorylation. Conversely, lisofylline treatment restored IRS-1 phosphorylation. Mass spectrometry indicated that the dilinoleoyl-phosphatidic acid content increased from undetectable levels to almost 20% of total phosphatidic acid in L6 cells and to 8% of total in the muscle of mice fed a high-fat diet. Micelles containing dilinoleoyl-phosphatidic acid specifically inhibited IRS-1 tyrosine phosphorylation and glycogen synthesis in L6 cells. These data indicate that linoleate-derived phosphatidic acid is a novel lipid species that contributes independently of protein kinase C to IRS-1 signalling defects in muscle cells in response to lipid

  7. Thiophosphoester analogs of phosphatidic acids: spectrophotometric substrates for phosphomonoesterases.

    PubMed

    Nyquist, D A

    1988-10-01

    Thiophosphoester analogs of dioctanoyl and didecanoyl phosphatidic acids were synthesized for use as substrates in spectrophotometric assays. These substrates are easily dispersable in aqueous media and release thiodiacylglycerols after phosphomonoesterase catalyzed hydrolysis. The free sulfhydryl of these thiodiacylglycerols reacts with the colorimetric reagent 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), allowing the reaction to be followed. These analogs were shown to be good substrates for calf intestine alkaline phosphatase (highest activity at alkaline pH) and phosphomonoesterases of partially purified beef brain cytosol (highest activity at physiologic pH). Cationic amphiphilic drugs inhibit the actions of alkaline phosphatase on the dioctanoyl analog, but did not inhibit enzymatic hydrolysis of p-nitrophenyl phosphate. In contrast, the beef brain cytosolic fraction p-nitrophenyl phosphate hydrolysis was mildly inhibited, and the phosphatidic acid analog hydrolysis was increased slightly. Tetramisole inhibited all enzyme activities with p-nitrophenyl phosphate, but was inhibitory only to the alkaline-phosphatase activity with the phosphatidic acid analog.

  8. Stimulation and binding of myocardial phospholipase C by phosphatidic acid.

    PubMed

    Henry, R A; Boyce, S Y; Kurz, T; Wolf, R A

    1995-08-01

    Exposure of adult ventricular myocytes to exogenous natural phosphatidic acid results in the production of inositol phosphates by unknown mechanism(s). We characterized stimulation of myocytic phosphoinositide-specific phospholipase C (PLC) by synthetic dioleoyl phosphatidic acid (PA) as a potential mechanism for modulation of inositol phosphate production. Our data demonstrate that exogenous PA, at 10(-8)-10(-5) M, caused a concentration-dependent increase in inositol 1,4,5-trisphosphate in adult rabbit ventricular myocytes. PA also caused a concentration-dependent increase in in vitro activity of myocytic PLC in the presence or absence of ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA). PLC-delta 1, the predominant isozyme of PLC expressed in adult rabbit ventricular myocytes, bound to liposomes of PA with high affinity in the presence of EGTA. The phosphomonoester group of PA was critical to in vitro stimulation of myocytic PLC activity and high-affinity binding of PLC-delta 1. We propose that binding of PLC-delta 1 to phosphatidic acid may be a novel mechanism for dynamic membrane association and modulation of PLC in adult ventricular myocytes.

  9. Phosphatidic acid metabolism in rat liver cell nuclei.

    PubMed

    Gaveglio, Virginia L; Pasquaré, Susana J; Giusto, Norma M

    2013-04-02

    The aim of the present research was to analyze the pathways for phosphatidic acid metabolism in purified nuclei from liver. Lipid phosphate phosphatase, diacylglycerol lipase, monoacylglycerol lipase and PA-phospholipase type A activities were detected. The presence of lysophosphatidic acid significantly reduced DAG production while sphingosine 1-phoshate and ceramide 1-phosphate reduced MAG formation from PA. Using different enzymatic modulators (detergents and ions) an increase in the PA metabolism by phospholipase type A was observed. Our findings evidence an active PA metabolism in purified liver nuclei which generates important lipid second messengers, and which could thus be involved in nuclear processes such as gene transcription.

  10. Phosphorylation of lipin 1 and charge on the phosphatidic acid head group control its phosphatidic acid phosphatase activity and membrane association.

    PubMed

    Eaton, James M; Mullins, Garrett R; Brindley, David N; Harris, Thurl E

    2013-04-05

    The lipin gene family encodes a class of Mg(2+)-dependent phosphatidic acid phosphatases involved in the de novo synthesis of phospholipids and triglycerides. Unlike other enzymes in the Kennedy pathway, lipins are not integral membrane proteins, and they need to translocate from the cytosol to intracellular membranes to participate in glycerolipid synthesis. The movement of lipin 1 within the cell is closely associated with its phosphorylation status. Although cellular analyses have demonstrated that highly phosphorylated lipin 1 is enriched in the cytosol and dephosphorylated lipin 1 is found on membranes, the effects of phosphorylation on lipin 1 activity and binding to membranes has not been recapitulated in vitro. Herein we describe a new biochemical assay for lipin 1 using mixtures of phosphatidic acid (PA) and phosphatidylethanolamine that reflects its physiological activity and membrane interaction. This depends on our observation that lipin 1 binding to PA in membranes is highly responsive to the electrostatic charge of PA. The studies presented here demonstrate that phosphorylation regulates the ability of the polybasic domain of lipin 1 to recognize di-anionic PA and identify mTOR as a crucial upstream signaling component regulating lipin 1 phosphorylation. These results demonstrate how phosphorylation of lipin 1 together with pH and membrane phospholipid composition play important roles in the membrane association of lipin 1 and thus the regulation of its enzymatic activity.

  11. Phosphatidic acid mediates demyelination in Lpin1 mutant mice.

    PubMed

    Nadra, Karim; de Preux Charles, Anne-Sophie; Médard, Jean-Jacques; Hendriks, William T; Han, Gil-Soo; Grès, Sandra; Carman, George M; Saulnier-Blache, Jean-Sébastien; Verheijen, Mark H G; Chrast, Roman

    2008-06-15

    Lipids play crucial roles in many aspects of glial cell biology, affecting processes ranging from myelin membrane biosynthesis to axo-glial interactions. In order to study the role of lipid metabolism in myelinating glial cells, we specifically deleted in Schwann cells the Lpin1 gene, which encodes the Mg2+-dependent phosphatidate phosphatase (PAP1) enzyme necessary for normal triacylglycerol biosynthesis. The affected animals developed pronounced peripheral neuropathy characterized by myelin degradation, Schwann cell dedifferentiation and proliferation, and a reduction in nerve conduction velocity. The observed demyelination is mediated by endoneurial accumulation of the substrate of the PAP1 enzyme, phosphatidic acid (PA). In addition, we show that PA is a potent activator of the MEK-Erk pathway in Schwann cells, and that this activation is required for PA-induced demyelination. Our results therefore reveal a surprising role for PA in Schwann cell fate determination and provide evidence of a direct link between diseases affecting lipid metabolism and abnormal Schwann cell function.

  12. Phosphatidic acid mediates demyelination in Lpin1 mutant mice

    PubMed Central

    Nadra, Karim; de Preux Charles, Anne-Sophie; Médard, Jean-Jacques; Hendriks, William T.; Han, Gil-Soo; Grès, Sandra; Carman, George M.; Saulnier-Blache, Jean-Sébastien; Verheijen, Mark H.G.; Chrast, Roman

    2008-01-01

    Lipids play crucial roles in many aspects of glial cell biology, affecting processes ranging from myelin membrane biosynthesis to axo-glial interactions. In order to study the role of lipid metabolism in myelinating glial cells, we specifically deleted in Schwann cells the Lpin1 gene, which encodes the Mg2+-dependent phosphatidate phosphatase (PAP1) enzyme necessary for normal triacylglycerol biosynthesis. The affected animals developed pronounced peripheral neuropathy characterized by myelin degradation, Schwann cell dedifferentiation and proliferation, and a reduction in nerve conduction velocity. The observed demyelination is mediated by endoneurial accumulation of the substrate of the PAP1 enzyme, phosphatidic acid (PA). In addition, we show that PA is a potent activator of the MEK–Erk pathway in Schwann cells, and that this activation is required for PA-induced demyelination. Our results therefore reveal a surprising role for PA in Schwann cell fate determination and provide evidence of a direct link between diseases affecting lipid metabolism and abnormal Schwann cell function. PMID:18559480

  13. Measuring phosphatidic acid phosphatase (EC 3.1.3.4) activity using two phosphomolybdate-based colorimetric methods

    USDA-ARS?s Scientific Manuscript database

    Phosphatidate phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4), which is also known as PAP, catalyzes the dephosphorylation of phosphatidate (PtdOH) to form diacylglycerol (DAG) and inorganic phosphate. In eukaryotes, PAP driven reaction is the committed step in the synthesis of triacyl...

  14. Cyclic Phosphatidic Acid – A Unique Bioactive Phospholipid

    PubMed Central

    Fujiwara, Yuko

    2008-01-01

    Cyclic phosphatidic acid (CPA) is a naturally occurring analog of the growth factor-like phospholipid mediator, lysophosphatidic acid (LPA). The sn-2 hydroxy group of CPA forms a 5-membered ring with the sn-3 phosphate. CPA affects numerous cellular functions, including antimitogenic regulation of the cell cycle, induction of stress fiber formation, inhibition of tumor cell invasion and metastasis, and regulation of differentiation and survival of neuronal cells. Interestingly, many of these cellular responses caused by CPA oppose those of LPA despite the activation of apparently overlapping receptor populations. Since the early 1990s, studies on CPA actions gradually developed, and we are now beginning to understand the importance of this lipid. In this review, we focus on the current knowledge about CPA, including enzymatic formation of CPA, unique biological activities and biological targets of CPA, and we also explore metabolically stabilized CPA analogs. PMID:18554524

  15. Stimulating effect of phosphatidic acid on autophosphorylation of phosphorylase kinase.

    PubMed

    Negami, A I; Sasaki, H; Yamamura, H

    1985-09-16

    Autophosphorylation of phosphorylase kinase from rabbit skeletal muscle was stimulated by acidic phospholipids such as phosphatidic acid (PA), phosphatidylinositol, and phosphatidyl-serine. PA stimulated an initial velocity of autophosphorylation 3.8-fold. When fully autophosphorylated, about 11 mol of phosphate per tetramer (alpha beta gamma delta) were incorporated in the presence of PA and about 6.5 mol in the absence of PA. In the presence of PA (100 micrograms/ml), there was a concomitant enhancement of its kinase activity about 25-fold at pH 6.8. PA (100 micrograms/ml) sharply decreased an apparent Ka for Ca2+ on autophosphorylation from 4.0 X 10(-5) M to 1.0 X 10(-6) M. Available evidence indicates that the Ca2+-activated, PA-dependent autophosphorylation of phosphorylase kinase shows an ability to stimulate glycogen breakdown.

  16. Defective phosphatidic acid-phospholipase C signaling in diabetic cardiomyopathy.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Dibrov, Elena; Austria, J Alejandro; Sahi, Nidhi; Panagia, Vincenzo; Pierce, Grant N

    2004-03-26

    The effects of exogenous phosphatidic acid (PA) on Ca2+ transients and contractile activity were studied in cardiomyocytes isolated from chronic streptozotocin-induced diabetic rats. In control cells, 25 microM PA induced a significant increase in active cell shortening and Ca2+ transients. PA increased IP3 generation in the control cardiomyocytes and its inotropic effects were blocked by a phospholipase C inhibitor. In cardiomyocytes from diabetic rats, PA induced a 25% decrease in active cell shortening and no significant effect on Ca2+ transients. Basal and PA-induced IP3 generation in diabetic rat cardiomyocytes was 3-fold lower as compared to control cells. Sarcolemmal membrane PLC activity was impaired. Insulin treatment of the diabetic animals resulted in a partial recovery of PA responses. Our results, therefore, identify an important defect in the PA-PLC signaling pathway in diabetic rat cardiomyocytes, which may have significant implications for heart dysfunction during diabetes.

  17. Cloning and characterization of drought-stimulated phosphatidic acid phosphatase genes from Vigna unguiculata.

    PubMed

    França, Marcel Giovanni Costa; Matos, Ana Rita; D'arcy-Lameta, Agnès; Passaquet, Chantal; Lichtlé, Christiane; Zuily-Fodil, Yasmine; Pham-Thi, Anh Thu

    2008-12-01

    Under environmental stresses, several lipolytic enzymes are known to be activated and to contribute to membrane lipid turnover and generation of second messengers. In animal cells, phosphatidic acid phosphatase (PAP, EC 3.1.3.4), which dephosphorylates phosphatidic acid generating diacylglycerol, is long known as an enzyme involved in lipid synthesis and cell signalling. However, knowledge on PAP in plants remains very limited. The aim of this work was to isolate and characterize PAP genes in the tropical legume Vigna unguiculata (cowpea), and to study their expression under different stress conditions. Two cDNAs designated as VuPAPalpha and VuPAPbeta were cloned from the leaves of cowpea. Both proteins share sequence homology to animal type 2 PAP, namely, the six transmembrane regions and the consensus sequences corresponding to the catalytic domain of the phosphatase family, like the recently described Arabidopsis LPP (Lipid Phosphate Phosphatase) proteins. The recombinant protein VuPAPalpha expressed in Escherichia coli cells was able to convert phosphatidic acid into diacylglycerol. Unlike VuPAPbeta, VuPAPalpha has an N-terminal transit peptide and was addressed to chloroplast in vitro. Both genes are expressed in several cowpea organs and their transcripts accumulate in leaves in response to water deficit, including progressive dehydration of whole plants and rapid desiccation of detached leaves. No changes in expression of both genes were observed after wounding or by treatment with jasmonic acid. Furthermore, the in silico analysis of VuPAPalpha promoter allowed the identification of several putative drought-related regulatory elements. The possible physiological role of the two cloned PAPs is discussed.

  18. Phosphatidic acid phosphatase and phospholipdase A activities in plasma membranes from fusing muscle cells.

    PubMed

    Kent, C; Vagelos, P R

    1976-06-17

    Plasma membrane from fusing embryonic muscle cells were assayed for phospholipase A activity to determine if this enzyme plays a role in cell fusion. The membranes were assayed under a variety of conditions with phosphatidylcholine as the substrate and no phospholipase A activity was found. The plasma membranes did contain a phosphatidic acid phosphatase which was optimally active in the presence of Triton X-100 and glycerol. The enzyme activity was constant from pH 5.2 to 7.0, and did not require divalent cations. Over 97% of the phosphatidic acid phosphatase activity was in the particulate fraction. The subcellular distribution of the phosphatidic acid phosphatase was the same as the distributions of the plasma membrane markers, (Na+ + k+)-ATPase and the acetylcholine receptor, which indicates that this phosphatase is located exclusively in the plasma membranes. There was no detectable difference in the phosphatidic acid phosphatase activities of plasma membranes from fusing and non-fusing cells.

  19. Phosphatidic acid stimulates inositol 1,4,5-trisphosphate production in adult cardiac myocytes.

    PubMed

    Kurz, T; Wolf, R A; Corr, P B

    1993-03-01

    The cellular content of phosphatidic acid can increase in response to several agonists either by phosphorylation of diacylglycerol after phospholipase C-catalyzed hydrolysis of phospholipids or directly through activation of phospholipase D. Although previous findings indicated that the generation of phosphatidic acid was exclusively a means of regulation of the cellular concentration of diacylglycerol, more recent studies have indicated that phosphatidic acid may also directly regulate several cellular functions. Accordingly, the present study was performed to assess whether phosphatidic acid could stimulate cardiac phospholipase C in intact adult rabbit ventricular myocytes. The mass of inositol 1,4,5-trisphosphate [Ins (1,4,5)P3] was determined by a specific and sensitive binding protein assay and by direct mass measurement using anion exchange chromatography for separation of selected inositol phosphates and gas chromatography and mass spectrometry for quantification of inositol monophosphate (IP1), inositol bisphosphate (IP2), inositol trisphosphate (IP3), and inositol tetrakisphosphate (IP4). Phosphatidic acid (10(-9)-10(-6) M) elicited a rapid concentration-dependent increase in Ins (1,4,5)P3 accumulation, with the peak fourfold to fivefold increase at 30 seconds of stimulation; the concentration required for 50% of maximal stimulation was 4.4 x 10(-8) M. The time course of individual inositol phosphates indicated a successive increase in the mass of IP3, IP4, IP2, and IP1 in response to stimulation with phosphatidic acid. The production of Ins (1,4,5)P3 in response to phosphatidic acid was not altered in the absence of extracellular calcium or in the presence of extracellular EGTA (10(-3) M). Thus, these findings indicate that phosphatidic acid is a potent activator of inositol phosphate production in adult ventricular myocytes.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Phosphatidic acid inhibits ceramide 1-phosphate-stimulated macrophage migration.

    PubMed

    Ouro, Alberto; Arana, Lide; Rivera, Io-Guané; Ordoñez, Marta; Gomez-Larrauri, Ana; Presa, Natalia; Simón, Jorge; Trueba, Miguel; Gangoiti, Patricia; Bittman, Robert; Gomez-Muñoz, Antonio

    2014-12-15

    Ceramide 1-phosphate (C1P) was recently demonstrated to potently induce cell migration. This action could only be observed when C1P was applied exogenously to cells in culture, and was inhibited by pertussis toxin. However, the mechanisms involved in this process are poorly understood. In this work, we found that phosphatidic acid (PA), which is structurally related to C1P, displaced radiolabeled C1P from its membrane-binding site and inhibited C1P-stimulated macrophage migration. This effect was independent of the saturated fatty acid chain length or the presence of a double bond in each of the fatty acyl chains of PA. Treatment of RAW264.7 macrophages with exogenous phospholipase D (PLD), an enzyme that produces PA from membrane phospholipids, also inhibited C1P-stimulated cell migration. Likewise, PA or exogenous PLD inhibited C1P-stimulated extracellularly regulated kinases (ERK) 1 and 2 phosphorylation, leading to inhibition of cell migration. However, PA did not inhibit C1P-stimulated Akt phosphorylation. It is concluded that PA is a physiological regulator of C1P-stimulated macrophage migration. These actions of PA may have important implications in the control of pathophysiological functions that are regulated by C1P, including inflammation and various cellular processes associated with cell migration such as organogenesis or tumor metastasis.

  1. Phosphatidate phosphatase plays role in zinc-mediated regulation of phospholipid synthesis in yeast.

    PubMed

    Soto-Cardalda, Aníbal; Fakas, Stylianos; Pascual, Florencia; Choi, Hyeon-Son; Carman, George M

    2012-01-06

    In the yeast Saccharomyces cerevisiae, the synthesis of phospholipids is coordinately regulated by mechanisms that control the homeostasis of the essential mineral zinc (Carman, G.M., and Han, G. S. (2007) Regulation of phospholipid synthesis in Saccharomyces cerevisiae by zinc depletion. Biochim. Biophys. Acta 1771, 322-330; Eide, D. J. (2009) Homeostatic and adaptive responses to zinc deficiency in Saccharomyces cerevisiae. J. Biol. Chem. 284, 18565-18569). The synthesis of phosphatidylcholine is balanced by the repression of CDP-diacylglycerol pathway enzymes and the induction of Kennedy pathway enzymes. PAH1-encoded phosphatidate phosphatase catalyzes the penultimate step in triacylglycerol synthesis, and the diacylglycerol generated in the reaction may also be used for phosphatidylcholine synthesis via the Kennedy pathway. In this work, we showed that the expression of PAH1-encoded phosphatidate phosphatase was induced by zinc deficiency through a mechanism that involved interaction of the Zap1p zinc-responsive transcription factor with putative upstream activating sequence zinc-responsive elements in the PAH1 promoter. The pah1Δ mutation resulted in the derepression of the CHO1-encoded phosphatidylserine synthase (CDP-diacylglycerol pathway enzyme) and loss of the zinc-mediated regulation of the enzyme. Loss of phosphatidate phosphatase also resulted in the derepression of the CKI1-encoded choline kinase (Kennedy pathway enzyme) but decreased the synthesis of phosphatidylcholine when cells were deficient of zinc. This result confirmed the role phosphatidate phosphatase plays in phosphatidylcholine synthesis via the Kennedy pathway.

  2. Phosphatidate Phosphatase Plays Role in Zinc-mediated Regulation of Phospholipid Synthesis in Yeast*

    PubMed Central

    Soto-Cardalda, Aníbal; Fakas, Stylianos; Pascual, Florencia; Choi, Hyeon-Son; Carman, George M.

    2012-01-01

    In the yeast Saccharomyces cerevisiae, the synthesis of phospholipids is coordinately regulated by mechanisms that control the homeostasis of the essential mineral zinc (Carman, G.M., and Han, G. S. (2007) Regulation of phospholipid synthesis in Saccharomyces cerevisiae by zinc depletion. Biochim. Biophys. Acta 1771, 322–330; Eide, D. J. (2009) Homeostatic and adaptive responses to zinc deficiency in Saccharomyces cerevisiae. J. Biol. Chem. 284, 18565–18569). The synthesis of phosphatidylcholine is balanced by the repression of CDP-diacylglycerol pathway enzymes and the induction of Kennedy pathway enzymes. PAH1-encoded phosphatidate phosphatase catalyzes the penultimate step in triacylglycerol synthesis, and the diacylglycerol generated in the reaction may also be used for phosphatidylcholine synthesis via the Kennedy pathway. In this work, we showed that the expression of PAH1-encoded phosphatidate phosphatase was induced by zinc deficiency through a mechanism that involved interaction of the Zap1p zinc-responsive transcription factor with putative upstream activating sequence zinc-responsive elements in the PAH1 promoter. The pah1Δ mutation resulted in the derepression of the CHO1-encoded phosphatidylserine synthase (CDP-diacylglycerol pathway enzyme) and loss of the zinc-mediated regulation of the enzyme. Loss of phosphatidate phosphatase also resulted in the derepression of the CKI1-encoded choline kinase (Kennedy pathway enzyme) but decreased the synthesis of phosphatidylcholine when cells were deficient of zinc. This result confirmed the role phosphatidate phosphatase plays in phosphatidylcholine synthesis via the Kennedy pathway. PMID:22128164

  3. Phosphatidate Phosphatase Activity Plays Key Role in Protection against Fatty Acid-induced Toxicity in Yeast*

    PubMed Central

    Fakas, Stylianos; Qiu, Yixuan; Dixon, Joseph L.; Han, Gil-Soo; Ruggles, Kelly V.; Garbarino, Jeanne; Sturley, Stephen L.; Carman, George M.

    2011-01-01

    The PAH1-encoded phosphatidate (PA) phosphatase in Saccharomyces cerevisiae is a pivotal enzyme that produces diacylglycerol for the synthesis of triacylglycerol (TAG) and simultaneously controls the level of PA used for phospholipid synthesis. Quantitative lipid analysis showed that the pah1Δ mutation caused a reduction in TAG mass and an elevation in the mass of phospholipids and free fatty acids, changes that were more pronounced in the stationary phase. The levels of unsaturated fatty acids in the pah1Δ mutant were unaltered, although the ratio of palmitoleic acid to oleic acid was increased with a similar change in the fatty acid composition of phospholipids. The pah1Δ mutant exhibited classic hallmarks of apoptosis in stationary phase and a marked reduction in the quantity of cytoplasmic lipid droplets. Cells lacking PA phosphatase were sensitive to exogenous fatty acids in the order of toxicity palmitoleic acid > oleic acid > palmitic acid. In contrast, the growth of wild type cells was not inhibited by fatty acid supplementation. In addition, wild type cells supplemented with palmitoleic acid exhibited an induction in PA phosphatase activity and an increase in TAG synthesis. Deletion of the DGK1-encoded diacylglycerol kinase, which counteracts PA phosphatase in controlling PA content, suppressed the defect in lipid droplet formation in the pah1Δ mutant. However, the sensitivity of the pah1Δ mutant to palmitoleic acid was not rescued by the dgk1Δ mutation. Overall, these findings indicate a key role of PA phosphatase in TAG synthesis for protection against fatty acid-induced toxicity. PMID:21708942

  4. Depressed phosphatidic acid-induced contractile activity of failing cardiomyocytes.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Panagia, Vincenzo; Pierce, Grant N

    2003-01-10

    The effects of phosphatidic acid (PA), a known inotropic agent, on Ca(2+) transients and contractile activity of cardiomyocytes in congestive heart failure (CHF) due to myocardial infarction were examined. In control cells, PA induced a significant increase (25%) in active cell shortening and Ca(2+) transients. The phospholipase C (PLC) inhibitor, 2-nitro-4-carboxyphenyl N,N-diphenylcarbonate, blocked the positive inotropic action induced by PA, indicating that PA induces an increase in contractile activity and Ca(2+) transients through stimulation of PLC. Conversely, in failing cardiomyocytes there was a loss of PA-induced increase in active cell shortening and Ca(2+) transients. PA did not alter resting cell length. Both diastolic and systolic [Ca(2+)] were significantly elevated in the failing cardiomyocytes. In vitro assessment of the cardiac sarcolemmal (SL) PLC activity revealed that the impaired failing cardiomyocyte response to PA was associated with a diminished stimulation of SL PLC activity by PA. Our results identify an important defect in the PA-PLC signaling pathway in failing cardiomyocytes, which may have significant implications for the depressed contractile function during CHF.

  5. Coincident Phosphatidic Acid Interaction Restrains Drp1 in Mitochondrial Division.

    PubMed

    Adachi, Yoshihiro; Itoh, Kie; Yamada, Tatsuya; Cerveny, Kara L; Suzuki, Takamichi L; Macdonald, Patrick; Frohman, Michael A; Ramachandran, Rajesh; Iijima, Miho; Sesaki, Hiromi

    2016-09-15

    Mitochondria divide to control their size, distribution, turnover, and function. Dynamin-related protein 1 (Drp1) is a critical mechanochemical GTPase that drives constriction during mitochondrial division. It is generally believed that mitochondrial division is regulated during recruitment of Drp1 to mitochondria and its oligomerization into a division apparatus. Here, we report an unforeseen mechanism that regulates mitochondrial division by coincident interactions of Drp1 with the head group and acyl chains of phospholipids. Drp1 recognizes the head group of phosphatidic acid (PA) and two saturated acyl chains of another phospholipid by penetrating into the hydrophobic core of the membrane. The dual phospholipid interactions restrain Drp1 via inhibition of oligomerization-stimulated GTP hydrolysis that promotes membrane constriction. Moreover, a PA-producing phospholipase, MitoPLD, binds Drp1, creating a PA-rich microenvironment in the vicinity of a division apparatus. Thus, PA controls the activation of Drp1 after the formation of the division apparatus.

  6. Astrocyte-derived phosphatidic acid promotes dendritic branching.

    PubMed

    Zhu, Yan-Bing; Gao, Weizhen; Zhang, Yongbo; Jia, Feng; Zhang, Hai-Long; Liu, Ying-Zi; Sun, Xue-Fang; Yin, Yuhua; Yin, Dong-Min

    2016-02-17

    Astrocytes play critical roles in neural circuit formation and function. Recent studies have revealed several secreted and contact-mediated signals from astrocytes which are essential for neurite outgrowth and synapse formation. However, the mechanisms underlying the regulation of dendritic branching by astrocytes remain elusive. Phospholipase D1 (PLD1), which catalyzes the hydrolysis of phosphatidylcholine (PC) to generate phosphatidic acid (PA) and choline, has been implicated in the regulation of neurite outgrowth. Here we showed that knockdown of PLD1 selectively in astrocytes reduced dendritic branching of neurons in neuron-glia mixed culture. Further studies from sandwich-like cocultures and astrocyte conditioned medium suggested that astrocyte PLD1 regulated dendritic branching through secreted signals. We later demonstrated that PA was the key mediator for astrocyte PLD1 to regulate dendritic branching. Moreover, PA itself was sufficient to promote dendritic branching of neurons. Lastly, we showed that PA could activate protein kinase A (PKA) in neurons and promote dendritic branching through PKA signaling. Taken together, our results demonstrate that astrocyte PLD1 and its lipid product PA are essential regulators of dendritic branching in neurons. These results may provide new insight into mechanisms underlying how astrocytes regulate dendrite growth of neurons.

  7. Phosphatidic acid increases in response to noradrenaline and endothelin-1 in adult rabbit ventricular myocytes.

    PubMed

    Ye, H; Wolf, R A; Kurz, T; Corr, P B

    1994-12-01

    The aim was to assess whether noradrenaline and endothelin-1 can stimulate endogenous production of phosphatidic acid in adult ventricular myocytes. After stimulation of rabbit ventricular myocytes with noradrenaline and endothelin-1, total lipids were extracted using the Bligh and Dyer procedure and separated by thin layer chromatography, and phosphatidic acid was quantified using photodensitometric analysis of visualised lipids with CuSO4/H3PO4. Noradrenaline (10(-5) M) elicited a rapid increase in phosphatidic acid at 2 min, followed by a decrease at 5 min. A second delayed and sustained increase in phosphatidic acid occurred at 10 min. The response to noradrenaline (10(-9) to 10(-5) M) was concentration dependent with a half maximum response (EC50) of 3.1 x 10(-8) M and the maximum effect at 10(-6) M. The increase in phosphatidic acid production in response to noradrenaline was abolished by an alpha 1 adrenergic receptor blocking agent (2-[beta-(4-hydroxyphenyl)-ethylaminomethyl]tetralone) but unaffected by the beta adrenergic blocking agent L-propranolol. An increase in phosphatidic acid was also elicited in rabbit ventricular myocytes in response to endothelin-1. The response was time and concentration dependent with the maximal increase at 12 min, EC50 5.3 x 10(-9) M, and maximum effect at 10(-6) M. Both noradrenalin and endothelin-1 stimulated phosphatidylbutanol production in the presence of butanol (100 mM), indicating that both agonists activate phospholipase D. Noradrenaline at physiological concentrations elicits both a rapid and a delayed increase in phosphatidic acid in adult rabbit ventricular myocytes. Endothelial-1, at physiological concentrations, also stimulates an increase in the mass of phosphatidic acid in myocytes, but the increase induced by endothelin-1 is monophasic, in contrast to the biphasic response seen during stimulation with noradrenaline. Activation of phospholipase D contributes to the increase in phosphatidic acid seen during

  8. New roles for Smad signaling and phosphatidic acid in the regulation of skeletal muscle mass

    PubMed Central

    Goodman, Craig A.

    2014-01-01

    Skeletal muscle is essential for normal bodily function and the loss of skeletal muscle (i.e. muscle atrophy/wasting) can have a major impact on mobility, whole-body metabolism, disease resistance, and quality of life. Thus, there is a clear need for the development of therapies that can prevent the loss, or increase, of skeletal muscle mass. However, in order to develop such therapies, we will first have to develop a thorough understanding of the molecular mechanisms that regulate muscle mass. Fortunately, our knowledge is rapidly advancing, and in this review, we will summarize recent studies that have expanded our understanding of the roles that Smad signaling and the synthesis of phosphatidic acid play in the regulation of skeletal muscle mass. PMID:24765525

  9. New roles for Smad signaling and phosphatidic acid in the regulation of skeletal muscle mass.

    PubMed

    Goodman, Craig A; Hornberger, Troy A

    2014-01-01

    Skeletal muscle is essential for normal bodily function and the loss of skeletal muscle (i.e. muscle atrophy/wasting) can have a major impact on mobility, whole-body metabolism, disease resistance, and quality of life. Thus, there is a clear need for the development of therapies that can prevent the loss, or increase, of skeletal muscle mass. However, in order to develop such therapies, we will first have to develop a thorough understanding of the molecular mechanisms that regulate muscle mass. Fortunately, our knowledge is rapidly advancing, and in this review, we will summarize recent studies that have expanded our understanding of the roles that Smad signaling and the synthesis of phosphatidic acid play in the regulation of skeletal muscle mass.

  10. Phosphatidic acid and phosphatidylinositol labelling in adipose tissue. Relationship to the metabolic effects of insulin and insulin-like agents.

    PubMed Central

    Honeyman, T W; Strohsnitter, W; Scheid, C R; Schimmel, R J

    1983-01-01

    Exposure to phospholipase C increased the incorporation of [32P]Pi into phosphatidate, CMP-phosphatidate and phosphatidylinositol in rat adipose tissue and isolated adipocytes. A similar effect was observed in response to insulin and oxytocin. Theophylline, 3-isobutyl-1-methylxanthine and adenosine deaminase decreased [32P]Pi incorporation, and adenosine and N6-phenylisopropyladenosine reversed these effects. As with insulin, exposure of adipose tissue to phospholipase C stimulated oxidation of glucose, pyruvate and leucine and activated pyruvate dehydrogenase. Oxytocin and adenosine also mimicked the effects of insulin on leucine oxidation and pyruvate dehydrogenase. However, only insulin stimulated glycogen synthase activity, indicating that the regulation of synthase may be achieved by intracellular events distinct from those regulating changes in phospholipid metabolism, sugar transport and mitochondrial enzyme activities. It is postulated that exposure to phospholipase C forms diacylglycerol, which is phosphorylated to yield phosphatidate. The increased labelling of CMP-phosphatidate and phosphatidylinositol results from the conversion of phosphatidate into these lipids. The correlation between the effects of phospholipase C on phosphatidate synthesis and changes in adipose-tissue metabolism suggests the possibility that increased phosphatidate may directly or indirectly produce changes in membrane transport and enzyme activities. The pattern of phospholipid labelling produced by insulin, adenosine and oxytocin suggests that these stimuli may also increase phosphatidate synthesis, and, if so, changes in phospholipid metabolism could account for some of the metabolic actions of these stimuli. PMID:6411068

  11. Redundant Systems of Phosphatidic Acid Biosynthesis via Acylation of Glycerol-3-Phosphate or Dihydroxyacetone Phosphate in the Yeast Saccharomyces cerevisiae

    PubMed Central

    Athenstaedt, Karin; Weys, Sabine; Paltauf, Fritz; Daum, Günther

    1999-01-01

    In the yeast Saccharomyces cerevisiae lipid particles harbor two acyltransferases, Gat1p and Slc1p, which catalyze subsequent steps of acylation required for the formation of phosphatidic acid. Both enzymes are also components of the endoplasmic reticulum, but this compartment contains additional acyltransferase(s) involved in the biosynthesis of phosphatidic acid (K. Athenstaedt and G. Daum, J. Bacteriol. 179:7611–7616, 1997). Using the gat1 mutant strain TTA1, we show here that Gat1p present in both subcellular fractions accepts glycerol-3-phosphate and dihydroxyacetone phosphate as a substrate. Similarly, the additional acyltransferase(s) present in the endoplasmic reticulum can acylate both precursors. In contrast, yeast mitochondria harbor an enzyme(s) that significantly prefers dihydroxyacetone phosphate as a substrate for acylation, suggesting that at least one additional independent acyltransferase is present in this organelle. Surprisingly, enzymatic activity of 1-acyldihydroxyacetone phosphate reductase, which is required for the conversion of 1-acyldihydroxyacetone phosphate to 1-acylglycerol-3-phosphate (lysophosphatidic acid), is detectable only in lipid particles and the endoplasmic reticulum and not in mitochondria. In vivo labeling of wild-type cells with [2-3H, U-14C]glycerol revealed that both glycerol-3-phosphate and dihydroxyacetone phosphate can be incorporated as a backbone of glycerolipids. In the gat1 mutant and the 1-acylglycerol-3-phosphate acyltransferase slc1 mutant, the dihydroxyacetone phosphate pathway of phosphatidic acid biosynthesis is slightly preferred as compared to the wild type. Thus, mutations of the major acyltransferases Gat1p and Slc1p lead to an increased contribution of mitochondrial acyltransferase(s) to glycerolipid synthesis due to their substrate preference for dihydroxyacetone phosphate. PMID:10049376

  12. The selective activation of the cardiac sarcolemmal sodium-calcium exchanger by plasmalogenic phosphatidic acid produced by phospholipase D.

    PubMed

    Hale, C C; Ebeling, E G; Hsu, F F; Ford, D A

    1998-01-30

    Since plasmalogens are the predominant phospholipid of cardiac sarcolemma, the activation of the sodium-calcium exchanger by either plasmenylethanolamine or plasmalogenic phosphatidic acid generated by phospholipase D was explored. Sodium-calcium exchange activity was 7-fold greater in proteoliposomes comprised of plasmenylethanolamine compared to proteoliposomes comprised of only plasmenylcholine. Phospholipase D treatment of proteoliposomes resulted in 1 mol % conversion of plasmenylcholine or phosphatidylcholine to their respective phosphatidic acid molecular species with a concomitant 8-fold or 2-fold activation of sodium-calcium exchange activity, respectfully. Thus, phospholipase D-mediated hydrolysis of plasmalogens to phosphatidic acid may be an important mechanism for the regulation of the sodium-calcium exchanger.

  13. Phosphatidic Acid Binds to Cytosolic Glyceraldehyde-3-phosphate Dehydrogenase and Promotes Its Cleavage in Arabidopsis *

    PubMed Central

    Kim, Sang-Chul; Guo, Liang; Wang, Xuemin

    2013-01-01

    Phosphatidic acid (PA) is a class of lipid messengers involved in a variety of physiological processes. To understand how PA mediates cell functions in plants, we used a PA affinity membrane assay to isolate PA-binding proteins from Camelina sativa followed by mass spectrometric sequencing. A cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPC) was identified to bind to PA, and detailed analysis was carried out subsequently using GAPC1 and GAPC1 from Arabidopsis. The PA and GAPC binding was abolished by the cation zinc whereas oxidation of GAPCs promoted the PA binding. PA had little impact on the GAPC catalytic activity in vitro, but the PA treatment of Arabidopsis seedlings induced proteolytic cleavage of GAPC2 and inhibited Arabidopsis seedling growth. The extent of PA inhibition was greater in GAPC-overexpressing than wild-type seedlings, but the greater PA inhibition was abolished by application of zinc to the seedling. The PA treatment also reduced the expression of genes involved in PA synthesis and utilization, and the PA-reduced gene expression was partially recovered by zinc treatment. These data suggest that PA binds to oxidized GAPDH and promotes its cleavage and that the PA and GAPC interaction may provide a signaling link coordinating carbohydrate and lipid metabolism. PMID:23504314

  14. Activation of phosphatidic acid metabolism of human erythrocyte membranes by perfringolysin O

    SciTech Connect

    Saito, M.; Ando, S.; Mitsui, K.; Homma, Y.; Takenawa, T.

    1986-05-29

    The effect of perfringolysin O on the lipid metabolism of human erythrocyte membranes was investigated. Erythrocytes were prelabeled with (/sup 3/H)arachidonic acid and (/sup 32/P)inorganic phosphate. In the presence of calcium ion (5.5 mM), the effect of perfringolysin O on lipid metabolism was very similar to that of an calcium-ionophore A23187. In the absence of calcium ion, the accumulation of phosphatidic acid and its following decreasing trend were observed during the reaction with the toxin. Such changes were not caused by filipin. These results suggest that perfringolysin O causes the activation of a diglyceride-phosphatidic acid cycle, which might be involved in the calcium transport.

  15. Characterization of a Soluble Phosphatidic Acid Phosphatase in Bitter Melon (Momordica charantia)

    PubMed Central

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C.; Ullah, Abul H. J.

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and Pi. PAPs are typically categorized into two subfamilies: Mg2+-dependent soluble PAP and Mg2+-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg2+-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53–60°C and unaffected by up to 0.3 mM MgCl2. The Km and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na3VO4, Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg2+-independent enzyme in plants. PMID:25203006

  16. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia).

    PubMed

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C; Ullah, Abul H J

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and P(i). PAPs are typically categorized into two subfamilies: Mg(2+)-dependent soluble PAP and Mg(2+)-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg(2+)-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53-60 °C and unaffected by up to 0.3 mM MgCl2. The K(m) and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na(3)VO(4), Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg(2+)-independent enzyme in plants.

  17. Altered Lipid Synthesis by Lack of Yeast Pah1 Phosphatidate Phosphatase Reduces Chronological Life Span.

    PubMed

    Park, Yeonhee; Han, Gil-Soo; Mileykovskaya, Eugenia; Garrett, Teresa A; Carman, George M

    2015-10-16

    In Saccharomyces cerevisiae, Pah1 phosphatidate phosphatase, which catalyzes the dephosphorylation of phosphatidate to yield diacylglycerol, plays a crucial role in the synthesis of the storage lipid triacylglycerol. This evolutionarily conserved enzyme also plays a negative regulatory role in controlling de novo membrane phospholipid synthesis through its consumption of phosphatidate. We found that the pah1Δ mutant was defective in the utilization of non-fermentable carbon sources but not in oxidative phosphorylation; the mutant did not exhibit major changes in oxygen consumption rate, mitochondrial membrane potential, F1F0-ATP synthase activity, or gross mitochondrial morphology. The pah1Δ mutant contained an almost normal complement of major mitochondrial phospholipids with some alterations in molecular species. Although oxidative phosphorylation was not compromised in the pah1Δ mutant, the cellular levels of ATP in quiescent cells were reduced by 2-fold, inversely correlating with a 4-fold increase in membrane phospholipids. In addition, the quiescent pah1Δ mutant cells had 3-fold higher levels of mitochondrial superoxide and cellular lipid hydroperoxides, had reduced activities of superoxide dismutase 2 and catalase, and were hypersensitive to hydrogen peroxide. Consequently, the pah1Δ mutant had a shortened chronological life span. In addition, the loss of Tsa1 thioredoxin peroxidase caused a synthetic growth defect with the pah1Δ mutation. The shortened chronological life span of the pah1Δ mutant along with its growth defect on non-fermentable carbon sources and hypersensitivity to hydrogen peroxide was suppressed by the loss of Dgk1 diacylglycerol kinase, indicating that the underpinning of pah1Δ mutant defects was the excess synthesis of membrane phospholipids.

  18. Altered Lipid Synthesis by Lack of Yeast Pah1 Phosphatidate Phosphatase Reduces Chronological Life Span*

    PubMed Central

    Park, Yeonhee; Han, Gil-Soo; Mileykovskaya, Eugenia; Garrett, Teresa A.; Carman, George M.

    2015-01-01

    In Saccharomyces cerevisiae, Pah1 phosphatidate phosphatase, which catalyzes the dephosphorylation of phosphatidate to yield diacylglycerol, plays a crucial role in the synthesis of the storage lipid triacylglycerol. This evolutionarily conserved enzyme also plays a negative regulatory role in controlling de novo membrane phospholipid synthesis through its consumption of phosphatidate. We found that the pah1Δ mutant was defective in the utilization of non-fermentable carbon sources but not in oxidative phosphorylation; the mutant did not exhibit major changes in oxygen consumption rate, mitochondrial membrane potential, F1F0-ATP synthase activity, or gross mitochondrial morphology. The pah1Δ mutant contained an almost normal complement of major mitochondrial phospholipids with some alterations in molecular species. Although oxidative phosphorylation was not compromised in the pah1Δ mutant, the cellular levels of ATP in quiescent cells were reduced by 2-fold, inversely correlating with a 4-fold increase in membrane phospholipids. In addition, the quiescent pah1Δ mutant cells had 3-fold higher levels of mitochondrial superoxide and cellular lipid hydroperoxides, had reduced activities of superoxide dismutase 2 and catalase, and were hypersensitive to hydrogen peroxide. Consequently, the pah1Δ mutant had a shortened chronological life span. In addition, the loss of Tsa1 thioredoxin peroxidase caused a synthetic growth defect with the pah1Δ mutation. The shortened chronological life span of the pah1Δ mutant along with its growth defect on non-fermentable carbon sources and hypersensitivity to hydrogen peroxide was suppressed by the loss of Dgk1 diacylglycerol kinase, indicating that the underpinning of pah1Δ mutant defects was the excess synthesis of membrane phospholipids. PMID:26338708

  19. Phosphatidic acid phosphatase activity in subcellular fractions of normal and dystrophic human muscle.

    PubMed

    Kunze, D; Rüstow, B; Olthoff, D; Jung, K

    1985-03-15

    Biopsy samples from normal and dystrophic human muscle (Duchenne type) were fractionated by differential centrifugation and microsomes, mitochondria and cytosol were assayed for phosphatidic acid phosphatase (EC 3.1.3.4) and marker enzymes of mitochondria and cytosol. The activity of phosphatidic acid phosphatase was significantly lower in microsomes and higher in cytosol and mitochondria of dystrophic muscle than in the corresponding subcellular fractions of normal muscle. The results support an explanation of earlier findings that there is reduced G3P incorporation into diglycerides and phosphatidylcholine and a qualitative and quantitative change in the amount of phosphatidylcholine in dystrophic microsomes. The possible reasons for the reduction in the activity of only microsomal PA-P-ase were discussed.

  20. Darmstoff analogues. 3. Actions of choline esters of acetal phosphatidic acids on visceral smooth muscle.

    PubMed

    Marx, M H; Wiley, R A; Satchell, D G; Maguire, M H

    1989-06-01

    A number of naturally occurring phospholipids, e.g. the acetal phosphatidic acid derivatives that comprise Darmstoff (1) and the phosphatidylcholine derivative platelet activating factor (PAF), cause contraction of certain visceral smooth muscles and cause platelet activation. Because the Darmstoff phosphatidic acids and PAF are structurally similar, it was of interest to compare the biological actions of choline esters of Darmstoff with those of PAF and of the parent Darmstoff phosphatidic acids. To this end, [(2-pentadecyl-1,3-dioxolan-4-yl)methyl]phosphocholine (3a), [[2-(cis-8-heptadecenyl)-1,3-dioxolan-4-yl]methyl]phosphocho line (3b), and [[2-(cis-8-pentadecenyl)-1,3-dioxolan-4-yl]methyl]phosphocho line (3c) were synthesized. Compounds 3a, 3b, 3c, and PAF caused dose-dependent relaxation of taenia coli strips. In contrast, the unesterified materials 1a and 1b, as well as lyso-PAF, caused contraction in taenia coli strips. Thus, the contractile effect of Darmstoff is reversed on esterification with choline. In preparations of whole trachea, both 1a and 3a had contractile effects similar to those of PAF.

  1. The effects of barbiturates on the metabolism of phosphatidic acid and phosphatidylinositol in rat brain synaptosomes.

    PubMed Central

    Miller, J C; Leung, I

    1979-01-01

    Barbiturates and diphenylhydantoin inhibit the carbamoylcholine-stimulated increase in 32P incorporation into phosphatidylinositol and phosphatidic acid, but have a relatively slight effect on the incorporation of 32P into these lipids in the absence of carbamoylcholine and no effect on 32P incorporation into phosphatidylcholine and phosphatidylethanolamine. Inhibition of the carbamoylcholine-stimulated increase was observed for pentobarbital, thiopental, phenobarbital, 5-(1,3-dimethylbutyl)-5-ethylbarbiturate, (+)- and (-)-5-ethyl-N-methyl-5-propylbarbituate and diphenylhydantoin. Similar concentrations of barbiturates and diphenylhydantoin were previously reported to inhibit the K+-stimulated Ca2+ influx, and therefore other agents that affect Ca2+ influx were tested to find whether they had any effect on 32P incorporation into these lipids. K+ (35 mM) increases 32P incorporation into phosphatidic acid, but to a smaller degree than 100 micrometer-carbamoylcholine, and its effect was inhibited by pentobarbital. Veratridine (75 micrometer) does not increase 32P incorporation into either phosphatidic acid or phosphatidylinositol, but did inhibit the carbamoylcholine-stimulated increase in 32P incorporation into phosphatidylinositol. The possible relationship between the phospholipid effect and stimulated Ca2+ influx is discussed. PMID:435289

  2. Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer

    PubMed Central

    Bruntz, Ronald C.; Lindsley, Craig W.

    2014-01-01

    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928

  3. Phospholipase D signaling pathways and phosphatidic acid as therapeutic targets in cancer.

    PubMed

    Bruntz, Ronald C; Lindsley, Craig W; Brown, H Alex

    2014-10-01

    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein-coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions.

  4. Cooperation of MICAL-L1, syndapin2, and phosphatidic acid in tubular recycling endosome biogenesis

    PubMed Central

    Giridharan, Sai Srinivas Panapakkam; Cai, Bishuang; Vitale, Nicolas; Naslavsky, Naava; Caplan, Steve

    2013-01-01

    Endocytic transport necessitates the generation of membrane tubules and their subsequent fission to transport vesicles for sorting of cargo molecules. The endocytic recycling compartment, an array of tubular and vesicular membranes decorated by the Eps15 homology domain protein, EHD1, is responsible for receptor and lipid recycling to the plasma membrane. It has been proposed that EHD dimers bind and bend membranes, thus generating recycling endosome (RE) tubules. However, recent studies show that molecules interacting with CasL-Like1 (MICAL-L1), a second, recently identified RE tubule marker, recruits EHD1 to preexisting tubules. The mechanisms and events supporting the generation of tubular recycling endosomes were unclear. Here, we propose a mechanism for the biogenesis of RE tubules. We demonstrate that MICAL-L1 and the BAR-domain protein syndapin2 bind to phosphatidic acid, which we identify as a novel lipid component of RE. Our studies demonstrate that direct interactions between these two proteins stabilize their association with membranes, allowing for nucleation of tubules by syndapin2. Indeed, the presence of phosphatidic acid in liposomes enhances the ability of syndapin2 to tubulate membranes in vitro. Overall our results highlight a new role for phosphatidic acid in endocytic recycling and provide new insights into the mechanisms by which tubular REs are generated. PMID:23596323

  5. The mechanistic and ergogenic effects of phosphatidic acid in skeletal muscle.

    PubMed

    Shad, Brandon James; Smeuninx, Benoit; Atherton, Philip James; Breen, Leigh

    2015-12-01

    Skeletal muscle mass plays a vital role in locomotion, whole-body metabolic health, and is a positive predictor of longevity. It is well established the mammalian target of rapamycin (mTOR) is a central regulator of skeletal muscle protein turnover. The pursuit to find novel nutrient compounds or functional food sources that possess the ability to activate mTOR and promote skeletal muscle protein accretion has been on going. Over the last decade, a key role has been proposed for the phospholipid phosphatidic acid (PA) in mTOR activation. Mechanical load-induced (i.e., resistance exercise) intramuscular PA can directly bind to and activate mTOR. In addition, PA provided exogenously in cell culture heightens mTOR activity, albeit indirectly. Thus, endogenously generated PA and exogenous provision of PA appear to act through distinct mechanisms that converge on mTOR and, potentially, may amplify muscle protein synthesis. In support of this notion, limited evidence from humans suggests that resistance exercise training combined with oral supplemental PA enhances strength gains and muscle hypertrophy. However, the precise mechanisms underpinning the augmented muscle remodelling response with supplemental PA remain elusive. In this review, we will critically examine available evidence from cell cultures and animal and human experimental models to provide an overview of the mechanisms through which endogenous and exogenous PA may act to promote muscle anabolism, and discuss the potential for PA as a therapeutic tool to maintain or restore skeletal muscle mass in the context of ageing and disease.

  6. Correlation of phospholipid structure with functional effects on the nicotinic acetylcholine receptor. A modulatory role for phosphatidic acid.

    PubMed Central

    Bhushan, A; McNamee, M G

    1993-01-01

    Fourier transform infrared spectroscopy is used to characterize specific interactions between negatively charged lipids, such as phosphatidic acid, and the purified nicotinic acetylcholine receptor from Torpedo californica. The specific interaction of phosphatidic acid with acetylcholine receptor is demonstrated by the receptor-induced perturbation of the lipid ionization state, which is monitored using Fourier transform infrared bands arising from the phosphate head group. The acetylcholine receptor shifts the pKa of phosphatidic acid molecules adjacent to the receptor to a lower value by almost 2 pH units from 8.5 to 6.6. Decreased pH also leads to changes in ion channel function and to changes in the secondary structure of the acetylcholine receptor in membranes containing ionizable phospholipids. Phospholipase D restores functional activity of acetylcholine receptor reconstituted in an unfavorable environment containing phosphatidylcholine by generating phosphatidic acid. Lipids such as phosphatidic acid may serve as allosteric effectors for membrane protein function and the lipid-protein interface could be a site for activity-dependent changes that lead to modulation of synaptic efficacy. PMID:8471723

  7. Saturated phosphatidic acids mediate saturated fatty acid-induced vascular calcification and lipotoxicity.

    PubMed

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M; Kuro-O, Makoto; Miyazaki, Makoto

    2015-10-26

    Recent evidence indicates that saturated fatty acid-induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification.

  8. Suppression of DS1 phosphatidic acid phosphatase confirms resistance to Ralstonia solanacearum in Nicotiana benthamiana.

    PubMed

    Nakano, Masahito; Nishihara, Masahiro; Yoshioka, Hirofumi; Takahashi, Hirotaka; Sawasaki, Tatsuya; Ohnishi, Kouhei; Hikichi, Yasufumi; Kiba, Akinori

    2013-01-01

    Nicotianabenthamiana is susceptible to Ralstonia solanacearum. To analyze molecular mechanisms for disease susceptibility, we screened a gene-silenced plant showing resistance to R. solanacearum, designated as DS1 (Disease suppression 1). The deduced amino acid sequence of DS1 cDNA encoded a phosphatidic acid phosphatase (PAP) 2. DS1 expression was induced by infection with a virulent strain of R. solanacearum in an hrp-gene-dependent manner. DS1 rescued growth defects of the temperature-sensitive ∆lpp1∆dpp1∆pah1 mutant yeast. Recombinant DS1 protein showed Mg(2+)-independent PAP activity. DS1 plants showed reduced PAP activity and increased phosphatidic acid (PA) content. After inoculation with R. solanacearum, DS1 plants showed accelerated cell death, over-accumulation of reactive oxygen species (ROS), and hyper-induction of PR-4 expression. In contrast, DS1-overexpressing tobacco plants showed reduced PA content, greater susceptibility to R. solanacearum, and reduced ROS production and PR-4 expression. The DS1 phenotype was partially compromised in the plants in which both DS1 and NbCoi1 or DS1 and NbrbohB were silenced. These results show that DS1 PAP may affect plant immune responses related to ROS and JA cascades via regulation of PA levels. Suppression of DS1 function or DS1 expression could rapidly activate plant defenses to achieve effective resistance against Ralstonia solanacearum.

  9. Suppression of DS1 Phosphatidic Acid Phosphatase Confirms Resistance to Ralstonia solanacearum in Nicotiana benthamiana

    PubMed Central

    Nakano, Masahito; Nishihara, Masahiro; Yoshioka, Hirofumi; Takahashi, Hirotaka; Sawasaki, Tatsuya; Ohnishi, Kouhei; Hikichi, Yasufumi; Kiba, Akinori

    2013-01-01

    Nicotianabenthamiana is susceptible to Ralstonia solanacearum. To analyze molecular mechanisms for disease susceptibility, we screened a gene-silenced plant showing resistance to R. solanacearum, designated as DS1 (Disease suppression 1). The deduced amino acid sequence of DS1 cDNA encoded a phosphatidic acid phosphatase (PAP) 2. DS1 expression was induced by infection with a virulent strain of R. solanacearum in an hrp-gene-dependent manner. DS1 rescued growth defects of the temperature-sensitive ∆lpp1∆dpp1∆pah1 mutant yeast. Recombinant DS1 protein showed Mg2+-independent PAP activity. DS1 plants showed reduced PAP activity and increased phosphatidic acid (PA) content. After inoculation with R. solanacearum, DS1 plants showed accelerated cell death, over-accumulation of reactive oxygen species (ROS), and hyper-induction of PR-4 expression. In contrast, DS1-overexpressing tobacco plants showed reduced PA content, greater susceptibility to R. solanacearum, and reduced ROS production and PR-4 expression. The DS1 phenotype was partially compromised in the plants in which both DS1 and NbCoi1 or DS1 and NbrbohB were silenced. These results show that DS1 PAP may affect plant immune responses related to ROS and JA cascades via regulation of PA levels. Suppression of DS1 function or DS1 expression could rapidly activate plant defenses to achieve effective resistance against Ralstonia solanacearum. PMID:24073238

  10. Orally administered phosphatidic acids and lysophosphatidic acids ameliorate aspirin-induced stomach mucosal injury in mice.

    PubMed

    Tanaka, Tamotsu; Morito, Katsuya; Kinoshita, Masafumi; Ohmoto, Mayumi; Urikura, Mai; Satouchi, Kiyoshi; Tokumura, Akira

    2013-04-01

    Recent investigations revealed that lysophosphatidic acid (LPA), a phospholipid with a growth factor-like activity, plays an important role in the integrity of the gastrointestinal tract epithelium. This paper attempts to clarify the effect of orally administered phosphatidic acid (PA) and LPA on aspirin-induced gastric lesions in mice. Phospholipids, a free fatty acid, a diacylglycerol and a triglyceride at 1 mM (5.7 μmol/kg body weight) or 0.1 mM were orally administered to mice 0.5 h before oral administration of aspirin (1.7 mmol/kg). The total length of lesions formed on the stomach wall was measured as a lesion index. Formation of LPA from PA in the mouse stomach was examined by in vitro (in stomach lavage fluid), ex vivo (in an isolated stomach) and in vivo (in the stomach of a living mouse) examinations of phospholipase activity. Palmitic acid, dioleoyl-glycerol, olive oil and lysophosphatidylcholine did not affect the aspirin-induced lesions. In contrast, phosphatidylcholine (1 mM), LPA (1 mM) and PA (0.1, 1 mM) significantly reduced the lesion index. Evidence for formation of LPA from PA in the stomach by gastric phospholipase A2 was obtained by in vitro, ex vivo and in vivo experiments. An LPA-specific receptor, LPA2, was found to be localized on the gastric surface-lining cells of mice. Pretreatment with PA-rich diets may prevent nonsteroidal anti-inflammatory drug-induced stomach ulcers.

  11. Transfer of phosphatidic acid from liposomes to cells is collision dependent

    SciTech Connect

    Longmuir, K.J.; Malinick, L.A.

    1989-03-01

    The kinetics of lipid transfer from unilamellar liposomes to cells in monolayer culture were determined for a fluorescent phosphatidic acid, 1-palmitoyl-2-(6-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)aminocaproyl) -sn-glycerol 3-phosphate (C6-NBD-PA), and for the analogous phosphatidic acid without the fluorescent NBD group, 1-palmitoyl-2-caproyl-sn-(U-14C) glycerol 3-phosphate (C6-(14C)PA). Initial rates of liposome-to-cell transfer were measured at 2 degrees C under conditions in which the concentration of diffusible monomer in the aqueous medium was constant during the course of an experiment and was independent of total liposome concentration. Rates were similar for C6-NBD-PA and C6-(14C)PA, indicating that the NBD group does not significantly alter the transfer kinetics. It was found that liposome-to-cell transfer was dependent on 1) the mole fraction of diffusible lipid in the liposomes, 2) the liposome concentration, and 3) the cell density. The dependence of rate on the liposome concentration (observed under conditions in which aqueous monomer concentration remained constant) cannot be explained by a liposome-to-cell transfer mechanism involving the free diffusion of monomers through the aqueous medium. Instead, the data are consistent with a collision-dependent mechanism of monomer transfer that occurs when liposome and cell membranes come into contact but do not fuse.

  12. Yeast PAH1-encoded phosphatidate phosphatase controls the expression of CHO1-encoded phosphatidylserine synthase for membrane phospholipid synthesis.

    PubMed

    Han, Gil-Soo; Carman, George M

    2017-08-11

    The PAH1-encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae, exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1-encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1Δ mutant is induced through the inositol-sensitive upstream activation sequence (UASINO), a cis-acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UASINO mutation suppressed pah1Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1-encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Phosphatidic acid signaling mediates lung cytokine expression and lung inflammatory injury after hemorrhage in mice.

    PubMed

    Abraham, E; Bursten, S; Shenkar, R; Allbee, J; Tuder, R; Woodson, P; Guidot, D M; Rice, G; Singer, J W; Repine, J E

    1995-02-01

    Because phosphatidic acid (PA) pathway signaling may mediate many basic reactions involving cytokine-dependent responses, we investigated the effects of CT1501R, a functional inhibitor of the enzyme lysophosphatidic acid acyltransferase (LPAAT) which converts lysophosphatidic acid (Lyso-PA) to PA. We found that CT1501R treatment not only prevented hypoxia-induced PA increases and lyso-PA consumption in human neutrophils, but also prevented neutrophil chemotaxis and adherence in vitro, and lung injury and lung neutrophil accumulation in mice subjected to hemorrhage and resuscitation. In addition, CT1501R treatment prevented increases in mRNA levels and protein production of a variety of proinflammatory cytokines in multiple lung cell populations after blood loss and resuscitation. Our results indicate the fundamental role of PA metabolism in the development of acute inflammatory lung injury after blood loss.

  14. Molecular cloning of magnesium-independent type 2 phosphatidic acid phosphatases from airway smooth muscle.

    PubMed

    Tate, R J; Tolan, D; Pyne, S

    1999-07-01

    Members of the type 2 phosphatidic acid phosphatase (PAP2) family catalyse the dephosphorylation of phosphatidic acid (PA), lysophosphatidate and sphingosine 1-phosphate. Here, we demonstrate the presence of a Mg(2+)-independent and N-ethymaleimide-insensitive PAP2 activity in cultured guinea-pig airway smooth muscle (ASM) cells. Two PAP2 cDNAs of 923 and 926 base pairs were identified and subsequently cloned from these cells. The ORF of the 923 base pair cDNA encoded a protein of 285 amino acids (Mr = 32.1 kDa), which had 94% homology with human PAP2a (hPAP2a) and which probably represents a guinea-pig specific PAP2a (gpPAP2a1). The ORF of the 926 base pair cDNA encoded a protein of 286 amino acids (Mr = 32.1 kDa) which had 84% and 91% homology with hPAP2a and gpPAP2a1, respectively. This protein, termed gpPAP2a2, has two regions (aa 21-33 and 51-74) of marked divergence and altered hydrophobicity compared with hPAP2a and gpPAP2a1. This occurs in the predicted first and second transmembrane domains and at the extremes of the first outer loop. Other significant differences between gpPAP2a1/2 and hPAP2a, hPAP2b and hPAP2c occur at the cytoplasmic C-terminal. Transient expression of gpPAP2a2 in Cos-7 cells resulted in an approx. 4-fold increase in Mg(2+)-independent PAP activity, thereby confirming that gpPAP2a2 is another catalytically active member of an extended PAP2 family.

  15. Phosphatidic acid formation is required for extracellular ATP-mediated nitric oxide production in suspension-cultured tomato cells.

    PubMed

    Sueldo, Daniela J; Foresi, Noelia P; Casalongué, Claudia A; Lamattina, Lorenzo; Laxalt, Ana M

    2010-03-01

    *In animals and plants, extracellular ATP exerts its effects by regulating the second messengers Ca(2+), nitric oxide (NO) and reactive oxygen species (ROS). In animals, phospholipid-derived molecules, such as diacylglycerol, phosphatidic acid (PA) and inositol phosphates, have been associated with the extracellular ATP signaling pathway. The involvement of phospholipids in extracellular ATP signaling in plants, as it is established in animals, is unknown. *In vivo phospholipid signaling upon extracellular ATP treatment was studied in (32)P(i)-labeled suspension-cultured tomato (Solanum lycopersicum) cells. *Here, we report that, in suspension-cultured tomato cells, extracellular ATP induces the formation of the signaling lipid phosphatidic acid. Exogenous ATP at doses of 0.1 and 1 mM induce the formation of phosphatidic acid within minutes. Studies on the enzymatic sources of phosphatidic acid revealed the participation of both phospholipase D and C in concerted action with diacylglycerol kinase. *Our results suggest that extracellular ATP-mediated nitric oxide production is downstream of phospholipase C/diacylglycerol kinase activation.

  16. Rhabdomyolysis-Associated Mutations in Human LPIN1 Lead to Loss of Phosphatidic Acid Phosphohydrolase Activity.

    PubMed

    Schweitzer, George G; Collier, Sara L; Chen, Zhouji; Eaton, James M; Connolly, Anne M; Bucelli, Robert C; Pestronk, Alan; Harris, Thurl E; Finck, Brian N

    2015-01-01

    Rhabdomyolysis is an acute syndrome due to extensive injury of skeletal muscle. Recurrent rhabdomyolysis is often caused by inborn errors in intermediary metabolism, and recent work has suggested that mutations in the human gene encoding lipin 1 (LPIN1) may be a common cause of recurrent rhabdomyolysis in children. Lipin 1 dephosphorylates phosphatidic acid to form diacylglycerol (phosphatidic acid phosphohydrolase; PAP) and acts as a transcriptional regulatory protein to control metabolic gene expression. Herein, a 3-year-old boy with severe recurrent rhabdomyolysis was determined to be a compound heterozygote for a novel c.1904T>C (p.Leu635Pro) substitution and a previously reported genomic deletion of exons 18-19 (E766-S838_del) in LPIN1. Western blotting with patient muscle biopsy lysates demonstrated a marked reduction in lipin 1 protein, while immunohistochemical staining for lipin 1 showed abnormal subcellular localization. We cloned cDNAs to express recombinant lipin 1 proteins harboring pathogenic mutations and showed that the E766-S838_del allele was not expressed at the RNA or protein level. Lipin 1 p.Leu635Pro was expressed, but the protein was less stable, was aggregated in the cytosol, and was targeted for proteosomal degradation. Another pathogenic single amino acid substitution, lipin 1 p.Arg725His, was well expressed and retained its transcriptional regulatory function. However, both p.Leu635Pro and p.Arg725His proteins were found to be deficient in PAP activity. Kinetic analyses demonstrated a loss of catalysis rather than diminished substrate binding. These data suggest that loss of lipin 1-mediated PAP activity may be involved in the pathogenesis of rhabdomyolysis in lipin 1 deficiency.

  17. Concentrated Phosphatidic Acid in Cereal Brans as Potential Protective Agents against Indomethacin-Induced Stomach Ulcer.

    PubMed

    Afroz, Sheuli; Ikoma, Teru; Yagi, Ayano; Kogure, Kentaro; Tokumura, Akira; Tanaka, Tamotsu

    2016-09-21

    One of complications associated with long-term use of nonsteroidal anti-inflammatory drugs (NSAIDs) is peptic ulcer. Recently, we found that orally administered phosphatidic acid (PA) ameliorated aspirin-induced stomach lesions in mice. In this study, we identified PA-rich food sources and examined the effects of the food materials on indomethacin-induced stomach ulcer. Among examined, buckwheat (Fagopyrum esculentum) bran contained the highest level of PA (188 mg/100 g). PA was the richest phospholipid (25%) in the lipid fraction of the buckwheat bran. Administration of the lipid extracts of buckwheat bran significantly ameliorated indomethacin-induced stomach lesions in mice. In contrast, wheat (Triticum durum) bran lipids (PA, 4%) and soybean (Glycine max) lipids (PA, 3%) were not associated with ameliorative effects. These results indicated that PA-rich lipids can be used as an effective supplement for prevention of NSAID-induced stomach ulcer.

  18. Phosphatidic acid osmotically destabilizes lysosomes through increased permeability to K+ and H+.

    PubMed

    Yi, Y-P; Wang, X; Zhang, G; Fu, T-S; Zhang, G-J

    2006-06-01

    Lysosomal destabilization is a critical event not only for the organelle but also for living cells. However, what factors can affect lysosomal stability is not fully studied. In this work, the effects of phosphatidic acid (PA) on the lysosomal integrity were investigated. Through the measurements of lysosomal beta-hexosaminidase free activity, intralysosomal pH, leakage of lysosomal protons and lysosomal latency loss in hypotonic sucrose medium, we established that PA could increase the lysosomal permeability to K+ and H+, and enhance the lysosomal osmotic sensitivity. Treatment of lysosomes with PA promoted entry of K+ into the organelle via K+/H+ exchange, which could produce osmotic stresses and osmotically destabilize the lysosomes. In addition, PA-induced increase in the lysosomal osmotic sensitivity caused the lysosomes to become more liable to destabilization in osmotic shocks. The results suggest that PA may play a role in the lysosomal destabilization.

  19. Tips on the analysis of phosphatidic acid by the fluorometric coupled enzyme assay.

    PubMed

    Hassaninasab, Azam; Han, Gil-Soo; Carman, George M

    2017-06-01

    The fluorometric coupled enzyme assay to measure phosphatidic acid (PA) involves the solubilization of extracted lipids in Triton X-100, deacylation, and the oxidation of PA-derived glycerol-3-phosphate to produce hydrogen peroxide for conversion of Amplex Red to resorufin. The enzyme assay is sensitive, but plagued by high background fluorescence from the peroxide-containing detergent and incomplete heat inactivation of lipoprotein lipase. These problems affecting the assay reproducibility were obviated by the use of highly pure Triton X-100 and by sufficient heat inactivation of the lipase enzyme. The enzyme assay could accurately measure the PA content from the subcellular fractions of yeast cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Phosphatidic acid is a major phospholipid class in reproductive organs of Arabidopsis thaliana

    PubMed Central

    Yunus, Ian Sofian; Cazenave-Gassiot, Amaury; Liu, Yu-chi; Lin, Ying-Chen; Wenk, Markus R; Nakamura, Yuki

    2015-01-01

    Phospholipids are the crucial components of biological membranes and signal transduction. Among different tissues, flower phospholipids are one of the least characterized features of plant lipidome. Here, we report that floral reproductive organs of Arabidopsis thaliana contain high levels of phosphatidic acid (PA), a known lipid second messenger. By using floral homeotic mutants enriched with specific floral organs, lipidomics study showed increased levels of PA species in ap3-3 mutant with enriched pistils. Accompanied gene expression study for 7 diacylglycerol kinases and 11 PA phosphatases revealed distinct floral organ specificity, suggesting an active phosphorylation/dephosphorylation between PA and diacylglycerol in flowers. Our results suggest that PA is a major phospholipid class in floral reproductive organs of A. thaliana. PMID:26179579

  1. Phosphatidic acid is a major phospholipid class in reproductive organs of Arabidopsis thaliana.

    PubMed

    Yunus, Ian Sofian; Cazenave-Gassiot, Amaury; Liu, Yu-Chi; Lin, Ying-Chen; Wenk, Markus R; Nakamura, Yuki

    2015-01-01

    Phospholipids are the crucial components of biological membranes and signal transduction. Among different tissues, flower phospholipids are one of the least characterized features of plant lipidome. Here, we report that floral reproductive organs of Arabidopsis thaliana contain high levels of phosphatidic acid (PA), a known lipid second messenger. By using floral homeotic mutants enriched with specific floral organs, lipidomics study showed increased levels of PA species in ap3-3 mutant with enriched pistils. Accompanied gene expression study for 7 diacylglycerol kinases and 11 PA phosphatases revealed distinct floral organ specificity, suggesting an active phosphorylation/dephosphorylation between PA and diacylglycerol in flowers. Our results suggest that PA is a major phospholipid class in floral reproductive organs of A. thaliana.

  2. Redundant roles of the phosphatidate phosphatase family in triacylglycerol synthesis in human adipocytes.

    PubMed

    Temprano, Ana; Sembongi, Hiroshi; Han, Gil-Soo; Sebastián, David; Capellades, Jordi; Moreno, Cristóbal; Guardiola, Juan; Wabitsch, Martin; Richart, Cristóbal; Yanes, Oscar; Zorzano, Antonio; Carman, George M; Siniossoglou, Symeon; Miranda, Merce

    2016-09-01

    In mammals, the evolutionary conserved family of Mg(2+)-dependent phosphatidate phosphatases (PAP1), involved in phospholipid and triacylglycerol synthesis, consists of lipin-1, lipin-2 and lipin-3. While mutations in the murine Lpin1 gene cause lipodystrophy and its knockdown in mouse 3T3-L1 cells impairs adipogenesis, deleterious mutations of human LPIN1 do not affect adipose tissue distribution. However, reduced LPIN1 and PAP1 activity has been described in participants with type 2 diabetes. We aimed to characterise the roles of all lipin family members in human adipose tissue and adipogenesis. The expression of the lipin family was analysed in adipose tissue in a cross-sectional study. Moreover, the effects of lipin small interfering RNA (siRNA)-mediated depletion on in vitro human adipogenesis were assessed. Adipose tissue gene expression of the lipin family is altered in type 2 diabetes. Depletion of every lipin family member in a human Simpson-Golabi-Behmel syndrome (SGBS) pre-adipocyte cell line, alters expression levels of adipogenic transcription factors and lipid biosynthesis genes in early stages of differentiation. Lipin-1 knockdown alone causes a 95% depletion of PAP1 activity. Despite the reduced PAP1 activity and alterations in early adipogenesis, lipin-silenced cells differentiate and accumulate neutral lipids. Even combinatorial knockdown of lipins shows mild effects on triacylglycerol accumulation in mature adipocytes. Overall, our data support the hypothesis of alternative pathways for triacylglycerol synthesis in human adipocytes under conditions of repressed lipin expression. We propose that induction of alternative lipid phosphate phosphatases, along with the inhibition of lipid hydrolysis, contributes to the maintenance of triacylglycerol content to near normal levels.

  3. Question 7: Biosynthesis of Phosphatidic Acid in Liposome Compartments Toward the Self-Reproduction of Minimal Cells

    NASA Astrophysics Data System (ADS)

    Kuruma, Yutetsu

    2007-10-01

    Self-reproduction is one of main properties that define living cells. In order to explore the self-reproduction process for the study of early cells, and to develop a research line somehow connected to the origin of life, we have built up a constructive ‘synthetic cells (minimal cells)’ approach. The minimal cells approach consists in the investigation of the minimal number of elements to accomplish simple cell-like processes like self-reproduction. Such approach belongs to the field of synthetic biology. The minimal cells are reconstructed from a totally reconstituted cell-free protein synthesis system (PURESYSTEM) and liposome compartments as containers. Based on this approach, we synthesized two membrane proteins (enzymes), GPAT and LPAAT, which are involved in the phosphatidic acid biosynthesis in bacteria. Both membrane proteins were successfully synthesized by PURESYSTEM encapsulated inside POPC liposomes. Additionally, the enzymatic activity of GPAT was restored by mixing the expressed enzyme with lipid and by forming liposomes in situ. Through these experimental evidences, here we present a possible model to achieve self-reproduction in minimal cells. Our results would contribute to the idea that early cells could have been built by an extremely small number of genes.

  4. Dual Regulation of RA-RhoGAP Activity by Phosphatidic Acid and Rap1 during Neurite Outgrowth*

    PubMed Central

    Kurooka, Takao; Yamamoto, Yasunori; Takai, Yoshimi; Sakisaka, Toshiaki

    2011-01-01

    During neurite outgrowth, Rho small G protein activity is spatiotemporally regulated to organize the neurite sprouting, extension, and branching. We have previously identified a potent Rho GTPase-activating protein (GAP), RA-RhoGAP, as a direct downstream target of Rap1 small G protein in the neurite outgrowth. In addition to the Ras-associating (RA) domain for Rap1 binding, RA-RhoGAP has the pleckstrin homology (PH) domain for lipid binding. Here, we showed that phosphatidic acid (PA) bound to the PH domain and enhanced GAP activity for Rho. RA-RhoGAP induced extension of neurite in a diacylglycerol kinase-mediated synthesis of the PA-dependent manner. Knockdown of RA-RhoGAP reduced the diacylglycerol kinase-induced neurite extension. In contrast to the effect of the RA domain, the PH domain was specifically involved in the neurite extension, not in the sprouting and branching. These results indicate that PA and Rap1 cooperatively regulate RA-RhoGAP activity for promoting neurite outgrowth. PMID:21169361

  5. Insulin controls subcellular localization and multisite phosphorylation of the phosphatidic acid phosphatase, lipin 1.

    PubMed

    Harris, Thurl E; Huffman, Todd A; Chi, An; Shabanowitz, Jeffrey; Hunt, Donald F; Kumar, Anil; Lawrence, John C

    2007-01-05

    Brain, liver, kidney, heart, and skeletal muscle from fatty liver dystrophy (fld/fld) mice, which do not express lipin 1 (lipin), contained much less Mg(2+)-dependent phosphatidic acid phosphatase (PAP) activity than tissues from wild type mice. Lipin harboring the fld(2j) (Gly(84) --> Arg) mutation exhibited relatively little PAP activity. These results indicate that lipin is a major PAP in vivo and that the loss of PAP activity contributes to the fld phenotype. PAP activity was readily detected in immune complexes of lipin from 3T3-L1 adipocytes, where the protein was found both as a microsomal form and a soluble, more highly phosphorylated, form. Fifteen phosphorylation sites were identified by mass spectrometric analyses. Insulin increased the phosphorylation of multiple sites and promoted a gel shift that was due in part to phosphorylation of Ser(106). In contrast, epinephrine and oleic acid promoted dephosphorylation of lipin. The PAP-specific activity of lipin was not affected by the hormones or by dephosphorylation of lipin with protein phosphatase 1. However, the ratio of soluble to microsomal lipin was markedly increased in response to insulin and decreased in response to epinephrine and oleic acid. The results suggest that insulin and epinephrine control lipin primarily by changing localization rather than intrinsic PAP activity.

  6. Phosphatidic acid phosphatase and diacylglycerol acyltransferase: potential targets for metabolic engineering of microorganism oil.

    PubMed

    Jin, Hong-Hao; Jiang, Jian-Guo

    2015-04-01

    Oleaginous microorganism is becoming one of the most promising oil feedstocks for biodiesel production due to its great advantages in triglyceride (TAG) accumulation. Previous studies have shown that de novo TAG biosynthesis can be divided into two parts: the fatty acid biosynthesis pathway (the upstream part which generates acyl-CoAs) and the glycerol-3-phosphate acylation pathway (the downstream part in which three acyl groups are sequentially added onto a glycerol backbone). This review mainly focuses on two enzymes in the G3P pathway, phosphatidic acid phosphatase (PAP) and diacylglycerol acyltransferase (DGAT). The former catalyzes a dephosphorylation reaction, and the latter catalyzes a subsequent acylation reaction. Genes, functional motifs, transmembrane domains, action mechanism, and new studies of the two enzymes are discussed in detail. Furthermore, this review also covers diacylglycerol kinase, an enzyme that catalyzes the reverse reaction of diacylglycerol formation. In addition, PAP and DGAT are the conjunction points of the G3P pathway, the Kennedy pathway, and the CDP-diacylglycerol pathway (CDP-DAG pathway), and the mutual transformation between TAGs and phospholipids is discussed as well. Given that both the Kennedy and CDP-diacylglycerol pathways are in metabolic interlock (MI) with the G3P pathway, it is suggested that, via metabolic engineering, TAG accumulation can be improved by the two pathways based on the pivotal function of PAP and DGAT.

  7. The fusogenic lipid phosphatidic acid promotes the biogenesis of mitochondrial outer membrane protein Ugo1

    PubMed Central

    Keller, Michael; Taskin, Asli A.; Horvath, Susanne E.; Guan, Xue Li; Prinz, Claudia; Opalińska, Magdalena; Zorzin, Carina; van der Laan, Martin; Wenk, Markus R.; Schubert, Rolf; Wiedemann, Nils; Holzer, Martin

    2015-01-01

    Import and assembly of mitochondrial proteins depend on a complex interplay of proteinaceous translocation machineries. The role of lipids in this process has been studied only marginally and so far no direct role for a specific lipid in mitochondrial protein biogenesis has been shown. Here we analyzed a potential role of phosphatidic acid (PA) in biogenesis of mitochondrial proteins in Saccharomyces cerevisiae. In vivo remodeling of the mitochondrial lipid composition by lithocholic acid treatment or by ablation of the lipid transport protein Ups1, both leading to an increase of mitochondrial PA levels, specifically stimulated the biogenesis of the outer membrane protein Ugo1, a component of the mitochondrial fusion machinery. We reconstituted the import and assembly pathway of Ugo1 in protein-free liposomes, mimicking the outer membrane phospholipid composition, and found a direct dependency of Ugo1 biogenesis on PA. Thus, PA represents the first lipid that is directly involved in the biogenesis pathway of a mitochondrial membrane protein. PMID:26347140

  8. Phosphatidylcholine is a major source of phosphatidic acid and diacylglycerol in angiotensin II-stimulated vascular smooth-muscle cells.

    PubMed

    Lassègue, B; Alexander, R W; Clark, M; Akers, M; Griendling, K K

    1993-06-01

    In cultured vascular smooth-muscle cells, angiotensin II produces a sustained formation of diacylglycerol (DG) and phosphatidic acid (PtdOH). Since the fatty acid composition of these molecules is likely to determine their efficacy as second messengers, it is important to ascertain the phospholipid precursors and the biochemical pathways from which they are produced. Our experiments suggest that phospholipase D (PLD)-mediated phosphatidylcholine (PtdCho) hydrolysis is the major source of both DG and PtdOH during the late signalling phase. First, in cells labelled with [3H]myristate, which preferentially labels PtdCho, formation of [3H]PtdOH precedes formation of [3H]DG. Second, in contrast with phospholipase C (PLC) activation, DG mass accumulation is dependent on extracellular Ca2+. Similarly, DG mass accumulation is not attenuated by protein kinase C activation, which we have previously shown to inhibit the phosphoinositide-specific PLC. Third, the fatty acid composition of late-phase DG and PtdOH more closely resembles that of PtdCho than that of phosphatidylinositol. Finally, in cells labelled for a short time with [3H]glycerol, the radioactivity incorporated into [3H]DG and PtdOH was greater than that incorporated into PtdIns, but not into PtdCho. We found no evidence that synthesis de novo or phosphatidylethanolamine breakdown contributes to sustained DG and PtdOH formation. Thus, in angiotensin II-stimulated cultured vascular smooth-muscle cells, PLD-mediated PtdCho hydrolysis is the major source of sustained DG and PtdOH, whereas phosphoinositide breakdown is a minor contributor. Furthermore, PtdOH phosphohydrolase, which determines the relative levels of DG and PtdOH, appears to be regulated by protein kinase C. These results have important implications for the role of these second messengers in growth and contraction.

  9. The role of phosphoinositide 3-kinase and phosphatidic acid in the regulation of mammalian target of rapamycin following eccentric contractions.

    PubMed

    O'Neil, T K; Duffy, L R; Frey, J W; Hornberger, T A

    2009-07-15

    Resistance exercise induces a hypertrophic response in skeletal muscle and recent studies have begun to shed light on the molecular mechanisms involved in this process. For example, several studies indicate that signalling by the mammalian target of rapamycin (mTOR) is necessary for a hypertrophic response. Furthermore, resistance exercise has been proposed to activate mTOR signalling through an upstream pathway involving the phosphoinositide 3-kinase (PI3K) and protein kinase B (PKB); however, this hypothesis has not been thoroughly tested. To test this hypothesis, we first evaluated the temporal pattern of signalling through PI3K-PKB and mTOR following a bout of resistance exercise with eccentric contractions (EC). Our results indicated that the activation of signalling through PI3K-PKB is a transient event (<15 min), while the activation of mTOR is sustained for a long duration (>12 h). Furthermore, inhibition of PI3K-PKB activity did not prevent the activation of mTOR signalling by ECs, indicating that PI3K-PKB is not part of the upstream regulatory pathway. These observations led us to investigate an alternative pathway for the activation of mTOR signalling involving the synthesis of phosphatidic acid (PA) by phospholipase D (PLD). Our results demonstrate that ECs induce a sustained elevation in [PA] and inhibiting the synthesis of PA by PLD prevented the activation of mTOR. Furthermore, we determined that similar to ECs, PA activates mTOR signalling through a PI3K-PKB-independent mechanism. Combined, the results of this study indicate that the activation of mTOR following eccentric contractions occurs through a PI3K-PKB-independent mechanism that requires PLD and PA.

  10. The role of phosphoinositide 3-kinase and phosphatidic acid in the regulation of mammalian target of rapamycin following eccentric contractions

    PubMed Central

    O’Neil, T K; Duffy, L R; Frey, J W; Hornberger, T A

    2009-01-01

    Resistance exercise induces a hypertrophic response in skeletal muscle and recent studies have begun to shed light on the molecular mechanisms involved in this process. For example, several studies indicate that signalling by the mammalian target of rapamycin (mTOR) is necessary for a hypertrophic response. Furthermore, resistance exercise has been proposed to activate mTOR signalling through an upstream pathway involving the phosphoinositide 3-kinase (PI3K) and protein kinase B (PKB); however, this hypothesis has not been thoroughly tested. To test this hypothesis, we first evaluated the temporal pattern of signalling through PI3K–PKB and mTOR following a bout of resistance exercise with eccentric contractions (EC). Our results indicated that the activation of signalling through PI3K–PKB is a transient event (<15 min), while the activation of mTOR is sustained for a long duration (>12 h). Furthermore, inhibition of PI3K–PKB activity did not prevent the activation of mTOR signalling by ECs, indicating that PI3K–PKB is not part of the upstream regulatory pathway. These observations led us to investigate an alternative pathway for the activation of mTOR signalling involving the synthesis of phosphatidic acid (PA) by phospholipase D (PLD). Our results demonstrate that ECs induce a sustained elevation in [PA] and inhibiting the synthesis of PA by PLD prevented the activation of mTOR. Furthermore, we determined that similar to ECs, PA activates mTOR signalling through a PI3K–PKB-independent mechanism. Combined, the results of this study indicate that the activation of mTOR following eccentric contractions occurs through a PI3K–PKB-independent mechanism that requires PLD and PA. PMID:19470781

  11. Identification and physiological characterization of phosphatidic acid phosphatase enzymes involved in triacylglycerol biosynthesis in Streptomyces coelicolor.

    PubMed

    Comba, Santiago; Menendez-Bravo, Simón; Arabolaza, Ana; Gramajo, Hugo

    2013-01-29

    Phosphatidic acid phosphatase (PAP, EC 3.1.3.4) catalyzes the dephosphorylation of phosphatidate yielding diacylglycerol (DAG), the lipid precursor for triacylglycerol (TAG) biosynthesis. Despite the importance of PAP activity in TAG producing bacteria, studies to establish its role in lipid metabolism have been so far restricted only to eukaryotes. Considering the increasing interest of bacterial TAG as a potential source of raw material for biofuel production, we have focused our studies on the identification and physiological characterization of the putative PAP present in the TAG producing bacterium Streptomyces coelicolor. We have identified two S. coelicolor genes, named lppα (SCO1102) and lppβ (SCO1753), encoding for functional PAP proteins. Both enzymes mediate, at least in part, the formation of DAG for neutral lipid biosynthesis. Heterologous expression of lppα and lppβ genes in E. coli resulted in enhanced PAP activity in the membrane fractions of the recombinant strains and concomitantly in higher levels of DAG. In addition, the expression of these genes in yeast complemented the temperature-sensitive growth phenotype of the PAP deficient strain GHY58 (dpp1lpp1pah1). In S. coelicolor, disruption of either lppα or lppβ had no effect on TAG accumulation; however, the simultaneous mutation of both genes provoked a drastic reduction in de novo TAG biosynthesis as well as in total TAG content. Consistently, overexpression of Lppα and Lppβ in the wild type strain of S. coelicolor led to a significant increase in TAG production. The present study describes the identification of PAP enzymes in bacteria and provides further insights on the genetic basis for prokaryotic oiliness. Furthermore, this finding completes the whole set of enzymes required for de novo TAG biosynthesis pathway in S. coelicolor. Remarkably, the overexpression of these PAPs in Streptomyces bacteria contributes to a higher productivity of this single cell oil. Altogether, these

  12. Dependence on the Lazaro phosphatidic acid phosphatase for the maximum light response.

    PubMed

    Kwon, Young; Montell, Craig

    2006-04-04

    The Drosophila phototransduction cascade serves as a paradigm for characterizing the regulation of sensory signaling and TRP channels in vivo . Activation of these channels requires phospholipase C (PLC) and may depend on subsequent production of diacylglycerol (DAG) and downstream metabolites . DAG could potentially be produced through a second pathway involving the combined activities of a phospholipase D (PLD) and a phosphatidic acid (PA) phosphatase (PAP). However, a role for a PAP in the regulation of TRP channels has not been described. Here, we report the identification of a PAP, referred to as Lazaro (Laza). Mutations in laza caused a reduction in the light response and faster termination kinetics. Loss of laza suppressed the severity of the phenotype caused by mutation of the DAG kinase, RDGA , indicating that Laza functions in opposition to RDGA. We also showed that the retinal degeneration resulting from overexpression of the PLD was suppressed by elimination of Laza. These data demonstrate a requirement for a PLD/PAP-dependent pathway for achieving the maximal light response. The genetic interactions with both rdgA and Pld indicate that Laza functions in the convergence of both PLC- and PLD-coupled signaling in vivo.

  13. Phosphatidic Acid Induces Ligand-independent Epidermal Growth Factor Receptor Endocytic Traffic through PDE4 Activation

    PubMed Central

    Norambuena, Andrés; Metz, Claudia; Jung, Juan E.; Silva, Antonia; Otero, Carolina; Cancino, Jorge; Retamal, Claudio; Valenzuela, Juan C.; Soza, Andrea

    2010-01-01

    Endocytosis modulates EGFR function by compartmentalizing and attenuating or enhancing its ligand-induced signaling. Here we show that it can also control the cell surface versus intracellular distribution of empty/inactive EGFR. Our previous observation that PKA inhibitors induce EGFR internalization prompted us to test phosphatidic acid (PA) generated by phospholipase D (PLD) as an endogenous down-regulator of PKA activity, which activates rolipram-sensitive type 4 phosphodiesterases (PDE4) that degrade cAMP. We found that inhibition of PA hydrolysis by propranolol, in the absence of ligand, provokes internalization of inactive (neither tyrosine-phosphorylated nor ubiquitinated) EGFR, accompanied by a transient increase in PA levels and PDE4s activity. This EGFR internalization is mimicked by PA micelles and is strongly counteracted by PLD2 silencing, rolipram or forskolin treatment, and PKA overexpression. Accelerated EGFR endocytosis seems to be mediated by clathrin-dependent and -independent pathways, leading to receptor accumulation in juxtanuclear recycling endosomes, also due to a decreased recycling. Internalized EGFR can remain intracellular without degradation for several hours or return rapidly to the cell surface upon discontinuation of the stimulus. This novel regulatory mechanism of EGFR, also novel function of signaling PA, can transmodulate receptor accessibility in response to heterologous stimuli. PMID:20554760

  14. Phosphatidic acid stimulates cardiac KATP channels like phosphatidylinositols, but with novel gating kinetics.

    PubMed

    Fan, Zheng; Gao, Lizhi; Wang, Wenxia

    2003-01-01

    Membrane-bound anionic phospholipids such as phosphatidylinositols have the capacity to modulate ATP-sensitive potassium (K(ATP)) channels through a mechanism involving long-range electrostatic interaction between the lipid headgroup and channel. However, it has not yet been determined whether the multiple effects of phosphatidylinositols reported in the literature all result from this general electrostatic interaction or require a specific headgroup structure. The present study investigated whether phosphatidic acid (PA), an anionic phospholipid substantially different in structure from phosphatidylinositols, evokes effects similar to phosphatidylinositols on native K(ATP) channels of rat heart and heterogeneous Kir6.2/SUR2A channels. Channels treated with PA (0.2-1 mg/ml applied to the cytoplasmic side of the membrane) exhibited higher activity, lower sensitivity to ATP inhibition, less Mg(2+)-dependent nucleotide stimulation, and poor sulfonylurea inhibition. These effects match the spectrum of phosphatidylinositols' effects, but, in addition, PA also induced a novel pattern in gating kinetics, represented by a decreased mean open time (from 12.2 +/- 2.0 to 3.3 +/- 0.7 ms). This impact on gating kinetics clearly distinguishes PA's effects from those of phosphatidylinositols. Results indicate that multiple effects of anionic phospholipids on K(ATP) channels are related phenomena and can likely be attributed to a common mechanism, but additional specific effects due to other mechanisms may also coincide.

  15. Special interaction of anionic phosphatidic acid promotes high secondary structure in tetrameric potassium channel.

    PubMed

    Raja, Mobeen

    2014-08-01

    Anionic phosphatidic acid (PA) has been shown to stabilize and bind stronger than phosphatidylglycerol via electrostatic and hydrogen bond interaction with the positively charged residues of potassium channel KcsA. However, the effects of these lipids on KcsA folding or secondary structure are not clear. In this study, the secondary structure analyses of KcsA potassium channel was carried out using circular dichroism spectroscopy. It was found that PA interaction leads to increases in α-helical and β-sheet content of KcsA protein. In PA, KcsA α-helical structure was further stabilized by classical membrane-active cosolvent trifluoroethanol followed by reduction in the β-sheet content indicating cooperative transformation from the β-sheet to an α-helical structure. The data further uncover the role of anionic PA in KcsA folding and provide mechanism by which strong hydrogen bonds/electrostatic interaction among PA headgroup and basic residues on lipid binding domains may induce high helical structure thereby altering the protein folding and increasing the stability of tetrameric assembly.

  16. Diacylglycerol Kinases: Shaping Diacylglycerol and Phosphatidic Acid Gradients to Control Cell Polarity

    PubMed Central

    Baldanzi, Gianluca; Bettio, Valentina; Malacarne, Valeria; Graziani, Andrea

    2016-01-01

    Diacylglycerol kinases (DGKs) terminate diacylglycerol (DAG) signaling and promote phosphatidic acid (PA) production. Isoform specific regulation of DGKs activity and localization allows DGKs to shape the DAG and PA gradients. The capacity of DGKs to constrain the areas of DAG signaling is exemplified by their role in defining the contact interface between T cells and antigen presenting cells: the immune synapse. Upon T cell receptor engagement, both DGK α and ζ metabolize DAG at the immune synapse thus constraining DAG signaling. Interestingly, their activity and localization are not fully redundant because DGKζ activity metabolizes the bulk of DAG in the cell, whereas DGKα limits the DAG signaling area localizing specifically at the periphery of the immune synapse. When DGKs terminate DAG signaling, the local PA production defines a new signaling domain, where PA recruits and activates a second wave of effector proteins. The best-characterized example is the role of DGKs in protrusion elongation and cell migration. Indeed, upon growth factor stimulation, several DGK isoforms, such as α, ζ, and γ, are recruited and activated at the plasma membrane. Here, local PA production controls cell migration by finely modulating cytoskeletal remodeling and integrin recycling. Interestingly, DGK-produced PA also controls the localization and activity of key players in cell polarity such as aPKC, Par3, and integrin β1. Thus, T cell polarization and directional migration may be just two instances of the general contribution of DGKs to the definition of cell polarity by local specification of membrane identity signaling. PMID:27965956

  17. A central role for phosphatidic acid as a lipid mediator of regulated exocytosis in apicomplexa.

    PubMed

    Bullen, Hayley E; Soldati-Favre, Dominique

    2016-08-01

    Lipids are commonly known for the structural roles they play, however, the specific contribution of different lipid classes to wide-ranging signalling pathways is progressively being unravelled. Signalling lipids and their associated effector proteins are emerging as significant contributors to a vast array of effector functions within cells, including essential processes such as membrane fusion and vesicle exocytosis. Many phospholipids have signalling capacity, however, this review will focus on phosphatidic acid (PA) and the enzymes implicated in its production from diacylglycerol (DAG) and phosphatidylcholine (PC): DGK and PLD respectively. PA is a negatively charged, cone-shaped lipid identified as a key mediator in specific membrane fusion and vesicle exocytosis events in a variety of mammalian cells, and has recently been implicated in specialised secretory organelle exocytosis in apicomplexan parasites. This review summarises the recent work implicating a role for PA regulation in exocytosis in various cell types. We will discuss how these signalling events are linked to pathogenesis in the phylum Apicomplexa. © 2016 Federation of European Biochemical Societies.

  18. Saturated phosphatidic acids mediate saturated fatty acid–induced vascular calcification and lipotoxicity

    PubMed Central

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L.; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M.; Kuro-o, Makoto; Miyazaki, Makoto

    2015-01-01

    Recent evidence indicates that saturated fatty acid–induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification. PMID:26517697

  19. Mechanisms of xylanase-induced nitric oxide and phosphatidic acid production in tomato cells.

    PubMed

    Lanteri, M Luciana; Lamattina, Lorenzo; Laxalt, Ana M

    2011-10-01

    The second messenger nitric oxide (NO), phosphatidic acid (PA) and reactive oxygen species (ROS) are involved in the plant defense response during plant-pathogen interactions. NO has been shown to participate in PA production in response to the pathogen-associated molecular pattern xylanase in tomato cell suspensions. Defense responses downstream of PA include ROS production. The goal of this work was to study the signaling mechanisms involved in PA production during the defense responses triggered by xylanase and mediated by NO in the suspension-cultured tomato cells. We analyzed the participation of protein kinases, guanylate cyclase and the NO-mediated posttranslational modification S-nitrosylation, by means of pharmacology and biochemistry. We showed that NO, PA and ROS levels are significantly diminished by treatment with the general protein kinase inhibitor staurosporine. This indicates that xylanase-induced protein phosphorylation events might be the important components leading to NO formation, and hence for the downstream regulation of PA and ROS levels. When assayed, a guanylate cyclase inhibitor or a cGMP analog did not alter the PA accumulation. These results suggest that a cGMP-mediated pathway is not involved in xylanase-induced PA formation. Finally, the inhibition of protein S-nitrosylation did not affect NO formation but compromised PA and ROS production. Data collectively indicate that upon xylanase perception, cells activate a protein kinase pathway required for NO formation and that, S-nitrosylation-dependent mechanisms are involved in downstream signaling leading to PA and ROS.

  20. High specificity of human secretory class II phospholipase A2 for phosphatidic acid.

    PubMed

    Snitko, Y; Yoon, E T; Cho, W

    1997-02-01

    Lysophosphatidic acid (LPA) is a potent lipid second messenger which stimulates platelet aggregation, cell proliferation and smooth-muscle contraction. The phospholipase A2 (PLA2)-catalysed hydrolysis of phosphatidic acid (PA) is thought to be a primary synthetic route for LPA. Of the multiple forms of PLA2 present in human tissues, human secretory class-II PLA2 (hs-PLA2) has been implicated in the production of LPA from platelets and whole blood cells challenged with inflammatory stimuli. To explore further the possibility that hs-PLA2 is involved in the production of LPA, we rigorously measured the phospholipid head group specificity of hs-PLA2 by a novel PLA2 kinetic system using polymerized mixed liposomes. Kinetic analysis of recombinant hs-PLA2 demonstrates that hs-PLA2 strongly prefers PA as substrate over other phospholipids found in the mammalian plasma membrane including phosphatidylserine (PS), phosphatidylcholine (PC) and phosphatidylethanolamine (PE). The order of preference is PA > PE approximately PS > PC. To identify amino acid residues of hs-PLA2 that are involved in its unique substrate specificity, we mutated two residues, Glu-56 and Lys-69, which were shown to interact with the phospholipid head group in the X-ray-crystallographic structure of the hs-PLA2-transition-state-analogue complex. The K69Y mutant showed selective inactivation toward PA whereas the E56K mutant displayed a most pronounced inactivation to PE. Thus it appears that Lys-69 is at least partially involved in the PA specificity of hs-PLA2 and Glu-56 in the distinction between PE and PC. In conjunction with a recent cell study [Fourcade, Simon, Viode, Rugani, Leballe, Ragab, Fournie, Sarda and Chap (1995) Cell 80, 919-927], these studies suggest that hs-PLA2 can rapidly hydrolyse PA molecules exposed to the outer layer of cell-derived microvesicles and thereby produce LPA.

  1. Phosphatidic acid mediates activation of mTORC1 through the ERK signaling pathway

    PubMed Central

    Winter, Jeremiah N.; Fox, Todd E.; Kester, Mark; Jefferson, Leonard S.

    2010-01-01

    The mammalian target of rapamycin (mTOR) assembles into two distinct multiprotein complexes known as mTORC1 and mTORC2. Of the two complexes, mTORC1 acts to integrate a variety of positive and negative signals to downstream targets that regulate cell growth. The lipid second messenger, phosphatidic acid (PA), represents one positive input to mTORC1, and it is thought to act by binding directly to mTOR, thereby enhancing the protein kinase activity of mTORC1. Support for this model includes findings that PA binds directly to mTOR and addition of PA to the medium of cells in culture results in activation of mTORC1. In contrast, the results of the present study do not support a model in which PA activates mTORC1 through direct interaction with the protein kinase but, instead, show that the lipid promotes mTORC1 signaling through activation of the ERK pathway. Moreover, rather than acting directly on mTORC1, the results suggest that exogenous PA must be metabolized to lysophosphatidic acid (LPA), which subsequently activates the LPA receptor endothelial differentiation gene (EDG-2). Finally, in contrast to previous studies, the results of the present study demonstrate that leucine does not act through phospholipase D and PA to activate mTORC1 and, instead, show that the two mediators act through parallel upstream signaling pathways to activate mTORC1. Overall, the results demonstrate that leucine and PA signal through parallel pathways to activate mTORC1 and that PA mediates its effect through the ERK pathway, rather than through direct binding to mTOR. PMID:20427710

  2. Phosphatidylinositol and phosphatidic acid transport between the ER and plasma membrane during PLC activation requires the Nir2 protein.

    PubMed

    Kim, Yeun Ju; Guzman-Hernandez, Maria Luisa; Wisniewski, Eva; Echeverria, Nicolas; Balla, Tamas

    2016-02-01

    Phospholipase C (PLC)-mediated hydrolysis of the limited pool of plasma membrane (PM) phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] requires replenishment from a larger pool of phosphatidylinositol (PtdIns) via sequential phosphorylation by PtdIns 4-kinases and phosphatidylinositol 4-phosphate (PtdIns4P) 5-kinases. Since PtdIns is synthesized in the endoplasmic reticulum (ER) and PtdIns(4,5)P2 is generated in the PM, it has been postulated that PtdIns transfer proteins (PITPs) provide the means for this lipid transfer function. Recent studies identified the large PITP protein, Nir2 as important for PtdIns transfer from the ER to the PM. It was also found that Nir2 was required for the transfer of phosphatidic acid (PtdOH) from the PM to the ER. In Nir2-depleted cells, activation of PLC leads to PtdOH accumulation in the PM and PtdIns synthesis becomes severely impaired. In quiescent cells, Nir2 is localized to the ER via interaction of its FFAT domain with ER-bound VAMP-associated proteins VAP-A and-B. After PLC activation, Nir2 also binds to the PM via interaction of its C-terminal domains with diacylglycerol (DAG) and PtdOH. Through these interactions, Nir2 functions in ER-PM contact zones. Mutations in VAP-B that have been identified in familial forms of amyotrophic lateral sclerosis (ALS or Lou-Gehrig's disease) cause aggregation of the VAP-B protein, which then impairs its binding to several proteins, including Nir2. These findings have shed new lights on the importance of non-vesicular lipid transfer of PtdIns and PtdOH in ER-PM contact zones with a possible link to a devastating human disease.

  3. Phosphatidic acid binding proteins display differential binding as a function of membrane curvature stress and chemical properties.

    PubMed

    Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E

    2016-11-01

    Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.

  4. Phosphorylation of Dgk1 Diacylglycerol Kinase by Casein Kinase II Regulates Phosphatidic Acid Production in Saccharomyces cerevisiae.

    PubMed

    Qiu, Yixuan; Hassaninasab, Azam; Han, Gil-Soo; Carman, George M

    2016-12-16

    In the yeast Saccharomyces cerevisiae, Dgk1 diacylglycerol (DAG) kinase catalyzes the CTP-dependent phosphorylation of DAG to form phosphatidic acid (PA). The enzyme in conjunction with Pah1 PA phosphatase controls the levels of PA and DAG for the synthesis of triacylglycerol and membrane phospholipids, the growth of the nuclear/endoplasmic reticulum membrane, and the formation of lipid droplets. Little is known about how DAG kinase activity is regulated by posttranslational modification. In this work, we examined the phosphorylation of Dgk1 DAG kinase by casein kinase II (CKII). When phosphate groups were globally reduced using nonspecific alkaline phosphatase, Triton X-100-solubilized membranes from DGK1-overexpressing cells showed a 7.7-fold reduction in DAG kinase activity; the reduced enzyme activity could be increased 5.5-fold by treatment with CKII. Dgk1(1-77) expressed heterologously in Escherichia coli was phosphorylated by CKII on a serine residue, and its phosphorylation was dependent on time as well as on the concentrations of CKII, ATP, and Dgk1(1-77). We used site-specific mutagenesis, coupled with phosphorylation analysis and phosphopeptide mapping, to identify Ser-45 and Ser-46 of Dgk1 as the CKII target sites, with Ser-46 being the major phosphorylation site. In vivo, the S46A and S45A/S46A mutations of Dgk1 abolished the stationary phase-dependent stimulation of DAG kinase activity. In addition, the phosphorylation-deficient mutations decreased Dgk1 function in PA production and in eliciting pah1Δ phenotypes, such as the expansion of the nuclear/endoplasmic reticulum membrane, reduced lipid droplet formation, and temperature sensitivity. This work demonstrates that the CKII-mediated phosphorylation of Dgk1 regulates its function in the production of PA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. TGD4 involved in endoplasmic reticulum-to-chloroplast lipid trafficking is a phosphatidic acid binding protein

    SciTech Connect

    Wang Z.; Xu C.; Benning, C.

    2012-05-01

    The synthesis of galactoglycerolipids, which are prevalent in photosynthetic membranes, involves enzymes at the endoplasmic reticulum (ER) and the chloroplast envelope membranes. Genetic analysis of trigalactosyldiacylglycerol (TGD) proteins in Arabidopsis has demonstrated their role in polar lipid transfer from the ER to the chloroplast. The TGD1, 2, and 3 proteins resemble components of a bacterial-type ATP-binding cassette (ABC) transporter, with TGD1 representing the permease, TGD2 the substrate binding protein, and TGD3 the ATPase. However, the function of the TGD4 protein in this process is less clear and its location in plant cells remains to be firmly determined. The predicted C-terminal {beta}-barrel structure of TGD4 is weakly similar to proteins of the outer cell membrane of Gram-negative bacteria. Here, we show that, like TGD2, the TGD4 protein when fused to DsRED specifically binds phosphatidic acid (PtdOH). As previously shown for tgd1 mutants, tgd4 mutants have elevated PtdOH content, probably in extraplastidic membranes. Using highly purified and specific antibodies to probe different cell fractions, we demonstrated that the TGD4 protein was present in the outer envelope membrane of chloroplasts, where it appeared to be deeply buried within the membrane except for the N-terminus, which was found to be exposed to the cytosol. It is proposed that TGD4 is either directly involved in the transfer of polar lipids, possibly PtdOH, from the ER to the outer chloroplast envelope membrane or in the transfer of PtdOH through the outer envelope membrane.

  6. Phosphatidic acid enhances mTOR signaling and resistance exercise induced hypertrophy

    PubMed Central

    2014-01-01

    Introduction The lipid messenger phosphatidic acid (PA) plays a critical role in the stimulation of mTOR signaling. However, the mechanism by which PA stimulates mTOR is currently unknown. Therefore, the purpose of this study was to compare the effects of various PA precursors and phospholipids on their ability to stimulate mTOR signaling and its ability to augment resistance training-induced changes in body composition and performance. Methods In phase one, C2C12 myoblasts cells were stimulated with different phospholipids and phospholipid precursors derived from soy and egg sources. The ratio of phosphorylated p70 (P-p70-389) to total p70 was then used as readout for mTOR signaling. In phase two, resistance trained subjects (n = 28, 21 ± 3 years, 77 ± 4 kg, 176 ± 9 cm) consumed either 750 mg PA daily or placebo and each took part in an 8 week periodized resistance training program. Results In phase one, soy-phosphatidylserine, soy-Lyso-PA, egg-PA, and soy-PA stimulated mTOR signaling, and the effects of soy-PA (+636%) were significantly greater than egg-PA (+221%). In phase two, PA significantly increased lean body mass (+2.4 kg), cross sectional area (+1.0 cm), and leg press strength (+51.9 kg) over placebo. Conclusion PA significantly activates mTOR and significantly improved responses in skeletal muscle hypertrophy, lean body mass, and maximal strength to resistance exercise. PMID:24959196

  7. Phosphatidic acid enhances mTOR signaling and resistance exercise induced hypertrophy.

    PubMed

    Joy, Jordan M; Gundermann, David M; Lowery, Ryan P; Jäger, Ralf; McCleary, Sean A; Purpura, Martin; Roberts, Michael D; Wilson, Stephanie Mc; Hornberger, Troy A; Wilson, Jacob M

    2014-01-01

    The lipid messenger phosphatidic acid (PA) plays a critical role in the stimulation of mTOR signaling. However, the mechanism by which PA stimulates mTOR is currently unknown. Therefore, the purpose of this study was to compare the effects of various PA precursors and phospholipids on their ability to stimulate mTOR signaling and its ability to augment resistance training-induced changes in body composition and performance. In phase one, C2C12 myoblasts cells were stimulated with different phospholipids and phospholipid precursors derived from soy and egg sources. The ratio of phosphorylated p70 (P-p70-389) to total p70 was then used as readout for mTOR signaling. In phase two, resistance trained subjects (n = 28, 21 ± 3 years, 77 ± 4 kg, 176 ± 9 cm) consumed either 750 mg PA daily or placebo and each took part in an 8 week periodized resistance training program. In phase one, soy-phosphatidylserine, soy-Lyso-PA, egg-PA, and soy-PA stimulated mTOR signaling, and the effects of soy-PA (+636%) were significantly greater than egg-PA (+221%). In phase two, PA significantly increased lean body mass (+2.4 kg), cross sectional area (+1.0 cm), and leg press strength (+51.9 kg) over placebo. PA significantly activates mTOR and significantly improved responses in skeletal muscle hypertrophy, lean body mass, and maximal strength to resistance exercise.

  8. Activation of Src and release of intracellular calcium by phosphatidic acid during Xenopus laevis fertilization

    PubMed Central

    Bates, Ryan C.; Fees, Colby P.; Holland, William L.; Winger, Courtney C.; Batbayar, Khulan; Ancar, Rachel; Bergren, Todd; Petcoff, Douglas; Stith, Bradley J.

    2014-01-01

    We report a new step in the fertilization in Xenopus laevis which has been found to involve activation of Src tyrosine kinase to stimulate phospholipase C-γ (PLC- γ) which increases inositol 1,4,5-trisphosphate (IP3) to release intracellular calcium ([Ca]i). Molecular species analysis and mass measurements suggested that sperm activate phospholipase D (PLD) to elevate phosphatidic acid (PA). We now report that PA mass increased 2.7 fold by 1 minute after insemination and inhibition of PA production by two methods inhibited activation of Src and PLCγ, increased [Ca]i and other fertilization events. As compared to 14 other lipids, PA strongly bound Xenopus Src but not PLCγ. Addition of synthetic PA activated egg Src (an action requiring intact lipid rafts) and PLCγ as well as doubling the amount of PLCγ in rafts. In the absence of elevated [Ca]i, PA addition elevated IP3 mass to levels equivalent to that induced by sperm (but twice that achieved by calcium ionophore). Finally, PA induced [Ca]i release that was blocked by an IP3 receptor inhibitor. As only PLD1b message was detected, and Western blotting did not detect PLD2, we suggest that sperm activate PLD1b to elevate PA which then binds to and activates Src leading to PLCγ stimulation, IP3 elevation and [Ca]i release. Due to these and other studies, PA may also play a role in membrane fusion events such as sperm-egg fusion, cortical granule exocytosis, the elevation of phosphatidylinositol 4,5-bisphosphate and the large, late increase in sn 1,2-diacylglycerol in fertilization. PMID:24269904

  9. Studies on the formation by rat brain preparations of CDP-diglyceride from CTP and phosphatidic acids of varying fatty acid compositions.

    PubMed

    Bishop, H H; Strickland, K P

    1976-03-01

    The enzyme, CTP:phosphatidate cytidylyltransferase (EC2.7.7.41) which catalyses formation of CDP-diglyceride from CTP and phosphatidic acid has been studied in rat brain preparations and other tissues. Improvement, as judged by the higher tissue activities obtained, in the assay method for this enzyme was achieved through use of phosphatidic acids sonicated in buffer-detergent solution saturated with ether and containing bovine serum albumin and use of short incubation times which essentially provided a measure of initial rates. The enzyme of rat brain microsomes yielded with 1,2-dioleolphosphatidic acid as substrate a pH optimum of 6.8 with maleate buffer and optimal concentrations of 60mM for MG2+, 6MM for CTP and 250 mug per 0.8 ml for phosphatidic acid. Enzyme activity was mainly located in the 90,000 X g fraction (microsomal) with small but significant activity in the 12,000 X g fraction. Comparison of activities (nanomoles CTP incorporated per milligram protein per minute) amongst tissues showed the following order: brain, 1.87; liver, 1.32; lung, 1.19; small intestine, 1.00; kidney, 0.69; heart, 0.41; diaphragm, 0.07; skeletal muscle, 0.02. Examination of the effect of varying the fatty acid composition in the phosphatidic acids added exogenously gave the following order (activities in parentheses); 1-stearoyl-2-oleoyl- (5.58), 1-oleoyl-2-stearoyl- (5.37), 1,2-dioleoyl- (4.49) 1-palmitoyl-2-oleoyl-(3.85), 1-stearoyl-2-arachidonoyl-(3.31), 1-arachidonoyl-2-stearoyl-(3.16), 1,2-diarachidonoyl-(0.72), 1,2-dicaproyl-(0.67), 1,2-dipalmitoyl-(0.67) and 1,2-distearoyl-(0.18). The single bis- and lysophosphatidic acids tested were inactive as substrates. Apart from a possible preference for one or more unsaturated fatty acids the transferase enzyme showed no selectivity in respect to the fatty acid distribution of phosphatidic acids.

  10. Phosphatidic acid increases intracellular free Ca2+ and cardiac contractile force.

    PubMed

    Xu, Y J; Panagia, V; Shao, Q; Wang, X; Dhalla, N S

    1996-08-01

    Although phosphatidic acid (PA) is mainly formed due to the hydrolysis of phosphatidylcholine by myocardial phospholipase D, its functional significance in the heart is not fully understood. The present study was designed to determine the effects of PA on intracellular free Ca2+ level ([Ca2+]i) in freshly isolated adult rat cardiomyocytes by using fura 2-acextoxmethylester and free fura 2 technique. Addition of PA at concentrations of 1-200 microM produced a concentration-dependent increase in [Ca2+]i from the basal level of 117 +/- 8 nM; maximal increase in [Ca2+]i was 233 +/- 50 nM, whereas median effective concentration (EC50) for PA was 45 +/- 1.2 microM. This increase in [Ca2+]i was abolished by the removal of extracellular Ca2+ with ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid and was partially attenuated by Ca2+ channel blockers, verapamil or diltiazem. Preincubation of cardiomyocytes with cyclopiazonic acid and thapsigargin or with ryanodine [to deplete sarcoplasmic reticulum (SR) Ca2+] attenuated the PA-induced increase in [Ca2+]i by 66, 37, and 43%, respectively. Furthermore, the response of [Ca2+]i to PA was blunted by 2-nitro-4 carboxyphenylcarbonate, an inhibitor of phospholipase C, but was unaffected by staurosporine, a protein kinase C inhibitor. PA was also observed to induce Ca2+ efflux from the myocytes. In addition, an injection of PA (0.34 microgram/100 g body wt i.v.) in rats produced a significant increase of the left ventricular developed pressure as well as the maximum rates of cardiac contraction and relaxation within 5 min. These data suggest that the PA-induced increase in [Ca2+]i in cardiomyocytes is a consequence of both Ca2+ influx from the extracellular source and Ca2+ release from the intracellular SR stores. Furthermore, these in vitro data suggest the possibility that PA may regulate [Ca2+]i and contractile parameters in the heart.

  11. Responses of heart function and intracellular free Ca2+ to phosphatidic acid in chronic diabetes.

    PubMed

    Xu, Y J; Botsford, M W; Panagia, V; Dhalla, N S

    1996-10-01

    In view of the crucial role of phosphatidic acid (PA) in signal transduction and Ca(2+)-handling in myocardium, it was the objective of this study to examine the effects of PA on cardiac contractile force and intracellular free Ca2+ in control and chronic diabetic rats. Diabetes was induced in rats by a single intravenous injection of streptozotocin (65 mg/kg.) and the animals were used for experiments eight weeks after the injection. Heart function was measured by using the isolated perfused heart preparations, and values for systolic pressure, diastolic pressure, rate of contraction (+dP/dt) and rate of relaxation (-dP/dt) were monitored. Intracellular free Ca2+ in cardiomyocytes was estimated by employing Fura-2/AM method. PA (5 x 10(-8) to 1 x 10(-5) M) produced a concentration-dependent increase in +dP/dt and -dP/dt in the isolated heart; however, these responses were significantly attenuated in diabetic hearts. ATP also caused a positive inotropic effect at concentrations of 1 x 10(-5) to 1 x 10(-4) M but the magnitude of these responses was similar in both control and diabetic groups. Using freshly isolated cardiomyocytes and Fura-2 technique, PA (1 x 10(-6) to 1 x 10(-4) M) was observed to evoke a concentration-dependent increase in [Ca2+]i in both control and diabetic groups. The EC50 and EC95 values for PA were not different but the maximum increase of [Ca2+]i in diabetic hearts was significantly lower in comparison to the control group (152 +/- 41 versus 304 +/- 56 nM). On the other hand, no difference in the increase of [Ca2+]i due to ATP or potassium chloride was seen between control and diabetic cardiomyocytes. Adrenaline pretreatment enhanced [Ca2+]i responses to ATP and PA in both groups; however, the PA-induced increase in [Ca2+]i, unlike the ATP-induced increase, was lower in the diabetic group compared to the control cells with similar pretreatment with adrenaline. The diminished increase in [Ca2+]i due to PA was also observed in cardiomyocytes

  12. Effects of phosphatidic acid supplementation on muscle thickness and strength in resistance-trained men.

    PubMed

    Gonzalez, Adam M; Sell, Katie M; Ghigiarelli, Jamie J; Kelly, Christopher F; Shone, Edward W; Accetta, Matthew R; Baum, Jamie B; Mangine, Gerald T

    2017-04-01

    The purpose of this study was to investigate the effects of phosphatidic acid (PA) supplementation on muscle thickness and strength following an 8 week supervised resistance-training program. Fifteen resistance trained men (22.8 ± 3.5 years; 80.6 ± 8.7 kg; 178.1 ± 5.6 cm; 14.6% ± 8.8% body fat) were randomly assigned to a group that either consumed 750 mg of PA or a placebo (PL). Testing was carried out before (PRE) and after (POST) training/supplementation for muscle thickness and strength. Muscle thickness of the rectus femoris (RF), vastus lateralis (VL), biceps brachii (BB), and triceps brachii (TB) muscles were measured via ultrasonography, along with 1 repetition maximum (1RM) of squat, deadlift, and bench press. Analysis of covariance (ANCOVA), using PRE values as the covariate, did not reveal any group differences for measures of muscle thickness in the RF (PA: 3.6% ± 5.2%; PL: 3.2% ± 4.2%, p = 0.97), VL (PA: 23.4% ± 18.1%, PL: 12.5% ± 15.4%, p = 0.37), BB (PA: 3.7% ± 6.4%, PL: 9.6% ± 12.4%, p = 0.86), or TB (PA: 15.1% ± 17.9%, PL: 10.7% ± 19.3%, p = 0.79). Likewise, no group differences were observed in changes in squat (PA: 8.4% ± 4.1%, PL: 8.1% ± 4.2%, p = 0.79), deadlift (PA: 10.1% ± 10.1%, PL: 8.9% ± 9.5%, p = 0.66), or bench press (PA: 5.7% ± 5.5%, PL: 5.1% ± 3.0%, p = 0.76) exercises. Collectively, however, all participants experienced significant (p < 0.05) improvements in each measure of muscle thickness and strength. Results of this study suggest that PA supplementation, in combination with a 3 days·week(-1) resistance-training program for 8 weeks, did not have a differential effect compared with PL on changes in muscle thickness or 1RM strength.

  13. Phosphatidate Phosphatase, a Key Regulator of Lipid Homeostasis

    PubMed Central

    Pascual, Florencia; Carman, George M.

    2012-01-01

    Yeast Pah1p phosphatidate phosphatase (PAP) catalyzes the penultimate step in the synthesis of triacylglycerol. PAP plays a crucial role in lipid homeostasis by controlling the relative proportions of its substrate phosphatidate and its product diacylglycerol. The cellular amounts of these lipid intermediates influence the synthesis of triacylglycerol and the pathways by which membrane phospholipids are synthesized. Physiological functions affected by PAP activity include phospholipid synthesis gene expression, nuclear/endoplasmic reticulum membrane growth, lipid droplet formation, and vacuole homeostasis and fusion. Yeast lacking Pah1p PAP activity are acutely sensitive to fatty acid-induced toxicity and exhibit respiratory deficiency. PAP is distinguished in its cellular location, catalytic mechanism, and physiological functions from Dpp1p and Lpp1p lipid phosphate phosphatases that utilize a variety of substrates that include phosphatidate. Phosphorylation/dephosphorylation is a major mechanism by which Pah1p PAP activity is regulated. Pah1p is phosphorylated by cytosolic-associated Pho85p-Pho80p, Cdc28p-cyclin B, and protein kinase A and is dephosphorylated by the endoplasmic reticulum-associated Nem1p-Spo7p phosphatase. The dephosphorylation of Pah1p stimulates PAP activity and facilitates the association with the membrane/phosphatidate allowing for its reaction and triacylglycerol synthesis. PMID:22910056

  14. A HPLC-fluorescence detection method for determination of phosphatidic acid phosphohydrolase activity: application in human myocardium.

    PubMed

    Burgdorf, Christof; Prey, Antje; Richardt, Gert; Kurz, Thomas

    2008-03-15

    Phosphatidic acid phosphohydrolase (PAP) catalyzes the dephosphorylation of phosphatidic acid (PA) to diacylglycerol, the second messenger responsible for activation of protein kinase C. Despite the crucial role of PAP lipid signaling, there are no data on PAP signaling function in the human heart. Here we present a nonradioactive assay for the investigation of PAP activity in human myocardium using a fluorescent derivative of PA, 2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphate (BODIPY-PA), as substrate in an in vitro PAP-catalyzed reaction. Unreacted BODIPY-PA was resolved from the PAP products by a binary gradient HPLC system and BODIPY-diacylglycerol was detected by fluorimetry. The reaction proceeded at a linear rate for up to 60 min and increased linearly with increasing amounts of cardiac protein in a range of 0.25 to 8.0 microg. This assay proved to be sensitive for accurate quantitation of total PAP activity, PAP-1 activity, and PAP-2 activity in human atrial tissue and right ventricular endomyocardial biopsies. Total PAP activity was approximately fourfold higher in ventricular myocardium than in atrial tissue. There was negligible PAP-1 activity in atrial myocardium compared with ventricular myocardium, indicating regional differences in activities and distribution pattern of PAP-1 and PAP-2 in the human heart.

  15. Interaction between repressor Opi1p and ER membrane protein Scs2p facilitates transit of phosphatidic acid from the ER to mitochondria and is essential for INO1 gene expression in the presence of choline.

    PubMed

    Gaspar, Maria L; Chang, Yu-Fang; Jesch, Stephen A; Aregullin, Manuel; Henry, Susan A

    2017-09-18

    In the yeast Saccharomyces cerevisiae, the Opi1p repressor controls the expression of INO1 via the Opi1p/Ino2p-Ino4p regulatory circuit. Inositol depletion favors Opi1p interaction with both Scs2p and phosphatidic acid at the ER membrane. Inositol supplementation, however, favors the translocation of Opi1p from the ER into the nucleus where it interacts with the Ino2p-Ino4p complex, attenuating transcription of INO1. A strain devoid of Scs2p (scs2) and a mutant, OPI1FFAT, lacking the ability to interact with Scs2p were utilized to examine the specific role(s) of the Opi1p-Scs2p interaction in the regulation of INO1 expression and overall lipid metabolism. Loss of the Opi1p-Scs2p interaction reduced INO1 expression, and conferred inositol auxotrophy. Moreover, inositol depletion in strains lacking this interaction resulted in Opi1p being localized to sites of lipid droplet formation, coincident with increased synthesis of triacylglycerol. Supplementation of choline to inositol-depleted growth medium led to decreased TAG synthesis in all three strains. However, in strains lacking the Opi1p-Scs2p interaction, Opi1p remained in the nucleus, preventing expression of INO1. These data support the conclusion that a specific pool of phosphatidic acid, associated with lipid droplet formation in the perinuclear ER, is responsible for the initial rapid exit of Opi1p from the nucleus to the ER and is required for INO1 expression in the presence of choline. Moreover, the mitochondrial-specific phospholipid, cardiolipin, was significantly reduced in both strains compromised for Opi1p-Scs2p interaction, indicating that this interaction is required for the transfer of phosphatidic acid from the ER to the mitochondria for cardiolipin synthesis. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  16. Mice with an adipocyte-specific lipin 1 separation-of-function allele reveal unexpected roles for phosphatidic acid in metabolic regulation.

    PubMed

    Mitra, Mayurranjan S; Chen, Zhouji; Ren, Hongmei; Harris, Thurl E; Chambers, Kari T; Hall, Angela M; Nadra, Karim; Klein, Samuel; Chrast, Roman; Su, Xiong; Morris, Andrew J; Finck, Brian N

    2013-01-08

    Lipin 1 is a coregulator of DNA-bound transcription factors and a phosphatidic acid (PA) phosphatase (PAP) enzyme that catalyzes a critical step in the synthesis of glycerophospholipids. Lipin 1 is highly expressed in adipocytes, and constitutive loss of lipin 1 blocks adipocyte differentiation; however, the effects of Lpin1 deficiency in differentiated adipocytes are unknown. Here we report that adipocyte-specific Lpin1 gene recombination unexpectedly resulted in expression of a truncated lipin 1 protein lacking PAP activity but retaining transcriptional regulatory function. Loss of lipin 1-mediated PAP activity in adipocytes led to reduced glyceride synthesis and increased PA content. Characterization of the deficient mice also revealed that lipin 1 normally modulates cAMP-dependent signaling through protein kinase A to control lipolysis by metabolizing PA, which is an allosteric activator of phosphodiesterase 4 and the molecular target of rapamycin. Consistent with these findings, lipin 1 expression was significantly related to adipose tissue lipolytic rates and protein kinase A signaling in adipose tissue of obese human subjects. Taken together, our findings identify lipin 1 as a reciprocal regulator of triglyceride synthesis and hydrolysis in adipocytes, and suggest that regulation of lipolysis by lipin 1 is mediated by PA-dependent modulation of phosphodiesterase 4.

  17. Raf-1 kinase possesses distinct binding domains for phosphatidylserine and phosphatidic acid. Phosphatidic acid regulates the translocation of Raf-1 in 12-O-tetradecanoylphorbol-13-acetate-stimulated Madin-Darby canine kidney cells.

    PubMed

    Ghosh, S; Strum, J C; Sciorra, V A; Daniel, L; Bell, R M

    1996-04-05

    Previous studies demonstrated that the cysteine-rich amino-terminal domain of Raf-1 kinase interacts selectively with phosphatidylserine (Ghosh, S., Xie, W. Q., Quest, A. F. G., Mabrouk, G. M., Strum, J. C., and Bell, R. M. (1994) J. Biol. Chem. 269, 10000-10007). Further analysis showed that full-length Raf-1 bound to both phosphatidylserine and phosphatidic acid (PA). Specifically, a carboxyl-terminal domain of Raf-1 kinase (RafC; residues 295 648 of human Raf-1) interacted strongly with phosphatidic acid. The binding of RafC to PA displayed positive cooperativity with Hill numbers between 3.3 and 6.2; the apparent Kd ranged from 4.9 +/- 0.6 to 7.8 +/- 0.9 mol % PA. The interaction of RafC with PA displayed a pH dependence distinct from the interaction between the cysteine-rich domain of Raf-1 and PA. Also, the RafC-PA interaction was unaffected at high ionic strength. Of all the lipids tested, only PA and cardiolipin exhibited high affinity binding; other acidic lipids were either ineffective or weakly effective. By deletion mutagenesis, the PA binding site within RafC was narrowed down to a 35-amino acid segment between residues 389 and 423. RafC did not bind phosphatidyl alcohols; also, inhibition of PA formation in Madin-Darby canine kidney cells by treatment with 1% ethanol significantly reduced the translocation of Raf-1 from the cytosol to the membrane following stimulation with 12-O-tetradecanoylphorbol-13-acetate. These results suggest a potential role of the lipid second messenger, PA, in the regulation of translocation and subsequent activation of Raf-1 in vivo.

  18. Overexpression of a phosphatidic acid phosphatase type 2 leads to an increase in triacylglycerol production in oleaginous Rhodococcus strains.

    PubMed

    Hernández, Martín A; Comba, Santiago; Arabolaza, Ana; Gramajo, Hugo; Alvarez, Héctor M

    2015-03-01

    Oleaginous Rhodococcus strains are able to accumulate large amounts of triacylglycerol (TAG). Phosphatidic acid phosphatase (PAP) enzyme catalyzes the dephosphorylation of phosphatidic acid (PA) to yield diacylglycerol (DAG), a key precursor for TAG biosynthesis. Studies to establish its role in lipid metabolism have been mainly focused in eukaryotes but not in bacteria. In this work, we identified and characterized a putative PAP type 2 (PAP2) encoded by the ro00075 gene in Rhodococcus jostii RHA1. Heterologous expression of ro00075 in Escherichia coli resulted in a fourfold increase in PAP activity and twofold in DAG content. The conditional deletion of ro00075 in RHA1 led to a decrease in the content of DAG and TAG, whereas its overexpression in both RHA1 and Rhodococcus opacus PD630 promoted an increase up to 10 to 15 % by cellular dry weight in TAG content. On the other hand, expression of ro00075 in the non-oleaginous strain Rhodococcus fascians F7 promoted an increase in total fatty acid content up to 7 % at the expense of free fatty acid (FFA), DAG, and TAG fractions. Moreover, co-expression of ro00075/atf2 genes resulted in a fourfold increase in total fatty acid content by a further increase of the FFA and TAG fractions. The results of this study suggest that ro00075 encodes for a PAP2 enzyme actively involved in TAG biosynthesis. Overexpression of this gene, as single one or with an atf gene, provides an alternative approach to increase the biosynthesis and accumulation of bacterial oils as a potential source of raw material for biofuel production.

  19. Agonist-induced production of 1,2-diacylglycerol and phosphatidic acid in intact resistance arteries. Evidence that accumulation of diacylglycerol is not a prerequisite for contraction.

    PubMed

    Ohanian, J; Ollerenshaw, J; Collins, P; Heagerty, A

    1990-05-25

    The production of total amounts of 1,2-diacylglycerol as well as those specifically derived from inositol lipid hydrolysis was studied in intact rat resistance arteries stimulated with either noradrenaline, vasopressin, or angiotensin II at 20 s when the onset of contraction would be nearing its maximum, and at 5 min during the sustained phase of contraction. Total amounts of 1,2-diacylglycerol were not altered by any agonist at 20 s, or at 5 min. However, arachidonate-containing species of 1,2-diacylglycerol were differentially influenced being increased at 5 min by noradrenaline, and decreased at 20 s and 5 min by vasopressin. Only angiotensin II produced substantial increases in this class of 1,2-diacylglycerol at both time points. In order to investigate the fate of this second messenger total and inositol lipid derived phosphatidic acids were then measured at both 20 s and 5 min. Noradrenaline induced a rise in both total and arachidonate-containing phosphatidic acid at both times as did vasopressin. Only small increases were induced by angiotensin II at 20 s. These data demonstrate that the accumulation of 1,2-diacylglycerol generated from inositol lipid breakdown is only observed with activation by angiotensin II. Other agonists produced phosphatidic acids with time and the rate of generation of these lipids is agonist-specific. Thus phosphatidic acid may play a more prominent role during the sustained phase of contraction than previously anticipated.

  20. A Novel Phosphatidic Acid-Protein-tyrosine Phosphatase D2 Axis Is Essential for ERBB2 Signaling in Mammary Epithelial Cells*

    PubMed Central

    Ramesh, Mathangi; Krishnan, Navasona; Muthuswamy, Senthil K.; Tonks, Nicholas K.

    2015-01-01

    We used a loss-of-function screen to investigate the role of classical protein-tyrosine phosphatases (PTPs) in three-dimensional mammary epithelial cell morphogenesis and ERBB2 signaling. The study revealed a novel role for PTPD2 as a positive regulator of ERBB2 signaling. Suppression of PTPD2 attenuated the ERBB2-induced multiacinar phenotype in three-dimensional cultures specifically by inhibiting ERBB2-mediated loss of polarity and lumen filling. In contrast, overexpression of PTPD2 enhanced the ERBB2 phenotype. We also found that a lipid second messenger, phosphatidic acid, bound PTPD2 in vitro and enhanced its catalytic activity. Small molecule inhibitors of phospholipase D (PLD), an enzyme that produces phosphatidic acid in cells, also attenuated the ERBB2 phenotype. Exogenously added phosphatidic acid rescued the PLD-inhibition phenotype, but only when PTPD2 was present. These findings illustrate a novel pathway involving PTPD2 and the lipid second messenger phosphatidic acid that promotes ERBB2 function. PMID:25681440

  1. A 25-Amino Acid Sequence of the Arabidopsis TGD2 Protein Is Sufficient for Specific Binding of Phosphatidic Acid*

    PubMed Central

    Lu, Binbin; Benning, Christoph

    2009-01-01

    Genetic analysis suggests that the TGD2 protein of Arabidopsis is required for the biosynthesis of endoplasmic reticulum derived thylakoid lipids. TGD2 is proposed to be the substrate-binding protein of a presumed lipid transporter consisting of the TGD1 (permease) and TGD3 (ATPase) proteins. The TGD1, -2, and -3 proteins are localized in the inner chloroplast envelope membrane. TGD2 appears to be anchored with an N-terminal membrane-spanning domain into the inner envelope membrane, whereas the C-terminal domain faces the intermembrane space. It was previously shown that the C-terminal domain of TGD2 binds phosphatidic acid (PtdOH). To investigate the PtdOH binding site of TGD2 in detail, the C-terminal domain of the TGD2 sequence lacking the transit peptide and transmembrane sequences was fused to the C terminus of the Discosoma sp. red fluorescent protein (DR). This greatly improved the solubility of the resulting DR-TGD2C fusion protein following production in Escherichia coli. The DR-TGD2C protein bound PtdOH with high specificity, as demonstrated by membrane lipid-protein overlay and liposome association assays. Internal deletion and truncation mutagenesis identified a previously undescribed minimal 25-amino acid fragment in the C-terminal domain of TGD2 that is sufficient for PtdOH binding. Binding characteristics of this 25-mer were distinctly different from those of TGD2C, suggesting that additional sequences of TGD2 providing the proper context for this 25-mer are needed for wild type-like PtdOH binding. PMID:19416982

  2. Phosphatidic acid phosphatase in neonatal rat lung: effects of prenatal dexamethasone or terbutaline treatment on basal activity and on responsiveness to beta adrenergic stimulation.

    PubMed

    Kudlacz, E M; Navarro, H A; Slotkin, T A

    1989-07-01

    Phosphatidic acid phosphatase (PAPase) is a key enzyme in the synthesis of lung surfactant. This study compares the effects of prenatal exposure (gestational days 17, 18 and 19) to two drugs which enhance surfactant synthesis: dexamethasone (0.2 mg/kg) and terbutaline (2 or 10 mg/kg). Maternal dexamethasone treatment did not cause an initial stimulation of lung PAPase but did eventually evoke a small increase after the 1st postnatal week. The effect was selective in that brain PAPase activity was generally unaffected; liver PAPase was stimulated during the early neonatal period only. Dexamethasone also prolonged the developmental period of peak reactivity of lung PAPase to beta developmental period of peak reactivity of lung PAPase to beta adrenergic stimulation (tested with acute isoproterenol challenge), which ordinarily accompanies genesis of alveoli in the 2nd to 3rd postnatal week. Significant growth retardation was present even at this low dose of dexamethasone. In contrast, maternal administration of the beta adrenergic agonist, terbutaline, resulted in a large increase in basal enzyme activity in the lung during the immediate perinatal period and enhanced the responsiveness to isoproterenol challenge. The effect of terbutaline was accompanied by little or no growth impairment. Thus, although prenatal administration of either glucocorticoids or beta adrenergic agonists can enhance lung PAPase activity and reactivity to stimulation, the two classes of drugs differ substantially in time course of effect and in the propensity to retard growth.

  3. Phosphatidic acid plays a special role in stabilizing and folding of the tetrameric potassium channel KcsA.

    PubMed

    Raja, Mobeen; Spelbrink, Robin E J; de Kruijff, Ben; Killian, J Antoinette

    2007-12-11

    In this study, we investigated how the presence of anionic lipids influenced the stability and folding properties of the potassium channel KcsA. By using a combination of gel electrophoresis, tryptophan fluorescence and acrylamide quenching experiments, we found that the presence of the anionic lipid phosphatidylglycerol (PG) in a phosphatidylcholine (PC) bilayer slightly stabilized the tetramer and protected it from trifluoroethanol-induced dissociation. Surprisingly, the presence of phosphatidic acid (PA) had a much larger effect on the stability of KcsA and this lipid, in addition, significantly influenced the folding properties of the protein. The data indicate that PA creates some specificity over PG, and that it most likely stabilizes the tetramer via both electrostatic and hydrogen bond interactions.

  4. Surface dipole potential at the interface between water and self-assembled monolayers of phosphatidylserine and phosphatidic acid.

    PubMed Central

    Moncelli, M R; Becucci, L; Buoninsegni, F T; Guidelli, R

    1998-01-01

    The nature and magnitude of the surface dipole potential chi at a membrane/water interface still remain open to discussion. By combining measurements of differential capacity C and charge density sigma at the interface between self-assembled monolayers of phosphatidylserine and phosphatidic acid supported by mercury and aqueous electrolytes of different concentration and pH, a sigmoidal dependence of chi upon sigma is revealed, with the inflection at sigma = 0. This behavior is strongly reminiscent of the surface dipole potential due to reorientation of adsorbed water molecules at electrified interfaces. The small increase in C with a decrease in the frequency of the AC signal below approximately 80 Hz, as observed with phospholipid monolayers with partially protonated polar groups, is explained either by a sluggish collective reorientation of some polar groups of the lipid or by a sluggish movement of protons across the polar head region. PMID:9591665

  5. Phosphatidic Acid Produced by RalA-activated PLD2 Stimulates Caveolae-mediated Endocytosis and Trafficking in Endothelial Cells.

    PubMed

    Jiang, Ying; Sverdlov, Maria S; Toth, Peter T; Huang, Long Shuang; Du, Guangwei; Liu, Yiyao; Natarajan, Viswanathan; Minshall, Richard D

    2016-09-23

    Caveolae are the primary route for internalization and transendothelial transport of macromolecules, such as insulin and albumin. Caveolae-mediated endocytosis is activated by Src-dependent caveolin-1 (Cav-1) phosphorylation and subsequent recruitment of dynamin-2 and filamin A (FilA), which facilitate vesicle fission and trafficking, respectively. Here, we tested the role of RalA and phospholipase D (PLD) signaling in the regulation of caveolae-mediated endocytosis and trafficking. The addition of albumin to human lung microvascular endothelial cells induced the activation of RalA within minutes, and siRNA-mediated down-regulation of RalA abolished fluorescent BSA uptake. Co-immunoprecipitation studies revealed that albumin induced the association between RalA, Cav-1, and FilA; however, RalA knockdown with siRNA did not affect FilA recruitment to Cav-1, suggesting that RalA was not required for FilA and Cav-1 complex formation. Rather, RalA probably facilitates caveolae-mediated endocytosis by activating downstream effectors. PLD2 was shown to be activated by RalA, and inhibition of PLD2 abolished Alexa-488-BSA uptake, indicating that phosphatidic acid (PA) generated by PLD2 may facilitate caveolae-mediated endocytosis. Furthermore, using a PA biosensor, GFP-PASS, we observed that BSA induced an increase in PA co-localization with Cav-1-RFP, which could be blocked by a dominant negative PLD2 mutant. Total internal reflection fluorescence microscopy studies of Cav-1-RFP also showed that fusion of caveolae with the basal plasma membrane was dependent on PLD2 activity. Thus, our results suggest that the small GTPase RalA plays an important role in promoting invagination and trafficking of caveolae, not by potentiating the association between Cav-1 and FilA but by stimulating PLD2-mediated generation of phosphatidic acid.

  6. Mechanical Stimulation Induces mTOR Signaling via an ERK-Independent Mechanism: Implications for a Direct Activation of mTOR by Phosphatidic Acid

    PubMed Central

    You, Jae Sung; Frey, John W.; Hornberger, Troy A.

    2012-01-01

    Signaling by mTOR is a well-recognized component of the pathway through which mechanical signals regulate protein synthesis and muscle mass. However, the mechanisms involved in the mechanical regulation of mTOR signaling have not been defined. Nevertheless, recent studies suggest that a mechanically-induced increase in phosphatidic acid (PA) may be involved. There is also evidence which suggests that mechanical stimuli, and PA, utilize ERK to induce mTOR signaling. Hence, we reasoned that a mechanically-induced increase in PA might promote mTOR signaling via an ERK-dependent mechanism. To test this, we subjected mouse skeletal muscles to mechanical stimulation in the presence or absence of a MEK/ERK inhibitor, and then measured several commonly used markers of mTOR signaling. Transgenic mice expressing a rapamycin-resistant mutant of mTOR were also used to confirm the validity of these markers. The results demonstrated that mechanically-induced increases in p70s6k T389 and 4E-BP1 S64 phosphorylation, and unexpectedly, a loss in total 4E-BP1, were fully mTOR-dependent signaling events. Furthermore, we determined that mechanical stimulation induced these mTOR-dependent events, and protein synthesis, through an ERK-independent mechanism. Similar to mechanical stimulation, exogenous PA also induced mTOR-dependent signaling via an ERK-independent mechanism. Moreover, PA was able to directly activate mTOR signaling in vitro. Combined, these results demonstrate that mechanical stimulation induces mTOR signaling, and protein synthesis, via an ERK-independent mechanism that potentially involves a direct interaction of PA with mTOR. Furthermore, it appears that a decrease in total 4E-BP1 may be part of the mTOR-dependent mechanism through which mechanical stimuli activate protein synthesis. PMID:23077579

  7. Mechanical stimulation induces mTOR signaling via an ERK-independent mechanism: implications for a direct activation of mTOR by phosphatidic acid.

    PubMed

    You, Jae Sung; Frey, John W; Hornberger, Troy A

    2012-01-01

    Signaling by mTOR is a well-recognized component of the pathway through which mechanical signals regulate protein synthesis and muscle mass. However, the mechanisms involved in the mechanical regulation of mTOR signaling have not been defined. Nevertheless, recent studies suggest that a mechanically-induced increase in phosphatidic acid (PA) may be involved. There is also evidence which suggests that mechanical stimuli, and PA, utilize ERK to induce mTOR signaling. Hence, we reasoned that a mechanically-induced increase in PA might promote mTOR signaling via an ERK-dependent mechanism. To test this, we subjected mouse skeletal muscles to mechanical stimulation in the presence or absence of a MEK/ERK inhibitor, and then measured several commonly used markers of mTOR signaling. Transgenic mice expressing a rapamycin-resistant mutant of mTOR were also used to confirm the validity of these markers. The results demonstrated that mechanically-induced increases in p70(s6k) T389 and 4E-BP1 S64 phosphorylation, and unexpectedly, a loss in total 4E-BP1, were fully mTOR-dependent signaling events. Furthermore, we determined that mechanical stimulation induced these mTOR-dependent events, and protein synthesis, through an ERK-independent mechanism. Similar to mechanical stimulation, exogenous PA also induced mTOR-dependent signaling via an ERK-independent mechanism. Moreover, PA was able to directly activate mTOR signaling in vitro. Combined, these results demonstrate that mechanical stimulation induces mTOR signaling, and protein synthesis, via an ERK-independent mechanism that potentially involves a direct interaction of PA with mTOR. Furthermore, it appears that a decrease in total 4E-BP1 may be part of the mTOR-dependent mechanism through which mechanical stimuli activate protein synthesis.

  8. Hydrophilic interaction liquid chromatography-mass spectrometry of (lyso)phosphatidic acids, (lyso)phosphatidylserines and other lipid classes.

    PubMed

    Cífková, Eva; Hájek, Roman; Lísa, Miroslav; Holčapek, Michal

    2016-03-25

    The goal of this work is a systematic optimization of hydrophilic interaction liquid chromatography (HILIC) separation of acidic lipid classes (namely phosphatidic acids-PA, lysophosphatidic acids-LPA, phosphatidylserines-PS and lysophosphatidylserines-LPS) and other lipid classes under mass spectrometry (MS) compatible conditions. The main parameters included in this optimization are the type of stationary phases used in HILIC, pH of the mobile phase, the type and concentration of mobile phase additives. Nine HILIC columns with different chemistries (unmodified silica, modified silica using diol, 2-picolylamine, diethylamine and 1-aminoanthracene and hydride silica) are compared with the emphasis on peak shapes of acidic lipid classes. The optimization of pH is correlated with the theoretical calculation of acidobasic equilibria of studied lipid classes. The final method using the hydride column, pH 4 adjusted by formic acid and the gradient of acetonitrile and 40 mmol/L of aqueous ammonium formate provides good peak shapes for all analyzed lipid classes including acidic lipids. This method is applied for the identification of lipids in real samples of porcine brain and kidney extracts.

  9. Levels of Arabidopsis thaliana Leaf Phosphatidic Acids, Phosphatidylserines, and Most Trienoate-Containing Polar Lipid Molecular Species Increase during the Dark Period of the Diurnal Cycle.

    PubMed

    Maatta, Sara; Scheu, Brad; Roth, Mary R; Tamura, Pamela; Li, Maoyin; Williams, Todd D; Wang, Xuemin; Welti, Ruth

    2012-01-01

    Previous work has demonstrated that plant leaf polar lipid fatty acid composition varies during the diurnal (dark-light) cycle. Fatty acid synthesis occurs primarily during the light, but fatty acid desaturation continues in the absence of light, resulting in polyunsaturated fatty acids reaching their highest levels toward the end of the dark period. In this work, Arabidopsis thaliana were grown at constant (21°C) temperature with 12-h light and 12-h dark periods. Collision induced dissociation time-of-flight mass spectrometry (MS) demonstrated that 16:3 and 18:3 fatty acid content in membrane lipids of leaves are higher at the end of the dark than at the end of the light period, while 16:1, 16:2, 18:0, and 18:1 content are higher at the end of the light period. Lipid profiling of membrane galactolipids, phospholipids, and lysophospholipids by electrospray ionization triple quadrupole MS indicated that the monogalactosyldiacylglycerol, phosphatidylglycerol, and phosphatidylcholine classes include molecular species whose levels are highest at end of the light period and others that are highest at the end of the dark period. The levels of phosphatidic acid (PA) and phosphatidylserine classes were higher at the end of the dark period, and molecular species within these classes either followed the class pattern or were not significantly changed in the diurnal cycle. Phospholipase D (PLD) is a family of enzymes that hydrolyzes phospholipids to produce PA. Analysis of several PLD mutant lines suggests that PLDζ2 and possibly PLDα1 may contribute to diurnal cycling of PA. The polar lipid compositional changes are considered in relation to recent data that demonstrate phosphatidylcholine acyl editing.

  10. Levels of Arabidopsis thaliana Leaf Phosphatidic Acids, Phosphatidylserines, and Most Trienoate-Containing Polar Lipid Molecular Species Increase during the Dark Period of the Diurnal Cycle

    PubMed Central

    Maatta, Sara; Scheu, Brad; Roth, Mary R.; Tamura, Pamela; Li, Maoyin; Williams, Todd D.; Wang, Xuemin; Welti, Ruth

    2012-01-01

    Previous work has demonstrated that plant leaf polar lipid fatty acid composition varies during the diurnal (dark–light) cycle. Fatty acid synthesis occurs primarily during the light, but fatty acid desaturation continues in the absence of light, resulting in polyunsaturated fatty acids reaching their highest levels toward the end of the dark period. In this work, Arabidopsis thaliana were grown at constant (21°C) temperature with 12-h light and 12-h dark periods. Collision induced dissociation time-of-flight mass spectrometry (MS) demonstrated that 16:3 and 18:3 fatty acid content in membrane lipids of leaves are higher at the end of the dark than at the end of the light period, while 16:1, 16:2, 18:0, and 18:1 content are higher at the end of the light period. Lipid profiling of membrane galactolipids, phospholipids, and lysophospholipids by electrospray ionization triple quadrupole MS indicated that the monogalactosyldiacylglycerol, phosphatidylglycerol, and phosphatidylcholine classes include molecular species whose levels are highest at end of the light period and others that are highest at the end of the dark period. The levels of phosphatidic acid (PA) and phosphatidylserine classes were higher at the end of the dark period, and molecular species within these classes either followed the class pattern or were not significantly changed in the diurnal cycle. Phospholipase D (PLD) is a family of enzymes that hydrolyzes phospholipids to produce PA. Analysis of several PLD mutant lines suggests that PLDζ2 and possibly PLDα1 may contribute to diurnal cycling of PA. The polar lipid compositional changes are considered in relation to recent data that demonstrate phosphatidylcholine acyl editing. PMID:22629276

  11. Phosphatidic acid: biosynthesis, pharmacokinetics, mechanisms of action and effect on strength and body composition in resistance-trained individuals.

    PubMed

    Bond, Peter

    2017-01-01

    The mechanistic target of rapamycin complex 1 (mTORC1) has received much attention in the field of exercise physiology as a master regulator of skeletal muscle hypertrophy. The multiprotein complex is regulated by various signals such as growth factors, energy status, amino acids and mechanical stimuli. Importantly, the glycerophospholipid phosphatidic acid (PA) appears to play an important role in mTORC1 activation by mechanical stimulation. PA has been shown to modulate mTOR activity by direct binding to its FKBP12-rapamycin binding domain. Additionally, it has been suggested that exogenous PA activates mTORC1 via extracellular conversion to lysophosphatidic acid and subsequent binding to endothelial differentiation gene receptors on the cell surface. Recent trials have therefore evaluated the effects of PA supplementation in resistance-trained individuals on strength and body composition. As research in this field is rapidly evolving, this review attempts to provide a comprehensive overview of its biosynthesis, pharmacokinetics, mechanisms of action and effect on strength and body composition in resistance-trained individuals.

  12. Efficacy of phosphatidic acid ingestion on lean body mass, muscle thickness and strength gains in resistance-trained men.

    PubMed

    Hoffman, Jay R; Stout, Jeffrey R; Williams, David R; Wells, Adam J; Fragala, Maren S; Mangine, Gerald T; Gonzalez, Adam M; Emerson, Nadia S; McCormack, William P; Scanlon, Tyler C; Purpura, Martin; Jäger, Ralf

    2012-10-05

    Phosphatidic acid (PA) has been reported to activate the mammalian target of rapamycin (mTOR) signaling pathway and is thought to enhance the anabolic effects of resistance training. The purpose of this pilot study was to examine if oral phosphatidic acid administration can enhance strength, muscle thickness and lean tissue accruement during an 8-week resistance training program. Sixteen resistance-trained men were randomly assigned to a group that either consumed 750 mg of PA (n = 7, 23.1 ± 4.4 y; 176.7 ± 6.7 cm; 86.5 ± 21.2 kg) or a placebo (PL, n = 9, 22.5 ± 2.0 y; 179.8 ± 5.4 cm; 89.4 ± 13.6 kg) group. During each testing session subjects were assessed for strength (one repetition maximum [1-RM] bench press and squat) and body composition. Muscle thickness and pennation angle were also measured in the vastus lateralis of the subject's dominant leg. Subjects ingesting PA demonstrated a 12.7% increase in squat strength and a 2.6% increase in LBM, while subjects consuming PL showed a 9.3% improvement in squat strength and a 0.1% change in LBM. Although parametric analysis was unable to demonstrate significant differences, magnitude based inferences indicated that the Δ change in 1-RM squat showed a likely benefit from PA on increasing lower body strength and a very likely benefit for increasing lean body mass (LBM). Results of this study suggest that a combination of a daily 750 mg PA ingestion, combined with a 4-day per week resistance training program for 8-weeks appears to have a likely benefit on strength improvement, and a very likely benefit on lean tissue accruement in young, resistance trained individuals.

  13. Phospholipase D2 specifically regulates TREK potassium channels via direct interaction and local production of phosphatidic acid.

    PubMed

    Comoglio, Yannick; Levitz, Joshua; Kienzler, Michael A; Lesage, Florian; Isacoff, Ehud Y; Sandoz, Guillaume

    2014-09-16

    Membrane lipids serve as second messengers and docking sites for proteins and play central roles in cell signaling. A major question about lipid signaling is whether diffusible lipids can selectively target specific proteins. One family of lipid-regulated membrane proteins is the TWIK-related K channel (TREK) subfamily of K2P channels: TREK1, TREK2, and TWIK-related arachdonic acid stimulated K(+) channel (TRAAK). We investigated the regulation of TREK channels by phosphatidic acid (PA), which is generated by phospholipase D (PLD) via hydrolysis of phosphatidylcholine. Even though all three of the channels are sensitive to PA, we found that only TREK1 and TREK2 are potentiated by PLD2 and that none of these channels is modulated by PLD1, indicating surprising selectivity. We found that PLD2, but not PLD1, directly binds to the C terminus of TREK1 and TREK2, but not to TRAAK. The results have led to a model for selective lipid regulation by localization of phospholipid enzymes to specific effector proteins. Finally, we show that regulation of TREK channels by PLD2 occurs natively in hippocampal neurons.

  14. Modification of intracellular free calcium in cultured A10 vascular smooth muscle cells by exogenous phosphatidic acid.

    PubMed

    Bhugra, Praveen; Xu, Yan-Jun; Rathi, Satyajeet; Dhalla, Naranjan S

    2003-06-15

    Exogenous phosphatidic acid (PA) was observed to produce a concentration-dependent increase in [Ca(2+)](i) in cultured A10 vascular smooth muscle cells. Preincubation of cells with sarcoplasmic reticulum Ca(2+)-ATPase inhibitors (cyclopiazonic acid and thapsigargin), a phospholipase C inhibitor (2-nitro-4-carboxyphenyl-N,N-diphenylcarbamate), inositol 1,4,5-trisphosphate receptor antagonists (2-aminoethoxydiphenyl borate and xestospongin), and an activator of protein kinase C (PKC) (phorbol 12-myristate 13-acetate) depressed the PA-evoked increase in [Ca(2+)](i). Although EGTA, an extracellular Ca(2+) chelator, decreased the PA-induced increase in [Ca(2+)](i), sarcolemmal Ca(2+)-channel blockers (verapamil or diltiazem) did not alter the action of PA. On the other hand, inhibitors of PKC (bisindolylmaleimide I) and G(i)-protein (pertussis toxin) potentiated the increase in [Ca(2+)](i) evoked by PA significantly. These results suggest that the PA-induced increase in [Ca(2+)](i) in vascular smooth muscle cells may occur upon the activation of phospholipase C and the subsequent release of Ca(2+) from the inositol 1,4,5-trisphosphate-sensitive Ca(2+) pool in the sarcoplasmic reticulum. This action of PA may be mediated through the involvement of PKC.

  15. Mass Spectrometry Analysis of Wild-Type and Knock-in Q140/Q140 Huntington's Disease Mouse Brains Reveals Changes in Glycerophospholipids Including Alterations in Phosphatidic Acid and Lyso-Phosphatidic Acid.

    PubMed

    Vodicka, Petr; Mo, Shunyan; Tousley, Adelaide; Green, Karin M; Sapp, Ellen; Iuliano, Maria; Sadri-Vakili, Ghazaleh; Shaffer, Scott A; Aronin, Neil; DiFiglia, Marian; Kegel-Gleason, Kimberly B

    2015-01-01

    Huntington's disease (HD) is a neurodegenerative disease caused by a CAG expansion in the HD gene, which encodes the protein Huntingtin. Huntingtin associates with membranes and can interact directly with glycerophospholipids in membranes. We analyzed glycerophospholipid profiles from brains of 11 month old wild-type (WT) and Q140/Q140 HD knock-in mice to assess potential changes in glycerophospholipid metabolism. Polar lipids from cerebellum, cortex, and striatum were extracted and analyzed by liquid chromatography and negative ion electrospray tandem mass spectrometry analysis (LC-MS/MS). Gene products involved in polar lipid metabolism were studied using western blotting, immuno-electron microscopy and qPCR. Significant changes in numerous species of glycerophosphate (phosphatidic acid, PA) were found in striatum, cerebellum and cortex from Q140/Q140 HD mice compared to WT mice at 11 months. Changes in specific species could also be detected for other glycerophospholipids. Increases in species of lyso-PA (LPA) were measured in striatum of Q140/Q140 HD mice compared to WT. Protein levels for c-terminal binding protein 1 (CtBP1), a regulator of PA biosynthesis, were reduced in striatal synaptosomes from HD mice compared to wild-type at 6 and 12 months. Immunoreactivity for CtBP1 was detected on membranes of synaptic vesicles in striatal axon terminals in the globus pallidus. These novel results identify a potential site of molecular pathology caused by mutant Huntingtin that may impart early changes in HD.

  16. PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.

    PubMed

    Pascual, Florencia; Soto-Cardalda, Aníbal; Carman, George M

    2013-12-13

    In the yeast Saccharomyces cerevisiae, the synthesis of phospholipids in the exponential phase of growth occurs at the expense of the storage lipid triacylglycerol. As exponential phase cells progress into the stationary phase, the synthesis of triacylglycerol occurs at the expense of phospholipids. Early work indicates a role of the phosphatidate phosphatase (PAP) in this metabolism; the enzyme produces the diacylglycerol needed for the synthesis of triacylglycerol and simultaneously controls the level of phosphatidate for the synthesis of phospholipids. Four genes (APP1, DPP1, LPP1, and PAH1) encode PAP activity in yeast, and it has been unclear which gene is responsible for the synthesis of triacylglycerol throughout growth. An analysis of lipid synthesis and composition, as well as PAP activity in various PAP mutant strains, showed the essential role of PAH1 in triacylglycerol synthesis throughout growth. Pah1p is a phosphorylated enzyme whose in vivo function is dependent on its dephosphorylation by the Nem1p-Spo7p protein phosphatase complex. nem1Δ mutant cells exhibited defects in triacylglycerol synthesis and lipid metabolism that mirrored those imparted by the pah1Δ mutation, substantiating the importance of Pah1p dephosphorylation throughout growth. An analysis of cells bearing PPAH1-lacZ and PPAH1-DPP1 reporter genes showed that PAH1 expression was induced throughout growth and that the induction in the stationary phase was stimulated by inositol supplementation. A mutant analysis indicated that the Ino2p/Ino4p/Opi1p regulatory circuit and transcription factors Gis1p and Rph1p mediated this regulation.

  17. PAH1-encoded Phosphatidate Phosphatase Plays a Role in the Growth Phase- and Inositol-mediated Regulation of Lipid Synthesis in Saccharomyces cerevisiae*

    PubMed Central

    Pascual, Florencia; Soto-Cardalda, Aníbal; Carman, George M.

    2013-01-01

    In the yeast Saccharomyces cerevisiae, the synthesis of phospholipids in the exponential phase of growth occurs at the expense of the storage lipid triacylglycerol. As exponential phase cells progress into the stationary phase, the synthesis of triacylglycerol occurs at the expense of phospholipids. Early work indicates a role of the phosphatidate phosphatase (PAP) in this metabolism; the enzyme produces the diacylglycerol needed for the synthesis of triacylglycerol and simultaneously controls the level of phosphatidate for the synthesis of phospholipids. Four genes (APP1, DPP1, LPP1, and PAH1) encode PAP activity in yeast, and it has been unclear which gene is responsible for the synthesis of triacylglycerol throughout growth. An analysis of lipid synthesis and composition, as well as PAP activity in various PAP mutant strains, showed the essential role of PAH1 in triacylglycerol synthesis throughout growth. Pah1p is a phosphorylated enzyme whose in vivo function is dependent on its dephosphorylation by the Nem1p-Spo7p protein phosphatase complex. nem1Δ mutant cells exhibited defects in triacylglycerol synthesis and lipid metabolism that mirrored those imparted by the pah1Δ mutation, substantiating the importance of Pah1p dephosphorylation throughout growth. An analysis of cells bearing PPAH1-lacZ and PPAH1-DPP1 reporter genes showed that PAH1 expression was induced throughout growth and that the induction in the stationary phase was stimulated by inositol supplementation. A mutant analysis indicated that the Ino2p/Ino4p/Opi1p regulatory circuit and transcription factors Gis1p and Rph1p mediated this regulation. PMID:24196957

  18. Lysophosphatidic Acid Regulation and Roles in Human Prostate Cancer

    DTIC Science & Technology

    2005-01-01

    be generated by other pathways. LPA is produced from phosphatidic acid 4 ") (PA) in activated platelets and ovarian and prostate cancer cells by...material. Appendix 1 JCB in revision 2 ABSTRACT The bioactive phospholipids, lysophosphatidic acid (LPA) and phosphatidic acid (PA), regulate pivotal...glycerolipid synthesis, abundant evidence now indicates that bioactive LPA can also be generated by other pathways. LPA is produced from phosphatidic acid (PA

  19. Phosphatidic acid phospholipase A1 mediates ER–Golgi transit of a family of G protein–coupled receptors

    PubMed Central

    Kunduri, Govind; Yuan, Changqing; Parthibane, Velayoudame; Nyswaner, Katherine M.; Kanwar, Ritu; Nagashima, Kunio; Britt, Steven G.; Mehta, Nickita; Kotu, Varshika; Porterfield, Mindy; Tiemeyer, Michael; Dolph, Patrick J.; Acharya, Usha

    2014-01-01

    The coat protein II (COPII)–coated vesicular system transports newly synthesized secretory and membrane proteins from the endoplasmic reticulum (ER) to the Golgi complex. Recruitment of cargo into COPII vesicles requires an interaction of COPII proteins either with the cargo molecules directly or with cargo receptors for anterograde trafficking. We show that cytosolic phosphatidic acid phospholipase A1 (PAPLA1) interacts with COPII protein family members and is required for the transport of Rh1 (rhodopsin 1), an N-glycosylated G protein–coupled receptor (GPCR), from the ER to the Golgi complex. In papla1 mutants, in the absence of transport to the Golgi, Rh1 is aberrantly glycosylated and is mislocalized. These defects lead to decreased levels of the protein and decreased sensitivity of the photoreceptors to light. Several GPCRs, including other rhodopsins and Bride of sevenless, are similarly affected. Our findings show that a cytosolic protein is necessary for transit of selective transmembrane receptor cargo by the COPII coat for anterograde trafficking. PMID:25002678

  20. Physiological Role for Phosphatidic Acid in the Translocation of the Novel Protein Kinase C Apl II in Aplysia Neurons▿

    PubMed Central

    Farah, Carole A.; Nagakura, Ikue; Weatherill, Daniel; Fan, Xiaotang; Sossin, Wayne S.

    2008-01-01

    In Aplysia californica, the serotonin-mediated translocation of protein kinase C (PKC) Apl II to neuronal membranes is important for synaptic plasticity. The orthologue of PKC Apl II, PKCɛ, has been reported to require phosphatidic acid (PA) in conjunction with diacylglycerol (DAG) for translocation. We find that PKC Apl II can be synergistically translocated to membranes by the combination of DAG and PA. We identify a mutation in the C1b domain (arginine 273 to histidine; PKC Apl II-R273H) that removes the effects of exogenous PA. In Aplysia neurons, the inhibition of endogenous PA production by 1-butanol inhibited the physiological translocation of PKC Apl II by serotonin in the cell body and at the synapse but not the translocation of PKC Apl II-R273H. The translocation of PKC Apl II-R273H in the absence of PA was explained by two additional effects of this mutation: (i) the mutation removed C2 domain-mediated inhibition, and (ii) the mutation decreased the concentration of DAG required for PKC Apl II translocation. We present a model in which, under physiological conditions, PA is important to activate the novel PKC Apl II both by synergizing with DAG and removing C2 domain-mediated inhibition. PMID:18505819

  1. The brown adipocyte protein CIDEA promotes lipid droplet fusion via a phosphatidic acid-binding amphipathic helix

    PubMed Central

    Barneda, David; Planas-Iglesias, Joan; Gaspar, Maria L; Mohammadyani, Dariush; Prasannan, Sunil; Dormann, Dirk; Han, Gil-Soo; Jesch, Stephen A; Carman, George M; Kagan, Valerian; Parker, Malcolm G; Ktistakis, Nicholas T; Klein-Seetharaman, Judith; Dixon, Ann M; Henry, Susan A; Christian, Mark

    2015-01-01

    Maintenance of energy homeostasis depends on the highly regulated storage and release of triacylglycerol primarily in adipose tissue, and excessive storage is a feature of common metabolic disorders. CIDEA is a lipid droplet (LD)-protein enriched in brown adipocytes promoting the enlargement of LDs, which are dynamic, ubiquitous organelles specialized for storing neutral lipids. We demonstrate an essential role in this process for an amphipathic helix in CIDEA, which facilitates embedding in the LD phospholipid monolayer and binds phosphatidic acid (PA). LD pairs are docked by CIDEA trans-complexes through contributions of the N-terminal domain and a C-terminal dimerization region. These complexes, enriched at the LD–LD contact site, interact with the cone-shaped phospholipid PA and likely increase phospholipid barrier permeability, promoting LD fusion by transference of lipids. This physiological process is essential in adipocyte differentiation as well as serving to facilitate the tight coupling of lipolysis and lipogenesis in activated brown fat. DOI: http://dx.doi.org/10.7554/eLife.07485.001 PMID:26609809

  2. Long-chain bases, phosphatidic acid, MAPKs, and reactive oxygen species as nodal signal transducers in stress responses in Arabidopsis

    PubMed Central

    Saucedo-García, Mariana; Gavilanes-Ruíz, Marina; Arce-Cervantes, Oscar

    2015-01-01

    Due to their sessile condition, plants have developed sensitive, fast, and effective ways to contend with environmental changes. These mechanisms operate as informational wires conforming extensive and intricate networks that are connected in several points. The responses are designed as pathways orchestrated by molecules that are transducers of protein and non-protein nature. Their chemical nature imposes selective features such as specificity, formation rate, and generation site to the informational routes. Enzymes such as mitogen-activated protein kinases and non-protein, smaller molecules, such as long-chain bases, phosphatidic acid, and reactive oxygen species are recurrent transducers in the pleiotropic responses to biotic and abiotic stresses in plants. In this review, we considered these four components as nodal points of converging signaling pathways that start from very diverse stimuli and evoke very different responses. These pleiotropic effects may be explained by the potentiality that every one of these four mediators can be expressed from different sources, cellular location, temporality, or magnitude. Here, we review recent advances in our understanding of the interplay of these four specific signaling components in Arabidopsis cells, with an emphasis on drought, cold and pathogen stresses. PMID:25763001

  3. Phospholipase Dα1-mediated phosphatidic acid change is a key determinant of desiccation-induced viability loss in seeds.

    PubMed

    Chen, Hongying; Yu, Xiaomei; Zhang, Xudong; Yang, Lan; Huang, Xing; Zhang, Jie; Pritchard, Hugh W; Li, Weiqi

    2017-02-02

    High sensitivity of seeds to water loss is a widespread phenomenon in the world's plant species. The molecular basis of this trait is poorly understood but thought to be associated with critical changes in membrane function. We profiled membrane lipids of seeds in eight species with varying levels of desiccation tolerance and found a close association between reducing seed viability and increasing phosphatidic acid (PA). We applied hydration-dehydration cycles to Arabidopsis seeds, which are normally desiccation tolerant, to mimic the onset of desiccation sensitivity with progression towards germination and examined the role of phospholipase D (PLD) in desiccation stress-induced production of PA. We found that PLDα1 became more abundant and migrated from the cytosol to the membrane during desiccation, whereas PLDδ did not change, and that all desiccation-induced PA was derived from PLDα1 hydrolysis. When PLDα1 was suppressed, the germination level after each hydration-dehydration cycle improved significantly. We further demonstrated that PLDα1-mediated PA formation modulates desiccation sensitivity as applying its inhibitor improved seed desiccation tolerance and its suppression in protoplasts enhanced survival under dehydration. The insights provided by comparative lipidomics enable us to propose a new membrane-based model for seed desiccation stress and survival.

  4. Relationship between stimulated phosphatidic acid production and inositol lipid hydrolysis in intestinal longitudinal smooth muscle from guinea pig.

    PubMed

    Mallows, R S; Bolton, T B

    1987-06-15

    Accumulation of [32P]phosphatidic acid (PA) and total [3H]inositol phosphates (IPs) was measured in the longitudinal smooth-muscle layer from guinea-pig small intestine. Stimulation with carbachol, histamine and substance P produced increases in accumulation of both [3H]IPs and [32P]PA over the same concentration range. The increase in [32P]PA accumulation in response to carbachol (1 microM-0.1 mM) was inhibited in the presence of atropine (0.5 microM). Buffering the external free [Ca2+] to 10 nM did not prevent the carbachol-stimulated increase in [32P]PA accumulation. Carbachol and Ca2+ appear to act synergistically to increase accumulation of [32P]PA. In contrast, although incubation with noradrenaline also increased accumulation of [3H]IPs, no increase in accumulation of [32P]PA could be detected. These results suggest that an increase in formation of IPs is not necessarily accompanied by an increase in PA formation, and imply the existence of receptor-modulated pathways regulating PA concentrations other than by phospholipase-C-catalysed inositol phospholipid hydrolysis.

  5. Regulation of Phospholipase D Activity and Phosphatidic Acid Production after Purinergic (P2Y6) Receptor Stimulation*

    PubMed Central

    Scott, Sarah A.; Xiang, Yun; Mathews, Thomas P.; Cho, Hyekyung P.; Myers, David S.; Armstrong, Michelle D.; Tallman, Keri A.; O'Reilly, Matthew C.; Lindsley, Craig W.; Brown, H. Alex

    2013-01-01

    Phosphatidic acid (PA) is a lipid second messenger located at the intersection of several lipid metabolism and cell signaling events including membrane trafficking, survival, and proliferation. Generation of signaling PA has long been primarily attributed to the activation of phospholipase D (PLD). PLD catalyzes the hydrolysis of phosphatidylcholine into PA. A variety of both receptor-tyrosine kinase and G-protein-coupled receptor stimulations have been shown to lead to PLD activation and PA generation. This study focuses on profiling the PA pool upon P2Y6 receptor signaling manipulation to determine the major PA producing enzymes. Here we show that PLD, although highly active, is not responsible for the majority of stable PA being produced upon UDP stimulation of the P2Y6 receptor and that PA levels are tightly regulated. By following PA flux in the cell we show that PLD is involved in an initial increase in PA upon receptor stimulation; however, when PLD is blocked, the cell compensates by increasing PA production from other sources. We further delineate the P2Y6 signaling pathway showing that phospholipase Cβ3 (PLCβ3), PLCδ1, DGKζ and PLD are all downstream of receptor activation. We also show that DGKζ is a novel negative regulator of PLD activity in this system that occurs through an inhibitory mechanism with PKCα. These results further define the downstream events resulting in PA production in the P2Y6 receptor signaling pathway. PMID:23723068

  6. The role of phosphatidic acid and cardiolipin in stability of the tetrameric assembly of potassium channel KcsA.

    PubMed

    Raja, Mobeen

    2010-04-01

    In this study, the roles of two anionic phospholipids-phosphatidic acid (PA), which is an important signaling molecule, and cardiolipin (CL), which plays a crucial role in the bioenergetics of the cell-in stabilizing the oligomeric structure of potassium channel KcsA were determined. The stability of KcsA was drastically increased as a function of PA or CL content (mol%) in phosphatidylcholine (PC) bilayers. Deletion of the membrane-associated N terminus significantly reduced channel stability at high levels of PA content; however, the intrinsic stability of this protein was marginally affected in the presence of CL. These studies indicate that the electrostatic-hydrogen bond switch between PA and N terminus, involving basic residues, is much stronger than the stabilizing effect of CL. Furthermore, the unique properties of the PA headgroup alter protein assembly and folding properties differently from the CL headgroup, and both lipids stabilize the tetrameric assembly via their specific interaction on the extra- or the intracellular side of KcsA.

  7. Arabidopsis phospholipase D alpha 1-derived phosphatidic acid regulates microtubule organization and cell development under microtubule-interacting drugs treatment.

    PubMed

    Zhang, Qun; Qu, Yana; Wang, Qing; Song, Ping; Wang, Peipei; Jia, Qianru; Guo, Jinhe

    2017-01-01

    Phospholipase D (PLD) and its product phosphatidic acid (PA) are emerging as essential regulators of cytoskeleton organization in plants. However, the underlying molecular mechanisms of PA-mediated microtubule reorganization in plants remain largely unknown. In this study, we used pharmacological and genetic approaches to analyze the function of Arabidopsis thaliana PLDα1 in the regulation of microtubule organization and cell development in response to microtubule-affecting drugs. Treatment with the microtubule-stabilizing drug paclitaxel resulted in less growth inhibition and decreased rightward slant of roots, longitudinal alignment of microtubules, and enhanced length of hypocotyl epidermal cells in the pldα1 mutant, the phenotype of which was rescued by exogenous application of PA. Moreover, the pldα1 mutant was sensitive to the microtubule-disrupting drugs oryzalin and propyzamide in terms of seedling survival ratio, left-skewing angle of roots and microtubule organization. In addition, both disruption and stabilization of microtubules induced by drugs activated PLDα1 activity. Our findings demonstrate that in A. thaliana, PLDα1/PA might regulate cell development by modulating microtubule organization in an activity-dependent manner.

  8. Phosphatidic acid-mediated activation and translocation to the cell surface of sialidase NEU3, promoting signaling for cell migration.

    PubMed

    Shiozaki, Kazuhiro; Takahashi, Kohta; Hosono, Masahiro; Yamaguchi, Kazunori; Hata, Keiko; Shiozaki, Momo; Bassi, Rosaria; Prinetti, Alessandro; Sonnino, Sandro; Nitta, Kazuo; Miyagi, Taeko

    2015-05-01

    The plasma membrane-associated sialidase NEU3 plays crucial roles in regulation of transmembrane signaling, and its aberrant up-regulation in various cancers contributes to malignancy. However, it remains uncertain how NEU3 is naturally activated and locates to plasma membranes, because of its Triton X-100 requirement for the sialidase activity in vitro and its often changing subcellular location. Among phospholipids examined, we demonstrate that phosphatidic acid (PA) elevates its sialidase activity 4 to 5 times at 50 μM in vitro at neutral pH and promotes translocation to the cell surface and cell migration through Ras-signaling in HeLa and COS-1 cells. NEU3 was found to interact selectively with PA as assessed by phospholipid array, liposome coprecipitation, and ELISA assays and to colocalize with phospholipase D (PLD) 1 in response to epidermal growth factor (EGF) or serum stimulation. Studies using tagged NEU3 fragments with point mutations identified PA- and calmodulin (CaM)-binding sites around the N terminus and confirmed its participation in translocation and catalytic activity. EGF induced PLD1 activation concomitantly with enhanced NEU3 translocation to the cell surface, as assessed by confocal microscopy. These results suggest that interactions of NEU3 with PA produced by PLD1 are important for regulation of transmembrane signaling, this aberrant acceleration probably promoting malignancy in cancers.

  9. Quantitation of phosphatidic acid and lysophosphatidic acid molecular species using hydrophilic interaction liquid chromatography coupled to electrospray ionization high resolution mass spectrometry.

    PubMed

    Triebl, Alexander; Trötzmüller, Martin; Eberl, Anita; Hanel, Pia; Hartler, Jürgen; Köfeler, Harald C

    2014-06-20

    A method for a highly selective and sensitive identification and quantitation of lysophosphatidic acid (LPA) and phosphatidic acid (PA) molecular species was developed using hydrophilic interaction liquid chromatography (HILIC) followed by negative-ion electrospray ionization high resolution mass spectrometry. Different extraction methods for the polar LPA and PA species were compared and a modified Bligh & Dyer extraction by addition of 0.1M hydrochloric acid resulted in a ≈1.2-fold increase of recovery for the 7 PA and a more than 15-fold increase for the 6 LPA molecular species of a commercially available natural mix compared to conventional Bligh & Dyer extraction. This modified Bligh & Dyer extraction did not show any artifacts resulting from hydrolysis of natural abundant phospholipids. The developed HILIC method is able to separate all PA and LPA species from major polar membrane lipid classes which might have suppressive effects on the minor abundant lipid classes of interest. The elemental compositions of intact lipid species are provided by the high mass resolution of 100,000 and high mass accuracy below 3ppm of the Orbitrap instrument. Additionally, tandem mass spectra were generated in a parallel data dependent acquisition mode in the linear ion trap to provide structural information at molecular level. Limits of quantitation were identified at 45fmol on column and the dynamic range reaches 20pmol on column, covering the range of natural abundance well. By applying the developed method to mouse brain it can be shown that phosphatidic acid contains less unsaturated fatty acids with PA 34:1 and PA 36:1 as the major species. In contrast, for LPA species a high content of polyunsaturated fatty acids (LPA 20:4 and LPA 22:6) was quantified. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Quantification of phosphatidylserine, phosphatidic acid and free fatty acids in an ultrasound contrast agent by normal-phase high-performance liquid chromatography with evaporative light scattering detection.

    PubMed

    Hvattum, Erlend; Uran, Steinar; Sandbaek, Anne Gunvor; Karlsson, Anders A; Skotland, Tore

    2006-10-11

    Sonazoid is a new contrast agent for ultrasound imaging. The product is an aqueous suspension of perfluorobutane microbubbles coated with phospholipids obtained from hydrogenated egg phosphatidylserine (H-EPS). A normal-phase high-performance liquid chromatographic (HPLC) method with evaporative light scattering detection was developed for quantification of free fatty acids, phosphatidylserine and phosphatidic acid in H-EPS and Sonazoid. Separation of the lipids was carried out on an HPLC diol column and a gradient of chloroform and methanol with 0.2% formic acid titrated to pH 7.5 with ammonia. The calibration standards contained stearic acid, distearoyl-phosphatidic acid (DSPA) and distearoyl-phosphatidylserine (DSPS) in the concentration range of 0.016-1.0mg/ml (0.4-25microg injected). The method was validated with a limit of quantification of the three lipids set to 0.4microg (approximately 20-60microM). The best fit of the three calibration curves were obtained when the logarithmic transformed theoretical lipid concentration was plotted against the logarithmic transformed area under the peak and fitted to a second order polynomial equation. Stearic acid, DSPA and DSPS were analysed with an intermediate precision ranging from 4.4% to 5.3% R.S.D. and they were extracted from an aqueous suspension with a recovery ranging from 103.3% to 113.3%. The sum of total phospholipid concentration determined in H-EPS ranged from 96.4% to 103.2% of the theoretical values. The lipids in the ultrasound product were quantitated with a repeatability ranging from 6.2% to 11.7% R.S.D.

  11. Protection of neuroblastoma Neuro2A cells from hypoxia-induced apoptosis by cyclic phosphatidic acid (cPA).

    PubMed

    Gotoh, Mari; Sano-Maeda, Katsura; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2012-01-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator with a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We have previously shown that cPA significantly suppresses ischemia-induced delayed neuronal death and the accumulation of glial fibrillary acidic protein in the CA1 region of the rat hippocampus. These results indicated that the systemic administration of cPA can protect hippocampal neurons against ischemia-induced delayed neuronal cell death. In the current study, we investigated the effects of cPA on neuronal cell death caused by hypoxia in vitro and the molecular mechanisms underlying these effects. We used cobalt chloride (CoCl(2)) to expose cells to hypoxic conditions in vitro. Treating mouse neuroblastoma (Neuro2A) cells with CoCl(2) induced nuclear DNA condensation and phosphatidylserine exposure. However, adding cPA led to the suppression of CoCl(2)-induced apoptosis in a cPA dose-dependent manner and attenuated the increase in the Bax/Bcl-2 ratio caused by CoCl(2). Quantitative PCR analysis showed that Neuro2A cells strongly express the LPA(1), LPA(2), and LPA(6), which are G-protein coupled receptors that can be activated by cPA. To date, LPA(1) and LPA(2) have been reported to exhibit antiapoptotic activity. Therefore, to assess the roles of LPA(1) and LPA(2) on cPA-induced neuroprotective functions, Ki16425, a selective LPA(1) and LPA(3) antagonist, was adopted to know the LPA(1) function and siRNA was used to knockdown the expression of LPA(2). On the basis of our results, we propose that cPA-induced protection of Neuro2A cells from CoCl(2)-induced hypoxia damage is mediated via LPA(2).

  12. Phosphatidic acid increases inositol-1,4,5,-trisphosphate and [Ca2+]i levels in neonatal rat cardiomyocytes.

    PubMed

    Liu, P; Xu, Y; Hopfner, R L; Gopalakrishnan, V

    1999-08-25

    Phosphatidic acid (PA), which can be synthesized de novo, or as a product of phosphatidylcholine hydrolysis and/or phosphorylation of 1,2-diacylglycerol (DAG), mediates diverse cellular functions in various cell types, including cardiomyocytes. We set out to characterize the effect of PA on intracellular free calcium ([Ca2+]i) and inositol-1,4,5-trisphosphate (IP(3)) levels in primary cultures of neonatal rat cardiomyocytes. Addition of PA led to rapid, concentration and time dependent increases in both IP(3) and [Ca2+]i levels in adherent cells. There was strong correlation in the concentration-response relationships between IP(3) and [Ca2+]i increases evoked by PA. Incubation with the sarcoplasmic reticulum (SR) Ca2+ pump inhibitor, cyclopiazonic acid (CPA), significantly attenuated the PA evoked [Ca2+]i increase but had no significant effect on IP(3) accumulation. The phospholipase C (PLC) inhibitor, D-609, attenuated both IP(3) and [Ca2+]i elevations evoked by PA whereas staurosporine (STS), a potent and non-selective PKC inhibitor, had no significant effect on either. Another PLC inhibitor, U73122, but not its inactive analog, U73343, also inhibited PA evoked increases in [Ca2+]i. Depletion of extracellular calcium attenuated both basal and PA evoked increases in [Ca2+]i. The PLA(2) inhibitors, bromophenylacyl-bromide (BPB) and CDP-choline, had no effect on PA evoked [Ca2+]i responses. Neither the DAG analog, dioctanoylglycerol, nor the DAG kinase inhibitor, R59949, affected PA evoked changes in [Ca2+]i. Taken together, these data indicate that PA, in a manner independent of PKC, DAG, or PLA(2), may enhance Ca2+ release from IP(3) sensitive SR Ca(2+) stores via activation of PLC in neonatal rat cardiomyocytes.

  13. The role of diacylglycerol kinase ζ and phosphatidic acid in the mechanical activation of mammalian target of rapamycin (mTOR) signaling and skeletal muscle hypertrophy.

    PubMed

    You, Jae-Sung; Lincoln, Hannah C; Kim, Chan-Ran; Frey, John W; Goodman, Craig A; Zhong, Xiao-Ping; Hornberger, Troy A

    2014-01-17

    The activation of mTOR signaling is essential for mechanically induced changes in skeletal muscle mass, and previous studies have suggested that mechanical stimuli activate mTOR (mammalian target of rapamycin) signaling through a phospholipase D (PLD)-dependent increase in the concentration of phosphatidic acid (PA). Consistent with this conclusion, we obtained evidence which further suggests that mechanical stimuli utilize PA as a direct upstream activator of mTOR signaling. Unexpectedly though, we found that the activation of PLD is not necessary for the mechanically induced increases in PA or mTOR signaling. Motivated by this observation, we performed experiments that were aimed at identifying the enzyme(s) that promotes the increase in PA. These experiments revealed that mechanical stimulation increases the concentration of diacylglycerol (DAG) and the activity of DAG kinases (DGKs) in membranous structures. Furthermore, using knock-out mice, we determined that the ζ isoform of DGK (DGKζ) is necessary for the mechanically induced increase in PA. We also determined that DGKζ significantly contributes to the mechanical activation of mTOR signaling, and this is likely driven by an enhanced binding of PA to mTOR. Last, we found that the overexpression of DGKζ is sufficient to induce muscle fiber hypertrophy through an mTOR-dependent mechanism, and this event requires DGKζ kinase activity (i.e. the synthesis of PA). Combined, these results indicate that DGKζ, but not PLD, plays an important role in mechanically induced increases in PA and mTOR signaling. Furthermore, this study suggests that DGKζ could be a fundamental component of the mechanism(s) through which mechanical stimuli regulate skeletal muscle mass.

  14. Role of Phosphatidic Acid Phosphatase Domain Containing 2 in Squalestatin 1-Mediated Activation of the Constitutive Androstane Receptor in Primary Cultured Rat Hepatocytes.

    PubMed

    Pant, Asmita; Kocarek, Thomas A

    2016-03-01

    Farnesyl pyrophosphate (FPP) is a branch-point intermediate in the mevalonate pathway that is normally converted mainly to squalene by squalene synthase in the first committed step of sterol biosynthesis. Treatment with the squalene synthase inhibitor squalestatin 1 (SQ1) causes accumulation of FPP, its dephosphorylated metabolite farnesol, and several oxidized farnesol-derived metabolites. In addition, SQ1 treatment of primary cultured rat hepatocytes increases CYP2B expression through a mechanism that requires FPP synthesis and activation of the constitutive androstane receptor (CAR). Because direct farnesol treatment also increases CYP2B expression, it seems likely that SQ1-mediated CAR activation requires FPP dephosphorylation to farnesol. The lipid phosphatase, phosphatidic acid phosphatase domain containing 2 (PPAPDC2), was recently reported to catalyze FPP dephosphorylation. We therefore determined the effect of overexpressing or knocking down PPAPDC2 on SQ1-mediated CAR activation in primary cultured rat hepatocytes. Cotransfection of rat hepatocytes with a plasmid expressing rat or human PPAPDC2 enhanced SQ1-mediated activation of a CAR-responsive reporter by 1.7- or 2.4-fold over the SQ1-mediated activation that was produced when hepatocytes were cotransfected with empty expression plasmid. Similarly, transduction of rat hepatocytes with a recombinant adenovirus expressing PPAPDC2 enhanced SQ1-mediated CYP2B1 mRNA induction by 1.4-fold over the induction that was seen in hepatocytes transduced with control adenovirus. Cotransfection with a short hairpin RNA targeting PPAPDC2 reduced SQ1-mediated CAR activation by approximately 80% relative to the activation that occurred in hepatocytes transfected with nontargeting short hairpin RNA. These results indicate that PPAPDC2 plays an important role in SQ1-mediated CAR activation, most likely by catalyzing the conversion of FPP to farnesol. Copyright © 2016 by The American Society for Pharmacology and

  15. The Role of Diacylglycerol Kinase ζ and Phosphatidic Acid in the Mechanical Activation of Mammalian Target of Rapamycin (mTOR) Signaling and Skeletal Muscle Hypertrophy*

    PubMed Central

    You, Jae-Sung; Lincoln, Hannah C.; Kim, Chan-Ran; Frey, John W.; Goodman, Craig A.; Zhong, Xiao-Ping; Hornberger, Troy A.

    2014-01-01

    The activation of mTOR signaling is essential for mechanically induced changes in skeletal muscle mass, and previous studies have suggested that mechanical stimuli activate mTOR (mammalian target of rapamycin) signaling through a phospholipase D (PLD)-dependent increase in the concentration of phosphatidic acid (PA). Consistent with this conclusion, we obtained evidence which further suggests that mechanical stimuli utilize PA as a direct upstream activator of mTOR signaling. Unexpectedly though, we found that the activation of PLD is not necessary for the mechanically induced increases in PA or mTOR signaling. Motivated by this observation, we performed experiments that were aimed at identifying the enzyme(s) that promotes the increase in PA. These experiments revealed that mechanical stimulation increases the concentration of diacylglycerol (DAG) and the activity of DAG kinases (DGKs) in membranous structures. Furthermore, using knock-out mice, we determined that the ζ isoform of DGK (DGKζ) is necessary for the mechanically induced increase in PA. We also determined that DGKζ significantly contributes to the mechanical activation of mTOR signaling, and this is likely driven by an enhanced binding of PA to mTOR. Last, we found that the overexpression of DGKζ is sufficient to induce muscle fiber hypertrophy through an mTOR-dependent mechanism, and this event requires DGKζ kinase activity (i.e. the synthesis of PA). Combined, these results indicate that DGKζ, but not PLD, plays an important role in mechanically induced increases in PA and mTOR signaling. Furthermore, this study suggests that DGKζ could be a fundamental component of the mechanism(s) through which mechanical stimuli regulate skeletal muscle mass. PMID:24302719

  16. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia)

    USDA-ARS?s Scientific Manuscript database

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initia...

  17. Phospholipase D Activity Is Regulated by Product Segregation and the Structure Formation of Phosphatidic Acid within Model Membranes

    PubMed Central

    Wagner, Kerstin; Brezesinski, Gerald

    2007-01-01

    Phospholipase D from Streptomyces chromofuscus (scPLD) hydrolyzes phosphatidylcholines (PC) to produce choline and phosphatidic acid (PA), a lipid messenger molecule within biological membranes. To scrutinize the influence of membrane structure on scPLD activity, three different substrate-containing monolayers are used as model systems: pure dipalmitoylphosphatidylcholine (DPPC) as well as equimolar mixtures of DPPC/n-hexadecanol (C16OH) and DPPC/dipalmitoylglycerol (DPG). The activity of scPLD toward these monolayers is tested by infrared reflection-absorption spectroscopy and exhibits different dependencies on surface pressure. For pure DPPC, the catalytic turnover drastically drops above 20 mN/m. On addition of C16OH, this strong decrease starts at 5 mN/m. For the DPPC/DPG system, the reaction yield linearly decreases between 5 and 25 mN/m. The difference in scPLD activity is correlated to the phase state of the monolayers as examined by x-ray diffraction, Brewster angle microscopy, and atomic force microscopy. Because the additives C16OH and DPG mediate the miscibility of PC and PA, only a basal activity of scPLD is observed toward the mixed systems at higher surface pressures. At pure DPPC monolayers, scPLD is activated after the segregation of initially formed PA. Furthermore, scPLD is inhibited when the lipids in the PA-rich domains adopt an upright orientation. This phenomenon offers a self-regulating mechanism for the concentration of the second messenger PA within biological membranes. PMID:17557794

  18. A Phosphatidic Acid (PA) conveyor system of continuous intracellular transport from cell membrane to nucleus maintains EGF receptor homeostasis

    PubMed Central

    Henkels, Karen M.; Miller, Taylor E.; Ganesan, Ramya; Wilkins, Brandon A.; Fite, Kristen; Gomez-Cambronero, Julian

    2016-01-01

    The intracellular concentration of the mitogen phosphatidic acid (PA) must be maintained at low levels until the need arises for cell proliferation. How temporal and spatial trafficking of PA affects its target proteins in the different cellular compartments is not fully understood. We report that in cancer cells, PA cycles back and forth from the cellular membrane to the nucleus, affecting the function of epidermal growth factor (EGF), in a process that involves PPARα/LXRα signaling. Upon binding to its ligand, EGF receptor (EGFR)-initiated activation of phospholipase D (PLD) causes a spike in intracellular PA production that forms vesicles transporting EGFR from early endosomes (EEA1 marker) and prolonged internalization in late endosomes and Golgi (RCAS marker). Cells incubated with fluorescent-labeled PA (NBD-PA) show PA in “diffuse” locations throughout the cytoplasm, punctae (small, <0.1 μm) vesicles) and large (>0.5 μm) vesicles that co-localize with EGFR. We also report that PPARα/LXRα form heterodimers that bind to new Responsive Elements (RE) in the EGFR promoter. Nuclear PA enhances EGFR expression, a role compatible with the mitogenic ability of the phospholipid. Newly made EGFR is packaged into PA recycling vesicles (Rab11 marker) and transported back to the cytoplasm and plasma membrane. However, a PLD+PA combination impedes binding of PPARα/LXRα to the EGFR promoter. Thus, if PA levels inside the nucleus reach a certain threshold (>100 nM) PA outcompetes the nuclear receptors and transcription is inhibited. This new signaling function of PLD-PA targeting EGFR trafficking and biphasically modulating its transcription, could explain cell proliferation initiation and its maintenance in cancer cells. PMID:27256981

  19. Soybean MAPK, GMK1 is dually regulated by phosphatidic acid and hydrogen peroxide and translocated to nucleus during salt stress.

    PubMed

    Im, Jong Hee; Lee, Hyoungseok; Kim, Jitae; Kim, Ho Bang; An, Chung Sun

    2012-09-01

    Mitogen-activated protein kinase (MAPK) is activated by various biotic and abiotic stresses. Salt stress induces two well-characterized MAPK activating signaling molecules, phosphatidic acid (PA) via phospholipase D and phospholipase C, and reactive oxygen species (ROS) via nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase. In our previous study, the activity of soybean MAPK, GMK1 was strongly induced within 5 min of 300 mM NaCl treatment and this early activity was regulated by PA. In this study, we focused on the regulation of GMK1 at the later stage of the salt stress, because its activity was strongly persistent for up to 30 min. H(2)O(2) activated GMK1 even in the presence of PA generation inhibitors, but GMK1 activity was greatly decreased in the presence of diphenyleneiodonium, an inhibitor of NADPH-oxidase after 5 min of the treatment. On the contrary, the n-butanol and neomycin reduced GMK1 activity within 5 min of the treatment. Thus, GMK1 activity may be sustained by H(2)O(2) 10 min after the treatment. Further, GMK1 was translocated into the nucleus 60 min after NaCl treatment. In the relationship between GMK1 and ROS generation, ROS generation was reduced by SB202190, a MAPK inhibitor, but was increased in protoplast overexpressing TESD-GMKK1. However, these effects were occurred at prolonged time of NaCl treatment. These data suggest that GMK1 indirectly regulates ROS generation. Taken together, we propose that soybean GMK1 is dually regulated by PA and H(2)O(2) at a time dependant manner and translocated to the nucleus by the salt stress signal.

  20. The role of phospholipase D and phosphatidic acid in the mechanical activation of mTOR signaling in skeletal muscle.

    PubMed

    Hornberger, T A; Chu, W K; Mak, Y W; Hsiung, J W; Huang, S A; Chien, S

    2006-03-21

    Signaling by the mammalian target of rapamycin (mTOR) has been reported to be necessary for mechanical load-induced growth of skeletal muscle. The mechanisms involved in the mechanical activation of mTOR signaling are not known, but several studies indicate that a unique [phosphotidylinositol-3-kinase (PI3K)- and nutrient-independent] mechanism is involved. In this study, we have demonstrated that a regulatory pathway for mTOR signaling that involves phospholipase D (PLD) and the lipid second messenger phosphatidic acid (PA) plays a critical role in the mechanical activation of mTOR signaling. First, an elevation in PA concentration was sufficient for the activation of mTOR signaling. Second, the isozymes of PLD (PLD1 and PLD2) are localized to the z-band in skeletal muscle (a critical site of mechanical force transmission). Third, mechanical stimulation of skeletal muscle with intermittent passive stretch ex vivo induced PLD activation, PA accumulation, and mTOR signaling. Finally, pharmacological inhibition of PLD blocked the mechanically induced increase in PA and the activation of mTOR signaling. Combined, these results indicate that mechanical stimuli activate mTOR signaling through a PLD-dependent increase in PA. Furthermore, we showed that mTOR signaling was partially resistant to rapamycin in muscles subjected to mechanical stimulation. Because rapamycin and PA compete for binding to the FRB domain on mTOR, these results suggest that mechanical stimuli activate mTOR signaling through an enhanced binding of PA to the FRB domain on mTOR.

  1. The role of phospholipase D and phosphatidic acid in the mechanical activation of mTOR signaling in skeletal muscle

    PubMed Central

    Hornberger, T. A.; Chu, W. K.; Mak, Y. W.; Hsiung, J. W.; Huang, S. A.; Chien, S.

    2006-01-01

    Signaling by the mammalian target of rapamycin (mTOR) has been reported to be necessary for mechanical load-induced growth of skeletal muscle. The mechanisms involved in the mechanical activation of mTOR signaling are not known, but several studies indicate that a unique [phosphotidylinositol-3-kinase (PI3K)- and nutrient-independent] mechanism is involved. In this study, we have demonstrated that a regulatory pathway for mTOR signaling that involves phospholipase D (PLD) and the lipid second messenger phosphatidic acid (PA) plays a critical role in the mechanical activation of mTOR signaling. First, an elevation in PA concentration was sufficient for the activation of mTOR signaling. Second, the isozymes of PLD (PLD1 and PLD2) are localized to the z-band in skeletal muscle (a critical site of mechanical force transmission). Third, mechanical stimulation of skeletal muscle with intermittent passive stretch ex vivo induced PLD activation, PA accumulation, and mTOR signaling. Finally, pharmacological inhibition of PLD blocked the mechanically induced increase in PA and the activation of mTOR signaling. Combined, these results indicate that mechanical stimuli activate mTOR signaling through a PLD-dependent increase in PA. Furthermore, we showed that mTOR signaling was partially resistant to rapamycin in muscles subjected to mechanical stimulation. Because rapamycin and PA compete for binding to the FRB domain on mTOR, these results suggest that mechanical stimuli activate mTOR signaling through an enhanced binding of PA to the FRB domain on mTOR. PMID:16537399

  2. A novel class of PTEN protein in Arabidopsis displays unusual phosphoinositide phosphatase activity and efficiently binds phosphatidic acid.

    PubMed

    Pribat, Anne; Sormani, Rodnay; Rousseau-Gueutin, Mathieu; Julkowska, Magdalena M; Testerink, Christa; Joubès, Jerôme; Castroviejo, Michel; Laguerre, Michel; Meyer, Christian; Germain, Véronique; Rothan, Christophe

    2012-01-01

    PTEN (phosphatase and tensin homologue deleted on chromosome ten) proteins are dual phosphatases with both protein and phosphoinositide phosphatase activity. They modulate signalling pathways controlling growth, metabolism and apoptosis in animals and are implied in several human diseases. In the present paper we describe a novel class of PTEN pro-teins in plants, termed PTEN2, which comprises the AtPTEN (Arabidopsis PTEN) 2a and AtPTEN2b proteins in Arabidopsis. Both display low in vitro tyrosine phosphatase activity. In addition, AtPTEN2a actively dephosphorylates in vitro the 3' phosphate group of PI3P (phosphatidylinositol 3-phosphate), PI(3,4)P2 (phosphatidylinositol 3,4-bisphosphate) and PI(3,5)P2 (phosphatidylinositol 3,5-bisphosphate). In contrast with animal PTENs, PI(3,4,5)P3 (phosphatidylinositol 3,4,5-trisphosphate) is a poor substrate. Site-directed mutagenesis of AtPTEN2a and molecular modelling of protein-phosphoinositide interactions indicated that substitutions at the PTEN2 core catalytic site of the Lys267 and Gly268 residues found in animals, which are critical for animal PTEN activity, by Met267 and Ala268 found in the eudicot PTEN2 are responsible for changes in substrate specificity. Remarkably, the AtPTEN2a protein also displays strong binding activity for PA (phosphatidic acid), a major lipid second messenger in plants. Promoter::GUS (β-glucuronidase) fusion, transcript and protein analyses further showed the transcriptional regulation of the ubiquitously expressed AtPTEN2a and AtPTEN2b by salt and osmotic stress. The results of the present study suggest a function for this novel class of plant PTEN proteins as an effector of lipid signalling in plants.

  3. Turnover of Phosphatidic Acid through Distinct Signaling Pathways Affects Multiple Aspects of Pollen Tube Growth in Tobacco.

    PubMed

    Pleskot, Roman; Pejchar, Přemysl; Bezvoda, Radek; Lichtscheidl, Irene K; Wolters-Arts, Mieke; Marc, Jan; Zárský, Viktor; Potocký, Martin

    2012-01-01

    Phosphatidic acid (PA) is an important intermediate in membrane lipid metabolism that acts as a key component of signaling networks, regulating the spatio-temporal dynamics of the endomembrane system and the cytoskeleton. Using tobacco pollen tubes as a model, we addressed the signaling effects of PA by probing the functions of three most relevant enzymes that regulate the production and degradation of PA, namely, phospholipases D (PLD), diacylglycerol kinases (DGKs), and lipid phosphate phosphatases (LPPs). Phylogenetic analysis indicated a highly dynamic evolution of all three lipid-modifying enzymes in land plants, with many clade-specific duplications or losses and massive diversification of the C2-PLD family. In silico transcriptomic survey revealed increased levels of expression of all three PA-regulatory genes in pollen development (particularly the DGKs). Using specific inhibitors we were able to distinguish the contributions of PLDs, DGKs, and LPPs into PA-regulated processes. Thus, suppressing PA production by inhibiting either PLD or DGK activity compromised membrane trafficking except early endocytosis, disrupted tip-localized deposition of cell wall material, especially pectins, and inhibited pollen tube growth. Conversely, suppressing PA degradation by inhibiting LPP activity using any of three different inhibitors significantly stimulated pollen tube growth, and similar effect was achieved by suppressing the expression of tobacco pollen LPP4 using antisense knock-down. Interestingly, inhibiting specifically DGK changed vacuolar dynamics and the morphology of pollen tubes, whereas inhibiting specifically PLD disrupted the actin cytoskeleton. Overall, our results demonstrate the critical importance of all three types of enzymes involved in PA production and degradation, with strikingly different roles of PA produced by the PLD and DGK pathways, in pollen tube growth.

  4. Evidence for coupling of Clostridium perfringens alpha-toxin-induced hemolysis to stimulated phosphatidic acid formation in rabbit erythrocytes.

    PubMed Central

    Sakurai, J; Ochi, S; Tanaka, H

    1993-01-01

    When rabbit erythrocytes were exposed to low concentrations of Clostridium perfringens alpha-toxin, hot-cold hemolysis was observed. The toxin induced production of phosphatidic acid (PA) in a dose-dependent manner when incubated with erythrocytes at 37 degrees C. When erythrocyte membranes were incubated with the toxin and [gamma-32P]ATP in the presence or absence of ethanol, [32P]PA formation was maximal within 30 s, then sharply decreased, and began again after 5 min of incubation. Ethanol had no effect on the early appearance (at approximately 5 min) of PA formation induced by the toxin but significantly inhibited formation of PA over 10 min of incubation. Treatment of erythrocyte membranes with alpha-toxin resulted in the biphasic formation of 1,2-diacylglycerol and PA as well as an increase of inositol-1,4,5-trisphosphate (IP3) and decrease of phosphatidylinositol-4,5-bisphosphate (PIP2) within 30 s. Neomycin inhibited the toxin-induced increase in turbidity of egg yolk suspensions but did not inhibit the toxin-induced hemolysis of intact erythrocytes. On the other hand, neomycin inhibited the toxin-induced hemolysis of saponin-treated erythrocytes. In addition, neomycin inhibited PA formation induced by the toxin in erythrocyte membranes. IP3 was released by incubation of PIP2 with erythrocyte membranes but not by incubation of PIP2 with the toxin. The toxin stimulated the membrane-induced release of IP3 from PIP2. These data suggest that the toxin-induced hemolysis is dependent on the action of phospholipase C in erythrocyte membranes. PMID:8395469

  5. Turnover of Phosphatidic Acid through Distinct Signaling Pathways Affects Multiple Aspects of Pollen Tube Growth in Tobacco

    PubMed Central

    Pleskot, Roman; Pejchar, Přemysl; Bezvoda, Radek; Lichtscheidl, Irene K.; Wolters-Arts, Mieke; Marc, Jan; Žárský, Viktor; Potocký, Martin

    2012-01-01

    Phosphatidic acid (PA) is an important intermediate in membrane lipid metabolism that acts as a key component of signaling networks, regulating the spatio-temporal dynamics of the endomembrane system and the cytoskeleton. Using tobacco pollen tubes as a model, we addressed the signaling effects of PA by probing the functions of three most relevant enzymes that regulate the production and degradation of PA, namely, phospholipases D (PLD), diacylglycerol kinases (DGKs), and lipid phosphate phosphatases (LPPs). Phylogenetic analysis indicated a highly dynamic evolution of all three lipid-modifying enzymes in land plants, with many clade-specific duplications or losses and massive diversification of the C2-PLD family. In silico transcriptomic survey revealed increased levels of expression of all three PA-regulatory genes in pollen development (particularly the DGKs). Using specific inhibitors we were able to distinguish the contributions of PLDs, DGKs, and LPPs into PA-regulated processes. Thus, suppressing PA production by inhibiting either PLD or DGK activity compromised membrane trafficking except early endocytosis, disrupted tip-localized deposition of cell wall material, especially pectins, and inhibited pollen tube growth. Conversely, suppressing PA degradation by inhibiting LPP activity using any of three different inhibitors significantly stimulated pollen tube growth, and similar effect was achieved by suppressing the expression of tobacco pollen LPP4 using antisense knock-down. Interestingly, inhibiting specifically DGK changed vacuolar dynamics and the morphology of pollen tubes, whereas inhibiting specifically PLD disrupted the actin cytoskeleton. Overall, our results demonstrate the critical importance of all three types of enzymes involved in PA production and degradation, with strikingly different roles of PA produced by the PLD and DGK pathways, in pollen tube growth. PMID:22639652

  6. Rapid phosphatidic acid accumulation in response to low temperature stress in Arabidopsis is generated through diacylglycerol kinase.

    PubMed

    Arisz, Steven A; van Wijk, Ringo; Roels, Wendy; Zhu, Jian-Kang; Haring, Michel A; Munnik, Teun

    2013-01-01

    Phosphatidic acid (PtdOH) is emerging as an important signaling lipid in abiotic stress responses in plants. The effect of cold stress was monitored using (32)P-labeled seedlings and leaf discs of Arabidopsis thaliana. Low, non-freezing temperatures were found to trigger a very rapid (32)P-PtdOH increase, peaking within 2 and 5 min, respectively. In principle, PtdOH can be generated through three different pathways, i.e., (1) via de novo phospholipid biosynthesis (through acylation of lyso-PtdOH), (2) via phospholipase D hydrolysis of structural phospholipids, or (3) via phosphorylation of diacylglycerol (DAG) by DAG kinase (DGK). Using a differential (32)P-labeling protocol and a PLD-transphosphatidylation assay, evidence is provided that the rapid (32)P-PtdOH response was primarily generated through DGK. A simultaneous decrease in the levels of (32)P-PtdInsP, correlating in time, temperature dependency, and magnitude with the increase in (32)P-PtdOH, suggested that a PtdInsP-hydrolyzing PLC generated the DAG in this reaction. Testing T-DNA insertion lines available for the seven DGK genes, revealed no clear changes in (32)P-PtdOH responses, suggesting functional redundancy. Similarly, known cold-stress mutants were analyzed to investigate whether the PtdOH response acted downstream of the respective gene products. The hos1, los1, and fry1 mutants were found to exhibit normal PtdOH responses. Slight changes were found for ice1, snow1, and the overexpression line Super-ICE1, however, this was not cold-specific and likely due to pleiotropic effects. A tentative model illustrating direct cold effects on phospholipid metabolism is presented.

  7. A Phosphatidic Acid (PA) conveyor system of continuous intracellular transport from cell membrane to nucleus maintains EGF receptor homeostasis.

    PubMed

    Henkels, Karen M; Miller, Taylor E; Ganesan, Ramya; Wilkins, Brandon A; Fite, Kristen; Gomez-Cambronero, Julian

    2016-07-26

    The intracellular concentration of the mitogen phosphatidic acid (PA) must be maintained at low levels until the need arises for cell proliferation. How temporal and spatial trafficking of PA affects its target proteins in the different cellular compartments is not fully understood. We report that in cancer cells, PA cycles back and forth from the cellular membrane to the nucleus, affecting the function of epidermal growth factor (EGF), in a process that involves PPARα/LXRα signaling. Upon binding to its ligand, EGF receptor (EGFR)-initiated activation of phospholipase D (PLD) causes a spike in intracellular PA production that forms vesicles transporting EGFR from early endosomes (EEA1 marker) and prolonged internalization in late endosomes and Golgi (RCAS marker). Cells incubated with fluorescent-labeled PA (NBD-PA) show PA in "diffuse" locations throughout the cytoplasm, punctae (small, <0.1 μm) vesicles) and large (>0.5 μm) vesicles that co-localize with EGFR. We also report that PPARα/LXRα form heterodimers that bind to new Responsive Elements (RE) in the EGFR promoter. Nuclear PA enhances EGFR expression, a role compatible with the mitogenic ability of the phospholipid. Newly made EGFR is packaged into PA recycling vesicles (Rab11 marker) and transported back to the cytoplasm and plasma membrane. However, a PLD+PA combination impedes binding of PPARα/LXRα to the EGFR promoter. Thus, if PA levels inside the nucleus reach a certain threshold (>100 nM) PA outcompetes the nuclear receptors and transcription is inhibited. This new signaling function of PLD-PA targeting EGFR trafficking and biphasically modulating its transcription, could explain cell proliferation initiation and its maintenance in cancer cells.

  8. Exercise-induced translocation of protein kinase C and production of diacylglycerol and phosphatidic acid in rat skeletal muscle in vivo. Relationship to changes in glucose transport.

    PubMed

    Cleland, P J; Appleby, G J; Rattigan, S; Clark, M G

    1989-10-25

    Contraction-induced translocation of protein kinase C (Richter E.A., Cleland, P.J.F., Rattigan, S., and Clark, M.G. (1987) FEBS Lett. 217, 232-236) implies a role for this enzyme in muscle contraction or the associated metabolic adjustments. In the present study, this role is further examined particularly in relation to changes in glucose transport. Electrical stimulation of the sciatic nerve of the anesthetized rat in vivo led to a time-dependent translocation of protein kinase C and a 2-fold increase in the concentrations of both diacylglycerol and phosphatidic acid. Maximum values for the latter were reached at 2 min and preceded the maximum translocation of protein kinase C (10 min). Stimulation of muscles in vitro increased the rate of glucose transport, but this required 20 min to reach maximum. There was no reversal of translocation or decrease in the concentrations of diacylglycerol and phosphatidic acid even after 30 min of rest following a 5-min period of stimulation in vivo. Translocation was not influenced by variations in applied load at maximal fiber recruitment but was dependent on the frequency of nontetanic stimuli, reaching a maximum at 4 Hz. The relationship between protein kinase C and glucose transport was also explored by varying the number of tetanic stimuli. Whereas only one train of stimuli (200 ms, 100 Hz) was required for maximal effects on protein kinase C, diacylglycerol, and phosphatidic acid, more than 35 trains of stimuli were required to activate glucose transport. It is concluded that the production of diacylglycerol and the translocation of protein kinase C may be causally related. However, if the translocated protein kinase C is involved in the activation of glucose transport during muscle contractions, an accumulated exposure to Ca2+, resulting from multiple contractions, would appear to be necessary.

  9. Identification of a soluble phosphatidate phosphohydrolase in the developing cotyledons of Morordica charantia

    USDA-ARS?s Scientific Manuscript database

    Phosphatidate phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4), which is also known as PAP, catalyzes the dephosphorylation of phosphatidate (PtdOH) to form diacylglycerol (DAG) and inorganic phosphate. In eukaryotes, PAP driven reaction is the committed step in the synthesis of triacy...

  10. Delta 6- and delta 12-desaturase activities and phosphatidic acid formation in microsomal preparations from the developing cotyledons of common borage (Borago officinalis).

    PubMed

    Griffiths, G; Stobart, A K; Stymne, S

    1988-06-15

    Microsomal membrane preparations from the maturing cotyledons of common borage (Borago officinalis) exhibit delta 12- and delta 6-desaturase activities, which resulted in the synthesis of linoleate and gamma-linolenate respectively. The desaturase enzymes utilized the complex lipid substrate phosphatidylcholine. The activity of these enzymes was sufficiently high to allow the monitoring of the mass changes in the endogenous oleate, linoleate and gamma-linolenate in the microsomal phosphatidylcholine in the presence of NADH (i.e. under desaturating conditions). The results illustrate that the delta 12-desaturase uses the oleate substrate at both the sn-1 and -2 positions of sn-phosphatidylcholine, whereas the delta 6-desaturase is almost totally restricted to the linoleate at position 2 of the complex lipid. Estimate of the acyl-substrate pool size at position 2 of sn-phosphatidylcholine for both desaturases indicated that some 50% of the oleate and linoleate was available to the enzymes. The microsomes (microsomal fractions) had a somewhat impaired Kennedy [(1961) Fed. Proc. Fed. Am. Soc. Exp. Biol. 20, 934-940] pathway for the formation of triacylglycerols when compared with other oil-rich plant species that have been studied [Stymne & Stobart (1987) The Biochemistry of Plants: a Comprehensive Treatise (Stumpf, P.K., ed.), vol. 10, chapter 8, pp. 175-214, Academic Press, New York]. In the presence of sn-glycerol 3-phosphate and acyl-CoA, large quantities of phosphatidic acid accumulated in the membranes. Acyl-selectivity studies on the glycerol-acylating enzymes showed that gamma-linolenate could be acylated to both the sn-1 and sn-2 positions of sn-glycerol 3-phosphate. However, stereochemical analysis of the acyl components of the sn-triacylglycerol obtained from mature seeds indicated that, whereas no gamma-linolenate was present at the sn-1 position, it accounted for over 50% of the fatty acids at position sn-3. The results indicate that the diacylglycerol

  11. Delta 6- and delta 12-desaturase activities and phosphatidic acid formation in microsomal preparations from the developing cotyledons of common borage (Borago officinalis).

    PubMed Central

    Griffiths, G; Stobart, A K; Stymne, S

    1988-01-01

    Microsomal membrane preparations from the maturing cotyledons of common borage (Borago officinalis) exhibit delta 12- and delta 6-desaturase activities, which resulted in the synthesis of linoleate and gamma-linolenate respectively. The desaturase enzymes utilized the complex lipid substrate phosphatidylcholine. The activity of these enzymes was sufficiently high to allow the monitoring of the mass changes in the endogenous oleate, linoleate and gamma-linolenate in the microsomal phosphatidylcholine in the presence of NADH (i.e. under desaturating conditions). The results illustrate that the delta 12-desaturase uses the oleate substrate at both the sn-1 and -2 positions of sn-phosphatidylcholine, whereas the delta 6-desaturase is almost totally restricted to the linoleate at position 2 of the complex lipid. Estimate of the acyl-substrate pool size at position 2 of sn-phosphatidylcholine for both desaturases indicated that some 50% of the oleate and linoleate was available to the enzymes. The microsomes (microsomal fractions) had a somewhat impaired Kennedy [(1961) Fed. Proc. Fed. Am. Soc. Exp. Biol. 20, 934-940] pathway for the formation of triacylglycerols when compared with other oil-rich plant species that have been studied [Stymne & Stobart (1987) The Biochemistry of Plants: a Comprehensive Treatise (Stumpf, P.K., ed.), vol. 10, chapter 8, pp. 175-214, Academic Press, New York]. In the presence of sn-glycerol 3-phosphate and acyl-CoA, large quantities of phosphatidic acid accumulated in the membranes. Acyl-selectivity studies on the glycerol-acylating enzymes showed that gamma-linolenate could be acylated to both the sn-1 and sn-2 positions of sn-glycerol 3-phosphate. However, stereochemical analysis of the acyl components of the sn-triacylglycerol obtained from mature seeds indicated that, whereas no gamma-linolenate was present at the sn-1 position, it accounted for over 50% of the fatty acids at position sn-3. The results indicate that the diacylglycerol

  12. Interaction of phosphatidic acid and phosphatidylserine with the Ca2+-ATPase of sarcoplasmic reticulum and the mechanism of inhibition.

    PubMed

    Dalton, K A; East, J M; Mall, S; Oliver, S; Starling, A P; Lee, A G

    1998-02-01

    The sarcoplasmic reticulum of skeletal muscle contains anionic phospholipids as well as the zwitterionic phosphatidylcholine and phosphatidylethanolamine. Here we study the effects of anionic phospholipids on the activity of the Ca2+-ATPase purified from the membrane. Reconstitution of the Ca2+-ATPase into dioleoylphosphatidylserine [di(C18:1)PS] or dioleoylphosphatidic acid [di(C18:1)PA] leads to a decrease in ATPase activity. Measurements of the quenching of the tryptophan fluorescence of the ATPase by brominated phospholipids give a relative binding constant for the anionic lipids compared with dioleoylphosphatidylcholine close to 1 and suggest that phosphatidic acid only binds to the ATPase at the bulk lipid sites around the ATPase. Addition of di(C18:1)PS or di(C18:1)PA to the ATPase in the short-chain dimyristoleoylphosphatidylcholine [di(C14:1)PC] reverse the effects of the short-chain lipid on ATPase activity and on Ca2+ binding, as revealed by the response of tryptophan fluorescence intensity to Ca2+ binding. It is concluded that the lipid headgroup and lipid fatty acyl chains have separate effects on the function of the ATPase. The anionic phospholipids have no significant effect on Ca2+ binding to the ATPase; the level of Ca2+ binding to the ATPase, the affinity of binding and the rate of dissociation of Ca2+ are unchanged by reconstitution into di(C18:1)PA. The major effect of the anionic lipids is a reduction in the maximal level of binding of MgATP. This is attributed to the formation of oligomers of the Ca2+-ATPase, in which only one molecule of the ATPase can bind MgATP dimers in di(C18:1)PS and trimers or tetramers in di(C18:1)PA. The rates of phosphorylation and dephosphorylation for the proportion of the ATPase still able to bind ATP are unaffected by reconstitution. Larger changes were observed in the level of phosphorylation of the ATPase by Pi, which became very low in the anionic phospholipids. The fluorescence response to Mg2+ for the ATPase

  13. Stimulation of insulin release by phospholipase D. A potential role for endogenous phosphatidic acid in pancreatic islet function.

    PubMed

    Metz, S A; Dunlop, M

    1990-09-01

    Although exogenous phosphatidic acid (PA) has been shown to promote insulin release, the effects of endogenous PA on endocrine function are largely unexplored. In order to generate PA in situ, intact adult-rat islets were treated with exogenous phospholipases of the D type (PLD), and their effects on phospholipid metabolism and on insulin release were studied in parallel. Chromatographically purified PLD from Streptomyces chromofuscus stimulated the accumulation of PA in [14C]arachidonate- or [14C]myristate-prelabelled islets, and also promoted insulin secretion over an identical concentration range. During 30 min incubations, insulin release correlated closely with the accumulation of [14C]arachidonate-labelled PA (r2 = 0.98; P less than 0.01) or [14C]myristate-labelled PA (r2 = 0.97; P less than 0.01). Similar effects were seen both in freshly isolated and in overnight-cultured intact islets. In contrast, PLDs (from cabbage or peanut) which do not support phospholipid hydrolysis at the pH of the extracellular medium also did not promote insulin release. The effects on secretion of the active PLD preparation were inhibited by modest cooling (to 30 degrees C); dantrolene or Co2+ also inhibited PLD-induced secretion without decreasing PLD-induced PA formation. Additionally, the removal of PLD left the subsequent islet responsiveness to glucose intact, further supporting an exocytotic non-toxic mechanism. PLD-induced insulin release did not appear to require influx of extracellular Ca2+, nor could the activation of protein kinase C clearly be implicated. During incubations of 30 min, PLD selectively generated PA; however, more prolonged incubations (60 min) also led to production of some diacyglycerol and free arachidonic acid concomitant with progressive insulin release. These data suggest that PLD activation has both rapid and direct effects (via PA) and more delayed, secondary, effects (via other effects of PA or the generation of other lipid signals). Taken in

  14. The basic amino acids in the coiled-coil domain of CIN85 regulate its interaction with c-Cbl and phosphatidic acid during epidermal growth factor receptor (EGFR) endocytosis.

    PubMed

    Zheng, Xiudan; Zhang, Jing; Liao, Kan

    2014-07-08

    During EGFR internalization CIN85 bridges EGFR-Cbl complex, endocytic machinery and fusible membrane through the interactions of CIN85 with c-Cbl, endophilins and phosphatidic acid. These protein-protein and protein-lipid interactions are mediated or regulated by the positively charged C-terminal coiled-coil domain of CIN85. However, the details of CIN85-lipid interaction remain unknown. The present study suggested a possible electric interaction between the negative charge of phosphatidic acid and the positive charge of basic amino acids in coiled-coil domain. Mutations of the basic amino acids in the coiled-coil domain, especially K645, K646, R648 and R650, into neutral amino acid alanine completely blocked the interaction of CIN85 with c-Cbl or phosphatidic acid. However, they did not affect CIN85-endophilin interaction. In addition, CIN85 was found to associate with the internalized EGFR endosomes. It interacted with several ESCRT (Endosomal Sorting Complex Required for Transport) component proteins for ESCRT assembly on endosomal membrane. Mutations in the coiled-coil domain (deletion of the coiled-coil domain or point mutations of the basic amino acids) dissociated CIN85 from endosomes. These mutants bound the ESCRT components in cytoplasm to prevent them from assembly on endosomal membrane and inhibited EGFR sorting for degradation. As an adaptor protein, CIN85 interacts with variety of partners through several domains. The positive charges of basic amino acids in the coiled-coil domain are not only involved in the interaction with phosphatidic acid, but also regulate the interaction of CIN85 with c-Cbl. CIN85 also interacts with ESCRT components for protein sorting in endosomes. These CIN85-protein and CIN85-lipid interactions enable CIN85 to link EGFR-Cbl endocytic complex with fusible membrane during EGFR endocytosis and subsequently to facilitate ESCRT formation on endosomal membrane for EGFR sorting and degradation.

  15. Increasing cellular level of phosphatidic acid enhances FGF-1 production in long term-cultured rat astrocytes.

    PubMed

    Nagayasu, Yuko; Morita, Shin-Ya; Hayashi, Hideki; Miura, Yutaka; Yokoyama, Kazuki; Michikawa, Makoto; Ito, Jin-Ichi

    2014-05-14

    We found in a previous study that both mRNA expression and release of fibroblast growth factor 1 (FGF-1) are greater in rat astrocytes that are long term-cultured for one month (W/M cells) than in the cells cultured for one week (W/W cells). However, FGF-1 does not enhance phosphorylation of Akt, MEK, and ERK in W/M cells, while it does in W/W cells. In this work we studied the mechanism to cause these differences between W/W and W/M cells in culture. As it is known that long term culture generates oxidative stress, we characterized the stresses which W/M cells undergo in comparison with W/W cells. The levels of superoxide dismutase 1 (SOD1) and mitochondrial Bax were higher in W/M cells than in W/W cells. W/M cells recovered their ability to respond to FGF-1 to enhance phosphorylation of Akt, MEK, and ERK in the presence of antioxidants. Oxidative stress induced by hydrogen peroxide (H2O2) had no effect on mRNA expression of FGF-1 in W/W cells, although H2O2 enhances release of FGF-1 from W/W cells without inducing apoptosis. The influence of cell density was studied on mRNA expression of FGF-1 and cellular response to FGF-1, as an increasing cell density is observed in W/M cells. The increasing cell density enhanced mRNA expression of FGF-1 in W/W cells without suppression of responses to FGF-1. The decrease in cell density lowered the FGF-1 mRNA expression in W/M cells without recovery of the response to FGF-1 to enhance phosphorylation of Akt, MEK, and ERK. These findings suggest that oxidative stress attenuate sensitivity to FGF-1 and higher cell density may enhance FGF-1 expression in W/M cells. In addition, we found that the cellular level of phosphatidic acid (PA) increased in H2O2-treated W/W and W/M cells and decreased by the treatment with antioxidants, and that PA enhances the mRNA expression of FGF-1 in the W/W cells. These findings suggest that the increasing PA production may enhance FGF-1 expression to protect astrocytes against oxidative stress

  16. Carbachol induces a rapid and sustained hydrolysis of polyphosphoinositide in bovine tracheal smooth muscle measurements of the mass of polyphosphoinositides, 1,2-diacylglycerol, and phosphatidic acid.

    PubMed

    Takuwa, Y; Takuwa, N; Rasmussen, H

    1986-11-05

    The effects of carbachol on polyphosphoinositides and 1,2-diacylglycerol metabolism were investigated in bovine tracheal smooth muscle by measuring both lipid mass and the turnover of [3H]inositol-labeled phosphoinositides. Carbachol induces a rapid reduction in the mass of phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate and a rapid increase in the mass of 1,2-diacylglycerol and phosphatidic acid. These changes in lipid mass are sustained for at least 60 min. The level of phosphatidylinositol shows a delayed and progressive decrease during a 60-min period of carbachol stimulation. The addition of atropine reverses these responses completely. Carbachol stimulates a rapid loss in [3H]inositol radioactivity from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate associated with production of [3H]inositol trisphosphate. The carbachol-induced change in the mass of phosphoinositides and phosphatidic acid is not affected by removal of extracellular Ca2+ and does not appear to be secondary to an increase in intracellular Ca2+. These results indicate that carbachol causes phospholipase C-mediated polyphosphoinositide breakdown, resulting in the production of inositol trisphosphate and a sustained increase in the actual content of 1,2-diacylglycerol. These results strongly suggest that carbachol-induced contraction is mediated by the hydrolysis of polyphosphoinositides with the resulting generation of two messengers: inositol 1,4,5-trisphosphate and 1,2-diacylglycerol.

  17. Carbachol induces a rapid and sustained hydrolysis of polyphosphoinositide in bovine tracheal smooth muscle measurements of the mass of polyphosphoinositides, 1,2-diacylglycerol, and phosphatidic acid

    SciTech Connect

    Takuwa, Y.; Takuwa, N.; Rasmussen, H.

    1986-11-05

    The effects of carbachol on polyphosphoinositides and 1,2-diacylglycerol metabolism were investigated in bovine tracheal smooth muscle by measuring both lipid mass and the turnover of (/sup 3/H)inositol-labeled phosphoinositides. Carbachol induces a rapid reduction in the mass of phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate and a rapid increase in the mass of 1,2-diacylglycerol and phosphatidic acid. These changes in lipid mass are sustained for at least 60 min. The level of phosphatidylinositol shows a delayed and progressive decrease during a 60-min period of carbachol stimulation. The addition of atropine reverses these responses completely. Carbachol stimulates a rapid loss in (/sup 3/H)inositol radioactivity from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate associated with production of (/sup 3/H)inositol trisphosphate. The carbachol-induced change in the mass of phosphoinositides and phosphatidic acid is not affected by removal of extracellular Ca/sup 2 +/ and does not appear to be secondary to an increase in intracellular Ca/sup 2 +/. These results indicate that carbachol causes phospholipase C-mediated polyphosphoinositide breakdown, resulting in the production of inositol trisphosphate and a sustained increase in the actual content of 1,2-diacylglycerol. These results strongly suggest that carbachol-induced contraction is mediated by the hydrolysis of polyphosphoinositides with the resulting generation of two messengers: inositol 1,4,5-trisphosphate and 1,2-diacylglycerol.

  18. Galectin-8 Induces Apoptosis in Jurkat T Cells by Phosphatidic Acid-mediated ERK1/2 Activation Supported by Protein Kinase A Down-regulation*

    PubMed Central

    Norambuena, Andrés; Metz, Claudia; Vicuña, Lucas; Silva, Antonia; Pardo, Evelyn; Oyanadel, Claudia; Massardo, Loreto; González, Alfonso; Soza, Andrea

    2009-01-01

    Galectins have been implicated in T cell homeostasis playing complementary pro-apoptotic roles. Here we show that galectin-8 (Gal-8) is a potent pro-apoptotic agent in Jurkat T cells inducing a complex phospholipase D/phosphatidic acid signaling pathway that has not been reported for any galectin before. Gal-8 increases phosphatidic signaling, which enhances the activity of both ERK1/2 and type 4 phosphodiesterases (PDE4), with a subsequent decrease in basal protein kinase A activity. Strikingly, rolipram inhibition of PDE4 decreases ERK1/2 activity. Thus Gal-8-induced PDE4 activation releases a negative influence of cAMP/protein kinase A on ERK1/2. The resulting strong ERK1/2 activation leads to expression of the death factor Fas ligand and caspase-mediated apoptosis. Several conditions that decrease ERK1/2 activity also decrease apoptosis, such as anti-Fas ligand blocking antibodies. In addition, experiments with freshly isolated human peripheral blood mononuclear cells, previously stimulated with anti-CD3 and anti-CD28, show that Gal-8 is pro-apoptotic on activated T cells, most likely on a subpopulation of them. Anti-Gal-8 autoantibodies from patients with systemic lupus erythematosus block the apoptotic effect of Gal-8. These results implicate Gal-8 as a novel T cell suppressive factor, which can be counterbalanced by function-blocking autoantibodies in autoimmunity. PMID:19276072

  19. Coupling of Fatty Acid and Phospholipid Synthesis in Bacillus subtilis▿

    PubMed Central

    Paoletti, Luciana; Lu, Ying-Jie; Schujman, Gustavo E.; de Mendoza, Diego; Rock, Charles O.

    2007-01-01

    plsX (acyl-acyl carrier protein [ACP]:phosphate acyltransferase), plsY (yneS) (acyl-phosphate:glycerol-phosphate acyltransferase), and plsC (yhdO) (acyl-ACP:1-acylglycerol-phosphate acyltransferase) function in phosphatidic acid formation, the precursor to membrane phospholipids. The physiological functions of these genes was inferred from their in vitro biochemical activities, and this study investigated their roles in gram-positive phospholipid metabolism through the analysis of conditional knockout strains in the Bacillus subtilis model system. The depletion of PlsX led to the cessation of both fatty acid synthesis and phospholipid synthesis. The inactivation of PlsY also blocked phospholipid synthesis, but fatty acid formation continued due to the appearance of acylphosphate intermediates and fatty acids arising from their hydrolysis. Phospholipid synthesis ceased following PlsC depletion, but fatty acid synthesis continued at a high rate, leading to the accumulation of fatty acids arising from the dephosphorylation of 1-acylglycerol-3-P followed by the deacylation of monoacylglycerol. Analysis of glycerol 3-P acylation in B. subtilis membranes showed that PlsY was an acylphosphate-specific acyltransferase, whereas PlsC used only acyl-ACP as an acyl donor. PlsX was found in the soluble fraction of disrupted cells but was associated with the cell membrane in intact organisms. These data establish that PlsX is a key enzyme that coordinates the production of fatty acids and membrane phospholipids in B. subtilis. PMID:17557823

  20. The effects of phosphatidic acid supplementation on strength, body composition, muscular endurance, power, agility, and vertical jump in resistance trained men.

    PubMed

    Escalante, Guillermo; Alencar, Michelle; Haddock, Bryan; Harvey, Phillip

    2016-01-01

    Phosphatidic acid (PA) is a lipid messenger that has been shown to increase muscle protein synthesis via signaling stimulation of the mammalian target of rapamycin (mTOR). MaxxTOR® (MT) is a supplement that contains PA as the main active ingredient but also contains other synergistic mTOR signaling substances including L-Leucine, Beta-Hydroxy-Beta-Methylbutyrate (HMB), and Vitamin D3. Eighteen healthy strength-trained males were randomly assigned to a group that either consumed MT (n = 8, 22.0 +/- 2.5 years; 175.8 +/- 11.5 cm; 80.3 +/- 15.1 kg) or a placebo (PLA) (n = 10, 25.6 +/- 4.2 years; 174.8 +/- 9.0 cm; 88.6 +/- 16.6 kg) as part of a double-blind, placebo controlled pre/post experimental design. All participants volunteered to complete the three day per week resistance training protocol for the eight week study duration. To determine the effects of MT, participants were tested on one repetition maximum (1RM) leg press strength (LP), 1RM bench press strength (BP), push-ups to failure (PU), vertical jump (VJ), pro-agility shuttle time (AG), peak power output (P), lean body mass (LBM), fat mass (FM), and thigh muscle mass (TMM). Subjects were placed and monitored on an isocaloric diet consisting of 25 protein, 50 carbohydrates, and 25 % fat by a registered dietitian. Separate two-way mixed factorial repeated measures ANOVA's (time [Pre, Post] x group [MT and PLA] were used to investigate strength, body composition, and other performance changes. Post-hoc tests were applied as appropriate. Analysis were performed via SPSS with significance at (p ≤ 0.05). There was a significant main effect (F(1,16) = 33.30, p < 0.001) for LBM where MT significantly increased LBM when compared to the PLA group (p < 0.001). Additionally, there was a significant main effect for LP (F(1,16) = 666.74, p < 0.001) and BP (F(1,16) = 126.36, p < 0.001) where both increased significantly more in MT than PLA group (p < 0.001). No

  1. Phospholipase D and phosphatidic acid in plant defence response: from protein-protein and lipid-protein interactions to hormone signalling.

    PubMed

    Zhao, Jian

    2015-04-01

    Phospholipase Ds (PLDs) and PLD-derived phosphatidic acids (PAs) play vital roles in plant hormonal and environmental responses and various cellular dynamics. Recent studies have further expanded the functions of PLDs and PAs into plant-microbe interaction. The molecular diversities and redundant functions make PLD-PA an important signalling complex regulating lipid metabolism, cytoskeleton dynamics, vesicle trafficking, and hormonal signalling in plant defence through protein-protein and protein-lipid interactions or hormone signalling. Different PLD-PA signalling complexes and their targets have emerged as fast-growing research topics for understanding their numerous but not yet established roles in modifying pathogen perception, signal transduction, and downstream defence responses. Meanwhile, advanced lipidomics tools have allowed researchers to reveal further the mechanisms of PLD-PA signalling complexes in regulating lipid metabolism and signalling, and their impacts on jasmonic acid/oxylipins, salicylic acid, and other hormone signalling pathways that essentially mediate plant defence responses. This review attempts to summarize the progress made in spatial and temporal PLD/PA signalling as well as PLD/PA-mediated modification of plant defence. It presents an in-depth discussion on the functions and potential mechanisms of PLD-PA complexes in regulating actin filament/microtubule cytoskeleton, vesicle trafficking, and hormonal signalling, and in influencing lipid metabolism-derived metabolites as critical signalling components in plant defence responses. The discussion puts PLD-PA in a broader context in order to guide future research.

  2. Phosphatidic acid and phosphoinositides facilitate liposome association of Yas3p and potentiate derepression of ARE1 (alkane-responsive element one)-mediated transcription control.

    PubMed

    Kobayashi, Satoshi; Hirakawa, Kiyoshi; Horiuchi, Hiroyuki; Fukuda, Ryouichi; Ohta, Akinori

    2013-12-01

    In the n-alkane assimilating yeast Yarrowia lipolytica, the expression of ALK1, encoding a cytochrome P450 that catalyzes terminal mono-oxygenation of n-alkanes, is induced by n-alkanes. The transcription of ALK1 is regulated by a heterocomplex that comprises the basic helix-loop-helix transcription activators, Yas1p and Yas2p, and binds to alkane-responsive element 1 (ARE1) in the ALK1 promoter. An Opi1 family transcription repressor, Yas3p, represses transcription by binding to Yas2p. Yas3p localizes in the nucleus when Y. lipolytica is grown on glucose but localizes to the endoplasmic reticulum (ER) upon the addition of n-alkanes. In this study, we showed that recombinant Yas3p binds to the acidic phospholipids, phosphatidic acid (PA) and phosphoinositides (PIPs), in vitro. The ARE1-mediated transcription was enhanced in vivo in mutants defective in an ortholog of the Saccharomyces cerevisiae gene PAH1, encoding PA phosphatase, and in an ortholog of SAC1, encoding PIP phosphatase in the ER. Truncation mutation analyses for Yas3p revealed two regions that bound to PA and PIPs. These results suggest that the interaction with acidic phospholipids is important for the n-alkane-induced association of Yas3p with the ER membrane.

  3. Phospholipase D and phosphatidic acid in plant defence response: from protein–protein and lipid–protein interactions to hormone signalling

    PubMed Central

    Zhao, Jian

    2015-01-01

    Phospholipase Ds (PLDs) and PLD-derived phosphatidic acids (PAs) play vital roles in plant hormonal and environmental responses and various cellular dynamics. Recent studies have further expanded the functions of PLDs and PAs into plant–microbe interaction. The molecular diversities and redundant functions make PLD–PA an important signalling complex regulating lipid metabolism, cytoskeleton dynamics, vesicle trafficking, and hormonal signalling in plant defence through protein–protein and protein–lipid interactions or hormone signalling. Different PLD–PA signalling complexes and their targets have emerged as fast-growing research topics for understanding their numerous but not yet established roles in modifying pathogen perception, signal transduction, and downstream defence responses. Meanwhile, advanced lipidomics tools have allowed researchers to reveal further the mechanisms of PLD–PA signalling complexes in regulating lipid metabolism and signalling, and their impacts on jasmonic acid/oxylipins, salicylic acid, and other hormone signalling pathways that essentially mediate plant defence responses. This review attempts to summarize the progress made in spatial and temporal PLD/PA signalling as well as PLD/PA-mediated modification of plant defence. It presents an in-depth discussion on the functions and potential mechanisms of PLD–PA complexes in regulating actin filament/microtubule cytoskeleton, vesicle trafficking, and hormonal signalling, and in influencing lipid metabolism-derived metabolites as critical signalling components in plant defence responses. The discussion puts PLD–PA in a broader context in order to guide future research. PMID:25680793

  4. Nonideal mixing and phase separation in phosphatidylcholine-phosphatidic acid mixtures as a function of acyl chain length and pH.

    PubMed Central

    Garidel, P; Johann, C; Blume, A

    1997-01-01

    The miscibilities of phosphatidic acids (PAs) and phosphatidylcholines (PCs) with different chain lengths (n = 14, 16) at pH 4, pH 7, and pH 12 were examined by differential scanning calorimetry. Simulation of heat capacity curves was performed using a new approach that incorporates changes of cooperativity of the transition in addition to nonideal mixing in the gel and the liquid-crystalline phase as a function of composition. From the simulations of the heat capacity curves, first estimates for the nonideality parameters for nonideal mixing as a function of composition were obtained, and phase diagrams were constructed using temperatures for onset and end of melting, which were corrected for the broadening effect caused by a decrease in cooperativity. In all cases the composition dependence of the nonideality parameters indicated nonsymmetrical mixing behavior. The phase diagrams were therefore further refined by simulations of the coexistence curves using a four-parameter approximation to account for nonideal and nonsymmetrical mixing in the gel and the liquid-crystalline phase. The mixing behavior was studied at three different pH values to investigate how changes in headgroup charge of the PA influences the miscibility. The experiments showed that at pH 7, where the PA component is negatively charged, the nonideality parameters are in most cases negative, indicating that electrostatic effects favor a mixing of the two components. Partial protonation of the PA component at pH 4 leads to strong changes in miscibility; the nonideality parameters for the liquid-crystalline phase are now in most cases positive, indicating clustering of like molecules. The phase diagram for 1,2-dimyristoyl-sn-glycero-3-phosphatidic acid:1,2-dipalmitoyl-sn-glycero-3-phosphorylcholine mixtures at pH 4 indicates that a fluid-fluid immiscibility is likely. The results show that a decrease in ionization of PAs can induce large changes in mixing behavior. This occurs because of a

  5. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  6. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

    PubMed

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-04-09

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

  7. Cyclic phosphatidic acid inhibits alkyl-glycerophosphate-induced downregulation of histone deacetylase 2 expression and suppresses the inflammatory response in human coronary artery endothelial cells.

    PubMed

    Tsukahara, Tamotsu; Haniu, Hisao; Matsuda, Yoshikazu

    2014-01-01

    Activation of the endothelium by alkyl-glycerophosphate (AGP) has been implicated in the development of atherosclerosis. Our previous study suggested that cyclic phosphatidic acid (cPA) inhibits arterial wall remodeling in a rat model in vivo. However, the mechanisms through which specific target genes are regulated during this process remain unclear. Here, we examined whether cPA inhibited AGP-induced expression of class I histone deacetylases (HDACs, namely HDAC1, HDAC2, HDAC3, and HDAC8), which may affect subsequent transcriptional activity of target genes. Our experimental results showed that human coronary artery endothelial cells (HCAECs) expressed high levels of HDAC2 and low levels HDAC1, HDAC3, and HDAC8. Moreover, AGP treatment induced downregulation of HDAC2 expression in HCAECs. However, cotreatment with cPA inhibited this downregulation of HDAC2 expression. Interestingly, treatment with AGP increased the expression and secretion of endogenous interleukin (IL)-6 and IL-8; however, this effect was inhibited when HCAECs were cotreated with cPA or the synthetic peroxisome proliferator-activator receptor gamma (PPARγ) antagonist T0070907. Thus, our data suggested that cPA may have beneficial effects in inflammation-related cardiovascular disease by controlling HDAC2 regulation.

  8. RNA Sequencing Identifies Upregulated Kyphoscoliosis Peptidase and Phosphatidic Acid Signaling Pathways in Muscle Hypertrophy Generated by Transgenic Expression of Myostatin Propeptide

    PubMed Central

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-01-01

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition. PMID:25860951

  9. Defense activation triggers differential expression of phospholipase-C (PLC) genes and elevated temperature induces phosphatidic acid (PA) accumulation in tomato

    PubMed Central

    Abd-El-Haliem, Ahmed; Meijer, Harold J.G.; Tameling, Wladimir I.L.; Vossen, Jack H.; Joosten, Matthieu H.A.J.

    2012-01-01

    Recently, we provided the first genetic evidence for the requirement of tomato PLC4 and PLC6 genes in defense activation and disease resistance. The encoded enzymes were catalytically active as they were able to degrade phosphatidylinositol (PI), thereby producing diacylglycerol (DG). Here we report differential PLC gene expression following the initiation of defense signaling by the interaction between Cladosporium fulvum resistance (R) protein Cf-4 and its matching effector Avr4 in tomato hybrid seedlings that express both Cf-4 and Avr4. Furthermore, we observed that PLC3 and PLC6 gene expression is upregulated by elevated temperature in the control seedlings. This upregulation coincides with an increase in the levels of phosphatidic acid (PA) and a decrease in the levels of PI and phosphatidylinositol phosphate (PIP). The decrease in PI and PIP levels matches with the activation of PLC. In addition, the levels of the structural phospholipids phosphatidylcholine (PC), phosphatidylethanolamine (PE) and phosphatidylglycerol (PG) declined transiently during recovery after the exposure to elevated temperature., Further studies will be required to explain the mechanism causing the sustained accumulation of PA during recovery, combined with a reduction in the levels of structural phospholipids. PMID:22899083

  10. Structural and Functional Studies of a Phosphatidic Acid-Binding Antifungal Plant Defensin MtDef4: Identification of an RGFRRR Motif Governing Fungal Cell Entry

    PubMed Central

    Buchko, Garry W.; Berg, Howard R.; Kaur, Jagdeep; Pandurangi, Raghu S.; Smith, Thomas J.; Shah, Dilip M.

    2013-01-01

    MtDef4 is a 47-amino acid cysteine-rich evolutionary conserved defensin from a model legume Medicago truncatula. It is an apoplast-localized plant defense protein that inhibits the growth of the ascomycetous fungal pathogen Fusarium graminearum in vitro at micromolar concentrations. Little is known about the mechanisms by which MtDef4 mediates its antifungal activity. In this study, we show that MtDef4 rapidly permeabilizes fungal plasma membrane and is internalized by the fungal cells where it accumulates in the cytoplasm. Furthermore, analysis of the structure of MtDef4 reveals the presence of a positively charged γ-core motif composed of β2 and β3 strands connected by a positively charged RGFRRR loop. Replacement of the RGFRRR sequence with AAAARR or RGFRAA abolishes the ability of MtDef4 to enter fungal cells, suggesting that the RGFRRR loop is a translocation signal required for the internalization of the protein. MtDef4 binds to phosphatidic acid (PA), a precursor for the biosynthesis of membrane phospholipids and a signaling lipid known to recruit cytosolic proteins to membranes. Amino acid substitutions in the RGFRRR sequence which abolish the ability of MtDef4 to enter fungal cells also impair its ability to bind PA. These findings suggest that MtDef4 is a novel antifungal plant defensin capable of entering into fungal cells and affecting intracellular targets and that these processes are mediated by the highly conserved cationic RGFRRR loop via its interaction with PA. PMID:24324798

  11. Phospholipase D-modified low density lipoprotein is taken up by macrophages at increased rate. A possible role for phosphatidic acid.

    PubMed Central

    Aviram, M; Maor, I

    1993-01-01

    Macrophage uptake of modified forms of LDL leads to cellular cholesterol accumulation. Upon incubation of LDL with phospholipase D (PLase D), a time- and enzyme dose-dependent production of phosphatidic acid (PA), paralleled by a rapid reduction in LDL phosphatidyl choline content (up to 65% within 15 min of incubation) was noted. No lipid peroxidation could be found in PLase D-modified LDL. Upon in vitro incubation of PLase D-LDL with copper ions, however, this modified LDL was substantially oxidized. The addition of 100 micrograms PA/ml to native LDL for the period of its in vitro oxidation resulted in a 63% elevation in the lipoprotein peroxides content. Incubation of PLase D-LDL with J-774A.1 macrophage-like cell line resulted in an increase in its cellular binding and degradation (up to 91 and 110%, respectively) in comparison with native LDL (via the LDL receptor). When PA was added to LDL before its incubation with the macrophages, a PA dose-dependent elevation in the cellular uptake of LDL (by up to twofold) was noted in comparison with LDL that was incubated without PA, suggesting that PA production in PLase D-LDL may be involved in the increased cellular uptake of PLase D-LDL. PLase D activity towards LDL was demonstrated in J-774A.1 macrophages. Human plasma was also shown to possess PLase D activity. Thus, PLase D modification of LDL may take place under certain pathological conditions and PLase D-LDL interaction with arterial wall macrophages can potentially lead to foam cell formation. PMID:8486764

  12. Eight Weeks of Phosphatidic Acid Supplementation in Conjunction with Resistance Training Does Not Differentially Affect Body Composition and Muscle Strength in Resistance-Trained Men.

    PubMed

    Andre, Thomas L; Gann, Joshua J; McKinley-Barnard, Sarah K; Song, Joon J; Willoughby, Darryn S

    2016-09-01

    This study attempted to determine the effects of eight weeks of resistance training (RT) combined with phosphatidic acid (PA) supplementation at a dose of either 250 mg or 375 mg on body composition and muscle size and strength. Twenty-eight resistance-trained men were randomly assigned to ingest 375 mg [PA375 (n = 9)] or 250 mg [PA250 (n = 9)] of PA or 375 mg of placebo [PLC (n = 10)] daily for eight weeks with RT. Supplements were ingested 60 minutes prior to RT and in the morning on non-RT days. Participants' body composition, muscle size, and lower-body muscle strength were determined before and after training/supplementation. Separate group x time ANOVAs for each criterion variable were used employing an alpha level of ≤ 0.05. Magnitude- based inferences were utilized to determine the likely or unlikely impact of PA on each criterion variable. A significant main effect for time was observed for improvements in total body mass (p = 0.003), lean mass (p = 0.008), rectus femoris cross-sectional area [RF CSA (p = 0.011)], and lower-body strength (p < 0.001), but no significant interactions were present (p > 0.05). Collectively, magnitude-based inferences determined both doses of PA to have a likely impact of increasing body mass (74.2%), lean mass (71.3%), RF CSA (92.2%), and very likely impact on increasing lower-body strength (98.1% beneficial). When combined with RT, it appears that PA has a more than likely impact on improving lower-body strength, whereas a likely impact exists for increasing muscle size and lean mass.

  13. Alpha 1-adrenergic receptor-mediated increase in the mass of phosphatidic acid and 1,2-diacylglycerol in ischemic rat heart.

    PubMed

    Kurz, T; Schneider, I; Tölg, R; Richardt, G

    1999-04-01

    1,2-Diacylglycerol (1,2-DAG) and phosphatidic acid (PA) are produced by phospholipase C and D activity and play a key role as second messengers in receptor-mediated signal transduction. So far, little is known about alterations of endogenous 1,2-DAG and PA production during myocardial ischemia. Rat isolated perfused hearts were subjected to global ischemia, total lipids were extracted, and separated by thin-layer chromatography. The mass of PA and 1,2-DAG were quantified using laserdensitometric analysis of visualized lipids. Compared to normoxic control values (1,2-DAG 713 +/- 45 ng/mg protein, PA 171 +/- 11 ng/mg protein), the myocardial content of 1,2-DAG and PA was unaltered after 10 min of ischemia. Prolonged myocardial ischemia (20 min), however, which was accompanied by marked overflow of endogenous norepinephrine, significantly increased the mass of both second messengers (1,2-DAG 1062 +/- 100 ng/mg protein, PA 340 +/- 29 ng/mg protein). The increase in PA and 1,2-DAG in response to ischemia was abolished by inhibition of ischemia-induced norepinephrine release as well as by alpha1-adrenergic blockade but unaffected by beta-adrenergic blockade. While inhibition of diacylglycerol kinase did not affect ischemia-induced increase in PA and 1,2-DAG, inhibition of phosphatidylinositol-specific phospholipase C activity significantly suppressed ischemia-induced increase in 1,2-DAG but did not affect endogenous production of PA indicating phospholipase C-independent formation of PA and activation of both, phospholipase C and D, in the ischemic heart. Ischemia elicits an alpha1-adrenergic receptor-mediated increase in the mass of myocardial PA and 1,2-DAG. The increase in endogenous PA is suggested to be due to the activation of myocardial phospholipase D, whereas 1,2-DAG is formed predominantly by activation of phospholipase C in the ischemic heart.

  14. Pulmonary Fibrosis Inducer, Bleomycin, Causes Redox-Sensitive Activation of Phospholipase D and Cytotoxicity Through Formation of Bioactive Lipid Signal Mediator, Phosphatidic Acid, in Lung Microvascular Endothelial Cells

    PubMed Central

    Patel, Rishi B.; Kotha, Sainath R.; Sherwani, Shariq I.; Sliman, Sean M.; Gurney, Travis O.; Loar, Brooke; Butler, Susan O’Connor; Morris, Andrew J.; Marsh, Clay B.; Parinandi, Narasimham L.

    2012-01-01

    The mechanisms of lung microvascular complications and pulmonary hypertension known to be associated with idiopathic pulmonary fibrosis (IPF), a debilitating lung disease, are not known. Therefore, we investigated whether bleomycin, the widely used experimental IPF inducer, would be capable of activating phospholipase D (PLD) and generating the bioactive lipid signal-mediator phosphatidic acid (PA) in our established bovine lung microvascular endothelial cell (BLMVEC) model. Our results revealed that bleomycin induced the activation of PLD and generation of PA in a dose-dependent (5, 10, and 100 μg) and time-dependent (2-12 hours) fashion that were significantly attenuated by the PLD-specific inhibitor, 5-fluoro-2-indolyl des-chlorohalopemide (FIPI). PLD activation and PA generation induced by bleomycin (5 μg) were significantly attenuated by the thiol protectant (N-acetyl-L-cysteine), antioxidants, and iron chelators suggesting the role of reactive oxygen species (ROS), lipid peroxidation, and iron therein. Furthermore, our study demonstrated the formation of ROS and loss of glutathione (GSH) in cells following bleomycin treatment, confirming oxidative stress as a key player in the bleomycin-induced PLD activation and PA generation in ECs. More noticeably, PLD activation and PA generation were observed to happen upstream of bleomycin-induced cytotoxicity in BLMVECs, which was protected by FIPI. This was also supported by our current findings that exposure of cells to exogenous PA led to internalization of PA and cytotoxicity in BLMVECs. For the first time, this study revealed novel mechanism of the bleomycin-induced redox-sensitive activation of PLD that led to the generation of PA, which was capable of inducing lung EC cytotoxicity, thus suggesting possible bioactive lipid-signaling mechanism/mechanisms of microvascular disorders encountered in IPF. PMID:21131602

  15. The catalytic domains of Clostridium sordellii lethal toxin and related large clostridial glucosylating toxins specifically recognize the negatively charged phospholipids phosphatidylserine and phosphatidic acid.

    PubMed

    Varela Chavez, Carolina; Hoos, Sylviane; Haustant, Georges Michel; Chenal, Alexandre; England, Patrick; Blondel, Arnaud; Pauillac, Serge; Lacy, D Borden; Popoff, Michel Robert

    2015-10-01

    Clostridium sordellii lethal toxin (TcsL) is a potent virulence factor belonging to the large clostridial glucosylating toxin family. TcsL enters target cells via receptor-mediated endocytosis and delivers the N-terminal catalytic domain (TcsL-cat) into the cytosol upon an autoproteolytic process. TcsL-cat inactivates small GTPases including Rac and Ras by glucosylation with uridine-diphosphate (UDP)-glucose as cofactor leading to drastic changes in cytoskeleton and cell viability. TcsL-cat was found to preferentially bind to phosphatidylserine (PS)-containing membranes and to increase the glucosylation of Rac anchored to lipid membrane. We here report binding affinity measurements of TcsL-cat for brain PS-containing membranes by surface plasmon resonance and enzyme-linked immunosorbent assay (ELISA). In addition, TcsL-cat bound to phosphatidic acid (PA) and, to a lesser extent, to other anionic lipids, but not to neutral lipids, sphingolipids or sterol. We further show that the lipid unsaturation status influenced TcsL-cat binding to phospholipids, PS with unsaturated acyl chains and PA with saturated acyl chains being the preferred bindingsubstrates. Phospholipid binding site is localized at the N-terminal four helical bundle structure (1-93 domain). However, TcsL-1-93 bound to a broad range of substrates, whereas TcsL-cat, which is the active domain physiologically delivered into the cytosol, selectively bound to PS and PA. Similar findings were observed with the other large clostridial glucosylating toxins from C. difficile, C. novyi and C. perfringens. © 2015 John Wiley & Sons Ltd.

  16. Structural Insights into the Inhibition of Actin-Capping Protein by Interactions with Phosphatidic Acid and Phosphatidylinositol (4,5)-Bisphosphate

    PubMed Central

    Pleskot, Roman; Pejchar, Přemysl; Žárský, Viktor; Staiger, Christopher J.; Potocký, Martin

    2012-01-01

    The actin cytoskeleton is a dynamic structure that coordinates numerous fundamental processes in eukaryotic cells. Dozens of actin-binding proteins are known to be involved in the regulation of actin filament organization or turnover and many of these are stimulus-response regulators of phospholipid signaling. One of these proteins is the heterodimeric actin-capping protein (CP) which binds the barbed end of actin filaments with high affinity and inhibits both addition and loss of actin monomers at this end. The ability of CP to bind filaments is regulated by signaling phospholipids, which inhibit the activity of CP; however, the exact mechanism of this regulation and the residues on CP responsible for lipid interactions is not fully resolved. Here, we focus on the interaction of CP with two signaling phospholipids, phosphatidic acid (PA) and phosphatidylinositol (4,5)-bisphosphate (PIP2). Using different methods of computational biology such as homology modeling, molecular docking and coarse-grained molecular dynamics, we uncovered specific modes of high affinity interaction between membranes containing PA/phosphatidylcholine (PC) and plant CP, as well as between PIP2/PC and animal CP. In particular, we identified differences in the binding of membrane lipids by animal and plant CP, explaining previously published experimental results. Furthermore, we pinpoint the critical importance of the C-terminal part of plant CPα subunit for CP–membrane interactions. We prepared a GST-fusion protein for the C-terminal domain of plant α subunit and verified this hypothesis with lipid-binding assays in vitro. PMID:23133367

  17. The FKBP-rapamycin binding domain of human TOR undergoes strong conformational changes in the presence of membrane mimetics with and without the regulator phosphatidic acid.

    PubMed

    Rodriguez Camargo, Diana C; Link, Nina M; Dames, Sonja A

    2012-06-19

    The Ser/Thr kinase target of rapamycin (TOR) is a central controller of cellular growth and metabolism. Misregulation of TOR signaling is involved in metabolic and neurological disorders and tumor formation. TOR can be inhibited by association of a complex of rapamycin and FKBP12 to the FKBP12-rapamycin binding (FRB) domain. This domain was further proposed to interact with phosphatidic acid (PA), a lipid second messenger present in cellular membranes. Because mammalian TOR has been localized at various cellular membranes and in the nucleus, the output of TOR signaling may depend on its localization, which is expected to be influenced by the interaction with complex partners and regulators in response to cellular signals. Here, we present a detailed characterization of the interaction of the FRB domain with PA and how it is influenced by the surrounding membrane environment. On the basis of nuclear magnetic resonance- and circular dichroism-monitored binding studies using different neutral and negatively charged lipids as well as different membrane mimetics (micelles, bicelles, and liposomes), the FRB domain may function as a conditional peripheral membrane protein. However, the data for the isolated domain just indicate an increased affinity for negatively charged lipids and membrane patches but no specific preference for PA or PA-enriched regions. The membrane-mimetic environment induces strong conformational changes that largely maintain the α-helical secondary structure content but presumably disperse the helices in the lipidic environment. Consistent with overlapping binding surfaces for different lipids and the FKBP12-rapamycin complex, binding of the inhibitor complex protects the FRB domain from interactions with membrane mimetics at lower lipid concentrations.

  18. The lysine-rich motif of intrinsically disordered stress protein CDeT11-24 from Craterostigma plantagineum is responsible for phosphatidic acid binding and protection of enzymes from damaging effects caused by desiccation

    PubMed Central

    Röhrig, Horst

    2012-01-01

    The late embryogenesis abundant (LEA)-like protein CDeT11-24 is one of the major desiccation-related phosphoproteins of the resurrection plant Craterostigma plantagineum. In this study, it was shown that CDeT11-24 is mostly intrinsically disordered and protects two different enzymes, citrate synthase and lactate dehydrogenase, against damaging effects caused by desiccation. Lipid-binding assays revealed that CDeT11-24 is able to interact with phosphatidic acid, although electrostatic repulsion was expected due to the overall negative net charge of the protein under the tested physiological conditions. CDeT11-24 carries an N-terminal lysine-rich sequence, which is predicted to form an amphipathic α-helix. Analysis of the truncated CDeT11-24 protein identified this region to be responsible for both activities: enzyme protection and phosphatidic acid interaction. Possible functions of the CDeT11-24 protein are discussed in the context of desiccation tolerance. Abbreviations:ABAabscisic acid;CDcircular dichroism;CScitrate synthase;IDPintrinsically disordered protein;LDHlactate dehydrogenase;LEAlate embryogenesis abundant;PAphosphatidic acid;PCphosphatidylcholine;TFEtrifluoroethanol. PMID:22791833

  19. The acylation of sn-glycerol 3-phosphate and the metabolism of phosphatidate in microsomal preparations from the developing cotyledons of safflower (Carthamus tinctorius L.) seed.

    PubMed

    Griffiths, G; Stobart, A K; Stymne, S

    1985-09-01

    Microsomal preparations from the developing cotyledons of safflower (Carthamus tinctorius) catalysed the acylation of sn-glycerol 3-phosphate in the presence of acyl-CoA. The resulting phosphatidate was further utilized in the synthesis of diacyl- and tri-acylglycerol by the reactions of the so-called 'Kennedy pathway' [Kennedy (1961) Fed. Proc. Fed. Am. Soc. Exp. Biol. 20, 934-940]. Diacylglycerol equilibrated with the phosphatidylcholine pool when glycerol backbone, with the associated acyl groups, flowed from phosphatidate to triacylglycerol. The formation of diacylglycerol from phosphatidate through the action of a phosphatidate phosphohydrolase (phosphatidase) was substantially inhibited by EDTA and, under these conditions, phosphatidate accumulated in the microsomal membranes. The inhibition of the phosphatidase by EDTA was alleviated by Mg2+. The presence of Mg2+ in all incubation mixtures stimulated quite considerably the synthesis of triacylglycerol in vitro. Microsomal preparations incubated with acyl-CoA, sn-glycerol 3-phosphate and EDTA synthesized sufficient phosphatidate for the reliable analysis of its intramolecular fatty acid distribution. In the presence of mixed acyl-CoA substrates the sn-glycerol 3-phosphate was acylated exclusively in position 1 with the saturated fatty acids, palmitate and stearate. The polyunsaturated fatty acid linoleate was, however, utilized largely in the acylation of position 2 of sn-glycerol 3-phosphate. The affinity of the enzymes involved in the acylation of positions 1 and 2 of sn-glycerol 3-phosphate for specific species of acyl-CoA therefore governs the non-random distribution of the different acyl groups in the seed triacylglycerols. The acylation of sn-glycerol 3-phosphate in position 1 with saturated acyl components also accounts for the presence of these groups in position 1 of sn-phosphatidylcholine through the equilibration of diacylglycerol with the phosphatidylcholine pool, which occurs when phosphatidate

  20. The acylation of sn-glycerol 3-phosphate and the metabolism of phosphatidate in microsomal preparations from the developing cotyledons of safflower (Carthamus tinctorius L.) seed.

    PubMed Central

    Griffiths, G; Stobart, A K; Stymne, S

    1985-01-01

    Microsomal preparations from the developing cotyledons of safflower (Carthamus tinctorius) catalysed the acylation of sn-glycerol 3-phosphate in the presence of acyl-CoA. The resulting phosphatidate was further utilized in the synthesis of diacyl- and tri-acylglycerol by the reactions of the so-called 'Kennedy pathway' [Kennedy (1961) Fed. Proc. Fed. Am. Soc. Exp. Biol. 20, 934-940]. Diacylglycerol equilibrated with the phosphatidylcholine pool when glycerol backbone, with the associated acyl groups, flowed from phosphatidate to triacylglycerol. The formation of diacylglycerol from phosphatidate through the action of a phosphatidate phosphohydrolase (phosphatidase) was substantially inhibited by EDTA and, under these conditions, phosphatidate accumulated in the microsomal membranes. The inhibition of the phosphatidase by EDTA was alleviated by Mg2+. The presence of Mg2+ in all incubation mixtures stimulated quite considerably the synthesis of triacylglycerol in vitro. Microsomal preparations incubated with acyl-CoA, sn-glycerol 3-phosphate and EDTA synthesized sufficient phosphatidate for the reliable analysis of its intramolecular fatty acid distribution. In the presence of mixed acyl-CoA substrates the sn-glycerol 3-phosphate was acylated exclusively in position 1 with the saturated fatty acids, palmitate and stearate. The polyunsaturated fatty acid linoleate was, however, utilized largely in the acylation of position 2 of sn-glycerol 3-phosphate. The affinity of the enzymes involved in the acylation of positions 1 and 2 of sn-glycerol 3-phosphate for specific species of acyl-CoA therefore governs the non-random distribution of the different acyl groups in the seed triacylglycerols. The acylation of sn-glycerol 3-phosphate in position 1 with saturated acyl components also accounts for the presence of these groups in position 1 of sn-phosphatidylcholine through the equilibration of diacylglycerol with the phosphatidylcholine pool, which occurs when phosphatidate

  1. Roles of phosphatidate phosphatase enzymes in lipid metabolism

    PubMed Central

    Carman, George M.; Han, Gil-Soo

    2006-01-01

    Phosphatidate phosphatase (PAP) enzymes catalyze the dephosphorylation of phosphatidate, yielding diacylglycerol and inorganic phosphate. In eukaryotic cells, PAP activity has a central role in the synthesis of phospholipids and triacylglycerol through its product diacylglycerol, and it also generates and/or degrades lipid-signaling molecules that are related to phosphatidate. There are two types of PAP enzyme, Mg2+ dependent (PAP1) and Mg2+ independent (PAP2), but only genes encoding PAP2 enzymes had been identified until recently, when a gene (PAH1) encoding a PAP1 enzyme was found in Saccharomyces cerevisiae. This discovery has revealed a molecular function of the mammalian protein lipin, a deficiency of which causes lipodystrophy in mice. With molecular information now available for both types of PAP, the specific roles of these enzymes in lipid metabolism are being clarified. PMID:17079146

  2. Eight Weeks of Phosphatidic Acid Supplementation in Conjunction with Resistance Training Does Not Differentially Affect Body Composition and Muscle Strength in Resistance-Trained Men

    PubMed Central

    Andre, Thomas L.; Gann, Joshua J.; McKinley-Barnard, Sarah K.; Song, Joon J.; Willoughby, Darryn S.

    2016-01-01

    This study attempted to determine the effects of eight weeks of resistance training (RT) combined with phosphatidic acid (PA) supplementation at a dose of either 250 mg or 375 mg on body composition and muscle size and strength. Twenty-eight resistance-trained men were randomly assigned to ingest 375 mg [PA375 (n = 9)] or 250 mg [PA250 (n = 9)] of PA or 375 mg of placebo [PLC (n = 10)] daily for eight weeks with RT. Supplements were ingested 60 minutes prior to RT and in the morning on non-RT days. Participants’ body composition, muscle size, and lower-body muscle strength were determined before and after training/supplementation. Separate group x time ANOVAs for each criterion variable were used employing an alpha level of ≤ 0.05. Magnitude- based inferences were utilized to determine the likely or unlikely impact of PA on each criterion variable. A significant main effect for time was observed for improvements in total body mass (p = 0.003), lean mass (p = 0.008), rectus femoris cross-sectional area [RF CSA (p = 0.011)], and lower-body strength (p < 0.001), but no significant interactions were present (p > 0.05). Collectively, magnitude-based inferences determined both doses of PA to have a likely impact of increasing body mass (74.2%), lean mass (71.3%), RF CSA (92.2%), and very likely impact on increasing lower-body strength (98.1% beneficial). When combined with RT, it appears that PA has a more than likely impact on improving lower-body strength, whereas a likely impact exists for increasing muscle size and lean mass. Key points In response to eight weeks resistance training and PLC and PA (375 mg and 250 mg) supplementation, similar increases in lower-body muscle strength occurred in all three groups; however, the increases were not different between supplement groups. In response to eight weeks resistance training and PLC and PA (375 mg and 250 mg) supplementation, similar increases in lean mass occurred in all three groups; however, the increases were

  3. The lysine-rich motif of intrinsically disordered stress protein CDeT11-24 from Craterostigma plantagineum is responsible for phosphatidic acid binding and protection of enzymes from damaging effects caused by desiccation.

    PubMed

    Petersen, Jan; Eriksson, Sylvia K; Harryson, Pia; Pierog, Steffen; Colby, Thomas; Bartels, Dorothea; Röhrig, Horst

    2012-08-01

    The late embryogenesis abundant (LEA)-like protein CDeT11-24 is one of the major desiccation-related phosphoproteins of the resurrection plant Craterostigma plantagineum. In this study, it was shown that CDeT11-24 is mostly intrinsically disordered and protects two different enzymes, citrate synthase and lactate dehydrogenase, against damaging effects caused by desiccation. Lipid-binding assays revealed that CDeT11-24 is able to interact with phosphatidic acid, although electrostatic repulsion was expected due to the overall negative net charge of the protein under the tested physiological conditions. CDeT11-24 carries an N-terminal lysine-rich sequence, which is predicted to form an amphipathic α-helix. Analysis of the truncated CDeT11-24 protein identified this region to be responsible for both activities: enzyme protection and phosphatidic acid interaction. Possible functions of the CDeT11-24 protein are discussed in the context of desiccation tolerance.

  4. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  5. Liposomes bi-functionalized with phosphatidic acid and an ApoE-derived peptide affect Aβ aggregation features and cross the blood-brain-barrier: implications for therapy of Alzheimer disease.

    PubMed

    Bana, Laura; Minniti, Stefania; Salvati, Elisa; Sesana, Silvia; Zambelli, Vanessa; Cagnotto, Alfredo; Orlando, Antonina; Cazzaniga, Emanuela; Zwart, Rob; Scheper, Wiep; Masserini, Massimo; Re, Francesca

    2014-10-01

    Targeting amyloid-β peptide (Aβ) within the brain is a strategy actively sought for therapy of Alzheimer's disease (AD). We investigated the ability of liposomes bi-functionalized with phosphatidic acid and with a modified ApoE-derived peptide (mApoE-PA-LIP) to affect Aβ aggregation/disaggregation features and to cross in vitro and in vivo the blood-brain barrier (BBB). Surface plasmon resonance showed that bi-functionalized liposomes strongly bind Aβ (kD=0.6 μM), while Thioflavin-T and SDS-PAGE/WB assays show that liposomes inhibit peptide aggregation (70% inhibition after 72 h) and trigger the disaggregation of preformed aggregates (60% decrease after 120 h incubation). Moreover, experiments with dually radiolabelled LIP suggest that bi-functionalization enhances the passage of radioactivity across the BBB either in vitro (permeability=2.5×10(-5) cm/min, 5-fold higher with respect to mono-functionalized liposomes) or in vivo in healthy mice. Taken together, our results suggest that mApoE-PA-LIP are valuable nanodevices with a potential applicability in vivo for the treatment of AD. From the clinical editor: Bi-functionalized liposomes with phosphatidic acid and a modified ApoE-derived peptide were demonstrated to influence Aβ aggregation/disaggregation as a potential treatment in an Alzheimer's model. The liposomes were able to cross the blood-brain barrier in vitro and in vivo. Similar liposomes may become clinically valuable nanodevices with a potential applicability for the treatment of Alzheimer's disease. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  7. Conjugated Fatty Acid Synthesis

    PubMed Central

    Rawat, Richa; Yu, Xiao-Hong; Sweet, Marie; Shanklin, John

    2012-01-01

    Conjugated linolenic acids (CLNs), 18:3 Δ9,11,13, lack the methylene groups found between the double bonds of linolenic acid (18:3 Δ9,12,15). CLNs are produced by conjugase enzymes that are homologs of the oleate desaturases FAD2. The goal of this study was to map the domain(s) within the Momordica charantia conjugase (FADX) responsible for CLN formation. To achieve this, a series of Momordica FADX-Arabidopsis FAD2 chimeras were expressed in the Arabidopsis fad3fae1 mutant, and the transformed seeds were analyzed for the accumulation of CLN. These experiments identified helix 2 and the first histidine box as a determinant of conjugase product partitioning into punicic acid (18:3 Δ9cis,11trans,13cis) or α-eleostearic acid (18:3 Δ9cis,11trans,13trans). This was confirmed by analysis of a FADX mutant containing six substitutions in which the sequence of helix 2 and first histidine box was converted to that of FAD2. Each of the six FAD2 substitutions was individually converted back to the FADX equivalent identifying residues 111 and 115, adjacent to the first histidine box, as key determinants of conjugase product partitioning. Additionally, expression of FADX G111V and FADX G111V/D115E resulted in an approximate doubling of eleostearic acid accumulation to 20.4% and 21.2%, respectively, compared with 9.9% upon expression of the native Momordica FADX. Like the Momordica conjugase, FADX G111V and FADX D115E produced predominantly α-eleostearic acid and little punicic acid, but the FADX G111V/D115E double mutant produced approximately equal amounts of α-eleostearic acid and its isomer, punicic acid, implicating an interactive effect of residues 111 and 115 in punicic acid formation. PMID:22451660

  8. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  9. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  10. Hydrothermal synthesis of amino acids

    NASA Astrophysics Data System (ADS)

    Marshall, William L.

    1994-05-01

    This study presents further evidence that amino acids can be synthesized rapidly in hydrothermal solutions from reactants that may have been present in primitive environments. Aqueous NH 4HCO 3 solutions were reacted with C 2H 2, H 2, and O 2 (formed in situ from CaC 2, Ca, and H 2O 2) at 200-275°C over 0.2-2 h periods to synthesize several amino acids and abundant amines. These amino acid and amine producing reactions were not observed to occur below 150°C. Amino acids and amines also were synthesized at 210°C from solutions of NH 4OH, HCHO, NaCN, and H 2. When NH 4OH was replaced by NH 4HCO 3, the syntheses predominantly confirmed the recent results of RENNET et al. (1992). Additionally, amino acids and amines were observed to form by reactions among NH 4OH, HCHO, and H 2 at hydrothermal conditions, essentially confirming the results of FOX and WINDSOR (1970). Inclusion of both carbonate and O 2 in these latter solutions greatly enhanced the production rate of amino acids. The amines synthesized hydrothermally could be significant if they are precursors in the amino acid syntheses either at hydrothermal or later at lower temperatures. These observations provide additional input to the current questions of synthesis, stability, and decomposition of amino acids at hydrothermal conditions, and their possible relevance to the origin of life.

  11. Effect of BN 52021, a specific antagonist of platelet activating factor (PAF-acether), on calcium movements and phosphatidic acid production induced by PAF-acether in human platelets

    SciTech Connect

    Simon, M.F.; Chap, H.; Braquet, P.; Douste-Blazy, L.

    1987-02-15

    /sup 32/P-labelled human platelets loaded with quin 2 and pretreated with aspirin were stimulated with 1-100 nM platelet activating factor (PAF-acether or 1-0-alkyl-2-acetyl-sn-glycero-3-phosphocholine) in a medium containing the ADP-scavenging system creatine phosphate/creatine phosphokinase. Under these conditions, PAF-acether evoked a characteristic fluorescence change allowing to quantify elevations in cytoplasmic free Ca/sup 2 +/ from internal stores (Ca/sup 2 +/ mobilization) or from external medium (Ca/sup 2 +/ influx), as well as an increased production of phosphatidic acid, reflecting phospholipase C activation. These effects, which can be attributed to PAF-acether only and not to released products such as ADP or thromboxane A2, were strongly inhibited in a dose-dependent manner by BN 52021, a specific antagonist of PAF-acether isolated from Ginkgo biloba. As the drug remained inactive against the same effects elicited by thrombin, it is concluded that BN 52021 does not interfere directly with the mechanism of transmembrane signalling involving inositol-phospholipids or (and) some putative receptor-operated channels, but rather acts on the binding of PAF-acether to its presumed membrane receptor.

  12. Acetylglyceryl ether phosphorylcholine (AGEPC; platelet-activating factor)-induced stimulation of rabbit platelets: correlation between phosphatidic acid level, 45Ca2+ uptake, and (3H)serotonin secretion

    SciTech Connect

    Shukla, S.D.; Hanahan, D.J.

    1984-08-01

    When 32P-labeled rabbits platelet were incubated with 5 X 10(-10) M 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine (AGEPC), either in the presence or absence (0.1 mM EGTA) of added Ca2+, there was a three- to five-fold increase in the (32P)phosphatidic acid (PA) pool within 15 to 20 s. This event was followed by a gradual decrease in the (32P)PA level to near basal level in 5 min. AGEPC effected this change in (32P)PA in a characteristic dose- and time-dependent manner. Polar head group analogs of AGEPC, such as AGEDME and AGEMME, also effected an increase in PA labeling at levels comparable to those previously reported for their activity toward rabbit platelets. Other analogs, i.e., lysoGEPC and the enantiomer, sn-1-AGEPC, which are inactive toward rabbit platelets, also showed no effect on the level of (32P)PA. The finding that the PA level in rabbit platelets could be manipulated by the addition of AGEPC, without any added Ca2+, provided an excellent model system for establishing a correlation between the uptake of Ca2+, serotonin release, and PA level. Thus, PA must be regarded as a sensitive indicator of a reaction mechanism important to the platelet response to AGEPC, and could be the focal point in promoting calcium uptake during the stimulation process.

  13. Cloning and characterization of a novel human phosphatidic acid phosphatase type 2, PAP2d, with two different transcripts PAP2d_v1 and PAP2d_v2.

    PubMed

    Sun, Liyun; Gu, Shaohua; Sun, Yaqiong; Zheng, Dan; Wu, Qihan; Li, Xin; Dai, Jianfeng; Dai, Jianliang; Ji, Chaoneng; Xie, Yi; Mao, Yumin

    2005-04-01

    This study reports the cloning and characterization of a novel human phosphatidic acid phosphatase type 2 isoform cDNAs (PAP2d) from the foetal brain cDNA library. The PAP2d gene is localized on chromosome 1p21.3. It contains six exons and spans 112 kb of the genomic DNA. By large-scale cDNA sequencing we found two splice variants of PAP2d, PAP2d_v1 and PAP2d_v2. The PAP2d_v1 cDNA is 1722 bp in length and spans an open reading frame from nucleotide 56 to 1021, encoding a 321aa protein. The PAP2d_v2 cDNA is 1707 bp in length encoding a 316aa protein from nucleotide 56-1006. The PAP2d_v1 cDNA is 15 bp longer than the PAP2d_v2 cDNA in the terminal of the fifth exon and it creates different ORF. Both of the proteins contain a well-conserved PAP2 motif. The PAP2d_v1 is mainly expressed in human brain, lung, kidney, testis and colon, while PAP2d_v2 is restricted to human placenta, skeletal muscle, and kidney. The two splice variants are co-expressed only in kidney.

  14. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  15. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Printable PDF Open All ... view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  16. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Printable PDF Open All ... view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  17. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  18. Lipin-1 phosphatidic phosphatase activity modulates phosphatidate levels to promote peroxisome proliferator-activated receptor γ (PPARγ) gene expression during adipogenesis.

    PubMed

    Zhang, Peixiang; Takeuchi, Kazuharu; Csaki, Lauren S; Reue, Karen

    2012-01-27

    Adipose tissue plays a key role in metabolic homeostasis. Disruption of the Lpin1 gene encoding lipin-1 causes impaired adipose tissue development and function in rodents. Lipin-1 functions as a phosphatidate phosphatase (PAP) enzyme in the glycerol 3-phosphate pathway for triglyceride storage and as a transcriptional coactivator/corepressor for metabolic nuclear receptors. Previous studies established that lipin-1 is required at an early step in adipocyte differentiation for induction of the adipogenic gene transcription program, including the key regulator peroxisome proliferator-activated receptor γ (PPARγ). Here, we investigate the requirement of lipin-1 PAP versus coactivator function in the establishment of Pparg expression during adipocyte differentiation. We demonstrate that PAP activity supplied by lipin-1, lipin-2, or lipin-3, but not lipin-1 coactivator activity, can rescue Pparg gene expression and lipogenesis during adipogenesis in lipin-1-deficient preadipocytes. In adipose tissue from lipin-1-deficient mice, there is an accumulation of phosphatidate species containing a range of medium chain fatty acids and an activation of the MAPK/extracellular signal-related kinase (ERK) signaling pathway. Phosphatidate inhibits differentiation of cultured adipocytes, and this can be rescued by the expression of lipin-1 PAP activity or by inhibition of ERK signaling. These results emphasize the importance of lipid intermediates as choreographers of gene regulation during adipogenesis, and the results highlight a specific role for lipins as determinants of levels of a phosphatidic acid pool that influences Pparg expression.

  19. Identification of an Mg2+-independent soluble phosphatidate phosphatase in cottonseed (Gossypium hirsutum L.)

    USDA-ARS?s Scientific Manuscript database

    Cotton (Gossypium hirsutum L.) provides a major source of oil for food and feed industries, but little was known about the oil biosynthesis pathway in cottonseed. Towards understanding the biochemical pathway of oil accumulation in cottonseed, this study focused on phosphatidic acid phosphatase (PAP...

  20. A soy-based phosphatidylserine/ phosphatidic acid complex (PAS) normalizes the stress reactivity of hypothalamus-pituitary-adrenal-axis in chronically stressed male subjects: a randomized, placebo-controlled study.

    PubMed

    Hellhammer, Juliane; Vogt, Dominic; Franz, Nadin; Freitas, Ulla; Rutenberg, David

    2014-07-31

    Supplementation with a phosphatidylserine and phosphatidylserine/ phosphatidic acid complex (PAS) has been observed to normalize stress induced dysregulations of the hypothalamus-pituitary-adrenal axis (HPAA). Prolonged stress first induces a hyper-activation of the HPAA, which then can be followed by a state of hypo-activation.The aim of this study was to examine effects of an oral supplementation with 400 mg PS & 400 mg PA (PAS 400) per day on the endocrine stress response (ACTH, saliva and serum cortisol) to a psychosocial stressor. A special focus was to analyze subgroups of low versus high chronically stressed subjects as well as to test efficacy of 200 mg PS & 200 mg PA (PAS 200). 75 healthy male volunteers were enrolled for this double-blind, placebo-controlled study, stratified by chronic stress level, and randomly allocated to one of three study arms (placebo, PAS 200 and PAS 400 per day, respectively). Study supplementation was administered for 42 days for each participant. Chronic stress was measured with the Trier Inventory for Chronic Stress (TICS), and subgroups of high and low chronic stress were differentiated by median values as provided by the TICS authors. A six week period of supplementation was followed by an acute stress test (Trier Social Stress Test - TSST). Chronic stress levels and other baseline measures did not differ between treatment groups (all p>0.05). Acute stress was successfully induced by the TSST and resulted in a hyper-responsivity of the HPAA in chronically stressed subjects. Compared to placebo, a supplementation with a daily dose of PAS 400 was effective in normalizing the ACTH (p=0.010), salivary (p=0.043) and serum cortisol responses (p=0.035) to the TSST in chronically high but not in low stressed subjects (all p>0.05). Compared to placebo, supplementation with PAS 200 did not result in any significant differences in these variables (all p>0.05). There were no significant effects of supplementation with PAS on heart rate

  1. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  2. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  3. Effects of acetylcholine and other agents on /sup 32/P-prelabeled phosphoinositides and phosphatidate in crude synaptosomal preparations

    SciTech Connect

    White, H.L.

    1988-05-01

    Experimental conditions are described which permit effects of various agents on polyphosphoinositides and phosphatidic acid (PA) to be evaluated simultaneously in crude nerve-ending preparations from rat brain. Acetylcholine (3-100 microM) or carbachol (30-1,000 microM) induced the hydrolysis of prelabeled polyphosphoinositides and, at the same time, stimulated the net label incorporated in phosphatidic acid. All muscarinic effects were blocked by atropine or pirenzepine. Non-muscarinic agonists (glutamate, adenosine, norepinephrine) stimulated polyphosphoinositide hydrolysis in this preparation, but of these only norepinephrine affected phosphatidic acid turnover. A potentiation of acetylcholine-induced phosphoinositide turnover by KCl was observed, as well as an apparent selective inhibition of PIP2 hydrolysis by LiCl. Acetylcholine-stimulated turnover of PA was not necessarily coupled to phosphoinositide hydrolysis.

  4. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  5. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  6. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  7. Colorimetric Determination of Pure Mg2+-dependent Phosphatidate Phosphatase Activity

    PubMed Central

    Havriluk, Tara; Lozy, Fred; Siniossoglou, Symeon; Carman, George M.

    2008-01-01

    The malachite green-molybdate reagent was used for a colorimetric assay of pure Mg2+-dependent phosphatidate phosphatase activity. This enzyme plays a major role in fat metabolism. Enzyme activity was linear with time and protein concentration, and with the concentration of water-soluble dioctanoyl phosphatidate. The colorimetric assay was used to examine enzyme inhibition by phenylglyoxal, propranolol, and dimethyl sulfoxide. Pure enzyme and a water-soluble phosphatidate substrate were required for the assay, which should be applicable to a well-defined large-scale screen of Mg2+-dependent phosphatidate phosphatase inhibitors (or activators). PMID:17910939

  8. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  9. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  10. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  11. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  12. Phosphorylation of Yeast Pah1 Phosphatidate Phosphatase by Casein Kinase II Regulates Its Function in Lipid Metabolism*

    PubMed Central

    Hsieh, Lu-Sheng; Su, Wen-Min; Han, Gil-Soo; Carman, George M.

    2016-01-01

    Pah1 phosphatidate phosphatase in Saccharomyces cerevisiae catalyzes the penultimate step in the synthesis of triacylglycerol (i.e. the production of diacylglycerol by dephosphorylation of phosphatidate). The enzyme playing a major role in lipid metabolism is subject to phosphorylation (e.g. by Pho85-Pho80, Cdc28-cyclin B, and protein kinases A and C) and dephosphorylation (e.g. by Nem1-Spo7) that regulate its cellular location, catalytic activity, and stability/degradation. In this work, we show that Pah1 is a substrate for casein kinase II (CKII); its phosphorylation was time- and dose-dependent and was dependent on the concentrations of Pah1 (Km = 0.23 μm) and ATP (Km = 5.5 μm). By mass spectrometry, truncation analysis, site-directed mutagenesis, phosphopeptide mapping, and phosphoamino acid analysis, we identified that >90% of its phosphorylation occurs on Thr-170, Ser-250, Ser-313, Ser-705, Ser-814, and Ser-818. The CKII-phosphorylated Pah1 was a substrate for the Nem1-Spo7 protein phosphatase and was degraded by the 20S proteasome. The prephosphorylation of Pah1 by protein kinase A or protein kinase C reduced its subsequent phosphorylation by CKII. The prephosphorylation of Pah1 by CKII reduced its subsequent phosphorylation by protein kinase A but not by protein kinase C. The expression of Pah1 with combined mutations of S705D and 7A, which mimic its phosphorylation by CKII and lack of phosphorylation by Pho85-Pho80, caused an increase in triacylglycerol content and lipid droplet number in cells expressing the Nem1-Spo7 phosphatase complex. PMID:27044741

  13. Phosphorylation of Yeast Pah1 Phosphatidate Phosphatase by Casein Kinase II Regulates Its Function in Lipid Metabolism.

    PubMed

    Hsieh, Lu-Sheng; Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2016-05-06

    Pah1 phosphatidate phosphatase in Saccharomyces cerevisiae catalyzes the penultimate step in the synthesis of triacylglycerol (i.e. the production of diacylglycerol by dephosphorylation of phosphatidate). The enzyme playing a major role in lipid metabolism is subject to phosphorylation (e.g. by Pho85-Pho80, Cdc28-cyclin B, and protein kinases A and C) and dephosphorylation (e.g. by Nem1-Spo7) that regulate its cellular location, catalytic activity, and stability/degradation. In this work, we show that Pah1 is a substrate for casein kinase II (CKII); its phosphorylation was time- and dose-dependent and was dependent on the concentrations of Pah1 (Km = 0.23 μm) and ATP (Km = 5.5 μm). By mass spectrometry, truncation analysis, site-directed mutagenesis, phosphopeptide mapping, and phosphoamino acid analysis, we identified that >90% of its phosphorylation occurs on Thr-170, Ser-250, Ser-313, Ser-705, Ser-814, and Ser-818. The CKII-phosphorylated Pah1 was a substrate for the Nem1-Spo7 protein phosphatase and was degraded by the 20S proteasome. The prephosphorylation of Pah1 by protein kinase A or protein kinase C reduced its subsequent phosphorylation by CKII. The prephosphorylation of Pah1 by CKII reduced its subsequent phosphorylation by protein kinase A but not by protein kinase C. The expression of Pah1 with combined mutations of S705D and 7A, which mimic its phosphorylation by CKII and lack of phosphorylation by Pho85-Pho80, caused an increase in triacylglycerol content and lipid droplet number in cells expressing the Nem1-Spo7 phosphatase complex. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Mitochondrial fatty acid synthesis and respiration.

    PubMed

    Hiltunen, J Kalervo; Autio, Kaija J; Schonauer, Melissa S; Kursu, V A Samuli; Dieckmann, Carol L; Kastaniotis, Alexander J

    2010-01-01

    Recent studies have revealed that mitochondria are able to synthesize fatty acids in a malonyl-CoA/acyl carrier protein (ACP)-dependent manner. This pathway resembles bacterial fatty acid synthesis (FAS) type II, which uses discrete, nuclearly encoded proteins. Experimental evidence, obtained mainly through using yeast as a model system, indicates that this pathway is essential for mitochondrial respiratory function. Curiously, the deficiency in mitochondrial FAS cannot be complemented by inclusion of fatty acids in the culture medium or by products of the cytosolic FAS complex. Defects in mitochondrial FAS in yeast result in the inability to grow on nonfermentable carbon sources, the loss of mitochondrial cytochromes a/a3 and b, mitochondrial RNA processing defects, and loss of cellular lipoic acid. Eukaryotic FAS II generates octanoyl-ACP, a substrate for mitochondrial lipoic acid synthase. Endogenous lipoic acid synthesis challenges the hypothesis that lipoic acid can be provided as an exogenously supplied vitamin. Purified eukaryotic FAS II enzymes are catalytically active in vitro using substrates with an acyl chain length of up to 16 carbon atoms. However, with the exception of 3-hydroxymyristoyl-ACP, a component of respiratory complex I in higher eukaryotes, the fate of long-chain fatty acids synthesized by the mitochondrial FAS pathway remains an enigma. The linkage of FAS II genes to published animal models for human disease supports the hypothesis that mitochondrial FAS dysfunction leads to the development of disorders in mammals.

  15. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  16. Chemical Synthesis of Modified Hyaluronic Acid Disaccharides.

    PubMed

    Mende, Marco; Nieger, Martin; Bräse, Stefan

    2017-09-07

    Herein we report a chemical synthesis towards new modified hyaluronic acid oligomers by using only commercially available d-glucose and d-glucosamine hydrochloride. The various protected hyaluronic acid disaccharides were synthesized bearing new functional groups at C-6 of the β-d-glucuronic acid moiety with a view to structure-related biological activity tests. The orthogonal protecting group pattern allows ready access to the corresponding higher oligomers. Also, (1) H NMR studies of the new derivatives demonstrated the effect of the various functional groups on the intramolecular electronic environment. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  18. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  19. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  20. Rates and Products of Long-Chain Fatty Acid Synthesis from [1-14C]Acetate in Chloroplasts Isolated from Leaves of 16:3 and 18:3 Plants

    PubMed Central

    Gardiner, Susan E.; Heinz, Ernst; Roughan, P. Grattan

    1984-01-01

    Chloroplasts highly active in the synthesis of long-chain fatty acids from [1-14C]acetate were prepared from leaves of Solanum nodiflorum, Chenopodium quinoa, Carthamus tinctorius, and Pisum sativum. These preparations were used to test whether the various additions to incubation media found to stimulate the synthesis of particular lipid classes in vitro by Spinacia oleracea chloroplasts were applicable generally. Chloroplasts from 18:3 plants incorporated a greater proportion of radioactivity into unesterified fatty acids under control conditions than did those from 16:3 plants. Supplying exogenous sn-glycerol 3-phosphate or Triton X-100 to chloroplasts increased the synthesis of glycerolipids in all cases and accentuated the capacity of chloroplasts from 18:3 plants to accumulate phosphatidic acid rather than the diacylglycerol accumulated by chloroplasts from 16:3 plants. The UDP-galactose-dependent synthesis of labeled diacylgalactosylglycerol was much less active in incubations of chloroplasts from 18:3 plants also containing sn-glycerol 3-phosphate and Triton X-100 compared with similar incubations from 16:3 plants. Exogenous CoA stimulated total fatty acid synthesis in all chloroplast preparations and the further addition of ATP diverted radioactivity from the unesterified fatty acid to acyl-CoA. The results have been discussed in terms of the two pathway hypothesis for lipid synthesis in leaves. Images Fig. 2 PMID:16663528

  1. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  2. Total Synthesis of (-)-Nahuoic Acid Ci (Bii).

    PubMed

    Liu, Qi; Deng, Yifan; Smith, Amos B

    2017-09-21

    A convergent total synthesis of (-)-nahuoic acid Ci(Bii) (3), a novel cis-decalin polyketide, has been achieved. Key synthetic transformations include Type II Anion Relay Chemistry (ARC) to construct the polyol chain, a Ti-catalyzed asymmetric Diels-Alder reaction to generate the cis-decalin skeleton, and a late-stage large fragment union exploiting a Micalizio alkoxide-directed alkyne-alkene coupling tactic.

  3. Resynthesis of phosphatidylinositol in permeabilized neutrophils following phospholipase Cbeta activation: transport of the intermediate, phosphatidic acid, from the plasma membrane to the endoplasmic reticulum for phosphatidylinositol resynthesis is not dependent on soluble lipid carriers or vesicular transport.

    PubMed Central

    Whatmore, J; Wiedemann, C; Somerharju, P; Swigart, P; Cockcroft, S

    1999-01-01

    Receptor-mediated phospholipase C (PLC) hydrolysis of phosphoinositides is accompanied by the resynthesis of phosphatidylinositol (PI). Hydrolysis of phosphoinositides occurs at the plasma membrane, and the resulting diacylglycerol (DG) is converted into phosphatidate (PA). Two enzymes located at the endoplasmic reticulum (ER) function sequentially to convert PA back into PI. We have established an assay whereby the resynthesis of PI could be followed in permeabilized cells. In the presence of [gamma-32P]ATP, DG generated by PLC activation accumulates label when converted into PA. The 32P-labelled PA is subsequently converted into labelled PI. The formation of labelled PI reports the arrival of labelled PA from the plasma membrane to the ER. Cytosol-depleted, permeabilized human neutrophils are capable of PI resynthesis following stimulation of PLCbeta (in the presence of phosphatidylinositol-transfer protein), provided that CTP and inositol are also present. We also found that wortmannin, an inhibitor of endocytosis, or cooling the cells to 15 degrees C did not stop PI resynthesis. We conclude that PI resynthesis is dependent neither on vesicular transport mechanisms nor on freely diffusible, soluble transport proteins. Phosphatidylcholine-derived PA generated by the ADP-ribosylation-factor-stimulated phospholipase D pathway was found to accumulate label, reflecting the rapid cycling of PA to DG, and back. This labelled PA was not converted into PI. We conclude that PA derived from the PLC pathway is selected for PI resynthesis, and its transfer to the ER could be membrane-protein-mediated at sites of close membrane contact. PMID:10393103

  4. Synthesis of phosphatidylcholine under possible primitive earth conditions

    NASA Technical Reports Server (NTRS)

    Rao, M.; Eichberg, J.; Oro, J.

    1982-01-01

    Using a primitive earth evaporating pond model, the synthesis of phosphatidylcholine was accomplished when a reaction mixture of choline chloride and disodium phosphatidate, in the presence of cyanamide and traces of acid, was evaporated and heated at temperatures ranging from 25 to 100 C for 7 hours. Optimum yields of about 15% were obtained at 80 C. Phosphatidylcholine was identified by chromatographic, chemical and enzymatic degradation methods. On enzymatic hydrolysis with phospholipase A2 and phospholipase C, lysophosphatidylcholine and phosphorylcholine were formed, respectively. Alkaline hydrolysis gave glycerophosphorylcholine. The synthesis of phosphatidylcholine as the major compound was accompanied by the formation of lysophosphatidylcholine in smaller amounts. Cyanamide was found to be essential for the formation of phosphatidylcholine, and only traces of HCl, of the order of that required to convert the disodium phosphatidate to free phosphatidic acid were found necessary for the synthesis. This work suggests that phosphatidylcholine, which is an essential component of most biological membranes, could have been synthesized on the primitive earth.

  5. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  6. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  7. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  8. The synthesis and transformations of uronic acid nucleosides

    NASA Astrophysics Data System (ADS)

    Timoshchuk, V. A.

    1994-08-01

    The results of studies on the synthesis and transformations of uronic acid nucleosides are surveyed. Various pathways leading to the synthesis of uronic acid nucleoside are examined, including methods involving specific and nonspecific oxidation of nucleosides, and the glycosylation and modification of the sugar residue or the heterocyclic base. The bibliography includes 97 references.

  9. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  10. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  11. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  12. Phosphorylation Regulates the Ubiquitin-independent Degradation of Yeast Pah1 Phosphatidate Phosphatase by the 20S Proteasome*

    PubMed Central

    Hsieh, Lu-Sheng; Su, Wen-Min; Han, Gil-Soo; Carman, George M.

    2015-01-01

    Saccharomyces cerevisiae Pah1 phosphatidate phosphatase, which catalyzes the conversion of phosphatidate to diacylglycerol for triacylglycerol synthesis and simultaneously controls phosphatidate levels for phospholipid synthesis, is subject to the proteasome-mediated degradation in the stationary phase of growth. In this study, we examined the mechanism for its degradation using purified Pah1 and isolated proteasomes. Pah1 expressed in S. cerevisiae or Escherichia coli was not degraded by the 26S proteasome, but by its catalytic 20S core particle, indicating that its degradation is ubiquitin-independent. The degradation of Pah1 by the 20S proteasome was dependent on time and proteasome concentration at the pH optimum of 7.0. The 20S proteasomal degradation was conserved for human lipin 1 phosphatidate phosphatase. The degradation analysis using Pah1 truncations and its fusion with GFP indicated that proteolysis initiates at the N- and C-terminal unfolded regions. The folded region of Pah1, in particular the haloacid dehalogenase-like domain containing the DIDGT catalytic sequence, was resistant to the proteasomal degradation. The structural change of Pah1, as reflected by electrophoretic mobility shift, occurs through its phosphorylation by Pho85-Pho80, and the phosphorylation sites are located within its N- and C-terminal unfolded regions. Phosphorylation of Pah1 by Pho85-Pho80 inhibited its degradation, extending its half-life by ∼2-fold. The dephosphorylation of endogenously phosphorylated Pah1 by the Nem1-Spo7 protein phosphatase, which is highly specific for the sites phosphorylated by Pho85-Pho80, stimulated the 20S proteasomal degradation and reduced its half-life by 2.6-fold. These results indicate that the proteolysis of Pah1 by the 20S proteasome is controlled by its phosphorylation state. PMID:25809482

  13. Phosphorylation regulates the ubiquitin-independent degradation of yeast Pah1 phosphatidate phosphatase by the 20S proteasome.

    PubMed

    Hsieh, Lu-Sheng; Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2015-05-01

    Saccharomyces cerevisiae Pah1 phosphatidate phosphatase, which catalyzes the conversion of phosphatidate to diacylglycerol for triacylglycerol synthesis and simultaneously controls phosphatidate levels for phospholipid synthesis, is subject to the proteasome-mediated degradation in the stationary phase of growth. In this study, we examined the mechanism for its degradation using purified Pah1 and isolated proteasomes. Pah1 expressed in S. cerevisiae or Escherichia coli was not degraded by the 26S proteasome, but by its catalytic 20S core particle, indicating that its degradation is ubiquitin-independent. The degradation of Pah1 by the 20S proteasome was dependent on time and proteasome concentration at the pH optimum of 7.0. The 20S proteasomal degradation was conserved for human lipin 1 phosphatidate phosphatase. The degradation analysis using Pah1 truncations and its fusion with GFP indicated that proteolysis initiates at the N- and C-terminal unfolded regions. The folded region of Pah1, in particular the haloacid dehalogenase-like domain containing the DIDGT catalytic sequence, was resistant to the proteasomal degradation. The structural change of Pah1, as reflected by electrophoretic mobility shift, occurs through its phosphorylation by Pho85-Pho80, and the phosphorylation sites are located within its N- and C-terminal unfolded regions. Phosphorylation of Pah1 by Pho85-Pho80 inhibited its degradation, extending its half-life by ∼2-fold. The dephosphorylation of endogenously phosphorylated Pah1 by the Nem1-Spo7 protein phosphatase, which is highly specific for the sites phosphorylated by Pho85-Pho80, stimulated the 20S proteasomal degradation and reduced its half-life by 2.6-fold. These results indicate that the proteolysis of Pah1 by the 20S proteasome is controlled by its phosphorylation state. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Yeast Pah1p phosphatidate phosphatase is regulated by proteasome-mediated degradation.

    PubMed

    Pascual, Florencia; Hsieh, Lu-Sheng; Soto-Cardalda, Aníbal; Carman, George M

    2014-04-04

    Yeast PAH1-encoded phosphatidate phosphatase is the enzyme responsible for the production of the diacylglycerol used for the synthesis of triacylglycerol that accumulates in the stationary phase of growth. Paradoxically, the growth phase-mediated inductions of PAH1 and phosphatidate phosphatase activity do not correlate with the amount of Pah1p; enzyme abundance declined in a growth phase-dependent manner. Pah1p from exponential phase cells was a relatively stable protein, and its abundance was not affected by incubation with an extract from stationary phase cells. Recombinant Pah1p was degraded upon incubation with the 100,000 × g pellet fraction of stationary phase cells, although the enzyme was stable when incubated with the same fraction of exponential phase cells. MG132, an inhibitor of proteasome function, prevented degradation of the recombinant enzyme. Endogenously expressed and plasmid-mediated overexpressed levels of Pah1p were more abundant in the stationary phase of cells treated with MG132. Pah1p was stabilized in mutants with impaired proteasome (rpn4Δ, blm10Δ, ump1Δ, and pre1 pre2) and ubiquitination (hrd1Δ, ubc4Δ, ubc7Δ, ubc8Δ, and doa4Δ) functions. The pre1 pre2 mutations that eliminate nearly all chymotrypsin-like activity of the 20 S proteasome had the greatest stabilizing effect on enzyme levels. Taken together, these results supported the conclusion that Pah1p is subject to proteasome-mediated degradation in the stationary phase. That Pah1p abundance was stabilized in pah1Δ mutant cells expressing catalytically inactive forms of Pah1p and dgk1Δ mutant cells with induced expression of DGK1-encoded diacylglycerol kinase indicated that alteration in phosphatidate and/or diacylglycerol levels might be the signal that triggers Pah1p degradation.

  15. Yeast Pah1p Phosphatidate Phosphatase Is Regulated by Proteasome-mediated Degradation*

    PubMed Central

    Pascual, Florencia; Hsieh, Lu-Sheng; Soto-Cardalda, Aníbal; Carman, George M.

    2014-01-01

    Yeast PAH1-encoded phosphatidate phosphatase is the enzyme responsible for the production of the diacylglycerol used for the synthesis of triacylglycerol that accumulates in the stationary phase of growth. Paradoxically, the growth phase-mediated inductions of PAH1 and phosphatidate phosphatase activity do not correlate with the amount of Pah1p; enzyme abundance declined in a growth phase-dependent manner. Pah1p from exponential phase cells was a relatively stable protein, and its abundance was not affected by incubation with an extract from stationary phase cells. Recombinant Pah1p was degraded upon incubation with the 100,000 × g pellet fraction of stationary phase cells, although the enzyme was stable when incubated with the same fraction of exponential phase cells. MG132, an inhibitor of proteasome function, prevented degradation of the recombinant enzyme. Endogenously expressed and plasmid-mediated overexpressed levels of Pah1p were more abundant in the stationary phase of cells treated with MG132. Pah1p was stabilized in mutants with impaired proteasome (rpn4Δ, blm10Δ, ump1Δ, and pre1 pre2) and ubiquitination (hrd1Δ, ubc4Δ, ubc7Δ, ubc8Δ, and doa4Δ) functions. The pre1 pre2 mutations that eliminate nearly all chymotrypsin-like activity of the 20 S proteasome had the greatest stabilizing effect on enzyme levels. Taken together, these results supported the conclusion that Pah1p is subject to proteasome-mediated degradation in the stationary phase. That Pah1p abundance was stabilized in pah1Δ mutant cells expressing catalytically inactive forms of Pah1p and dgk1Δ mutant cells with induced expression of DGK1-encoded diacylglycerol kinase indicated that alteration in phosphatidate and/or diacylglycerol levels might be the signal that triggers Pah1p degradation. PMID:24563465

  16. Apicoplast-Localized Lysophosphatidic Acid Precursor Assembly Is Required for Bulk Phospholipid Synthesis in Toxoplasma gondii and Relies on an Algal/Plant-Like Glycerol 3-Phosphate Acyltransferase

    PubMed Central

    Callahan, Damien L.; Dubois, David; van Dooren, Giel G.; Shears, Melanie J.; Cesbron-Delauw, Marie-France; Maréchal, Eric; McConville, Malcolm J.; McFadden, Geoffrey I.; Yamaryo-Botté, Yoshiki; Botté, Cyrille Y.

    2016-01-01

    Most apicomplexan parasites possess a non-photosynthetic plastid (the apicoplast), which harbors enzymes for a number of metabolic pathways, including a prokaryotic type II fatty acid synthesis (FASII) pathway. In Toxoplasma gondii, the causative agent of toxoplasmosis, the FASII pathway is essential for parasite growth and infectivity. However, little is known about the fate of fatty acids synthesized by FASII. In this study, we have investigated the function of a plant-like glycerol 3-phosphate acyltransferase (TgATS1) that localizes to the T. gondii apicoplast. Knock-down of TgATS1 resulted in significantly reduced incorporation of FASII-synthesized fatty acids into phosphatidic acid and downstream phospholipids and a severe defect in intracellular parasite replication and survival. Lipidomic analysis demonstrated that lipid precursors are made in, and exported from, the apicoplast for de novo biosynthesis of bulk phospholipids. This study reveals that the apicoplast-located FASII and ATS1, which are primarily used to generate plastid galactolipids in plants and algae, instead generate bulk phospholipids for membrane biogenesis in T. gondii. PMID:27490259

  17. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  18. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  19. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  20. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  1. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  2. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  3. Prebiotic synthesis of carboxylic acids, amino acids and nucleic acid bases from formamide under photochemical conditions⋆

    NASA Astrophysics Data System (ADS)

    Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele

    2017-07-01

    The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.

  4. Ribonucleic Acid Synthesis by Cucumber Chromatin

    PubMed Central

    Johnson, Kenneth D.; Purves, William K.

    1970-01-01

    When intact etiolated 2-day cucumber (Cucumis sativus) embryos were treated with indoleacetic acid (IAA), gibberellin A7 (GA7), or kinetin, chromatin derived from the embryonic axes exhibited an increased capacity to support RNA synthesis in either the presence or the absence of bacterial RNA polymerase. An IAA effect on cucumber RNA polymerase activity was evident after 4 hours of hormone treatment; the IAA effect on DNA template activity (bacterial RNA polymerase added) occurred after longer treatments (12 hours). GA7 also promoted template activity, but again only after a prior stimulation of endogenous chromatin activity. After 12 hours of kinetin treatment, both endogenous chromatin and DNA template activities were substantially above control values, but longer kinetin treatments caused these activities to decline in magnitude. When chromatin was prepared from hypocotyl segments that were floated on a GA7 solution, a GA-induced increase in endogenous chromatin activity occurred, but only if cotyledon tissue was left attached to the segments during the period of hormone treatment. Age of the seedling tissue had a profound influence on the chromatin characteristics. With progression of development from the 2-day to the 4-day stage, the endogenous chromatin activity declined while the DNA template activity increased. PMID:16657509

  5. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  6. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  7. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  8. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  9. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  10. Fluorescence spectroscopy measures yeast PAH1-encoded phosphatidate phosphatase interaction with liposome membranes

    PubMed Central

    Xu, Zhi; Su, Wen-Min; Carman, George M.

    2012-01-01

    Phosphatidate (PA) phosphatase, the enzyme that catalyzes the penultimate step in triacylglycerol synthesis, is a cytosolic enzyme that must associate with the membrane where its substrate PA resides. Fluorescence spectroscopy was used to measure the interaction of yeast PAH1-encoded PA phosphatase with model liposome membranes. PA phosphatase contains five tryptophan residues and exhibited inherit fluorescence that increased upon interaction with phosphatidylcholine liposomes. The interaction was enhanced by inclusion of other phospholipids and especially the substrate PA. Interaction was dependent on both the concentration of phosphatidylcholine-PA liposomes as well as the surface concentration of PA in liposomes. Mg2+ ions, which were required for catalysis, did not affect PA phosphatase interaction with phosphatidylcholine-PA liposomes. PA phosphatase was a substrate for protein kinase A, protein kinase C, and casein kinase II, and these phosphorylations decreased PA phosphatase interaction with phosphatidylcholine-PA liposome membranes. PMID:22180632

  11. The Saccharomyces cerevisiae Lipin Homolog is a Mg2+-dependent Phosphatidate Phosphatase Enzyme*

    PubMed Central

    Han, Gil-Soo; Wu, Wen-I; Carman, George M.

    2006-01-01

    Mg2+-dependent phosphatidate (PA) phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) catalyzes the dephosphorylation of PA to yield diacylglycerol and Pi. In this work, we identified the Saccharomyces cerevisiae PAH1 (previously known as SMP2) gene that encodes Mg2+-dependent PA phosphatase using amino acid sequence information derived from a purified preparation of the enzyme (Lin, Y.-P., and Carman, G.M. (1989) J. Biol. Chem. 264, 8641–8645). Overexpression of PAH1 in S. cerevisiae directed elevated levels of Mg2+-dependent PA phosphatase activity, whereas the pah1Δ mutation caused reduced levels of enzyme activity. Heterologous expression of PAH1 in Escherichia coli confirmed that Pah1p is a Mg2+-dependent PA phosphatase enzyme, and showed that its enzymological properties were very similar to those of the enzyme purified from S. cerevisiae. The PAH1-encoded enzyme activity was associated with both the membrane and cytosolic fractions of the cell, and the membrane-bound form of the enzyme was salt-extractable. Lipid analysis showed that mutants lacking PAH1 accumulated PA, and had reduced amounts of diacylglycerol and its derivative triacylglycerol. The PAH1-encoded Mg2+-dependent PA phosphatase shows homology to mammalian lipin, a fat-regulating protein whose molecular function is unknown. Heterologous expression of human LPIN1 in E. coli showed that lipin 1 is also a Mg2+-dependent PA phosphatase enzyme. PMID:16467296

  12. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    USDA-ARS?s Scientific Manuscript database

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  13. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    USDA-ARS?s Scientific Manuscript database

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  14. Ferrocene-containing nucleic acids. Synthesis and electrochemical properties

    NASA Astrophysics Data System (ADS)

    Zatsepin, Timofei S.; Andreev, Sergei Yu; Hianik, T.; Oretskaya, Tat'yana S.

    2003-06-01

    The published data on the synthesis of ferrocene-containing nucleic acid fragments are generalised. The known methods are systematised and their advantages and disadvantages are discussed. The use of nucleoside, nucleotide and oligonucleotide conjugates with ferrocene in the design of systems for electrochemical detection of nucleic acids is considered.

  15. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  16. The Saccharomyces cerevisiae Actin Patch Protein App1p Is a Phosphatidate Phosphatase Enzyme*♦

    PubMed Central

    Chae, Minjung; Han, Gil-Soo; Carman, George M.

    2012-01-01

    Phosphatidate phosphatase (PAP) catalyzes the dephosphorylation of phosphatidate to yield diacylglycerol. In the yeast Saccharomyces cerevisiae, PAP is encoded by PAH1, DPP1, and LPP1. The presence of PAP activity in the pah1Δ dpp1Δ lpp1Δ triple mutant indicated another gene(s) encoding the enzyme. We purified PAP from the pah1Δ dpp1Δ lpp1Δ triple mutant by salt extraction of mitochondria followed by chromatography with DE52, Affi-Gel Blue, phenyl-Sepharose, MonoQ, and Superdex 200. Liquid chromatography/tandem mass spectrometry analysis of a PAP-enriched sample revealed multiple putative phosphatases. By analysis of PAP activity in mutants lacking each of the proteins, we found that APP1, a gene whose molecular function has been unknown, confers ∼30% PAP activity of wild type cells. The overexpression of APP1 in the pah1Δ dpp1Δ lpp1Δ mutant exhibited a 10-fold increase in PAP activity. The PAP activity shown by App1p heterologously expressed in Escherichia coli confirmed that APP1 is the structural gene for the enzyme. Introduction of the app1Δ mutation into the pah1Δ dpp1Δ lpp1Δ triple mutant resulted in a complete loss of PAP activity, indicating that distinct PAP enzymes in S. cerevisiae are encoded by APP1, PAH1, DPP1, and LPP1. Lipid analysis of cells lacking the PAP genes, singly or in combination, showed that Pah1p is the only PAP involved in the synthesis of triacylglycerol as well as in the regulation of phospholipid synthesis. App1p, which shows interactions with endocytic proteins, may play a role in vesicular trafficking through its PAP activity. PMID:23071111

  17. [Novel L-amino acid ligases catalyzing oligopeptide synthesis].

    PubMed

    Kino, Kuniki

    2010-11-01

    L-Amino acid ligase (EC 6.3.2.28) is a microbial enzyme catalyzing formation of an alpha-peptide bond from unprotected L-amino acids in an ATP-dependent manner. The YwfE protein from Bacillus subtilis 168 was the first reported L-amino acid ligase, and it synthesizes various dipeptides. Thereafter, several L-amino acid ligases were newly obtained by in silico analysis using the ATP-grasp motif. But these L-amino acid ligases synthesize only dipeptide and no longer peptide. A novel L-amino acid ligase capable of catalyzing oligopeptide synthesis is required to increase the variety of peptides. We have previously found a new member of L-amino acid ligase, RizA, from B. subtilis NBRC3134, a microorganism that produces the peptide-antibiotic rhizocticin. We newly found that a gene at approximately 9 kbp upstream of rizA encoded a novel L-amino acid ligase RizB. Recombinant RizB synthesized homo-oligomers of branched-chain amino acids consisting of 2 to 5 amino acids, and also synthesized various heteropeptides. RizB is the first reported L-amino acid ligase that catalyzes oligopeptide synthesis. In addition, we obtained L-amino acid ligases showing oligopeptide synthesis activities by in silico analysis using BLAST, which is a set of similarity search programs. These L-amino acid ligases showed low similarity in amino acid sequence, but commonly used branched-chain amino acids, such as RizB, as substrates. Furthermore, the spr0969 protein of Streptococcus pneumoniae synthesized longer peptides than those synthesized by RizB, and the BAD_1200 protein of Bifidobacteria adolescentis showed higher activity toward aromatic amino acids than toward branched-chain ones.

  18. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  19. Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.

    PubMed

    Jiang, Jianghui; Xu, Jiaxi

    2017-04-16

    4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.

  20. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  1. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  2. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  3. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  4. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  5. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Astrophysics Data System (ADS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-08-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  6. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  7. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  8. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  9. Differential diagnosis in patients with suspected bile acid synthesis defects

    PubMed Central

    Haas, Dorothea; Gan-Schreier, Hongying; Langhans, Claus-Dieter; Rohrer, Tilman; Engelmann, Guido; Heverin, Maura; Russell, David W; Clayton, Peter T; Hoffmann, Georg F; Okun, Jürgen G

    2012-01-01

    AIM: To investigate the clinical presentations associated with bile acid synthesis defects and to describe identification of individual disorders and diagnostic pitfalls. METHODS: Authors describe semiquantitative determination of 16 urinary bile acid metabolites by electrospray ionization-tandem mass spectrometry. Sample preparation was performed by solid-phase extraction. The total analysis time was 2 min per sample. Authors determined bile acid metabolites in 363 patients with suspected defects in bile acid metabolism. RESULTS: Abnormal bile acid metabolites were found in 36 patients. Two patients had bile acid synthesis defects but presented with atypical presentations. In 2 other patients who were later shown to be affected by biliary atresia and cystic fibrosis the profile of bile acid metabolites was initially suggestive of a bile acid synthesis defect. Three adult patients suffered from cerebrotendinous xanthomatosis. Nineteen patients had peroxisomal disorders, and 10 patients had cholestatic hepatopathy of other cause. CONCLUSION: Screening for urinary cholanoids should be done in every infant with cholestatic hepatopathy as well as in children with progressive neurological disease to provide specific therapy. PMID:22416181

  10. Synthesis of imidazol-1-yl-acetic acid hydrochloride: A key intermediate for zoledronic acid

    PubMed Central

    Manne, Narendra; Ray, Purna Chandra

    2008-01-01

    Summary A convenient and practical synthesis of imidazol-1-yl-acetic acid hydrochloride was achieved via N-alkylation of imidazole using tert-butyl chloroacetate followed by a non-aqueous ester cleavage of the resulting imidazol-1-yl-acetic acid tert-butyl ester in the presence of titanium tetrachloride. The synthesized imidazol-1-yl-acetic acid hydrochloride was then utilized to prepare zoledronic acid. PMID:19104672

  11. Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver

    PubMed Central

    Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.

    1969-01-01

    1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319

  12. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  13. Characterization of the Yeast Actin Patch Protein App1p Phosphatidate Phosphatase*

    PubMed Central

    Chae, Minjung; Carman, George M.

    2013-01-01

    Yeast App1p is a phosphatidate phosphatase (PAP) that associates with endocytic proteins at cortical actin patches. App1p, which catalyzes the conversion of phosphatidate (PA) to diacylglycerol, is unique among Mg2+-dependent PAP enzymes in that its reaction is not involved with de novo lipid synthesis. Instead, App1p PAP is thought to play a role in endocytosis because its substrate and product facilitate membrane fission/fusion events and regulate enzymes that govern vesicular movement. App1p PAP was purified from yeast and characterized with respect to its enzymological, kinetic, and regulatory properties. Maximum PAP activity was dependent on Triton X-100 (20 mm), PA (2 mm), Mg2+ (0.5 mm), and 2-mercaptoethanol (10 mm) at pH 7.5 and 30 °C. Analysis of surface dilution kinetics with Triton X-100/PA-mixed micelles yielded constants for surface binding (KsA = 11 mm), interfacial PA binding (KmB = 4.2 mol %), and catalytic efficiency (Vmax = 557 μmol/min/mg). The activation energy, turnover number, and equilibrium constant were 16.5 kcal/mol, 406 s−1, and 16.2, respectively. PAP activity was stimulated by anionic lipids (cardiolipin, phosphatidylglycerol, phosphatidylserine, and CDP-diacylglycerol) and inhibited by zwitterionic (phosphatidylcholine and phosphatidylethanolamine) and cationic (sphinganine) lipids, nucleotides (ATP and CTP), N-ethylmaleimide, propranolol, phenylglyoxal, and divalent cations (Ca2+, Mn2+, and Zn2+). App1p also utilized diacylglycerol pyrophosphate and lyso-PA as substrates with specificity constants 4- and 7-fold lower, respectively, when compared with PA. PMID:23335564

  14. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  16. Role of Ribonucleic Acid Synthesis in Replication of Deoxyribonucleic Acid

    PubMed Central

    Pato, Martin L.

    1975-01-01

    An experiment previously interpreted to show a ribonucleic acid requirement for propagation of deoxyribonucleic replication is reexamined and the earlier interpretation is shown to be incorrect. PMID:1090599

  17. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  18. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  19. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    USDA-ARS?s Scientific Manuscript database

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  20. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-11

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC.

  1. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  2. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  3. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  4. Inhibition of Deoxyribonucleic Acid Synthesis and Bud Formation by Nalidixic Acid in Hyphomicrobium neptunium

    PubMed Central

    Weiner, Ronald M.; Blackman, Marcia A.

    1973-01-01

    The relationship between chromosome replication and morphogenesis in the budding bacterium Hyphomicrobium neptunium has been investigated. Nalidixic acid was found to completely inhibit deoxyribonucleic acid synthesis, but not ribonucleic acid synthesis. The antibiotic was bacteriostatic to the organism for the initial 5 h of exposure; thereafter it was bacteriocidal. Observation of inhibited cultures revealed cells that had produced abnormally long stalks, but no buds. These results indicate that bud formation is coupled to chromosome replication in H. neptunium. They do not exclude the possibilities that cross wall formation and bud separation may also be coupled to chromosome replication. Images PMID:4127631

  5. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  6. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  7. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  8. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  9. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  10. Yeast Nem1-Spo7 Protein Phosphatase Activity on Pah1 Phosphatidate Phosphatase Is Specific for the Pho85-Pho80 Protein Kinase Phosphorylation Sites*

    PubMed Central

    Su, Wen-Min; Han, Gil-Soo; Carman, George M.

    2014-01-01

    Pah1 is the phosphatidate phosphatase in the yeast Saccharomyces cerevisiae that produces diacylglycerol for triacylglycerol synthesis and concurrently controls the levels of phosphatidate used for phospholipid synthesis. Phosphorylation and dephosphorylation of Pah1 regulate its subcellular location and phosphatidate phosphatase activity. Compared with its phosphorylation by multiple protein kinases, Pah1 is dephosphorylated by a protein phosphatase complex consisting of Nem1 (catalytic subunit) and Spo7 (regulatory subunit). In this work, we characterized the Nem1-Spo7 phosphatase complex for its enzymological, kinetic, and regulatory properties with phosphorylated Pah1. The dephosphorylation of Pah1 by Nem1-Spo7 phosphatase resulted in the stimulation (6-fold) of phosphatidate phosphatase activity. For Pah1 phosphorylated by the Pho85-Pho80 kinase complex, maximum Nem1-Spo7 phosphatase activity required Mg2+ ions (8 mm) and Triton X-100 (0.25 mm) at pH 5.0. The energy of activation for the reaction was 8.4 kcal/mol, and the enzyme was thermally labile at temperatures above 40 °C. The enzyme activity was inhibited by sodium vanadate, sodium fluoride, N-ethylmaleimide, and phenylglyoxal but was not significantly affected by lipids or nucleotides. Nem1-Spo7 phosphatase activity was dependent on the concentrations of Pah1 phosphorylated by Pho85-Pho80, Cdc28-cyclin B, PKA, and PKC with kcat and Km values of 0.29 s−1 and 81 nm, 0.11 s−1 and 127 nm, 0.10 s−1 and 46 nm, and 0.02 s−1 and 38 nm, respectively. Its specificity constant (kcat/Km) for Pah1 phosphorylated by Pho85-Pho80 was 1.6-, 4-, and 6-fold higher, respectively, than that phosphorylated by PKA, Cdc28-cyclin B, and PKC. PMID:25359770

  11. Yeast Nem1-Spo7 protein phosphatase activity on Pah1 phosphatidate phosphatase is specific for the Pho85-Pho80 protein kinase phosphorylation sites.

    PubMed

    Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2014-12-12

    Pah1 is the phosphatidate phosphatase in the yeast Saccharomyces cerevisiae that produces diacylglycerol for triacylglycerol synthesis and concurrently controls the levels of phosphatidate used for phospholipid synthesis. Phosphorylation and dephosphorylation of Pah1 regulate its subcellular location and phosphatidate phosphatase activity. Compared with its phosphorylation by multiple protein kinases, Pah1 is dephosphorylated by a protein phosphatase complex consisting of Nem1 (catalytic subunit) and Spo7 (regulatory subunit). In this work, we characterized the Nem1-Spo7 phosphatase complex for its enzymological, kinetic, and regulatory properties with phosphorylated Pah1. The dephosphorylation of Pah1 by Nem1-Spo7 phosphatase resulted in the stimulation (6-fold) of phosphatidate phosphatase activity. For Pah1 phosphorylated by the Pho85-Pho80 kinase complex, maximum Nem1-Spo7 phosphatase activity required Mg(2+) ions (8 mm) and Triton X-100 (0.25 mm) at pH 5.0. The energy of activation for the reaction was 8.4 kcal/mol, and the enzyme was thermally labile at temperatures above 40 °C. The enzyme activity was inhibited by sodium vanadate, sodium fluoride, N-ethylmaleimide, and phenylglyoxal but was not significantly affected by lipids or nucleotides. Nem1-Spo7 phosphatase activity was dependent on the concentrations of Pah1 phosphorylated by Pho85-Pho80, Cdc28-cyclin B, PKA, and PKC with kcat and Km values of 0.29 s(-1) and 81 nm, 0.11 s(-1) and 127 nm, 0.10 s(-1) and 46 nm, and 0.02 s(-1) and 38 nm, respectively. Its specificity constant (kcat/Km) for Pah1 phosphorylated by Pho85-Pho80 was 1.6-, 4-, and 6-fold higher, respectively, than that phosphorylated by PKA, Cdc28-cyclin B, and PKC. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. The He(I) photoelectron spectra of lipid phosphatides

    NASA Astrophysics Data System (ADS)

    Ballard, R. E.; Jones, Jimmy; Read, Derek; Inchley, Andrew

    1986-12-01

    Complete layers of some lipids are formed spontaneously on the surfaces of solutions of sufficient concentration in certain solvents, e.g. phosphatidylcholine (egg lecithin) and phosphatidylinositol (wheat germ) dissolved in hydroxypropionitrile. The He(I) photoelectron spectra of phosphatides in such layers contain: (1) a broad band, assigned to alkyl groups, with maximum intensity at about 11 eV, (2) another broad band at about 8 eV, assigned to the PO -4 group with about 1 % of the band area of (1).

  13. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  14. Stimulation of hepatic glycogen synthesis by amino acids.

    PubMed Central

    Katz, J; Golden, S; Wals, P A

    1976-01-01

    Hepatocytes isolated from livers of fasted rats form little glycogen from glucose or lactate at concentrations below 20 mM. Glycogen is formed in substantial quantities at a glucose concentration of 60 mM. In the presence of 10 mM glucose, 20-30% as much glycogen as glucose is formed from fructose, sorbitol, or dihydroxyacetone. The addition of either glutamine, alanine, or asparagine stimulates the formation of glycogen from lactate 10- to 40-fold. The formation of glucose and glycogen is then about equal, and glycogen deposition in hepatocytes is similar to rates attained in vivo after fasted rats are refed. The amino acids stimulate 1.5- to 2-fold glycogen synthesis from fructose, and 2- to 4-fold synthesis from dihyDROXYACETONE. Ammonium chloride is about one-half as effective as amino acids in stimulating glycogen synthesis when glucose with lactate are substrates. It increased glycogen synthesis 25-50% from fructose but inhibited synthesis from dihydroxyacetone plus glucose. PMID:1068456

  15. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  16. High yielding synthesis of N-ethyl dehydroamino acids.

    PubMed

    Monteiro, Luís S; Suárez, Ana S

    2012-10-01

    Recently we reported the use of a sequence of alkylation and dehydration methodologies to obtain N-ethyl-α, β-dehydroamino acid derivatives. The application of this N-alkylation procedure to several methyl esters of β,β-dibromo and β-bromo, β-substituted dehydroamino acids protected with standard amine protecting groups was subsequently reported. The corresponding N-ethyl, β-bromo dehydroamino acid derivatives were obtained in fair to high yields and some were used as substrates in Suzuki cross-coupling reactions to give N-ethyl, β,β-disubstituted dehydroalanine derivatives. Herein, we further explore N-ethylation of β-halo dehydroamino acid derivatives using triethyloxonium tetrafluoroborate as alkylating agent, but substituting N,N-diisopropylethylamine for potassium tert-butoxide as auxiliary base. In these conditions, for all β-halo dehydroamino acid derivatives, reactions were complete and the N-ethylated derivative could be isolated in high yield. This method was also applied for N-ethylation of non-halogenated dehydroamino acids. Again, with all compounds the reactions were complete and the N-ethyl dehydroamino acid derivatives could be isolated in high yields. Some of these N-ethyl dehydroamino acid methyl ester derivatives were converted in high yields to their corresponding acids and coupled to an amino acid methyl ester to give N-ethyl dehydrodipeptide derivatives in good yields. Thus, this method constitutes a general procedure for high yielding synthesis of N-ethylated dehydroamino acids, which can be further applied in peptide synthesis.

  17. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  18. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  20. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  1. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  2. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  3. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  4. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  5. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  6. A concise synthesis of berkelic acid inspired by combining the natural products spicifernin and pulvilloric acid.

    PubMed

    Bender, Christopher F; Yoshimoto, Francis K; Paradise, Christopher L; De Brabander, Jef K

    2009-08-19

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid, an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24-28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in a 10 step linear sequence and 11-27% overall yield.

  7. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  8. Synthesis of the putative structure of 15-oxopuupehenoic acid.

    PubMed

    Boulifa, Ettahir; Fernández, Antonio; Alvarez, Esteban; Alvarez-Manzaneda, Ramón; Mansour, Ahmed I; Chahboun, Rachid; Alvarez-Manzaneda, Enrique

    2014-11-07

    Synthesis of the putative structure of the marine natural 15-oxopuupehenoic acid has been achieved starting from commercial (-)-sclareol. Key steps of the synthetic sequence are the Robinson annulation of a β-ketoester and methyl vinyl ketone and an unprecedented cyclization of the resulting α,β-enone, which is mediated by tin(IV) chloride in the presence of N-phenylselenophthalimide. The physical properties of the synthetic compound are somewhat different from those reported for the natural product.

  9. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  10. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  11. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  12. Insulin and amino acids independently stimulate skeletal muscle protein synthesis in neonatal pigs.

    PubMed

    O'Connor, Pamela M J; Bush, Jill A; Suryawan, Agus; Nguyen, Hanh V; Davis, Teresa A

    2003-01-01

    Infusion of physiological levels of insulin and/or amino acids reproduces the feeding-induced stimulation of muscle protein synthesis in neonates. To determine whether insulin and amino acids independently stimulate skeletal muscle protein synthesis in neonates, insulin secretion was blocked with somatostatin in fasted 7-day-old pigs (n = 8-12/group) while glucose and glucagon were maintained at fasting levels and insulin was infused to simulate either less than fasting, fasting, intermediate, or fed insulin levels. At each dose of insulin, amino acids were clamped at either the fasting or fed level; at the highest insulin dose, amino acids were also reduced to less than fasting levels. Skeletal muscle protein synthesis was measured using a flooding dose of l-[4-(3)H]phenylalanine. Hyperinsulinemia increased protein synthesis in skeletal muscle during hypoaminoacidemia and euaminoacidemia. Hyperaminoacidemia increased muscle protein synthesis during hypoinsulinemia and euinsulinemia. There was a dose-response effect of both insulin and amino acids on muscle protein synthesis. At each insulin dose, hyperaminoacidemia increased muscle protein synthesis. The effects of insulin and amino acids on muscle protein synthesis were largely additive until maximal rates of protein synthesis were achieved. Amino acids enhanced basal protein synthesis rates but did not enhance the sensitivity or responsiveness of muscle protein synthesis to insulin. The results suggest that insulin and amino acids independently stimulate protein synthesis in skeletal muscle of the neonate.

  13. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.

  14. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  15. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  16. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  17. Lettuce seed germination: modulation of pregermination protein synthesis by gibberellic Acid, abscisic Acid, and cytokinin.

    PubMed

    Fountain, D W; Bewley, J D

    1976-10-01

    Protein synthesis in gibberellin-treated lettuce (Lactuca sativa) seeds has been studied during the lag phase between the beginning of imbibition and the first signs of radicle protrusion. When compared to the water-imbibed controls, both polyribosome populations and radioactive leucine incorporation into protein increase in the embryos of GA(3)- induced seeds early in the imbibition period. Since these results are contradictory to previously published studies, the reasons for the differences are outlined and various alternative possibilities eliminated. The protocol for protein extraction, particularly the speed at which the supernatant from the seed homogenate is cleared, is important for demonstrating the GA(3)-mediated changes. Embryos maintained in the dormant state by abscisic acid still conduct considerable amounts of protein synthesis, and this is enhanced by concentrations of 6-benzylaminopurine which also promote germination. Therefore, the actions of GA(3), abscisic acid, and cytokinin on lettuce seed germination are mediated, directly or indirectly, via protein synthesis.

  18. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  19. Characterization of the human LPIN1-encoded phosphatidate phosphatase isoforms.

    PubMed

    Han, Gil-Soo; Carman, George M

    2010-05-07

    The human LPIN1 gene encodes the protein lipin 1, which possesses phosphatidate (PA) phosphatase (3-sn-phosphatidate phosphohydrolase; EC 3.1.3.4) activity (Han, G.-S., Wu, W.-I., and Carman, G. M. (2006) J. Biol. Chem. 281, 9210-9218). In this work, we characterized human lipin 1 alpha, beta, and gamma isoforms that were expressed in Escherichia coli and purified to near homogeneity. PA phosphatase activities of the alpha, beta, and gamma isoforms were dependent on Mg(2+) or Mn(2+) ions at pH 7.5 at 37 degrees C. The activities were inhibited by concentrations of Mg(2+) and Mn(2+) above their optimums and by Ca(2+), Zn(2+), N-ethylmaleimide, propranolol, and the sphingoid bases sphingosine and sphinganine. The activities were thermally labile at temperatures above 40 degrees C. The alpha, beta, and gamma activities followed saturation kinetics with respect to the molar concentration of PA (K(m) values of 0.35, 0.24, and 0.11 mm, respectively) but followed positive cooperative (Hill number approximately 2) kinetics with respect to the surface concentration of PA (K(m) values of 4.2, 4.5, and 4.3 mol %, respectively) in Triton X-100/PA-mixed micelles. The turnover numbers (k(cat)) for the alpha, beta, and gamma isoforms were 68.8 + or - 3.5, 42.8 + or - 2.5, and 5.7 + or - 0.2 s(-1), respectively, whereas their energy of activation values were 14.2, 15.5, and 18.5 kcal/mol, respectively. The isoform activities were dependent on PA as a substrate and required at least one unsaturated fatty acyl moiety for maximum activity.

  20. Characterization of the Human LPIN1-encoded Phosphatidate Phosphatase Isoforms*

    PubMed Central

    Han, Gil-Soo; Carman, George M.

    2010-01-01

    The human LPIN1 gene encodes the protein lipin 1, which possesses phosphatidate (PA) phosphatase (3-sn-phosphatidate phosphohydrolase; EC 3.1.3.4) activity (Han, G.-S., Wu, W.-I., and Carman, G. M. (2006) J. Biol. Chem. 281, 9210–9218). In this work, we characterized human lipin 1 α, β, and γ isoforms that were expressed in Escherichia coli and purified to near homogeneity. PA phosphatase activities of the α, β, and γ isoforms were dependent on Mg2+ or Mn2+ ions at pH 7.5 at 37 °C. The activities were inhibited by concentrations of Mg2+ and Mn2+ above their optimums and by Ca2+, Zn2+, N-ethylmaleimide, propranolol, and the sphingoid bases sphingosine and sphinganine. The activities were thermally labile at temperatures above 40 °C. The α, β, and γ activities followed saturation kinetics with respect to the molar concentration of PA (Km values of 0.35, 0.24, and 0.11 mm, respectively) but followed positive cooperative (Hill number ∼2) kinetics with respect to the surface concentration of PA (Km values of 4.2, 4.5, and 4.3 mol %, respectively) in Triton X-100/PA-mixed micelles. The turnover numbers (kcat) for the α, β, and γ isoforms were 68.8 ± 3.5, 42.8 ± 2.5, and 5.7 ± 0.2 s−1, respectively, whereas their energy of activation values were 14.2, 15.5, and 18.5 kcal/mol, respectively. The isoform activities were dependent on PA as a substrate and required at least one unsaturated fatty acyl moiety for maximum activity. PMID:20231281

  1. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  2. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  3. Incorporation of Extracellular Fatty Acids by a Fatty Acid Kinase-Dependent Pathway in Staphylococcus aureus

    PubMed Central

    Parsons, Joshua B.; Frank, Matthew W.; Jackson, Pamela; Subramanian, Chitra; Rock, Charles O.

    2014-01-01

    Summary Acyl-CoA and acyl-acyl carrier protein (ACP) synthetases activate exogenous fatty acids for incorporation into phospholipids in Gram-negative bacteria. However, Gram-positive bacteria utilize an acyltransferase pathway for the biogenesis of phosphatidic acid that begins with the acylation of sn-glycerol-3-phosphate by PlsY using an acyl-phosphate (acyl-PO4) intermediate. PlsX generates acyl-PO4 from the acyl-ACP end-products of fatty acid synthesis. The plsX gene of Staphylococcus aureus was inactivated and the resulting strain was both a fatty acid auxotroph and required de novo fatty acid synthesis for growth. Exogenous fatty acids were only incorporated into the 1-position and endogenous acyl groups were channeled into the 2-position of the phospholipids in strain PDJ39 (ΔplsX). Extracellular fatty acids were not elongated. Removal of the exogenous fatty acid supplement led to the rapid accumulation of intracellular acyl-ACP and the abrupt cessation of fatty acid synthesis. Extracts from the ΔplsX strain exhibited an ATP-dependent fatty acid kinase activity, and the acyl-PO4 was converted to acyl-ACP when purified PlsX is added. These data reveal the existence of a novel fatty acid kinase pathway for the incorporation of exogenous fatty acids into S. aureus phospholipids. PMID:24673884

  4. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  5. Synthesis of teichoic acid by Bacillus subtilis protoplasts.

    PubMed Central

    Bertram, K C; Hancock, I C; Baddiley, J

    1981-01-01

    Protoplasts of Bacillus subtilis W23 readily synthesized ribitol teichoic acid from nucleotide precursors in the surrounding medium. With cytidine diphosphate-ribitol they made poly(ribitol phosphate), presumably attached to lipoteichoic acid carrier; when cytidine diphosphate-glycerol and uridine diphosphate-N-acetylglucosamine were also present a 10-fold increase in the rate of polymer synthesis occurred, and the product contained both the main chain and the linkage unit. Synthesis was inhibited by trypsin or p-chloromercuribenzenesulfonate in the medium, and we concluded that it occurred at the outer surface of the membrane. During synthesis, which was also achieved readily by whole cells after a brief period of wall lysis, the cytidine phosphate portion of the nucleotide precursors did not pass through the membrane. No evidence could be obtained for a transphosphorylation mechanism for the translocation process. It is suggested that reaction with exogenous substrates was due to temporary exposure of a protein component of the enzyme complex at the outer surface of the membrane during the normal biosynthetic cycle. PMID:6271728

  6. Facile synthesis of glycosylated Fmoc amino acid building blocks assisted by microwave irradiation.

    PubMed

    Yao, Nianhuan; Fung, Gabriel; Malekan, Hamed; Ye, Long; Kurth, Mark J; Lam, Kit S

    2010-10-13

    The synthesis of glycosylated Fmoc amino acids by reaction of mono- and disaccharide peracetates with Fmoc amino acids having free carboxyl groups was rapidly promoted by Lewis acids (SnCl(4), BF(3)·Et(2)O) under microwave irradiation. The products are useful building blocks for the synthesis of glycopeptides. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  8. Synthesis of a conformationally constrained δ-amino acid building block.

    PubMed

    O'Reilly, Elaine; Pes, Lara; Ortin, Yannick; Müller-Bunz, Helge; Paradisi, Francesca

    2013-02-01

    Conformationally restricted amino acids are important components in peptidomimetics and drug design. Herein, we describe the synthesis of a novel, non-proteinogenic constrained delta amino acid containing a cyclobutane ring, cis-3(aminomethyl)cyclobutane carboxylic acid (ACCA). The synthesis of the target amino acid was achieved in seven steps, with the key reaction being a base induced intramolecular nucleophilic substitution. A small library of dipeptides was prepared through the coupling of ACCA with proteinogenic amino acids.

  9. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  10. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  11. Synthesis and properties of fatty acid starch esters.

    PubMed

    Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik

    2013-10-15

    Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Stereoselective synthesis of uridine-derived nucleosyl amino acids.

    PubMed

    Spork, Anatol P; Wiegmann, Daniel; Granitzka, Markus; Stalke, Dietmar; Ducho, Christian

    2011-12-16

    Novel hybrid structures of 5'-deoxyuridine and glycine were conceived and synthesized. Such nucleosyl amino acids (NAAs) represent simplified analogues of the core structure of muraymycin nucleoside antibiotics, making them useful synthetic building blocks for structure-activity relationship (SAR) studies. The key step of the developed synthetic route was the efficient and highly diastereoselective asymmetric hydrogenation of didehydro amino acid precursors toward protected NAAs. It was anticipated that the synthesis of unprotected muraymycin derivatives via this route would require a suitable intermediate protecting group at the N-3 of the uracil base. After initial attempts using PMB- and BOM-N-3 protection, both of which resulted in problematic deprotection steps, an N-3 protecting group-free route was envisaged. In spite of the pronounced acidity of the uracil-3-NH, this route worked equally efficient and with identical stereoselectivities as the initial strategies involving N-3 protection. The obtained NAA building blocks were employed for the synthesis of truncated 5'-deoxymuraymycin analogues.

  13. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Muricholic bile acids are potent regulators of bile acid synthesis via a positive feedback mechanism.

    PubMed

    Hu, X; Bonde, Y; Eggertsen, G; Rudling, M

    2014-01-01

    Bile acid (BA) synthesis is regulated by negative feedback end-product inhibition, initiated by farnesoid X receptors (FXRs) in liver and gut. Studies on cholic acid (CA)-free Cyp8b1(-/-) mice have concluded that CA is a potent suppressor of BA synthesis. Cyp8b1(-/-) mice have increased BA synthesis and an enlarged BA pool, a phenotype shared with bile-duct-ligated, antibiotics-administered and with germ-free mice. Studies on such mice have concluded BA synthesis is induced due to reduced hormonal signalling by fibroblast growth factor (FGF)15 from intestine to liver. A mutual finding in these models is that potent FXR-agonistic BAs are reduced. We hypothesized that the absence of the potent FXR agonist deoxycholic acid (DCA) may be important for the induction of BA synthesis in these situations. Two of these models were investigated, antibiotic treatment and Cyp8b1(-/-) mice and their combination. Secondary BA formation was inhibited by ampicillin (AMP) given to wild-type and Cyp8b1(-/-) mice. We then administered CA, chenodeoxycholic acid (CDCA) or DCA to AMP-treated Cyp8b1(-/-) mice. Our data show that the phenotype of AMP-treated wild-type mice resembles that of Cyp8b1(-/-) mice with fourfold induced Cyp7a1 expression, increased intestinal apical sodium-dependent BA transporter expression and increased hepatic BA levels. We also show that reductions in the FXR-agonistic BAs CDCA, CA, DCA or lithocholic acid cannot explain this phenotype; instead, it is likely due to increases in levels of α- and β-muricholic BAs and ursodeoxycholic acid, three FXR-antagonistic BAs. Our findings reveal a potent positive feedback mechanism for regulation of BA synthesis in mice that appears to be sufficient without endocrine effects of FGF15 on Cyp7a1. This mechanism will be fundamental in understanding BA metabolism in both mice and humans. © 2013 The Association for the Publication of the Journal of Internal Medicine.

  15. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  16. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  17. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  19. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  20. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures.

    PubMed

    Rodas-Junco, Beatriz A; Cab-Guillén, Yahaira; Muñoz-Sánchez, J Armando; Vázquez-Flota, Felipe; Monforte-González, Miriam; Hernández-Sotomayor, S M Teresa

    2013-10-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  1. Effect of cholesterol feeding and estrogen treatment on synthesis of fatty acids in liver.

    PubMed

    Srinivasan, K; Pynadath, T I

    1977-08-01

    The effect of cholesterol feeding and estrogen administration on synthesis of fatty acids in liver mitochondria, microsomes and cytoplasm of male rabbits has been investigated. The synthesis was measured by the incorporation of [1(-14)C] acetyl CoA or [2(-14)C]malonyl CoA into long chain fatty acids under optimal conditions. It was found that atherogenesis markedly decreased the fatty acid synthesis in cytoplasm. The mitochondrial fatty acid synthesis was not affected by the disease. There was a small but measurable decrease in the synthesis of fatty acids in microsomes. Estrogen had no effect on the synthesis of fatty acids in mitochondria or microsomes. But if effectively counteracted, after a short lag period, the decreased synthesis of cytoplasmic fatty acids observed in atherosclerosis. It is possible that liver fatty acid synthetase is one of the enzyme systems through which estrogens exert their atherosclerosis-retarding effect. The decreased cytoplasmic fatty acid synthesis observed in atherosclerosis might account for the low levels of saturated fatty acids reported in liver and plasma lipids of atherosclerotic animals.

  2. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  3. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  4. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  5. Indoleacetic Acid synthesis in soybean cotyledon callus tissue.

    PubMed

    Black, R C; Hamilton, R H

    1976-03-01

    Growth of an auxin-requiring soybean cotyledon callus tissue (Glycine max L., Merr. var. Acme) was promoted by tryptophan, tryptamine, indole, indoleacetamide and, to a very slight degree, anthranilic acid. When tryptophan-3-(14)C was supplied in the growth medium, labeled indoleacetic acid (IAA) was found in both the tissue and the medium. Medium, from which the cells had been removed, was also found to convert labeled tryptophan to IAA. Soybean callus contained 0.044 mumole/g free tryptophan, but this is apparently not available for conversion to IAA. These results suggest that while exogenously supplied trytophan could elevate a specific internal pool where IAA synthesis occurs some of the growth on a tryptophan medium can be accounted for by external conversion.

  6. Indoleacetic Acid Synthesis in Soybean Cotyledon Callus Tissue 1

    PubMed Central

    Black, Robert C.; Hamilton, Robert H.

    1976-01-01

    Growth of an auxin-requiring soybean cotyledon callus tissue (Glycine max L., Merr. var. Acme) was promoted by tryptophan, tryptamine, indole, indoleacetamide and, to a very slight degree, anthranilic acid. When tryptophan-3-14C was supplied in the growth medium, labeled indoleacetic acid (IAA) was found in both the tissue and the medium. Medium, from which the cells had been removed, was also found to convert labeled tryptophan to IAA. Soybean callus contained 0.044 μmole/g free tryptophan, but this is apparently not available for conversion to IAA. These results suggest that while exogenously supplied trytophan could elevate a specific internal pool where IAA synthesis occurs some of the growth on a tryptophan medium can be accounted for by external conversion. PMID:16659498

  7. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  8. One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.

    PubMed

    Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef

    2017-08-01

    Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ2 and PGA2, cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. The enzymic and chemical synthesis of ursodeoxycholic and chenodeoxycholic acid from cholic acid.

    PubMed

    Sutherland, J D; Macdonald, I A; Forrest, T P

    1982-01-01

    Three approaches to the synthesis of ursodeoxycholic acid (UDC) from cholic acid have been investigated: (i) oxidation of cholic acid to 3 alpha, 7 alpha-dihydroxy-12 keto-5 beta-cholanoic acid (12K-CDC) with Clostridium group P 12 alpha-hydroxysteroid dehydrogenase (HSDH), isomerization of 12K-CDC to 3 alpha, 7 beta-dihydroxy-12 keto-5 beta-cholanoic acid (12K-UDC) with Clostridium absonum 7 alpha- and 7 beta-HSDH and reduction of 12K-UDC by Wolff-Kishner to UDC; (ii) isomerization of cholic acid to ursocholic acid (UC) by C. absonum 7 alpha- and 7 beta-HSDH, oxidation of UC to 12K-UDC with Clostridium group P 12 alpha-HSDH and Wolff-Kishner reduction of 12K-UDC to UDC; (iii) oxidation of cholic acid to 12K-CDC by Clostridium group P 12 alpha-HSDH, Wolff-Kishner reduction of 12K-CDC to chenodeoxycholic acid (CDC) and isomerization of CDC to UDC using whole cell cultures of C. absonum. In the first two approaches (using cell free systems) the yields of desired product were relatively low primarily due to the formation of various side products. The third method proved the most successful giving an overall yield of 37% (UDC) whose structure was verified by mass spectroscopy of the methyl ester.

  10. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  11. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  12. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  13. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  14. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  15. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  16. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  17. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  18. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  19. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  1. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  2. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  3. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  4. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  5. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors.

    PubMed

    Lei, Anping; Chen, Huan; Shen, Guoming; Hu, Zhangli; Chen, Lei; Wang, Jiangxin

    2012-03-26

    Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production.

  6. Overproduction of a Functional Fatty Acid Biosynthetic Enzyme Blocks Fatty Acid Synthesis in Escherichia coli

    PubMed Central

    Subrahmanyam, Satyanarayana; Cronan, John E.

    1998-01-01

    β-Ketoacyl-acyl carrier protein (ACP) synthetase II (KAS II) is one of three Escherichia coli isozymes that catalyze the elongation of growing fatty acid chains by condensation of acyl-ACP with malonyl-ACP. Overexpression of this enzyme has been found to be extremely toxic to E. coli, much more so than overproduction of either of the other KAS isozymes, KAS I or KAS III. The immediate effect of KAS II overproduction is the cessation of phospholipid synthesis, and this inhibition is specifically due to the blockage of fatty acid synthesis. To determine the cause of this inhibition, we examined the intracellular pools of ACP, coenzyme A (CoA), and their acyl thioesters. Although no significant changes were detected in the acyl-ACP pools, the CoA pools were dramatically altered by KAS II overproduction. Malonyl-CoA increased to about 40% of the total cellular CoA pool upon KAS II overproduction from a steady-state level of around 0.5% in the absence of KAS II overproduction. This finding indicated that the conversion of malonyl-CoA to fatty acids had been blocked and could be explained if either the conversion of malonyl-CoA to malonyl-ACP and/or the elongation reactions of fatty acid synthesis had been blocked. Overproduction of malonyl-CoA:ACP transacylase, the enzyme catalyzing the conversion of malonyl-CoA to malonyl-ACP, partially relieved the toxicity of KAS II overproduction, consistent with a model in which high levels of KAS II blocks access of the other KAS isozymes to malonyl-CoA:ACP transacylase. PMID:9721301

  7. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  8. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  9. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  10. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  11. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  12. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  13. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  14. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  15. Effect of the quality of dietary amino acids composition on the urea synthesis in rats.

    PubMed

    Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko

    2011-01-01

    We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.

  16. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  17. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  18. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  19. Nuclear Fraction of Bacillus subtilis as a Template for Ribonucleic Acid Synthesis

    PubMed Central

    Mizuno, S.; Whiteley, H. R.

    1968-01-01

    A “nuclear fraction” prepared from Bacillus subtilis was a more efficient template than purified deoxyribonucleic acid for the synthesis of ribonucleic acid by exogenously added ribonucleic acid polymerase isolated from B. subtilis. The initial rate of synthesis with the nuclear fraction was higher and synthesis continued for several hours, yielding an amount of ribonucleic acid greater than the amount of deoxyribonucleic acid used as the template. The product was heterogenous in size, with a large portion exceeding 23S. When purified deoxyribonucleic acid was the template, a more limited synthesis was observed with a predominantly 7S product. However, the ribonucleic acids produced in vitro from these templates were very similar to each other and to in vivo synthesized ribonucleic acid as determined by the competition of ribonucleic acid from whole cells in the annealing of in vitro synthesized ribonucleic acids to deoxyribonucleic acid. Treatment of the nuclear fraction with heat (60 C for 15 min) or trypsin reduced the capacity of the nuclear fraction to synthesize ribonucleic acid to the level observed with purified deoxyribonucleic acid. PMID:4296512

  20. Efficient synthesis of phosphatidylserine in 2-methyltetrahydrofuran.

    PubMed

    Duan, Zhang-Qun; Hu, Fei

    2013-01-10

    2-Methyltetrahydrofuran has recently been described as a promising and green solvent. Herein, it was successfully used as the reaction medium for enzyme-mediated transphosphatidylation of phosphatidylcholine with L-serine with the aim of phosphatidylserine synthesis for the first time. Our results indicated that as high as 90% yield of phosphatidylserine could be achieved after 12 h combined with no byproduct (phosphatidic acid) forming. The present work accommodated a facilely and efficiently enzymatic strategy for preparing phosphatidylserine, which possessed obvious advantages over the reported processes in terms of high efficiency and environmental friendliness. This work is also a proof-of-concept opening the use of 2-methyltetrahydrofuran in biosynthesis as well.

  1. Synthesis of different deuterated carboxylic acids from unsaturated acids promoted by samarium diiodide and D2O.

    PubMed

    Concellón, José M; Rodríguez-Solla, Humberto

    2002-10-04

    An easy, and rapid reduction of the Cdbond;C bond of alpha,beta-unsaturated acids by means of samarium diiodide in the presence of D(2)O provides an efficient method for synthesizing 2,3-dideuterio acids. Starting from alka-2,4-dienoic acids, (E)-alpha,delta-dideuterio-betagamma-unsaturated acids are obtained, the new Cdbond;C bond being generated with complete diastereoselectivity. When H(2)O is used instead of D(2)O, saturated carboxylic acids and (E)-beta,gamma-unsaturated acids are isolated. A mechanism to explain each synthesis has been proposed.

  2. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  3. Effect of diarachidonin on prostaglandin E2 synthesis in rabbit kidney medulla slices.

    PubMed Central

    Fujimoto, Y; Uno, H; Kagen, C; Ueno, T; Fujita, T

    1985-01-01

    The effect of diarachidonin on the synthesis of prostaglandin E2 in rabbit kidney medulla slices was examined. The addition of diarachidonin stimulated prostaglandin E2 production in a dose-dependent manner. At three concentrations (10, 50 and 100 microM), increases in prostaglandin E2 formation induced by exogenous diarachidonin were 2-fold greater than those induced by exogenous arachidonic acid. Diacylglycerol or phosphatidic acid from egg lecithin had little or no effect on prostaglandin E2 production. Moreover, EGTA failed to inhibit diarachidonin-stimulated prostaglandin E2 formation, indicating that the stimulatory effect of diarachidonin is not mediated through the activation of endogenous phospholipase A2 (including phosphatidic acid-specific phospholipase A2). These results are discussed in the light of our former hypothesis that arachidonic acid release from kidney medulla phospholipids might occur through the sequential action of a phospholipase C coupled to diacylglycerol and monoacylglycerol lipases [Fujimoto, Akamatsu, Hattori & Fujita (1984) Biochem. J. 218, 69-74]. PMID:3937522

  4. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  5. Synthesis of Fatty Acid Esters of Selected Higher Polyols Over Homogeneous Metallic Catalysts.

    PubMed

    Nowicki, Janusz; Stańczyk, Dorota; Drabik, Jolanta; Mosio-Mosiewski, Jan; Woszczyński, Piotr; Warzała, Marek

    Studies on the synthesis of esters of natural origin fatty acids (oleic acid) and a branched synthetic isostearic acid derived from oleic acid with commercially available selected higher polyols in the presence of homogeneous metallic catalysts have been carried out. The effects of the synthesis temperature, molar ratio and the catalysts amount have also been studied. It was shown that higher fatty acid conversion and selectivity to tri- and tetraesters were obtained for organotin catalyst Fascat 2003, which was used as the esterification catalyst. Anti-wear test confirmed good tribological properties of the obtained esters.

  6. Synthesis and properties of carbohydrate-phosphate backbone-modified oligonucleotide analogues and nucleic acid mimetics

    NASA Astrophysics Data System (ADS)

    Abramova, Tatyana V.; Silnikov, Vladimir N.

    2011-05-01

    Advances in the synthesis of oligo(deoxy)ribonucleotide analogues and nucleic acid mimetics made in the last decade are summarized. Attention is focused on new methods for the synthesis of derivatives with a modified ribose-phosphate backbone (phosphorothioate, boranophosphate, and nucleoside phosphonate derivatives) and derivatives devoid of the phosphate group. Among nucleic acid mimetics, conformationally restricted modified peptide nucleic acids, including those bearing a negative or positive charge, and morpholino oligomers are considered. Advantages and drawbacks of the main types of analogues as regards the complexity of the synthesis and the possibility of their application as antisense agents or reagents for hybridization analysis are compared.

  7. Regulation of protein synthesis by amino acids in muscle of neonates

    PubMed Central

    Suryawan, Agus; Davis, Teresa A.

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241

  8. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  9. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  10. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  11. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  12. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    PubMed Central

    Torella, Joseph P.; Ford, Tyler J.; Kim, Scott N.; Chen, Amanda M.; Way, Jeffrey C.; Silver, Pamela A.

    2013-01-01

    Medium-chain fatty acids (MCFAs, 4–12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain–length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  13. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  14. Effects of Amino Acids on Protein Synthesis by Cellular and Subcellular Preparations from Ischaemic Livers

    PubMed Central

    Cajone, F.; Schiaffonati, L.

    1974-01-01

    The effects of liver ischaemia on protein synthesis have been studied in tissue slices from ischaemic livers, incubated in vitro. There is a rapid decrease in protein synthesis after the onset of ischaemia, which is more severe in slices than in any cell-free preparation. Liver slices from ischaemic livers do not respond to the presence of a full complement of amino acids with an increase in protein synthesis. The presence of amino acids in the incubation medium does not protect the state of aggregation of the polysomes in the slices from ischaemic livers, as occurs in normal liver slices. Isolated ribosomes, obtained from ischaemic livers and incubated with normal purified factors, show a reduced—but still evident—increase in their protein synthesis in the presence of a full complement of amino acids. This suggests that the decay of cell sap factors also plays a role in the impairment of protein synthesis caused by ischaemia. PMID:4447791

  15. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  16. Mass-Spectrometry-Based Quantification of Protein-Bound Fatty Acid Synthesis Intermediates from Escherichia coli.

    PubMed

    Noga, Marek J; Cerri, Mattia; Imholz, Nicole; Tulinski, Pawel; Şahin, Enes; Bokinsky, Gregory

    2016-10-07

    The production of fatty acids from simple nutrients occurs via a complex biosynthetic pathway with dozens of intermediate compounds and multiple branch points. Despite its importance for microbial physiology and biotechnology, critical aspects of fatty acid biosynthesis, especially dynamics of in vivo regulation, remain poorly characterized. We have developed a liquid chromatography/mass spectroscopy (LC-MS) method for relative quantification of fatty acid synthesis intermediates in Escherichia coli, a model organism for studies of fatty acid metabolism. The acyl carrier protein, a vehicle for the substrates and intermediates of fatty acid synthesis, is extracted from E. coli, proteolytically digested, resolved using reverse-phase LC, and detected using electrospray ionization coupled with a tandem MS. Our method reliably resolves 21 intermediates of fatty acid synthesis, with an average relative standard deviation in ratios of individual acyl-ACP species to total ACP concentrations of 20%. We demonstrate that fast sampling and quenching of cells is essential to accurately characterize intracellular concentrations of ACP species. We apply our method to examine the rapid response of fatty acid metabolism to the antibiotic cerulenin. We anticipate that our method will enable the characterization of in vivo regulation and kinetics of microbial fatty acid synthesis at unprecedented detail and will improve integration of fatty acid synthesis into models of microbial metabolism.

  17. Epidermal growth factor receptor endocytic traffic perturbation by phosphatidate phosphohydrolase inhibition: new strategy against cancer.

    PubMed

    Shaughnessy, Ronan; Retamal, Claudio; Oyanadel, Claudia; Norambuena, Andrés; López, Alejandro; Bravo-Zehnder, Marcela; Montecino, Fabian J; Metz, Claudia; Soza, Andrea; González, Alfonso

    2014-05-01

    Epidermal growth factor receptor (EGFR) exaggerated (oncogenic) function is currently targeted in cancer treatment with drugs that block receptor ligand binding or tyrosine kinase activity. Because endocytic trafficking is a crucial regulator of EGFR function, its pharmacological perturbation might provide a new anti-tumoral strategy. Inhibition of phosphatidic acid (PA) phosphohydrolase (PAP) activity has been shown to trigger PA signaling towards type 4 phosphodiesterase (PDE4) activation and protein kinase A inhibition, leading to internalization of empty/inactive EGFR. Here, we used propranolol, its l- and d- isomers and desipramine as PAP inhibitors to further explore the effects of PAP inhibition on EGFR endocytic trafficking and its consequences on EGFR-dependent cancer cell line models. PAP inhibition not only made EGFR inaccessible to stimuli but also prolonged the signaling lifetime of ligand-activated EGFR in recycling endosomes. Strikingly, such endocytic perturbations applied in acute/intermittent PAP inhibitor treatments selectively impaired cell proliferation/viability sustained by an exaggerated EGFR function. Phospholipase D inhibition with FIPI (5-fluoro-2-indolyl des-chlorohalopemide) and PDE4 inhibition with rolipram abrogated both the anti-tumoral and endocytic effects of PAP inhibition. Prolonged treatments with a low concentration of PAP inhibitors, although without detectable endocytic effects, still counteracted cell proliferation, induced apoptosis and decreased anchorage-independent growth of cells bearing EGFR oncogenic influences. Overall, our results show that PAP inhibitors can counteract EGFR oncogenic traits, including receptor overexpression or activating mutations resistant to current tyrosine kinase inhibitors, perturbing EGFR endocytic trafficking and perhaps other as yet unknown processes, depending on treatment conditions. This puts PAP activity forward as a new suitable target against EGFR-driven malignancy.

  18. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  19. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    USDA-ARS?s Scientific Manuscript database

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  20. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  1. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  2. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  3. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  4. Mechanism of triclosan inhibition of bacterial fatty acid synthesis.

    PubMed

    Heath, R J; Rubin, J R; Holland, D R; Zhang, E; Snow, M E; Rock, C O

    1999-04-16

    Triclosan is a broad-spectrum antibacterial agent that inhibits bacterial fatty acid synthesis at the enoyl-acyl carrier protein reductase (FabI) step. Resistance to triclosan in Escherichia coli is acquired through a missense mutation in the fabI gene that leads to the expression of FabI[G93V]. The specific activity and substrate affinities of FabI[G93V] are similar to FabI. Two different binding assays establish that triclosan dramatically increases the affinity of FabI for NAD+. In contrast, triclosan does not increase the binding of NAD+ to FabI[G93V]. The x-ray crystal structure of the FabI-NAD+-triclosan complex confirms that hydrogen bonds and hydrophobic interactions between triclosan and both the protein and the NAD+ cofactor contribute to the formation of a stable ternary complex, with the drug binding at the enoyl substrate site. These data show that the formation of a noncovalent "bi-substrate" complex accounts for the effectiveness of triclosan as a FabI inhibitor and illustrates that mutations in the FabI active site that interfere with the formation of a stable FabI-NAD+-triclosan ternary complex acquire resistance to the drug.

  5. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  6. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  7. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  8. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  9. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    USDA-ARS?s Scientific Manuscript database

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  10. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.

    PubMed

    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo

    2007-09-14

    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  11. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  12. Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

    PubMed Central

    Parsons, Joshua B.; Rock, Charles O.

    2011-01-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

  13. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  14. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  15. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central

    2016-01-01

    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  16. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R

    1998-01-01

    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  17. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  18. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  19. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    SciTech Connect

    Standaert, Robert F; Park, Dr Seung Bum

    2006-01-01

    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  20. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  1. Cross-talk phosphorylations by protein kinase C and Pho85p-Pho80p protein kinase regulate Pah1p phosphatidate phosphatase abundance in Saccharomyces cerevisiae.

    PubMed

    Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2014-07-04

    Yeast Pah1p is the phosphatidate phosphatase that catalyzes the penultimate step in triacylglycerol synthesis and plays a role in the transcriptional regulation of phospholipid synthesis genes. The enzyme is multiply phosphorylated, some of which is mediated by Pho85p-Pho80p, Cdc28p-cyclin B, and protein kinase A. Here, we showed that Pah1p is a bona fide substrate of protein kinase C; the phosphorylation reaction was time- and dose-dependent and dependent on the concentrations of ATP (Km = 4.5 μm) and Pah1p (Km = 0.75 μm). The stoichiometry of the reaction was 0.8 mol of phosphate/mol of Pah1p. By combining mass spectrometry, truncation analysis, site-directed mutagenesis, and phosphopeptide mapping, we identified Ser-677, Ser-769, Ser-773, and Ser-788 as major sites of phosphorylation. Analysis of Pah1p phosphorylations by different protein kinases showed that prephosphorylation with protein kinase C reduces its subsequent phosphorylation with protein kinase A and vice versa. Prephosphorylation with Pho85p-Pho80p had an inhibitory effect on its subsequent phosphorylation with protein kinase C; however, prephosphorylation with protein kinase C had no effect on the subsequent phosphorylation with Pho85p-Pho80p. Unlike its phosphorylations by Pho85p-Pho80p and protein kinase A, which cause a significant reduction in phosphatidate phosphatase activity, the phosphorylation of Pah1p by protein kinase C had a small stimulatory effect on the enzyme activity. Analysis of phosphorylation-deficient forms of Pah1p indicated that protein kinase C does not have a major effect on its location or its function in triacylglycerol synthesis, but instead, the phosphorylation favors loss of Pah1p abundance when it is not phosphorylated with Pho85p-Pho80p. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Pho85p-Pho80p Phosphorylation of Yeast Pah1p Phosphatidate Phosphatase Regulates Its Activity, Location, Abundance, and Function in Lipid Metabolism*♦

    PubMed Central

    Choi, Hyeon-Son; Su, Wen-Min; Han, Gil-Soo; Plote, Devin; Xu, Zhi; Carman, George M.

    2012-01-01

    The yeast Pah1p phosphatidate phosphatase, which catalyzes the penultimate step in the synthesis of triacylglycerol and plays a role in the transcriptional regulation of phospholipid synthesis genes, is a cytosolic enzyme that associates with the nuclear/endoplasmic reticulum membrane to catalyze the dephosphorylation of phosphatidate to yield diacylglycerol. Pah1p is phosphorylated on seven (Ser-110, Ser-114, Ser-168, Ser-602, Thr-723, Ser-744, and Ser-748) sites that are targets for proline-directed protein kinases. In this work, we showed that the seven sites are phosphorylated by Pho85p-Pho80p, a protein kinase-cyclin complex known to regulate a variety of cellular processes. The phosphorylation of recombinant Pah1p was time- and dose-dependent and dependent on the concentrations of ATP (3.7 μm) and Pah1p (0.25 μm). Phosphorylation reduced (6-fold) the catalytic efficiency (Vmax/Km) of Pah1p and reduced (3-fold) its interaction (Kd) with liposomes. Alanine mutations of the seven sites ablated the inhibitory effect that Pho85p-Pho80p had on Pah1p activity and on the interaction with liposomes. Analysis of pho85Δ mutant cells, phosphate-starved wild type cells, and cells expressing phosphorylation-deficient forms of Pah1p indicated that loss of Pho85p-Pho80p phosphorylation reduced Pah1p abundance. In contrast, lack of Nem1p-Spo7p, the phosphatase complex that dephosphorylates Pah1p at the nuclear/endoplasmic reticulum membrane, stabilized Pah1p abundance. Although loss of phosphorylation caused a decrease in abundance, a greater amount of Pah1p was associated with membranes when compared with phosphorylated enzyme, and the loss of phosphorylation allowed bypass of the Nem1p-Spo7p requirement for Pah1p function in the synthesis of triacylglycerol. PMID:22334681

  3. Synthesis of hyaluronic acid by human peritoneal mesothelial cells: effect of cytokines and dialysate.

    PubMed

    Breborowicz, A; Korybalska, K; Grzybowski, A; Wieczorowska-Tobis, K; Martis, L; Oreopoulos, D G

    1996-01-01

    To assess effects of the inflammatory cytokines (IL-1-beta, TNF-alpha, TGF-beta 1) and dialysate effluent on synthesis of hyaluronic acid by human peritoneal mesothelial cells (HMC) in in vitro culture. Dialysate effluent was collected after the overnight dwell of Dianeal 1.5% from patients during CAPD training. HMC were obtained from omentum from nonuremic donors or were harvested from the dialysate effluent from CAPD patients. Synthesis of hyaluronic acid was studied on monolayers of HMC, which were deprived of serum 48 hours prior to experiment. Effects of cytokines were tested in a medium with low serum concentration (0.1%) or in medium mixed (1:1 v/v) with the autologous dialysate. Hyaluronic acid level in medium was measured with radioimmunoassay. Cytokines enhanced synthesis of hyaluronic acid by HMC, and the strongest effect was induced by IL-1. Effluent dialysate stimulates synthesis of hyaluronic acid stronger than 10% FCS. Effluent dialysate and IL-1 synergistically enhance synthesis of hyaluronic acid by HMC. Effluent dialysate from CAPD patients stimulates production of hyaluronic acid by HMC and acts synergistically with cytokines.

  4. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.

    PubMed

    Oudot, F; Grynberg, A; Sergiel, J P

    1995-01-01

    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  5. Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.

    PubMed

    Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2017-08-01

    Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.

  6. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  7. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.

    PubMed

    Gray, W J; Midgley, J E

    1972-08-01

    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  8. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  9. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-06-28

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  10. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  11. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  12. [Abiogenic photochemical synthesis of amino acids in an aqueous medium containing carbohydrates and nitrates].

    PubMed

    Khenokh, M A; Nikolaeva, M V

    1977-01-01

    Ultraviolet light (PRK-2) induces the formation of various amino acids (lysine, asparaginic, as well as traces of some other acids) in mannose, glucose and arabinose solutions containing various nitrates. K+, Co2+, Ni2+ and Fe3+ significantly sensitize the formation of amino acids. In the atmosphere of N2, synthesis of appreciable amounts of glutamic acid takes place, wherease in the atmosphere of O2 or CO2 the latter is produced only in traces. Photolysis of glucose and mannose in nitrate-free solutions in the atmosphere of N2 results in the formation of lysine and glutamic acid. The data obtained show that in pre-biologic conditions in the hydrosphere of Earth (possibly, of other planets as well), abiogenically formed organic substances, e. g. carbohydrates, unter the influence of UV irradiation could be transformed into amino acids. Nitrates present in the water milieu could serve as a source of nitrogen in the amino acids synthesis.

  13. An Unconventional Diacylglycerol Kinase That Regulates Phospholipid Synthesis and Nuclear Membrane Growth*♦

    PubMed Central

    Han, Gil-Soo; O'Hara, Laura; Carman, George M.; Siniossoglou, Symeon

    2008-01-01

    Changes in nuclear size and shape during the cell cycle or during development require coordinated nuclear membrane remodeling, but the underlying molecular events are largely unknown. We have shown previously that the activity of the conserved phosphatidate phosphatase Pah1p/Smp2p regulates nuclear structure in yeast by controlling phospholipid synthesis and membrane biogenesis at the nuclear envelope. Two screens for novel regulators of phosphatidate led to the identification of DGK1. We show that Dgk1p is a unique diacylglycerol kinase that uses CTP, instead of ATP, to generate phosphatidate. DGK1 counteracts the activity of PAH1 at the nuclear envelope by controlling phosphatidate levels. Overexpression of DGK1 causes the appearance of phosphatidate-enriched membranes around the nucleus and leads to its expansion, without proliferating the cortical endoplasmic reticulum membrane. Mutations that decrease phosphatidate levels decrease nuclear membrane growth in pah1Δ cells. We propose that phosphatidate metabolism is a critical factor determining nuclear structure by regulating nuclear membrane biogenesis. PMID:18458075

  14. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  15. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  16. Synthesis of α-amino acids based on chiral tricycloiminolactone derived from natural (+)-camphor.

    PubMed

    Luo, Yong-Chun; Zhang, Huan-Huan; Wang, Yao; Xu, Peng-Fei

    2010-10-19

    Amino acids are one of the most important classes of the building blocks of life: they are the structural subunits of proteins, peptides, and many secondary metabolites. In addition to the 20 α-amino acids that constitute the backbone of proteins, hundreds of other natural α-amino acids have been discovered either in free form or as components in natural products. The difference between these molecules is the substituents at the chiral carbon situated between the amino and carboxyl moieties; this carbon (and any atom along a chain attached to it) is thus an important synthetic target. Because tailor-made α-amino acids are increasingly popular in biochemistry and organic synthesis, further refinement in synthetic methods to generate both natural (L-configuration) and unnatural (D-configuration) amino acids is a very active area of current research. In this Account, we examine the tricycloiminolactones, which are versatile glycine equivalents derived from natural camphor. We have developed the tricycloiminolactones in our laboratory and used them in the synthesis of several kinds of enantiopure α-amino acids. As nucleophiles, enolated tricycloiminolactones were shown to successfully participate in alkylations, Aldol reactions, Michael additions, and Mannich reactions. These reactions all gave excellent stereoselectivities and high yields. Simple conversion of the products offered α-alkyl-α-amino acids, α,α-dialkyl-α-amino acids, β-hydroxy-α-amino acids, α,γ-diamino acids, and α,β-diamino acids. One particular advantage is that the same electrophile can react with two chiral templates in the same way, thus affording access to both enantiomeric amino acids. In other words, some natural (L-configuration) α-amino acids and their unnatural (D-configuration) counterparts can be prepared very conveniently. The relation between substrate structures and product stereoconformations derived from our investigations serves as a convenient guide in the synthesis of

  17. Pyrazinoic acid decreases the proton motive force, respiratory ATP synthesis activity, and cellular ATP levels.

    PubMed

    Lu, Ping; Haagsma, Anna C; Pham, Hoang; Maaskant, Janneke J; Mol, Selena; Lill, Holger; Bald, Dirk

    2011-11-01

    Pyrazinoic acid, the active form of the first-line antituberculosis drug pyrazinamide, decreased the proton motive force and respiratory ATP synthesis rates in subcellular mycobacterial membrane assays. Pyrazinoic acid also significantly lowered cellular ATP levels in Mycobacterium bovis BCG. These results indicate that the predominant mechanism of killing by this drug may operate by depletion of cellular ATP reserves.

  18. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  19. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  20. Prolonged stimulation of protein synthesis by leucine is dependent on amino acid availability

    USDA-ARS?s Scientific Manuscript database

    Leucine is unique among the amino acids in its ability to enhance protein synthesis by activating translation initiation (Kimball and Jefferson, 2005). Our laboratory has shown that raising leucine to postprandial levels, whilst keeping all other amino acids at the post absorptive, level acutely st...

  1. Facile synthesis of nucleic acid-polymer amphiphiles and their self-assembly.

    PubMed

    Jia, Fei; Lu, Xueguang; Tan, Xuyu; Zhang, Ke

    2015-05-07

    A solid-phase synthesis for nucleic acid-polymer amphiphiles is developed. Using this strategy, several DNA-b-polymer amphiphiles are synthesized, and their self-assembly in aqueous solution is investigated. This general method can in principle be extended to nearly all polymers synthesized by atom transfer radical polymerization to produce a variety of nucleic acid-polymer conjugates.

  2. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.

    1966-01-01

    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  3. Quercetin inhibits fatty acid and triacylglycerol synthesis in rat-liver cells.

    PubMed

    Gnoni, G V; Paglialonga, G; Siculella, L

    2009-09-01

    Quercetin plays a cardiovascular protective role because of its antioxidant capacity and ability to modulate dyslipidemia. As alterations in hepatic lipid synthesis are crucial to the regulation of serum lipid levels, we investigated the quercetin effect on lipogenesis in rat liver cells. The effect of quercetin on the rate of synthesis of fatty acids, cholesterol, neutral lipids, phospholipids and very-low-density lipoproteins (VLDL) was investigated in rat hepatocyte suspensions following [1-(14)C]acetate incorporation into these lipid fractions. Enzyme activities of acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) as well as diacylglycerol acyltransferase (DGAT) and 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoA-R), pace-setting steps of de novo fatty acid, triacylglycerol (TAG) and cholesterol synthesis respectively were assayed in digitonin-permeabilized hepatocytes. Within 30 min of quercetin addition to the hepatocytes, inhibition (IC50 approximately 25 microM) of fatty acid synthesis occurred. A reduction in label incorporation mainly into TAG was observed. Among neosynthesized fatty acids, palmitic acid formation was greatly reduced, suggesting that enzymatic step(s) of de novo fatty synthesis was affected. Only ACC activity was noticeably reduced, but no change in FAS activity was observed. DGAT activity was also inhibited. The decreased intracellular TAG content was paralleled by a reduction in acetate incorporation into VLDL-TAG. Conversely, cholesterol synthesis and HMG-CoA-R were not significantly affected by quercetin. In hepatocytes from normal rats, the quercetin-induced decrease in both de novo fatty acid and TAG synthesis, with a consequent reduction in VLDL-TAG formation, may represent a potential mechanism contributing to the reported hypotriacylglycerolemic effect of quercetin.

  4. Formamide Synthesis through Borinic Acid Catalysed Transamidation under Mild Conditions.

    PubMed

    Dine, Tharwat Mohy El; Evans, David; Rouden, Jacques; Blanchet, Jérôme

    2016-04-18

    A highly efficient and mild transamidation of amides with amines co-catalysed by borinic acid and acetic acid has been reported. A wide range of functionalised formamides was synthesized in excellent yields, including important chiral α-amino acid derivatives, with minor racemisation being observed. Experiments suggested that the reaction rely on a cooperative catalysis involving an enhanced boron-derived Lewis acidity rather than an improved Brønsted acidity of acetic acid.

  5. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  6. Total synthesis of racemic and (R) and (S)-4-methoxyalkanoic acids and their antifungal activity.

    PubMed

    Das, Biswanath; Shinde, Digambar Balaji; Kanth, Boddu Shashi; Kamle, Avijeet; Kumar, C Ganesh

    2011-07-01

    The total synthesis of 4-methoxydecanoic acid and 4-methoxyundecanoic acid in racemic and stereoselective [(R) and (S)] forms has been accomplished. For stereoselective synthesis of the compounds (S) and (R)-BINOL complexes have been used to generate the required chiral centres. The antifungal activity of these compounds has been studied against different organisms and the results were found to be impressive. The activity of the compounds in racemic and in stereoselective forms was compared. (R)-4-Methoxydecanoic acid was found to be most potent (MIC: 0.019 mg/mL against Candida albicans MTCC 227, C. albicans MTCC 4748, Aspergillus brasiliensis (niger) MTCC 281 and Issatchenkia orientalis MTCC 3020).

  7. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  8. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  9. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  10. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  11. Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water

    NASA Technical Reports Server (NTRS)

    Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.

    2017-01-01

    Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing

  12. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  13. Detection of Serum Lysophosphatidic Acids Using Affinity Binding and Surface Enhanced Laser Deorption/Ionization (SELDI) Time of Flight Mass Spectrometry

    DTIC Science & Technology

    2006-04-01

    Byun H-S., Bittman R., Fan, D., Murph, M., Mills G.B., Tigyi G., 2006 Carba analogs of cyclic phosphatidic acid are selective inhibitors of autotaxin...O OH O P O – O –O O O OH O P O O –O CH2CH2N+(CH3)3 CholineATX/lysoPLD sPLA2 PLA1 Phosphatidic acid (PA) Lysophosphatidic acid (LPA...two distinct enzymatic mechanisms: a | hydrolysis of phosphatidic acid (PA) by soluble phospholipase A2 (sPLA2), which cleaves the fatty acyl chain

  14. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  15. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures

    PubMed Central

    Rodas-Junco, Beatriz A; Cab-Guillen, Yahaira; Muñoz-Sanchez, J Armando; Vázquez-Flota, Felipe; Monforte-Gonzalez, Miriam; Hérnandez-Sotomayor, S M Teresa

    2013-01-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was dim