Science.gov

Sample records for phosphatidic acid synthesis

  1. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  2. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  3. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  4. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  5. Synthesis and Pharmacological Evaluation of the Stereoisomersof 3-Carba Cyclic-Phosphatidic Acid

    PubMed Central

    Gupte, Renuka; Siddam, Anjaih; Lu, Yan; Li, Wei; Fujiwara, Yuko; Panupinthu, Nattapon; Truc-ChiPham; Baker, Daniel L.; Parrill, Abby L.; Gotoh, Mari; Murakami-Murofushi, Kimiko; Mills, Gordon B.; Tigyi, Gabor; Miller, Duane D.

    2010-01-01

    Cyclic phosphatidic acid (CPA) is a naturally occurring analog of lysophosphatidic acid (LPA) in which the sn-2 hydroxy group forms a 5-membered ring with the sn-3 phosphate. Here we describe the synthesis of R-3-CCPA and S-3-CCPA along with their pharmacological properties as inhibitors of lysophospholipase D/autotaxin, agonists of the LPA5 GPCR, and blockers of lung metastasis of B16-F10 melanoma cells in a C57BL/6 mouse model. S-3CCPA was significantly more efficacious in the activation of LPA5 compared to the R stereoisomer. In contrast, no stereoselective differences were found between the two isomers toward the inhibition of autotaxin or lung metastasis of B16-F10 melanoma cells in vivo. These results extend the potential utility of these compounds as potential lead compounds warranting evaluation as cancer therapeutics. PMID:21051230

  6. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  7. Synthesis of lyso(bis)phosphatidic acid in rabbit alveolar macrophages

    SciTech Connect

    Thornburg, T.; Roddick, V.; Wykle, R.L.; Waite, M.

    1987-05-01

    Reported here are studies on the biosynthetic pathway used by normal and BCG elicited alveolar macrophages for the synthesis of lyso(bis)phosphatidic acid (L(bis)PA). Earlier observations by this laboratory have shown that although L(bis)PA is abundant in these cells, there is little de novo synthesis of this lipid. Diaceyl phosphatidylglycerol (PG) labeled with either (1,2,3-/sup 3/H) glycerol or /sup 32/P demonstrated that PG is used as an exogenous substrate for L(bis)PA formation; both glycerol moieties are incorporated. Other phospholipids do not have this capacity. BCG-elicited macrophages are capable of only one-quarter the synthesis of L(bis)PA seen with normal cells, and also show a decreased amount of cell associated substrate. In addition, (/sup 3/H) 1-0-alkyl PG was used as a substrate to test the importance of the sn-1 acyl linkage in the synthetic pathway. This substrate produced less L(bis)PA while dramatically increasing the amounts of labelled phosphatidylethanolamine and phosphatidylcholine within the cell. The alkyl substrate also showed increased uptake by the cell. They conclude that the hydrolysis of the acyl group at the sn-1 position of PG is essential in the synthetic pathway leading to the production of L(bis)PA. They further suggest that the PG used by these cells as an exogenous substrate in vitro is obtained from the PG-rich surfactant surrounding the alveolar macrophage.

  8. Lyso(bis)phosphatidic acid: a preferred donor of arachidonic acid for macrophage-synthesis of eicosanoids

    SciTech Connect

    Cochran, F.; Roddick, V.; Connor, J.; Waite, M.

    1986-05-01

    In order to dissect mechanisms of arachidonic acid (20:4) metabolism, two cell populations were investigated, resident (AM) and Bacillus Calmette-Guerin-activated (BCG-AM) rabbit alveolar macrophages. After purified AM were labeled overnight with (/sup 3/H)20:4, radioactivity was localized primarily within lyso(bis)phosphatidic acid (L(bis)PA) (13.1%), phosphatidylethanolamine (PE) (22.8%) and phosphatidylcholine (PC) (26.7%), with lesser amounts recovered in phosphatidyl-serine (PS) plus phosphatidylinositol (PI) (9.2%). By contrast, analysis of the phospholipid classes from prelabeled BCG-AM revealed that the mass of L(bis)PA as well as its (/sup 3/H)20:4 content was profoundly decreased while other BCG-AM phospholipids remained unchanged. When (/sup 3/H)20:4-labeled AM were stimulated with 1 ..mu..M 12-0-tetradecanoyl-phorbol-13-acetate (TPA), a loss of (/sup 3/H)20:4 was observed from L(bis)PA, PE, PC, and PS/PI with a corresponding increase in eicosanoid synthesis. BCG-AM exposed to either TPA or 3.8 ..mu..M Ca/sup +2/ ionophore A23187 liberated (/sup 3/H)20:4 solely from Pe and PC. BCG-AM, which exhibited depressed eicosanoid formation, consistently failed to deacylate (/sup 3/H)20:4 from L(bis)PA or PI. Their evidence suggests that the diminution of eicosanoid synthesis by BCG-AM may be due to the reduction of 20:4 contained within specific phospholipid pools, namely L(bis)PA.

  9. Phosphatidic acid synthesis in the heart. 1. Effect of age and species difference in the mitochondrial and microsomal synthesis.

    PubMed

    Kako, K J; Zaror-Behrens, G; Peckett, S D

    1977-04-01

    the age and species differences in acyltransferase activities support a view that the mitochondrial fraction of both rat and rabbit hearts, in addition to the microsomal enzymes, is capable of catalyzing the de novo synthesis of phosphatidic acid.

  10. Acetal phosphatidic acids: novel platelet aggregating agents.

    PubMed

    Brammer, J P; Maguire, M H; Walaszek, E J; Wiley, R A

    1983-05-01

    1 Palmitaldehyde, olealdehyde and linolealdehyde acetal phosphatidic acids induced rapid shape change and dose-dependent biphasic aggregation of human platelets in platelet-rich plasma; aggregation was reversible at low doses and irreversible at high doses of the acetal phosphatidic acids. The palmitaldehyde congener elicited monophasic dose-dependent aggregation of sheep platelets in platelet-rich plasma.2 The threshold concentration for palmitaldehyde acetal phosphatidic acid (PGAP)-induced platelet aggregation was 2.5-5 muM for human platelets and 0.25-0.5 muM for sheep platelets. PGAP was 4-5 times as potent versus human platelets as the olealdehyde and linolealdehyde acetal phosphatidic acids, which were equipotent.3 PGAP-induced irreversible aggregation of [(14)C]-5-hydroxytryptamine ([(14)C]-5-HT)-labelled human platelets in platelet-rich plasma was accompanied by release of 44.0+/-2.4% (s.e.) of the platelet [(14)C]-5-HT; reversible aggregation was not associated with release. In contrast, PGAP-induced release of [(14)C]-5-HT-labelled sheep platelets was dose-dependent.4 The adenosine diphosphate (ADP) antagonist, 2-methylthio-AMP, and the cyclo-oxygenase inhibitor, aspirin, abolished PGAP-induced second phase aggregation and release in human platelets but did not affect the first, reversible, phase of aggregation. Both the first and second phases of PGAP-induced aggregation were abolished by chlorpromazine, by the phospholipase A(2) inhibitor, mepacrine, and by nmolar concentrations of prostaglandin E(1) (PGE(1)); these agents abolished the second, but not the first phase of ADP-induced aggregation.5 The related phospholipids, lecithin, lysolecithin and phosphatidic acid, at <100 muM, neither induced aggregation of human platelets in platelet-rich plasma, nor modified PGAP-induced aggregation; 1-palmityl lysophosphatidic acid elicited aggregation of human platelets at a threshold concentration of 100 muM.6 It is concluded that the acetal phosphatidic acids

  11. Accumulation of Phosphatidic Acid Increases Vancomycin Resistance in Escherichia coli

    PubMed Central

    Sutterlin, Holly A.; Zhang, Sisi

    2014-01-01

    In Gram-negative bacteria, lipopolysaccharide (LPS) contributes to the robust permeability barrier of the outer membrane, preventing entry of toxic molecules such as antibiotics. Mutations in lptD, the beta-barrel component of the LPS transport and assembly machinery, compromise LPS assembly and result in increased antibiotic sensitivity. Here, we report rare vancomycin-resistant suppressors that improve barrier function of a subset of lptD mutations. We find that all seven suppressors analyzed mapped to the essential gene cdsA, which is responsible for the conversion of phosphatidic acid to CDP-diacylglycerol in phospholipid biosynthesis. These cdsA mutations cause a partial loss of function and, as expected, accumulate phosphatidic acid. We show that this suppression is not confined to mutations that cause defects in outer membrane biogenesis but rather that these cdsA mutations confer a general increase in vancomycin resistance, even in a wild-type cell. We use genetics and quadrupole time of flight (Q-TOF) liquid chromatography-mass spectrometry (LC-MS) to show that accumulation of phosphatidic acid by means other than cdsA mutations also increases resistance to vancomycin. We suggest that increased levels of phosphatidic acid change the physical properties of the outer membrane to impede entry of vancomycin into the periplasm, hindering access to its target, an intermediate required for the synthesis of the peptidoglycan cell wall. PMID:24957626

  12. Phosphatidic acid: an emerging plant lipid second messenger.

    PubMed

    Munnik, T

    2001-05-01

    Evidence is accumulating that phosphatidic acid is a second messenger. Its level increases within minutes of a wide variety of stress treatments including ethylene, wounding, pathogen elicitors, osmotic and oxidative stress, and abscisic acid. Enhanced signal levels are rapidly attenuated by phosphorylating phosphatidic acid to diacylglycerol pyrophosphate. Phosphatidic acid is the product of two signalling pathways, those of phospholipases C and D, the former in combination with diacylglycerol kinase. Families of these genes are now being cloned from plants. Several downstream targets of phosphatidic acid have been identified, including protein kinases and ion channels.

  13. Insulin activates glycerol-3-phosphate acyltransferase (de novo phosphatidic acid synthesis) through a phospholipid-derived mediator. Apparent involvement of Gi alpha and activation of a phospholipase C.

    PubMed

    Vila, M C; Milligan, G; Standaert, M L; Farese, R V

    1990-09-18

    We studied the mechanism whereby insulin activates de novo phosphatidic acid synthesis in BC3H-1 myocytes. Insulin rapidly activated glycerol-3-phosphate acyltransferase (G3PAT) in intact and cell-free preparations of myocytes in a dose-related manner. The apparent Km of the enzyme was decreased by treatment with insulin, whereas the Vmax was unaffected. No activation was found by ACTH, insulin-like growth factor-I, angiotensin II, or phenylephrine, but epidermal growth factor, which, like insulin, is known to activate de novo phosphatidic acid synthesis in intact myocytes, also stimulated G3PAT activity. In homogenates or membrane fractions, the effect of insulin on G3PAT was fully mimicked by nonspecific or phosphatidylinositol (PI)-specific phospholipase C (PLC). An antiserum raised against PI-glycan-PLC completely blocked the effect of insulin on G3PAT. Although the above findings suggested involvement of a PLC in insulin-induced activation of G3PAT, neither diacylglycerol nor protein kinase C activation appeared to be involved. On the other hand, insulin stimulated the release of a cytosolic factor, which activated membrane-associated G3PAT. This cytosolic factor had a molecular weight of less than 5K as determined by Sephadex G-25 chromatography. NaF, a phosphatase inhibitor, blocked the activation of G3PAT by insulin, suggesting involvement of a phosphatase. Insulin-induced activation of G3PAT was also blocked by pretreatment of intact myocytes with pertussis toxin and by prior addition, to homogenates, of an antiserum that recognizes the C-terminal decapeptide of Gi alpha.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Purification, characterization, and bioinformatics studies of phosphatidic acid phosphohydrolase from Lagenaria siceraria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidic acid phosphohydrolase (PAP), EC 3.1.3.4, is the penultimate step in the Kennedy pathway of triacyl glycerol (TAG) synthesis leading to the formation of diacyl glycerol (DAG), which is a key intermediate in TAG synthesis. We partially purified a soluble PAP from mid maturing seeds of bot...

  15. Phosphatidic acid modulation of Kv channel voltage sensor function.

    PubMed

    Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick

    2014-01-01

    Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid. PMID:25285449

  16. The formation and continuous turnover of a fraction of phosphatidic acid on stimulation of NaC1 secretion by acetylcholine in the salt gland.

    PubMed

    Hokin, M R; Hokin, L E

    1967-03-01

    Acetylcholine, which stimulates NaCl secretion in the avian salt gland, causes the rapid formation of a fraction of phosphatidic acid, as measured by (32)P incorporation, which amounts maximally to about 0.18 micromoles per g of fresh tissue. This does not appear to involve synthesis of the diglyceride moiety of phosphatidic acid, as measured by glycerol-1-(14)C incorporation. It presumably involves formation of phosphatidic acid by the diglyceride kinase pathway from preformed diglyceride and ATP. The specific activity of the AT(32)P of the tissue is not increased in the presence of acetylcholine. At time intervals after addition of acetylcholine during which a full response, measured as increased O(2) uptake, may be observed, phosphatidic acid appears to be the only phosphatide which shows any increase either in total (32)P radioactivity or in net specific acitvity. This responsive fraction of phosphatidic acid undergoes continuous turnover of its phosphate moiety. There is no evidence that this turnover is due to the phosphatidic acid acting as a pool of intermediate for the synthesis of other phospholipids or glycerides. The responsive fraction amounts to not more than 20% of the total phosphatidic acid of the tissue; it does not mix with the other (non-responsive) phosphatidic acid of the tissue. The observations suggest that this phosphatidic acid plays some role in the over-all secretory process.

  17. Angiotensin II induces phosphatidic acid formation in neonatal rat cardiac fibroblasts: evaluation of the roles of phospholipases C and D.

    PubMed

    Booz, G W; Taher, M M; Baker, K M; Singer, H A

    1994-12-21

    Phosphatidic acid has been proposed to contribute to the mitogenic actions of various growth factors. In 32P-labeled neonatal rat cardiac fibroblasts, 100 nM [Sar1]angiotensin II was shown to rapidly induce formation of 32P-phosphatidic acid. Levels peaked at 5 min (1.5-fold above control), but were partially sustained over 2 h. Phospholipase D contributed in part to phosphatidic acid formation, as 32P- or 3H-phosphatidylethanol was produced when cells labeled with [32P]H3PO4 or 1-O-[1,2- 3H]hexadecyl-2-lyso-sn-glycero-3-phosphocholine were stimulated in the presence of 1% ethanol. [Sar1]angiotensin II-induced phospholipase D activity was transient and mainly mediated through protein kinase C (PKC), since PKC downregulation reduced phosphatidylethanol formation by 68%. Residual activity may have been due to increased intracellular Ca2+, as ionomycin also activated phospholipase D in PKC-depleted cells. Phospholipase D did not fully account for [Sar1]angiotensin II-induced phosphatidic acid: 1) compared to PMA, a potent activator of phospholipase D, [Sar1]angiotensin II produced more phosphatidic acid relative to phosphatidylethanol, and 2) PKC downregulation did not affect [Sar1]angiotensin II-induced phosphatidic acid formation. The diacylglycerol kinase inhibitor R59949 depressed [Sar1]angiotensin II-induced phosphatidic acid formation by only 21%, indicating that activation of a phospholipase C and diacylglycerol kinase also can not account for the bulk of phosphatidic acid. Thus, additional pathways not involving phospholipases C and D, such as de novo synthesis, may contribute to [Sar1]angiotensin II-induced phosphatidic acid in these cells. Finally, as previously shown for [Sar1]angiotensin II, phosphatidic acid stimulated mitogen activated protein (MAP) kinase activity.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. Stimulation and binding of myocardial phospholipase C by phosphatidic acid.

    PubMed

    Henry, R A; Boyce, S Y; Kurz, T; Wolf, R A

    1995-08-01

    Exposure of adult ventricular myocytes to exogenous natural phosphatidic acid results in the production of inositol phosphates by unknown mechanism(s). We characterized stimulation of myocytic phosphoinositide-specific phospholipase C (PLC) by synthetic dioleoyl phosphatidic acid (PA) as a potential mechanism for modulation of inositol phosphate production. Our data demonstrate that exogenous PA, at 10(-8)-10(-5) M, caused a concentration-dependent increase in inositol 1,4,5-trisphosphate in adult rabbit ventricular myocytes. PA also caused a concentration-dependent increase in in vitro activity of myocytic PLC in the presence or absence of ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA). PLC-delta 1, the predominant isozyme of PLC expressed in adult rabbit ventricular myocytes, bound to liposomes of PA with high affinity in the presence of EGTA. The phosphomonoester group of PA was critical to in vitro stimulation of myocytic PLC activity and high-affinity binding of PLC-delta 1. We propose that binding of PLC-delta 1 to phosphatidic acid may be a novel mechanism for dynamic membrane association and modulation of PLC in adult ventricular myocytes.

  19. Spontaneous curvature of phosphatidic acid and lysophosphatidic acid.

    PubMed

    Kooijman, Edgar E; Chupin, Vladimir; Fuller, Nola L; Kozlov, Michael M; de Kruijff, Ben; Burger, Koert N J; Rand, Peter R

    2005-02-15

    The formation of phosphatidic acid (PA) from lysophosphatidic acid (LPA), diacylglycerol, or phosphatidylcholine plays a key role in the regulation of intracellular membrane fission events, but the underlying molecular mechanism has not been resolved. A likely possibility is that PA affects local membrane curvature facilitating membrane bending and fission. To examine this possibility, we determined the spontaneous radius of curvature (R(0p)) of PA and LPA, carrying oleoyl fatty acids, using well-established X-ray diffraction methods. We found that, under physiological conditions of pH and salt concentration (pH 7.0, 150 mM NaCl), the R(0p) values of PA and LPA were -46 A and +20 A, respectively. Thus PA has considerable negative spontaneous curvature while LPA has the most positive spontaneous curvature of any membrane lipid measured to date. The further addition of Ca(2+) did not significantly affect lipid spontaneous curvature; however, omitting NaCl from the hydration buffer greatly reduced the spontaneous curvature of PA, turning it into a cylindrically shaped lipid molecule (R(0p) of -1.3 x 10(2) A). Our quantitative data on the spontaneous radius of curvature of PA and LPA at a physiological pH and salt concentration will be instrumental in developing future models of biomembrane fission.

  20. Insulin, concanavalin A, EGF, IFG-I and vanadate activate de novo phosphatidic acid and diacylglycerol synthesis, C-kinase, and glucose transport in BC3H-1 myocytes

    SciTech Connect

    Cooper, D.R.; Hernandez, H.; Konda, T.S.; Standaert, M.S.; Pollet, R.J.; Farese, R.V.

    1987-05-01

    The authors have reported that insulin stimulates de novo synthesis of phosphatidic acid (PA) which is metabolized directly to diacylglycerol (DG) in BS3H-1 myocytes; this is accompanied by increases in C-kinase activity in membrane and cytosolic extracts. This pathway may be involved in stimulating glucose transport and other metabolic processes. In this study, the authors have compared the effects of concanavalin A, EGF, IGF-I and sodium orthovanadate to insulin on PA/DG synthesis, C-kinase activity and glucose transport. All were found to be effective in stimulating glucose transport. Additionally, all activators rapidly increased the incorporation of (/sup 3/H)glycerol into DG and total glycerolipids, although none were as effective as insulin, which increased (/sup 3/H)DG 400% in 1 minute. Increased incorporation into phospholipids and triacylglycerols and to a lesser extent monoacylglycerol was also noted. They examined effects of concanavalin A and EGF on C-kinase activity and found that both agonists, like insulin, increase C-kinase activity in cytosolic and/or membrane fractions. Their findings raise the possibility that activation of receptors having associated tyrosine kinase activity may provoke some cellular responses through de novo PA/GD synthesis and C-kinase activation.

  1. Stimulating effect of phosphatidic acid on autophosphorylation of phosphorylase kinase.

    PubMed

    Negami, A I; Sasaki, H; Yamamura, H

    1985-09-16

    Autophosphorylation of phosphorylase kinase from rabbit skeletal muscle was stimulated by acidic phospholipids such as phosphatidic acid (PA), phosphatidylinositol, and phosphatidyl-serine. PA stimulated an initial velocity of autophosphorylation 3.8-fold. When fully autophosphorylated, about 11 mol of phosphate per tetramer (alpha beta gamma delta) were incorporated in the presence of PA and about 6.5 mol in the absence of PA. In the presence of PA (100 micrograms/ml), there was a concomitant enhancement of its kinase activity about 25-fold at pH 6.8. PA (100 micrograms/ml) sharply decreased an apparent Ka for Ca2+ on autophosphorylation from 4.0 X 10(-5) M to 1.0 X 10(-6) M. Available evidence indicates that the Ca2+-activated, PA-dependent autophosphorylation of phosphorylase kinase shows an ability to stimulate glycogen breakdown.

  2. Measuring phosphatidic acid phosphatase (EC 3.1.3.4) activity using two phosphomolybdate-based colorimetric methods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidate phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4), which is also known as PAP, catalyzes the dephosphorylation of phosphatidate (PtdOH) to form diacylglycerol (DAG) and inorganic phosphate. In eukaryotes, PAP driven reaction is the committed step in the synthesis of triacyl...

  3. Defective phosphatidic acid-phospholipase C signaling in diabetic cardiomyopathy.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Dibrov, Elena; Austria, J Alejandro; Sahi, Nidhi; Panagia, Vincenzo; Pierce, Grant N

    2004-03-26

    The effects of exogenous phosphatidic acid (PA) on Ca2+ transients and contractile activity were studied in cardiomyocytes isolated from chronic streptozotocin-induced diabetic rats. In control cells, 25 microM PA induced a significant increase in active cell shortening and Ca2+ transients. PA increased IP3 generation in the control cardiomyocytes and its inotropic effects were blocked by a phospholipase C inhibitor. In cardiomyocytes from diabetic rats, PA induced a 25% decrease in active cell shortening and no significant effect on Ca2+ transients. Basal and PA-induced IP3 generation in diabetic rat cardiomyocytes was 3-fold lower as compared to control cells. Sarcolemmal membrane PLC activity was impaired. Insulin treatment of the diabetic animals resulted in a partial recovery of PA responses. Our results, therefore, identify an important defect in the PA-PLC signaling pathway in diabetic rat cardiomyocytes, which may have significant implications for heart dysfunction during diabetes. PMID:15003542

  4. Defective phosphatidic acid-phospholipase C signaling in diabetic cardiomyopathy.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Dibrov, Elena; Austria, J Alejandro; Sahi, Nidhi; Panagia, Vincenzo; Pierce, Grant N

    2004-03-26

    The effects of exogenous phosphatidic acid (PA) on Ca2+ transients and contractile activity were studied in cardiomyocytes isolated from chronic streptozotocin-induced diabetic rats. In control cells, 25 microM PA induced a significant increase in active cell shortening and Ca2+ transients. PA increased IP3 generation in the control cardiomyocytes and its inotropic effects were blocked by a phospholipase C inhibitor. In cardiomyocytes from diabetic rats, PA induced a 25% decrease in active cell shortening and no significant effect on Ca2+ transients. Basal and PA-induced IP3 generation in diabetic rat cardiomyocytes was 3-fold lower as compared to control cells. Sarcolemmal membrane PLC activity was impaired. Insulin treatment of the diabetic animals resulted in a partial recovery of PA responses. Our results, therefore, identify an important defect in the PA-PLC signaling pathway in diabetic rat cardiomyocytes, which may have significant implications for heart dysfunction during diabetes.

  5. Lipin 2 binds phosphatidic acid by the electrostatic hydrogen bond switch mechanism independent of phosphorylation.

    PubMed

    Eaton, James M; Takkellapati, Sankeerth; Lawrence, Robert T; McQueeney, Kelley E; Boroda, Salome; Mullins, Garrett R; Sherwood, Samantha G; Finck, Brian N; Villén, Judit; Harris, Thurl E

    2014-06-27

    Lipin 2 is a phosphatidic acid phosphatase (PAP) responsible for the penultimate step of triglyceride synthesis and dephosphorylation of phosphatidic acid (PA) to generate diacylglycerol. The lipin family of PA phosphatases is composed of lipins 1-3, which are members of the conserved haloacid dehalogenase superfamily. Although genetic alteration of LPIN2 in humans is known to cause Majeed syndrome, little is known about the biochemical regulation of its PAP activity. Here, in an attempt to gain a better general understanding of the biochemical nature of lipin 2, we have performed kinetic and phosphorylation analyses. We provide evidence that lipin 2, like lipin 1, binds PA via the electrostatic hydrogen bond switch mechanism but has a lower rate of catalysis. Like lipin 1, lipin 2 is highly phosphorylated, and we identified 15 phosphosites. However, unlike lipin 1, the phosphorylation of lipin 2 is not induced by insulin signaling nor is it sensitive to inhibition of the mammalian target of rapamycin. Importantly, phosphorylation of lipin 2 does not negatively regulate either membrane binding or PAP activity. This suggests that lipin 2 functions as a constitutively active PA phosphatase in stark contrast to the high degree of phosphorylation-mediated regulation of lipin 1. This knowledge of lipin 2 regulation is important for a deeper understanding of how the lipin family functions with respect to lipid synthesis and, more generally, as an example of how the membrane environment around PA can influence its effector proteins. PMID:24811178

  6. Phosphatidic acid phosphatase and phospholipdase A activities in plasma membranes from fusing muscle cells.

    PubMed

    Kent, C; Vagelos, P R

    1976-06-17

    Plasma membrane from fusing embryonic muscle cells were assayed for phospholipase A activity to determine if this enzyme plays a role in cell fusion. The membranes were assayed under a variety of conditions with phosphatidylcholine as the substrate and no phospholipase A activity was found. The plasma membranes did contain a phosphatidic acid phosphatase which was optimally active in the presence of Triton X-100 and glycerol. The enzyme activity was constant from pH 5.2 to 7.0, and did not require divalent cations. Over 97% of the phosphatidic acid phosphatase activity was in the particulate fraction. The subcellular distribution of the phosphatidic acid phosphatase was the same as the distributions of the plasma membrane markers, (Na+ + k+)-ATPase and the acetylcholine receptor, which indicates that this phosphatase is located exclusively in the plasma membranes. There was no detectable difference in the phosphatidic acid phosphatase activities of plasma membranes from fusing and non-fusing cells.

  7. Phosphatidic acid stimulates inositol 1,4,5-trisphosphate production in adult cardiac myocytes.

    PubMed

    Kurz, T; Wolf, R A; Corr, P B

    1993-03-01

    The cellular content of phosphatidic acid can increase in response to several agonists either by phosphorylation of diacylglycerol after phospholipase C-catalyzed hydrolysis of phospholipids or directly through activation of phospholipase D. Although previous findings indicated that the generation of phosphatidic acid was exclusively a means of regulation of the cellular concentration of diacylglycerol, more recent studies have indicated that phosphatidic acid may also directly regulate several cellular functions. Accordingly, the present study was performed to assess whether phosphatidic acid could stimulate cardiac phospholipase C in intact adult rabbit ventricular myocytes. The mass of inositol 1,4,5-trisphosphate [Ins (1,4,5)P3] was determined by a specific and sensitive binding protein assay and by direct mass measurement using anion exchange chromatography for separation of selected inositol phosphates and gas chromatography and mass spectrometry for quantification of inositol monophosphate (IP1), inositol bisphosphate (IP2), inositol trisphosphate (IP3), and inositol tetrakisphosphate (IP4). Phosphatidic acid (10(-9)-10(-6) M) elicited a rapid concentration-dependent increase in Ins (1,4,5)P3 accumulation, with the peak fourfold to fivefold increase at 30 seconds of stimulation; the concentration required for 50% of maximal stimulation was 4.4 x 10(-8) M. The time course of individual inositol phosphates indicated a successive increase in the mass of IP3, IP4, IP2, and IP1 in response to stimulation with phosphatidic acid. The production of Ins (1,4,5)P3 in response to phosphatidic acid was not altered in the absence of extracellular calcium or in the presence of extracellular EGTA (10(-3) M). Thus, these findings indicate that phosphatidic acid is a potent activator of inositol phosphate production in adult ventricular myocytes.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Absence of correlation between ACh-induced Ca influx and phosphatidic acid labeling in rat uterus.

    PubMed

    Ichida, S; Moriyama, M; Hirooka, Y; Okazaki, Y; Yoshioka, K

    1984-11-27

    Rat uterine smooth muscle was preincubated in Ca-depleted modified Locke-Ringer solution to investigate the correlation between the 32Pi incorporation into phosphatidic acid induced by acetylcholine and the contractile response to acetylcholine induced by the addition of CaCl2 (Ca influx). The results showed that in rat uterine smooth muscle under these conditions phosphatidic acid does not act as a Ca ionophore or as a trigger for opening the Ca channel.

  9. Phosphatidic acid production in the processing of cabbage leaves.

    PubMed

    Urikura, Mai; Morishige, Jun-Ichi; Tanaka, Tamotsu; Satouchi, Kiyoshi

    2012-11-14

    Lysophosphatidic acid (LPA) is a lipid mediator involved in various physiological responses, including wound healing. Evidence of the antiulcer activity of LPA has been reported, and soybean LPA at a concentration of 10 μM is effective in reducing stress-induced gastric ulcer. Because LPA can be formed from phosphatidic acid (PA) by digestive phospholipase A₂, dietary PA can be considered a potential antiulcer phospholipid. In this study, PA production in cut processing of cabbage leaves was examined. The amounts of PA in sliced, minced, and homogenized cabbage leaves were 107 ± 5, 134 ± 19, and 286 ± 29 nmol PA/g (wet weight), respectively, all being significantly higher than the amount of PA found in intact leaves. Mixing mayonnaise with sliced cabbage dramatically increased the PA content (1586 ± 393 nmol/3 g), indicating phospholipase D activity leaked raw cabbage produced PA. These results indicate that fine cutting raw cabbage leaves and mixing them with foods rich in phospholipids resulted in an abundant production of PA. PMID:23098184

  10. Coincident Phosphatidic Acid Interaction Restrains Drp1 in Mitochondrial Division.

    PubMed

    Adachi, Yoshihiro; Itoh, Kie; Yamada, Tatsuya; Cerveny, Kara L; Suzuki, Takamichi L; Macdonald, Patrick; Frohman, Michael A; Ramachandran, Rajesh; Iijima, Miho; Sesaki, Hiromi

    2016-09-15

    Mitochondria divide to control their size, distribution, turnover, and function. Dynamin-related protein 1 (Drp1) is a critical mechanochemical GTPase that drives constriction during mitochondrial division. It is generally believed that mitochondrial division is regulated during recruitment of Drp1 to mitochondria and its oligomerization into a division apparatus. Here, we report an unforeseen mechanism that regulates mitochondrial division by coincident interactions of Drp1 with the head group and acyl chains of phospholipids. Drp1 recognizes the head group of phosphatidic acid (PA) and two saturated acyl chains of another phospholipid by penetrating into the hydrophobic core of the membrane. The dual phospholipid interactions restrain Drp1 via inhibition of oligomerization-stimulated GTP hydrolysis that promotes membrane constriction. Moreover, a PA-producing phospholipase, MitoPLD, binds Drp1, creating a PA-rich microenvironment in the vicinity of a division apparatus. Thus, PA controls the activation of Drp1 after the formation of the division apparatus. PMID:27635761

  11. Coincident Phosphatidic Acid Interaction Restrains Drp1 in Mitochondrial Division.

    PubMed

    Adachi, Yoshihiro; Itoh, Kie; Yamada, Tatsuya; Cerveny, Kara L; Suzuki, Takamichi L; Macdonald, Patrick; Frohman, Michael A; Ramachandran, Rajesh; Iijima, Miho; Sesaki, Hiromi

    2016-09-15

    Mitochondria divide to control their size, distribution, turnover, and function. Dynamin-related protein 1 (Drp1) is a critical mechanochemical GTPase that drives constriction during mitochondrial division. It is generally believed that mitochondrial division is regulated during recruitment of Drp1 to mitochondria and its oligomerization into a division apparatus. Here, we report an unforeseen mechanism that regulates mitochondrial division by coincident interactions of Drp1 with the head group and acyl chains of phospholipids. Drp1 recognizes the head group of phosphatidic acid (PA) and two saturated acyl chains of another phospholipid by penetrating into the hydrophobic core of the membrane. The dual phospholipid interactions restrain Drp1 via inhibition of oligomerization-stimulated GTP hydrolysis that promotes membrane constriction. Moreover, a PA-producing phospholipase, MitoPLD, binds Drp1, creating a PA-rich microenvironment in the vicinity of a division apparatus. Thus, PA controls the activation of Drp1 after the formation of the division apparatus.

  12. Depressed phosphatidic acid-induced contractile activity of failing cardiomyocytes.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Panagia, Vincenzo; Pierce, Grant N

    2003-01-10

    The effects of phosphatidic acid (PA), a known inotropic agent, on Ca(2+) transients and contractile activity of cardiomyocytes in congestive heart failure (CHF) due to myocardial infarction were examined. In control cells, PA induced a significant increase (25%) in active cell shortening and Ca(2+) transients. The phospholipase C (PLC) inhibitor, 2-nitro-4-carboxyphenyl N,N-diphenylcarbonate, blocked the positive inotropic action induced by PA, indicating that PA induces an increase in contractile activity and Ca(2+) transients through stimulation of PLC. Conversely, in failing cardiomyocytes there was a loss of PA-induced increase in active cell shortening and Ca(2+) transients. PA did not alter resting cell length. Both diastolic and systolic [Ca(2+)] were significantly elevated in the failing cardiomyocytes. In vitro assessment of the cardiac sarcolemmal (SL) PLC activity revealed that the impaired failing cardiomyocyte response to PA was associated with a diminished stimulation of SL PLC activity by PA. Our results identify an important defect in the PA-PLC signaling pathway in failing cardiomyocytes, which may have significant implications for the depressed contractile function during CHF.

  13. Regulation of the electric charge in phosphatidic acid domains.

    PubMed

    Wang, Wenjie; Anderson, Nathaniel A; Travesset, Alex; Vaknin, David

    2012-06-21

    Although a minor component of the lipidome, phosphatidic acid (PA) plays a crucial role in nearly all signaling pathways involving cell membranes, in part because of its variable electrical charge in response to environmental conditions. To investigate how charge is regulated in domains of PA, we applied surface-sensitive X-ray reflectivity and fluorescence near-total-reflection techniques to determine the binding of divalent ions (Ca(2+) at various pH values) to 1,2-dimyristoyl-sn-glycero-3-phosphate (DMPA) and to the simpler lipid dihexadecyl phosphate (DHDP) spread as monolayers at the air/water interface. We found that the protonation state of PA is controlled not only by the pK(a) and local pH but also by the strong affinity to PA driven by electrostatic correlations from divalent ions and the cooperative effect of the two dissociable protons, which dramatically enhance the surface charge. A precise theoretical model is presented providing a general framework to predict the protonation state of PA. Implications for recent experiments on charge regulation by hydrogen bonding and the role of pH in PA signaling are discussed in detail.

  14. Tracking Diacylglycerol and Phosphatidic Acid Pools in Budding Yeast

    PubMed Central

    Ganesan, Suriakarthiga; Shabits, Brittney N.; Zaremberg, Vanina

    2015-01-01

    Phosphatidic acid (PA) and diacylglycerol (DAG) are key signaling molecules and important precursors for the biosynthesis of all glycerolipids found in eukaryotes. Research conducted in the model organism Saccharomyces cerevisiae has been at the forefront of the identification of the enzymes involved in the metabolism and transport of PA and DAG. Both these lipids can alter the local physical properties of membranes by introducing negative curvature, but the anionic nature of the phosphomonoester headgroup in PA sets it apart from DAG. As a result, the mechanisms underlying PA and DAG interaction with other lipids and proteins are notoriously different. This is apparent from the analysis of the protein domains responsible for recognition and binding to each of these lipids. We review the current evidence obtained using the PA-binding proteins and domains fused to fluorescent proteins for in vivo tracking of PA pools in yeast. In addition, we present original results for visualization of DAG pools in yeast using the C1 domain from mammalian PKCδ. An emerging first cellular map of the distribution of PA and DAG pools in actively growing yeast is discussed. PMID:27081314

  15. Phosphatidic acid, a versatile water-stress signal in roots

    PubMed Central

    McLoughlin, Fionn; Testerink, Christa

    2013-01-01

    Adequate water supply is of utmost importance for growth and reproduction of plants. In order to cope with water deprivation, plants have to adapt their development and metabolism to ensure survival. To maximize water use efficiency, plants use a large array of signaling mediators such as hormones, protein kinases, and phosphatases, Ca2+, reactive oxygen species, and low abundant phospholipids that together form complex signaling cascades. Phosphatidic acid (PA) is a signaling lipid that rapidly accumulates in response to a wide array of abiotic stress stimuli. PA formation provides the cell with spatial and transient information about the external environment by acting as a protein-docking site in cellular membranes. PA reportedly binds to a number of proteins that play a role during water limiting conditions, such as drought and salinity and has been shown to play an important role in maintaining root system architecture. Members of two osmotic stress-activated protein kinase families, sucrose non-fermenting 1-related protein kinase 2 and mitogen activated protein kinases were recently shown bind PA and are also involved in the maintenance of root system architecture and salinity stress tolerance. In addition, PA regulates several proteins involved in abscisic acid-signaling. PA-dependent recruitment of glyceraldehyde-3-phosphate dehydrogenase under water limiting conditions indicates a role in regulating metabolic processes. Finally, a recent study also shows the PA recruits the clathrin heavy chain and a potassium channel subunit, hinting toward additional roles in cellular trafficking and potassium homeostasis. Taken together, the rapidly increasing number of proteins reported to interact with PA implies a broad role for this versatile signaling phospholipid in mediating salt and water stress responses. PMID:24391659

  16. New roles for Smad signaling and phosphatidic acid in the regulation of skeletal muscle mass.

    PubMed

    Goodman, Craig A; Hornberger, Troy A

    2014-01-01

    Skeletal muscle is essential for normal bodily function and the loss of skeletal muscle (i.e. muscle atrophy/wasting) can have a major impact on mobility, whole-body metabolism, disease resistance, and quality of life. Thus, there is a clear need for the development of therapies that can prevent the loss, or increase, of skeletal muscle mass. However, in order to develop such therapies, we will first have to develop a thorough understanding of the molecular mechanisms that regulate muscle mass. Fortunately, our knowledge is rapidly advancing, and in this review, we will summarize recent studies that have expanded our understanding of the roles that Smad signaling and the synthesis of phosphatidic acid play in the regulation of skeletal muscle mass. PMID:24765525

  17. New roles for Smad signaling and phosphatidic acid in the regulation of skeletal muscle mass.

    PubMed

    Goodman, Craig A; Hornberger, Troy A

    2014-01-01

    Skeletal muscle is essential for normal bodily function and the loss of skeletal muscle (i.e. muscle atrophy/wasting) can have a major impact on mobility, whole-body metabolism, disease resistance, and quality of life. Thus, there is a clear need for the development of therapies that can prevent the loss, or increase, of skeletal muscle mass. However, in order to develop such therapies, we will first have to develop a thorough understanding of the molecular mechanisms that regulate muscle mass. Fortunately, our knowledge is rapidly advancing, and in this review, we will summarize recent studies that have expanded our understanding of the roles that Smad signaling and the synthesis of phosphatidic acid play in the regulation of skeletal muscle mass.

  18. RAPESEED PHOSPHATIDYLCHOLINE HYDROLYSIS TO PHOSPHATIDIC ACID USING PLANT EXTRACTS WITH PHOPSPHOLIPASE D.

    PubMed

    Pasker, Beata; Sosada, Marian; Fraś, Paweł; Boryczka, Monika; Górecki, Michał; Zych, Maria

    2015-01-01

    Phosphatidic acid (PA) has a crucial role in cell membrane structure and function. For that reason it has a possible application in the treatment of some health disorders in humans, can be used as a natural and non toxic emulsifier and the component of drug carriers in pharmaceuticals and cosmetics as well as a component for synthesis of some new phospholipids. PA is short-lived in the cell and is difficult to extract directly from the biological material. PA may be easily prepared by hydrolysis of phospholipids, especially phosphatidylcholine (PC), using cabbage phospholipase D (PLD). Hydrolytic activity of purified by us PLD extracts from cabbage towards rapeseed phosphatidylcholine (RPC) was investigated. Hydrolysis was carried out in the biphasic system (water/diethyl ether) at pH 6,5 and temp 30°C. Influence of enzymatic extracts from three cabbage varieties, reaction time, Ca2+ concentration and enzyme extracts/PC ratio, on activity towards RPC resulting in rapeseed phosphatidic acid (RPA) formation were examined. Our study shows that the PLD extracts from savoy cabbage (PLDsc), white cabbage (PLDwc) and brussels sprouts (PLDbs) used in experiments exhibit hydrolytic activity towards RPC resulting in rapeseed RPA with different yield. The highest activity towards RPC shows PLD extract from PLDsc with the RPC conversion degree to RPA (90%) was observed at 120 mM Ca2+ concentration, reaction time 60 min and ratio of PLD extract to RPC 6 : 1 (w/w). Our study shows that purified by us PLDsc extracts exhibit hydrolytic activity towards RPC giving new RPA with satisfying conversion degree for use in pharmacy, cosmetics and as a standard in analytical chemistry.

  19. RAPESEED PHOSPHATIDYLCHOLINE HYDROLYSIS TO PHOSPHATIDIC ACID USING PLANT EXTRACTS WITH PHOPSPHOLIPASE D.

    PubMed

    Pasker, Beata; Sosada, Marian; Fraś, Paweł; Boryczka, Monika; Górecki, Michał; Zych, Maria

    2015-01-01

    Phosphatidic acid (PA) has a crucial role in cell membrane structure and function. For that reason it has a possible application in the treatment of some health disorders in humans, can be used as a natural and non toxic emulsifier and the component of drug carriers in pharmaceuticals and cosmetics as well as a component for synthesis of some new phospholipids. PA is short-lived in the cell and is difficult to extract directly from the biological material. PA may be easily prepared by hydrolysis of phospholipids, especially phosphatidylcholine (PC), using cabbage phospholipase D (PLD). Hydrolytic activity of purified by us PLD extracts from cabbage towards rapeseed phosphatidylcholine (RPC) was investigated. Hydrolysis was carried out in the biphasic system (water/diethyl ether) at pH 6,5 and temp 30°C. Influence of enzymatic extracts from three cabbage varieties, reaction time, Ca2+ concentration and enzyme extracts/PC ratio, on activity towards RPC resulting in rapeseed phosphatidic acid (RPA) formation were examined. Our study shows that the PLD extracts from savoy cabbage (PLDsc), white cabbage (PLDwc) and brussels sprouts (PLDbs) used in experiments exhibit hydrolytic activity towards RPC resulting in rapeseed RPA with different yield. The highest activity towards RPC shows PLD extract from PLDsc with the RPC conversion degree to RPA (90%) was observed at 120 mM Ca2+ concentration, reaction time 60 min and ratio of PLD extract to RPC 6 : 1 (w/w). Our study shows that purified by us PLDsc extracts exhibit hydrolytic activity towards RPC giving new RPA with satisfying conversion degree for use in pharmacy, cosmetics and as a standard in analytical chemistry. PMID:26642684

  20. Inhibited insulin signaling in mouse hepatocytes is associated with increased phosphatidic acid but not diacylglycerol.

    PubMed

    Zhang, Chongben; Hwarng, Gwen; Cooper, Daniel E; Grevengoed, Trisha J; Eaton, James M; Natarajan, Viswanathan; Harris, Thurl E; Coleman, Rosalind A

    2015-02-01

    Although an elevated triacylglycerol content in non-adipose tissues is often associated with insulin resistance, the mechanistic relationship remains unclear. The data support roles for intermediates in the glycerol-3-phosphate pathway of triacylglycerol synthesis: diacylglycerol (DAG), which may cause insulin resistance in liver by activating PKCϵ, and phosphatidic acid (PA), which inhibits insulin action in hepatocytes by disrupting the assembly of mTOR and rictor. To determine whether increases in DAG and PA impair insulin signaling when produced by pathways other than that of de novo synthesis, we examined primary mouse hepatocytes after enzymatically manipulating the cellular content of DAG or PA. Overexpressing phospholipase D1 or phospholipase D2 inhibited insulin signaling and was accompanied by an elevated cellular content of total PA, without a change in total DAG. Overexpression of diacylglycerol kinase-θ inhibited insulin signaling and was accompanied by an elevated cellular content of total PA and a decreased cellular content of total DAG. Overexpressing glycerol-3-phosphate acyltransferase-1 or -4 inhibited insulin signaling and increased the cellular content of both PA and DAG. Insulin signaling impairment caused by overexpression of phospholipase D1/D2 or diacylglycerol kinase-θ was always accompanied by disassociation of mTOR/rictor and reduction of mTORC2 kinase activity. However, although the protein ratio of membrane to cytosolic PKCϵ increased, PKC activity itself was unaltered. These data suggest that PA, but not DAG, is associated with impaired insulin action in mouse hepatocytes.

  1. The selective activation of the cardiac sarcolemmal sodium-calcium exchanger by plasmalogenic phosphatidic acid produced by phospholipase D.

    PubMed

    Hale, C C; Ebeling, E G; Hsu, F F; Ford, D A

    1998-01-30

    Since plasmalogens are the predominant phospholipid of cardiac sarcolemma, the activation of the sodium-calcium exchanger by either plasmenylethanolamine or plasmalogenic phosphatidic acid generated by phospholipase D was explored. Sodium-calcium exchange activity was 7-fold greater in proteoliposomes comprised of plasmenylethanolamine compared to proteoliposomes comprised of only plasmenylcholine. Phospholipase D treatment of proteoliposomes resulted in 1 mol % conversion of plasmenylcholine or phosphatidylcholine to their respective phosphatidic acid molecular species with a concomitant 8-fold or 2-fold activation of sodium-calcium exchange activity, respectfully. Thus, phospholipase D-mediated hydrolysis of plasmalogens to phosphatidic acid may be an important mechanism for the regulation of the sodium-calcium exchanger.

  2. Activation of phosphatidic acid metabolism of human erythrocyte membranes by perfringolysin O

    SciTech Connect

    Saito, M.; Ando, S.; Mitsui, K.; Homma, Y.; Takenawa, T.

    1986-05-29

    The effect of perfringolysin O on the lipid metabolism of human erythrocyte membranes was investigated. Erythrocytes were prelabeled with (/sup 3/H)arachidonic acid and (/sup 32/P)inorganic phosphate. In the presence of calcium ion (5.5 mM), the effect of perfringolysin O on lipid metabolism was very similar to that of an calcium-ionophore A23187. In the absence of calcium ion, the accumulation of phosphatidic acid and its following decreasing trend were observed during the reaction with the toxin. Such changes were not caused by filipin. These results suggest that perfringolysin O causes the activation of a diglyceride-phosphatidic acid cycle, which might be involved in the calcium transport.

  3. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia).

    PubMed

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C; Ullah, Abul H J

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and P(i). PAPs are typically categorized into two subfamilies: Mg(2+)-dependent soluble PAP and Mg(2+)-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg(2+)-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53-60 °C and unaffected by up to 0.3 mM MgCl2. The K(m) and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na(3)VO(4), Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg(2+)-independent enzyme in plants. PMID:25203006

  4. Altered Lipid Synthesis by Lack of Yeast Pah1 Phosphatidate Phosphatase Reduces Chronological Life Span.

    PubMed

    Park, Yeonhee; Han, Gil-Soo; Mileykovskaya, Eugenia; Garrett, Teresa A; Carman, George M

    2015-10-16

    In Saccharomyces cerevisiae, Pah1 phosphatidate phosphatase, which catalyzes the dephosphorylation of phosphatidate to yield diacylglycerol, plays a crucial role in the synthesis of the storage lipid triacylglycerol. This evolutionarily conserved enzyme also plays a negative regulatory role in controlling de novo membrane phospholipid synthesis through its consumption of phosphatidate. We found that the pah1Δ mutant was defective in the utilization of non-fermentable carbon sources but not in oxidative phosphorylation; the mutant did not exhibit major changes in oxygen consumption rate, mitochondrial membrane potential, F1F0-ATP synthase activity, or gross mitochondrial morphology. The pah1Δ mutant contained an almost normal complement of major mitochondrial phospholipids with some alterations in molecular species. Although oxidative phosphorylation was not compromised in the pah1Δ mutant, the cellular levels of ATP in quiescent cells were reduced by 2-fold, inversely correlating with a 4-fold increase in membrane phospholipids. In addition, the quiescent pah1Δ mutant cells had 3-fold higher levels of mitochondrial superoxide and cellular lipid hydroperoxides, had reduced activities of superoxide dismutase 2 and catalase, and were hypersensitive to hydrogen peroxide. Consequently, the pah1Δ mutant had a shortened chronological life span. In addition, the loss of Tsa1 thioredoxin peroxidase caused a synthetic growth defect with the pah1Δ mutation. The shortened chronological life span of the pah1Δ mutant along with its growth defect on non-fermentable carbon sources and hypersensitivity to hydrogen peroxide was suppressed by the loss of Dgk1 diacylglycerol kinase, indicating that the underpinning of pah1Δ mutant defects was the excess synthesis of membrane phospholipids. PMID:26338708

  5. Phosphatidic acid phosphatase activity in subcellular fractions of normal and dystrophic human muscle.

    PubMed

    Kunze, D; Rüstow, B; Olthoff, D; Jung, K

    1985-03-15

    Biopsy samples from normal and dystrophic human muscle (Duchenne type) were fractionated by differential centrifugation and microsomes, mitochondria and cytosol were assayed for phosphatidic acid phosphatase (EC 3.1.3.4) and marker enzymes of mitochondria and cytosol. The activity of phosphatidic acid phosphatase was significantly lower in microsomes and higher in cytosol and mitochondria of dystrophic muscle than in the corresponding subcellular fractions of normal muscle. The results support an explanation of earlier findings that there is reduced G3P incorporation into diglycerides and phosphatidylcholine and a qualitative and quantitative change in the amount of phosphatidylcholine in dystrophic microsomes. The possible reasons for the reduction in the activity of only microsomal PA-P-ase were discussed.

  6. Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer

    PubMed Central

    Bruntz, Ronald C.; Lindsley, Craig W.

    2014-01-01

    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928

  7. Darmstoff analogues. 3. Actions of choline esters of acetal phosphatidic acids on visceral smooth muscle.

    PubMed

    Marx, M H; Wiley, R A; Satchell, D G; Maguire, M H

    1989-06-01

    A number of naturally occurring phospholipids, e.g. the acetal phosphatidic acid derivatives that comprise Darmstoff (1) and the phosphatidylcholine derivative platelet activating factor (PAF), cause contraction of certain visceral smooth muscles and cause platelet activation. Because the Darmstoff phosphatidic acids and PAF are structurally similar, it was of interest to compare the biological actions of choline esters of Darmstoff with those of PAF and of the parent Darmstoff phosphatidic acids. To this end, [(2-pentadecyl-1,3-dioxolan-4-yl)methyl]phosphocholine (3a), [[2-(cis-8-heptadecenyl)-1,3-dioxolan-4-yl]methyl]phosphocho line (3b), and [[2-(cis-8-pentadecenyl)-1,3-dioxolan-4-yl]methyl]phosphocho line (3c) were synthesized. Compounds 3a, 3b, 3c, and PAF caused dose-dependent relaxation of taenia coli strips. In contrast, the unesterified materials 1a and 1b, as well as lyso-PAF, caused contraction in taenia coli strips. Thus, the contractile effect of Darmstoff is reversed on esterification with choline. In preparations of whole trachea, both 1a and 3a had contractile effects similar to those of PAF.

  8. The mechanistic and ergogenic effects of phosphatidic acid in skeletal muscle.

    PubMed

    Shad, Brandon James; Smeuninx, Benoit; Atherton, Philip James; Breen, Leigh

    2015-12-01

    Skeletal muscle mass plays a vital role in locomotion, whole-body metabolic health, and is a positive predictor of longevity. It is well established the mammalian target of rapamycin (mTOR) is a central regulator of skeletal muscle protein turnover. The pursuit to find novel nutrient compounds or functional food sources that possess the ability to activate mTOR and promote skeletal muscle protein accretion has been on going. Over the last decade, a key role has been proposed for the phospholipid phosphatidic acid (PA) in mTOR activation. Mechanical load-induced (i.e., resistance exercise) intramuscular PA can directly bind to and activate mTOR. In addition, PA provided exogenously in cell culture heightens mTOR activity, albeit indirectly. Thus, endogenously generated PA and exogenous provision of PA appear to act through distinct mechanisms that converge on mTOR and, potentially, may amplify muscle protein synthesis. In support of this notion, limited evidence from humans suggests that resistance exercise training combined with oral supplemental PA enhances strength gains and muscle hypertrophy. However, the precise mechanisms underpinning the augmented muscle remodelling response with supplemental PA remain elusive. In this review, we will critically examine available evidence from cell cultures and animal and human experimental models to provide an overview of the mechanisms through which endogenous and exogenous PA may act to promote muscle anabolism, and discuss the potential for PA as a therapeutic tool to maintain or restore skeletal muscle mass in the context of ageing and disease. PMID:26566242

  9. The mechanistic and ergogenic effects of phosphatidic acid in skeletal muscle.

    PubMed

    Shad, Brandon James; Smeuninx, Benoit; Atherton, Philip James; Breen, Leigh

    2015-12-01

    Skeletal muscle mass plays a vital role in locomotion, whole-body metabolic health, and is a positive predictor of longevity. It is well established the mammalian target of rapamycin (mTOR) is a central regulator of skeletal muscle protein turnover. The pursuit to find novel nutrient compounds or functional food sources that possess the ability to activate mTOR and promote skeletal muscle protein accretion has been on going. Over the last decade, a key role has been proposed for the phospholipid phosphatidic acid (PA) in mTOR activation. Mechanical load-induced (i.e., resistance exercise) intramuscular PA can directly bind to and activate mTOR. In addition, PA provided exogenously in cell culture heightens mTOR activity, albeit indirectly. Thus, endogenously generated PA and exogenous provision of PA appear to act through distinct mechanisms that converge on mTOR and, potentially, may amplify muscle protein synthesis. In support of this notion, limited evidence from humans suggests that resistance exercise training combined with oral supplemental PA enhances strength gains and muscle hypertrophy. However, the precise mechanisms underpinning the augmented muscle remodelling response with supplemental PA remain elusive. In this review, we will critically examine available evidence from cell cultures and animal and human experimental models to provide an overview of the mechanisms through which endogenous and exogenous PA may act to promote muscle anabolism, and discuss the potential for PA as a therapeutic tool to maintain or restore skeletal muscle mass in the context of ageing and disease.

  10. Differences in phosphatidic acid signalling and metabolism between ABA and GA treatments of barley aleurone cells.

    PubMed

    Villasuso, Ana Laura; Di Palma, Maria A; Aveldaño, Marta; Pasquaré, Susana J; Racagni, Graciela; Giusto, Norma M; Machado, Estela E

    2013-04-01

    Phosphatidic acid (PA) is the common lipid product in abscisic acid (ABA) and gibberellic acid (GA) response. In this work we investigated the lipid metabolism in response to both hormones. We could detect an in vivo phospholipase D activity (PLD, EC 3.1.4.4). This PLD produced [(32)P]PA (phosphatidic acid) rapidly (minutes) in the presence of ABA, confirming PA involvement in signal transduction, and transiently, indicating rapid PA removal after generation. The presence of PA removal by phosphatidate phosphatase 1 and 2 isoforms (E.C. 3.1.3.4) was verified in isolated aleurone membranes in vitro, the former but not the latter being specifically responsive to the presence of GA or ABA. The in vitro DGPP phosphatase activity was not modified by short time incubation with GA or ABA while the in vitro PA kinase - that allows the production of 18:2-DGPP from 18:2-PA - is stimulated by ABA. The long term effects (24 h) of ABA or GA on lipid and fatty acid composition of aleurone layer cells were then investigated. An increase in PC and, to a lesser extent, in PE levels is the consequence of both hormone treatments. ABA, in aleurone layer cells, specifically activates a PLD whose product, PA, could be the substrate of PAP1 and/or PAK activities. Neither PLD nor PAK activation can be monitored by GA treatment. The increase in PAP1 activity monitored after ABA or GA treatment might participate in the increase in PC level observed after 24 h hormone incubation.

  11. Saturated phosphatidic acids mediate saturated fatty acid-induced vascular calcification and lipotoxicity.

    PubMed

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M; Kuro-O, Makoto; Miyazaki, Makoto

    2015-12-01

    Recent evidence indicates that saturated fatty acid-induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification. PMID:26517697

  12. Saturated phosphatidic acids mediate saturated fatty acid-induced vascular calcification and lipotoxicity.

    PubMed

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M; Kuro-O, Makoto; Miyazaki, Makoto

    2015-10-26

    Recent evidence indicates that saturated fatty acid-induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification.

  13. The salt stress-induced LPA response in Chlamydomonas is produced via PLA₂ hydrolysis of DGK-generated phosphatidic acid.

    PubMed

    Arisz, Steven A; Munnik, Teun

    2011-11-01

    The unicellular green alga Chlamydomonas has frequently been used as a eukaryotic model system to study intracellular phospholipid signaling pathways in response to environmental stresses. Earlier, we found that hypersalinity induced a rapid increase in the putative lipid second messenger, phosphatidic acid (PA), which was suggested to be generated via activation of a phospholipase D (PLD) pathway and the combined action of a phospholipase C/diacylglycerol kinase (PLC/DGK) pathway. Lysophosphatidic acid (LPA) was also increased and was suggested to reflect a phospholipase A₂ (PLA₂) activity based on pharmacological evidence. The question of PA's and LPA's origin is, however, more complicated, especially as both function as precursors in the biosynthesis of phospho- and galactolipids. To address this complexity, a combination of fatty acid-molecular species analysis and in vivo ³²P-radiolabeling was performed. Evidence is provided that LPA is formed from a distinct pool of PA characterized by a high α-linolenic acid (18:3n-3) content. This molecular species was highly enriched in the polyphosphoinositide fraction, which is the substrate for PLC to form diacylglycerol. Together with differential ³²P-radiolabeling studies and earlier PLD-transphosphatidylation and PLA₂-inhibitor assays, the data were consistent with the hypothesis that the salt-induced LPA response is primarily generated through PLA₂-mediated hydrolysis of DGK-generated PA and that PLD or de novo synthesis [via endoplasmic reticulum - or plastid-localized routes] is not a major contributor.

  14. Functional analysis of a phosphatidic acid binding domain in human Raf-1 kinase: mutations in the phosphatidate binding domain lead to tail and trunk abnormalities in developing zebrafish embryos.

    PubMed

    Ghosh, Sujoy; Moore, Sean; Bell, Robert M; Dush, Michael

    2003-11-14

    Previously, we and others identified a 35-amino acid segment within human Raf-1 kinase that preferentially binds phosphatidic acid. The presence of phosphatidic acid was found to be necessary for the translocation of Raf-1 to the plasma membrane. We have now employed a combination of alanine-scanning and deletion mutagenesis to identify the critical amino acid residues in Raf-1 necessary for interaction with phosphatidic acid. Progressive mutations within a tetrapeptide motif (residues 398-401 of human Raf-1) reduced and finally eliminated binding of Raf-1 to phosphatidic acid. We then injected zebrafish embryos with RNA encoding wild-type Raf-1 kinase or a mutant version with triple alanine mutations in the tetrapeptide motif and followed the morphological fate of embryonic development. Embryos with mutant but not wild-type Raf-1 exhibited defects in posterior axis formation exemplified by bent trunk and tail structures. Molecular evidence for lack of signaling through mutated Raf-1 was obtained by aberrant in situ hybridization of the ntl (no tail) gene, which functions downstream of Raf-1. Our results demonstrate that a functional phosphatidate binding site is necessary for Raf-1 function in embryonic development.

  15. Interactions between the PDZ domains of Bazooka (Par-3) and phosphatidic acid: in vitro characterization and role in epithelial development.

    PubMed

    Yu, Cao Guo; Harris, Tony J C

    2012-09-01

    Bazooka (Par-3) is a conserved polarity regulator that organizes molecular networks in a wide range of cell types. In epithelia, it functions as a plasma membrane landmark to organize the apical domain. Bazooka is a scaffold protein that interacts with proteins through its three PDZ (postsynaptic density 95, discs large, zonula occludens-1) domains and other regions. In addition, Bazooka has been shown to interact with phosphoinositides. Here we show that the Bazooka PDZ domains interact with the negatively charged phospholipid phosphatidic acid immobilized on solid substrates or in liposomes. The interaction requires multiple PDZ domains, and conserved patches of positively charged amino acid residues appear to mediate the interaction. Increasing or decreasing levels of diacylglycerol kinase or phospholipase D-enzymes that produce phosphatidic acid-reveal a role for phosphatidic acid in Bazooka embryonic epithelial activity but not its localization. Mutating residues implicated in phosphatidic acid binding revealed a possible role in Bazooka localization and function. These data implicate a closer connection between Bazooka and membrane lipids than previously recognized. Bazooka polarity landmarks may be conglomerates of proteins and plasma membrane lipids that modify each other's activities for an integrated effect on cell polarity.

  16. Molecular cloning of magnesium-independent type 2 phosphatidic acid phosphatases from airway smooth muscle.

    PubMed

    Tate, R J; Tolan, D; Pyne, S

    1999-07-01

    Members of the type 2 phosphatidic acid phosphatase (PAP2) family catalyse the dephosphorylation of phosphatidic acid (PA), lysophosphatidate and sphingosine 1-phosphate. Here, we demonstrate the presence of a Mg(2+)-independent and N-ethymaleimide-insensitive PAP2 activity in cultured guinea-pig airway smooth muscle (ASM) cells. Two PAP2 cDNAs of 923 and 926 base pairs were identified and subsequently cloned from these cells. The ORF of the 923 base pair cDNA encoded a protein of 285 amino acids (Mr = 32.1 kDa), which had 94% homology with human PAP2a (hPAP2a) and which probably represents a guinea-pig specific PAP2a (gpPAP2a1). The ORF of the 926 base pair cDNA encoded a protein of 286 amino acids (Mr = 32.1 kDa) which had 84% and 91% homology with hPAP2a and gpPAP2a1, respectively. This protein, termed gpPAP2a2, has two regions (aa 21-33 and 51-74) of marked divergence and altered hydrophobicity compared with hPAP2a and gpPAP2a1. This occurs in the predicted first and second transmembrane domains and at the extremes of the first outer loop. Other significant differences between gpPAP2a1/2 and hPAP2a, hPAP2b and hPAP2c occur at the cytoplasmic C-terminal. Transient expression of gpPAP2a2 in Cos-7 cells resulted in an approx. 4-fold increase in Mg(2+)-independent PAP activity, thereby confirming that gpPAP2a2 is another catalytically active member of an extended PAP2 family.

  17. Rhabdomyolysis-Associated Mutations in Human LPIN1 Lead to Loss of Phosphatidic Acid Phosphohydrolase Activity.

    PubMed

    Schweitzer, George G; Collier, Sara L; Chen, Zhouji; Eaton, James M; Connolly, Anne M; Bucelli, Robert C; Pestronk, Alan; Harris, Thurl E; Finck, Brian N

    2015-01-01

    Rhabdomyolysis is an acute syndrome due to extensive injury of skeletal muscle. Recurrent rhabdomyolysis is often caused by inborn errors in intermediary metabolism, and recent work has suggested that mutations in the human gene encoding lipin 1 (LPIN1) may be a common cause of recurrent rhabdomyolysis in children. Lipin 1 dephosphorylates phosphatidic acid to form diacylglycerol (phosphatidic acid phosphohydrolase; PAP) and acts as a transcriptional regulatory protein to control metabolic gene expression. Herein, a 3-year-old boy with severe recurrent rhabdomyolysis was determined to be a compound heterozygote for a novel c.1904T>C (p.Leu635Pro) substitution and a previously reported genomic deletion of exons 18-19 (E766-S838_del) in LPIN1. Western blotting with patient muscle biopsy lysates demonstrated a marked reduction in lipin 1 protein, while immunohistochemical staining for lipin 1 showed abnormal subcellular localization. We cloned cDNAs to express recombinant lipin 1 proteins harboring pathogenic mutations and showed that the E766-S838_del allele was not expressed at the RNA or protein level. Lipin 1 p.Leu635Pro was expressed, but the protein was less stable, was aggregated in the cytosol, and was targeted for proteosomal degradation. Another pathogenic single amino acid substitution, lipin 1 p.Arg725His, was well expressed and retained its transcriptional regulatory function. However, both p.Leu635Pro and p.Arg725His proteins were found to be deficient in PAP activity. Kinetic analyses demonstrated a loss of catalysis rather than diminished substrate binding. These data suggest that loss of lipin 1-mediated PAP activity may be involved in the pathogenesis of rhabdomyolysis in lipin 1 deficiency. PMID:25967228

  18. Rhabdomyolysis-Associated Mutations in Human LPIN1 Lead to Loss of Phosphatidic Acid Phosphohydrolase Activity.

    PubMed

    Schweitzer, George G; Collier, Sara L; Chen, Zhouji; Eaton, James M; Connolly, Anne M; Bucelli, Robert C; Pestronk, Alan; Harris, Thurl E; Finck, Brian N

    2015-01-01

    Rhabdomyolysis is an acute syndrome due to extensive injury of skeletal muscle. Recurrent rhabdomyolysis is often caused by inborn errors in intermediary metabolism, and recent work has suggested that mutations in the human gene encoding lipin 1 (LPIN1) may be a common cause of recurrent rhabdomyolysis in children. Lipin 1 dephosphorylates phosphatidic acid to form diacylglycerol (phosphatidic acid phosphohydrolase; PAP) and acts as a transcriptional regulatory protein to control metabolic gene expression. Herein, a 3-year-old boy with severe recurrent rhabdomyolysis was determined to be a compound heterozygote for a novel c.1904T>C (p.Leu635Pro) substitution and a previously reported genomic deletion of exons 18-19 (E766-S838_del) in LPIN1. Western blotting with patient muscle biopsy lysates demonstrated a marked reduction in lipin 1 protein, while immunohistochemical staining for lipin 1 showed abnormal subcellular localization. We cloned cDNAs to express recombinant lipin 1 proteins harboring pathogenic mutations and showed that the E766-S838_del allele was not expressed at the RNA or protein level. Lipin 1 p.Leu635Pro was expressed, but the protein was less stable, was aggregated in the cytosol, and was targeted for proteosomal degradation. Another pathogenic single amino acid substitution, lipin 1 p.Arg725His, was well expressed and retained its transcriptional regulatory function. However, both p.Leu635Pro and p.Arg725His proteins were found to be deficient in PAP activity. Kinetic analyses demonstrated a loss of catalysis rather than diminished substrate binding. These data suggest that loss of lipin 1-mediated PAP activity may be involved in the pathogenesis of rhabdomyolysis in lipin 1 deficiency.

  19. Concentrated Phosphatidic Acid in Cereal Brans as Potential Protective Agents against Indomethacin-Induced Stomach Ulcer.

    PubMed

    Afroz, Sheuli; Ikoma, Teru; Yagi, Ayano; Kogure, Kentaro; Tokumura, Akira; Tanaka, Tamotsu

    2016-09-21

    One of complications associated with long-term use of nonsteroidal anti-inflammatory drugs (NSAIDs) is peptic ulcer. Recently, we found that orally administered phosphatidic acid (PA) ameliorated aspirin-induced stomach lesions in mice. In this study, we identified PA-rich food sources and examined the effects of the food materials on indomethacin-induced stomach ulcer. Among examined, buckwheat (Fagopyrum esculentum) bran contained the highest level of PA (188 mg/100 g). PA was the richest phospholipid (25%) in the lipid fraction of the buckwheat bran. Administration of the lipid extracts of buckwheat bran significantly ameliorated indomethacin-induced stomach lesions in mice. In contrast, wheat (Triticum durum) bran lipids (PA, 4%) and soybean (Glycine max) lipids (PA, 3%) were not associated with ameliorative effects. These results indicated that PA-rich lipids can be used as an effective supplement for prevention of NSAID-induced stomach ulcer. PMID:27561232

  20. Concentrated Phosphatidic Acid in Cereal Brans as Potential Protective Agents against Indomethacin-Induced Stomach Ulcer.

    PubMed

    Afroz, Sheuli; Ikoma, Teru; Yagi, Ayano; Kogure, Kentaro; Tokumura, Akira; Tanaka, Tamotsu

    2016-09-21

    One of complications associated with long-term use of nonsteroidal anti-inflammatory drugs (NSAIDs) is peptic ulcer. Recently, we found that orally administered phosphatidic acid (PA) ameliorated aspirin-induced stomach lesions in mice. In this study, we identified PA-rich food sources and examined the effects of the food materials on indomethacin-induced stomach ulcer. Among examined, buckwheat (Fagopyrum esculentum) bran contained the highest level of PA (188 mg/100 g). PA was the richest phospholipid (25%) in the lipid fraction of the buckwheat bran. Administration of the lipid extracts of buckwheat bran significantly ameliorated indomethacin-induced stomach lesions in mice. In contrast, wheat (Triticum durum) bran lipids (PA, 4%) and soybean (Glycine max) lipids (PA, 3%) were not associated with ameliorative effects. These results indicated that PA-rich lipids can be used as an effective supplement for prevention of NSAID-induced stomach ulcer.

  1. Identification of type-2 phosphatidic acid phosphohydrolase (PAPH-2) in neutrophil plasma membranes.

    PubMed

    Boder, E; Taylor, G; Akard, L; Jansen, J; English, D

    1994-11-01

    Plasma membrane phosphatidic acid phosphohydrolase (PAPH) plays an important role in signal transduction by converting phosphatidic acid to diacylglycerol. PAPH-2, a Mg(2+)-independent, detergent-dependent enzyme involved in cellular signal transduction, is reportedly absent from the plasma membranes of neutrophilic leukocytes, a cell that responds to metabolic stimulation with abundant phospholipase D-dependent diacylglycerol generation. The present study was designed to resolve this discrepancy, focusing on the influence of cellular disruption techniques, detergent availability and cation sensitivity on the apparent distribution of PAPH in neutrophil subcellular fractions. The results clearly indicate the presence of two distinct types of PAPH within the particulate and cytosolic fractions of disrupted cells. Unlike the cytosolic enzyme, the particulate enzymes was not potentiated by magnesium and was strongly detergent-dependent. The soluble and particulate enzymes displayed dissimilar pH profiles. Separation of neutrophil particulate material into fractions rich in plasma membranes, specific granules and azurophilic granules by high speed discontinuous density gradient centrifugation revealed that the majority of the particulate activity was confined to plasma membranes. This activity was not inhibited by pretreatment with n-ethyl-maleimide in concentrations as high as 25 mM. PAPH activity recovered in the cytosolic fraction of disrupted neutrophils was almost completely inhibited by 5.0 mM n-ethylmaleimide. We conclude that resting neutrophils possess n-ethylmaleimide-resistant PAPH (type 2) within their plasma membranes. This enzyme may markedly influence the kinetics of cell activation by metabolizing second messengers generated as a result of activation of plasma membrane phospholipase D.

  2. Insulin controls subcellular localization and multisite phosphorylation of the phosphatidic acid phosphatase, lipin 1.

    PubMed

    Harris, Thurl E; Huffman, Todd A; Chi, An; Shabanowitz, Jeffrey; Hunt, Donald F; Kumar, Anil; Lawrence, John C

    2007-01-01

    Brain, liver, kidney, heart, and skeletal muscle from fatty liver dystrophy (fld/fld) mice, which do not express lipin 1 (lipin), contained much less Mg(2+)-dependent phosphatidic acid phosphatase (PAP) activity than tissues from wild type mice. Lipin harboring the fld(2j) (Gly(84) --> Arg) mutation exhibited relatively little PAP activity. These results indicate that lipin is a major PAP in vivo and that the loss of PAP activity contributes to the fld phenotype. PAP activity was readily detected in immune complexes of lipin from 3T3-L1 adipocytes, where the protein was found both as a microsomal form and a soluble, more highly phosphorylated, form. Fifteen phosphorylation sites were identified by mass spectrometric analyses. Insulin increased the phosphorylation of multiple sites and promoted a gel shift that was due in part to phosphorylation of Ser(106). In contrast, epinephrine and oleic acid promoted dephosphorylation of lipin. The PAP-specific activity of lipin was not affected by the hormones or by dephosphorylation of lipin with protein phosphatase 1. However, the ratio of soluble to microsomal lipin was markedly increased in response to insulin and decreased in response to epinephrine and oleic acid. The results suggest that insulin and epinephrine control lipin primarily by changing localization rather than intrinsic PAP activity. PMID:17105729

  3. Insulin controls subcellular localization and multisite phosphorylation of the phosphatidic acid phosphatase, lipin 1.

    PubMed

    Harris, Thurl E; Huffman, Todd A; Chi, An; Shabanowitz, Jeffrey; Hunt, Donald F; Kumar, Anil; Lawrence, John C

    2007-01-01

    Brain, liver, kidney, heart, and skeletal muscle from fatty liver dystrophy (fld/fld) mice, which do not express lipin 1 (lipin), contained much less Mg(2+)-dependent phosphatidic acid phosphatase (PAP) activity than tissues from wild type mice. Lipin harboring the fld(2j) (Gly(84) --> Arg) mutation exhibited relatively little PAP activity. These results indicate that lipin is a major PAP in vivo and that the loss of PAP activity contributes to the fld phenotype. PAP activity was readily detected in immune complexes of lipin from 3T3-L1 adipocytes, where the protein was found both as a microsomal form and a soluble, more highly phosphorylated, form. Fifteen phosphorylation sites were identified by mass spectrometric analyses. Insulin increased the phosphorylation of multiple sites and promoted a gel shift that was due in part to phosphorylation of Ser(106). In contrast, epinephrine and oleic acid promoted dephosphorylation of lipin. The PAP-specific activity of lipin was not affected by the hormones or by dephosphorylation of lipin with protein phosphatase 1. However, the ratio of soluble to microsomal lipin was markedly increased in response to insulin and decreased in response to epinephrine and oleic acid. The results suggest that insulin and epinephrine control lipin primarily by changing localization rather than intrinsic PAP activity.

  4. The fusogenic lipid phosphatidic acid promotes the biogenesis of mitochondrial outer membrane protein Ugo1

    PubMed Central

    Keller, Michael; Taskin, Asli A.; Horvath, Susanne E.; Guan, Xue Li; Prinz, Claudia; Opalińska, Magdalena; Zorzin, Carina; van der Laan, Martin; Wenk, Markus R.; Schubert, Rolf; Wiedemann, Nils; Holzer, Martin

    2015-01-01

    Import and assembly of mitochondrial proteins depend on a complex interplay of proteinaceous translocation machineries. The role of lipids in this process has been studied only marginally and so far no direct role for a specific lipid in mitochondrial protein biogenesis has been shown. Here we analyzed a potential role of phosphatidic acid (PA) in biogenesis of mitochondrial proteins in Saccharomyces cerevisiae. In vivo remodeling of the mitochondrial lipid composition by lithocholic acid treatment or by ablation of the lipid transport protein Ups1, both leading to an increase of mitochondrial PA levels, specifically stimulated the biogenesis of the outer membrane protein Ugo1, a component of the mitochondrial fusion machinery. We reconstituted the import and assembly pathway of Ugo1 in protein-free liposomes, mimicking the outer membrane phospholipid composition, and found a direct dependency of Ugo1 biogenesis on PA. Thus, PA represents the first lipid that is directly involved in the biogenesis pathway of a mitochondrial membrane protein. PMID:26347140

  5. Phosphatidic acid phosphatase and diacylglycerol acyltransferase: potential targets for metabolic engineering of microorganism oil.

    PubMed

    Jin, Hong-Hao; Jiang, Jian-Guo

    2015-04-01

    Oleaginous microorganism is becoming one of the most promising oil feedstocks for biodiesel production due to its great advantages in triglyceride (TAG) accumulation. Previous studies have shown that de novo TAG biosynthesis can be divided into two parts: the fatty acid biosynthesis pathway (the upstream part which generates acyl-CoAs) and the glycerol-3-phosphate acylation pathway (the downstream part in which three acyl groups are sequentially added onto a glycerol backbone). This review mainly focuses on two enzymes in the G3P pathway, phosphatidic acid phosphatase (PAP) and diacylglycerol acyltransferase (DGAT). The former catalyzes a dephosphorylation reaction, and the latter catalyzes a subsequent acylation reaction. Genes, functional motifs, transmembrane domains, action mechanism, and new studies of the two enzymes are discussed in detail. Furthermore, this review also covers diacylglycerol kinase, an enzyme that catalyzes the reverse reaction of diacylglycerol formation. In addition, PAP and DGAT are the conjunction points of the G3P pathway, the Kennedy pathway, and the CDP-diacylglycerol pathway (CDP-DAG pathway), and the mutual transformation between TAGs and phospholipids is discussed as well. Given that both the Kennedy and CDP-diacylglycerol pathways are in metabolic interlock (MI) with the G3P pathway, it is suggested that, via metabolic engineering, TAG accumulation can be improved by the two pathways based on the pivotal function of PAP and DGAT.

  6. Phosphatidic acid-induced contraction in guinea-pig taenia coli.

    PubMed

    Ohata, H; Momose, K

    1990-06-01

    Natural phosphatidic acid from egg yolk lecithin (PA) caused a sustained contraction in guinea-pig taenia coli. The contractile response to PA was concentration-dependent (10(-6)-10(-4) M) in the normal medium and the maximal response to PA was about 20% of the response to carbachol (CCh) at 10(-6) M. Phospholipase D mimicked PA-induced contraction. This result suggests that increase in endogenous PA can induce contraction. The PA-induced contraction was not inhibited by atropine (10(-6) M). The contraction was more dependent on concentration of extracellular Ca2+ than CCh-induced contraction. PA increased 45Ca2+ uptake into the tissue. These results suggest that the PA-induced contraction results from increase in Ca2+ influx across plasma membranes, but not release of Ca2+ from intracellular stores in guinea-pig taenia coli. The PA-induced contraction was inhibited to 42% of the control response by propyl gallate (0.2 mM), a combined inhibitor of cyclooxygenase and lipoxygenase. This result indicates that a portion of the contraction is related to release of arachidonic acid and its metabolites, and the other portions are based on direct action of PA. These results suggest a possibility that increased PA by agonist stimulation is related to the following extracellular Ca2(+)-dependent contraction.

  7. PPAR γ Networks in Cell Signaling: Update and Impact of Cyclic Phosphatidic Acid.

    PubMed

    Tsukahara, Tamotsu

    2013-01-01

    Lysophospholipid (LPL) has long been recognized as a membrane phospholipid metabolite. Recently, however, the LPL has emerged as a candidate for diagnostic and pharmacological interest. LPLs include lysophosphatidic acid (LPA), alkyl glycerol phosphate (AGP), cyclic phosphatidic acid (cPA), and sphingosine-1-phosphate (S1P). These biologically active lipid mediators serve to promote a variety of responses that include cell proliferation, migration, and survival. These LPL-related responses are mediated by cell surface G-protein-coupled receptors and also intracellular receptor peroxisome proliferator-activated receptor gamma (PPAR γ ). In this paper, we focus mainly on the most recent findings regarding the biological function of nuclear receptor-mediated lysophospholipid signaling in mammalian systems, specifically as they relate to health and diseases. Also, we will briefly review the biology of PPAR γ and then provide an update of lysophospholipids PPAR γ ligands that are under investigation as a therapeutic compound and which are targets of PPAR γ relevant to diseases. PMID:23476786

  8. Phosphatidylcholine is a major source of phosphatidic acid and diacylglycerol in angiotensin II-stimulated vascular smooth-muscle cells.

    PubMed

    Lassègue, B; Alexander, R W; Clark, M; Akers, M; Griendling, K K

    1993-06-01

    In cultured vascular smooth-muscle cells, angiotensin II produces a sustained formation of diacylglycerol (DG) and phosphatidic acid (PtdOH). Since the fatty acid composition of these molecules is likely to determine their efficacy as second messengers, it is important to ascertain the phospholipid precursors and the biochemical pathways from which they are produced. Our experiments suggest that phospholipase D (PLD)-mediated phosphatidylcholine (PtdCho) hydrolysis is the major source of both DG and PtdOH during the late signalling phase. First, in cells labelled with [3H]myristate, which preferentially labels PtdCho, formation of [3H]PtdOH precedes formation of [3H]DG. Second, in contrast with phospholipase C (PLC) activation, DG mass accumulation is dependent on extracellular Ca2+. Similarly, DG mass accumulation is not attenuated by protein kinase C activation, which we have previously shown to inhibit the phosphoinositide-specific PLC. Third, the fatty acid composition of late-phase DG and PtdOH more closely resembles that of PtdCho than that of phosphatidylinositol. Finally, in cells labelled for a short time with [3H]glycerol, the radioactivity incorporated into [3H]DG and PtdOH was greater than that incorporated into PtdIns, but not into PtdCho. We found no evidence that synthesis de novo or phosphatidylethanolamine breakdown contributes to sustained DG and PtdOH formation. Thus, in angiotensin II-stimulated cultured vascular smooth-muscle cells, PLD-mediated PtdCho hydrolysis is the major source of sustained DG and PtdOH, whereas phosphoinositide breakdown is a minor contributor. Furthermore, PtdOH phosphohydrolase, which determines the relative levels of DG and PtdOH, appears to be regulated by protein kinase C. These results have important implications for the role of these second messengers in growth and contraction.

  9. Diacylglycerol, phosphatidic acid, and their metabolic enzymes in synaptic vesicle recycling.

    PubMed

    Tu-Sekine, Becky; Goldschmidt, Hana; Raben, Daniel M

    2015-01-01

    The synaptic vesicle (SV) cycle includes exocytosis of vesicles loaded with a neurotransmitter such as glutamate, coordinated recovery of SVs by endocytosis, refilling of vesicles, and subsequent release of the refilled vesicles from the presynaptic bouton. SV exocytosis is tightly linked with endocytosis, and variations in the number of vesicles, and/or defects in the refilling of SVs, will affect the amount of neurotransmitter available for release (Sudhof, 2004). There is increasing interest in the roles synaptic vesicle lipids and lipid metabolizing enzymes play in this recycling. Initial emphasis was placed on the role of polyphosphoinositides in SV cycling as outlined in a number of reviews (Lim and Wenk, 2009; Martin, 2012; Puchkov and Haucke, 2013; Rohrbough and Broadie, 2005). Other lipids are now recognized to also play critical roles. For example, PLD1 (Humeau et al., 2001; Rohrbough and Broadie, 2005) and some DGKs (Miller et al., 1999; Nurrish et al., 1999) play roles in neurotransmission which is consistent with the critical roles for phosphatidic acid (PtdOH) and diacylglycerol (DAG) in the regulation of SV exo/endocytosis (Cremona et al., 1999; Exton, 1994; Huttner and Schmidt, 2000; Lim and Wenk, 2009; Puchkov and Haucke, 2013; Rohrbough and Broadie, 2005). PLD generates phosphatidic acid by catalyzing the hydrolysis of phosphatidylcholine (PtdCho) and in some systems this PtdOH is de-phosphorylated to generate DAG. In contrast, DGK catalyzes the phosphorylation of DAG thereby converting it into PtdOH. While both enzymes are poised to regulate the levels of DAG and PtdOH, therefore, they both lead to the generation of PtdOH and could have opposite effects on DAG levels. This is particularly important for SV cycling as PtdOH and DAG are both needed for evoked exocytosis (Lim and Wenk, 2009; Puchkov and Haucke, 2013; Rohrbough and Broadie, 2005). Two lipids and their involved metabolic enzymes, two sphingolipids have also been implicated in

  10. The role of phosphoinositide 3-kinase and phosphatidic acid in the regulation of mammalian target of rapamycin following eccentric contractions.

    PubMed

    O'Neil, T K; Duffy, L R; Frey, J W; Hornberger, T A

    2009-07-15

    Resistance exercise induces a hypertrophic response in skeletal muscle and recent studies have begun to shed light on the molecular mechanisms involved in this process. For example, several studies indicate that signalling by the mammalian target of rapamycin (mTOR) is necessary for a hypertrophic response. Furthermore, resistance exercise has been proposed to activate mTOR signalling through an upstream pathway involving the phosphoinositide 3-kinase (PI3K) and protein kinase B (PKB); however, this hypothesis has not been thoroughly tested. To test this hypothesis, we first evaluated the temporal pattern of signalling through PI3K-PKB and mTOR following a bout of resistance exercise with eccentric contractions (EC). Our results indicated that the activation of signalling through PI3K-PKB is a transient event (<15 min), while the activation of mTOR is sustained for a long duration (>12 h). Furthermore, inhibition of PI3K-PKB activity did not prevent the activation of mTOR signalling by ECs, indicating that PI3K-PKB is not part of the upstream regulatory pathway. These observations led us to investigate an alternative pathway for the activation of mTOR signalling involving the synthesis of phosphatidic acid (PA) by phospholipase D (PLD). Our results demonstrate that ECs induce a sustained elevation in [PA] and inhibiting the synthesis of PA by PLD prevented the activation of mTOR. Furthermore, we determined that similar to ECs, PA activates mTOR signalling through a PI3K-PKB-independent mechanism. Combined, the results of this study indicate that the activation of mTOR following eccentric contractions occurs through a PI3K-PKB-independent mechanism that requires PLD and PA. PMID:19470781

  11. The role of phosphoinositide 3-kinase and phosphatidic acid in the regulation of mammalian target of rapamycin following eccentric contractions.

    PubMed

    O'Neil, T K; Duffy, L R; Frey, J W; Hornberger, T A

    2009-07-15

    Resistance exercise induces a hypertrophic response in skeletal muscle and recent studies have begun to shed light on the molecular mechanisms involved in this process. For example, several studies indicate that signalling by the mammalian target of rapamycin (mTOR) is necessary for a hypertrophic response. Furthermore, resistance exercise has been proposed to activate mTOR signalling through an upstream pathway involving the phosphoinositide 3-kinase (PI3K) and protein kinase B (PKB); however, this hypothesis has not been thoroughly tested. To test this hypothesis, we first evaluated the temporal pattern of signalling through PI3K-PKB and mTOR following a bout of resistance exercise with eccentric contractions (EC). Our results indicated that the activation of signalling through PI3K-PKB is a transient event (<15 min), while the activation of mTOR is sustained for a long duration (>12 h). Furthermore, inhibition of PI3K-PKB activity did not prevent the activation of mTOR signalling by ECs, indicating that PI3K-PKB is not part of the upstream regulatory pathway. These observations led us to investigate an alternative pathway for the activation of mTOR signalling involving the synthesis of phosphatidic acid (PA) by phospholipase D (PLD). Our results demonstrate that ECs induce a sustained elevation in [PA] and inhibiting the synthesis of PA by PLD prevented the activation of mTOR. Furthermore, we determined that similar to ECs, PA activates mTOR signalling through a PI3K-PKB-independent mechanism. Combined, the results of this study indicate that the activation of mTOR following eccentric contractions occurs through a PI3K-PKB-independent mechanism that requires PLD and PA.

  12. Lipids in salicylic acid-mediated defense in plants: focusing on the roles of phosphatidic acid and phosphatidylinositol 4-phosphate

    PubMed Central

    Zhang, Qiong; Xiao, Shunyuan

    2015-01-01

    Plants have evolved effective defense strategies to protect themselves from various pathogens. Salicylic acid (SA) is an essential signaling molecule that mediates pathogen-triggered signals perceived by different immune receptors to induce downstream defense responses. While many proteins play essential roles in regulating SA signaling, increasing evidence also supports important roles for signaling phospholipids in this process. In this review, we collate the experimental evidence in support of the regulatory roles of two phospholipids, phosphatidic acid (PA), and phosphatidylinositol 4-phosphate (PI4P), and their metabolizing enzymes in plant defense, and examine the possible mechanistic interaction between phospholipid signaling and SA-dependent immunity with a particular focus on the immunity-stimulated biphasic PA production that is reminiscent of and perhaps mechanistically connected to the biphasic reactive oxygen species (ROS) generation and SA accumulation during defense activation. PMID:26074946

  13. The salt stress-induced LPA response in Chlamydomonas is produced via PLA2 hydrolysis of DGK-generated phosphatidic acid[S

    PubMed Central

    Arisz, Steven A.; Munnik, Teun

    2011-01-01

    The unicellular green alga Chlamydomonas has frequently been used as a eukaryotic model system to study intracellular phospholipid signaling pathways in response to environmental stresses. Earlier, we found that hypersalinity induced a rapid increase in the putative lipid second messenger, phosphatidic acid (PA), which was suggested to be generated via activation of a phospholipase D (PLD) pathway and the combined action of a phospholipase C/diacylglycerol kinase (PLC/DGK) pathway. Lysophosphatidic acid (LPA) was also increased and was suggested to reflect a phospholipase A2 (PLA2) activity based on pharmacological evidence. The question of PA's and LPA's origin is, however, more complicated, especially as both function as precursors in the biosynthesis of phospho- and galactolipids. To address this complexity, a combination of fatty acid-molecular species analysis and in vivo 32P-radiolabeling was performed. Evidence is provided that LPA is formed from a distinct pool of PA characterized by a high α-linolenic acid (18:3n-3) content. This molecular species was highly enriched in the polyphosphoinositide fraction, which is the substrate for PLC to form diacylglycerol. Together with differential 32P-radiolabeling studies and earlier PLD-transphosphatidylation and PLA2-inhibitor assays, the data were consistent with the hypothesis that the salt-induced LPA response is primarily generated through PLA2-mediated hydrolysis of DGK-generated PA and that PLD or de novo synthesis [via endoplasmic reticulum - or plastid-localized routes] is not a major contributor. PMID:21900174

  14. Phosphatidic acid regulation of PIPKI is critical for actin cytoskeletal reorganization.

    PubMed

    Roach, Akua N; Wang, Ziqing; Wu, Ping; Zhang, Feng; Chan, Robin B; Yonekubo, Yoshiya; Di Paolo, Gilbert; Gorfe, Alemayehu A; Du, Guangwei

    2012-12-01

    Type I phosphatidylinositol-4-phosphate 5-kinase (PIPKI) is the main enzyme generating the lipid second messenger phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2], which has critical functions in many cellular processes, such as cytoskeletal reorganization, membrane trafficking, and signal transduction. All three members of the PIPKI family are activated by phosphatidic acid (PA). However, how PA regulates the activity and functions of PIPKI have not been fully elucidated. In this study, we identify a PA-binding site on PIPKIγ. Mutation of this site inhibited the PA-stimulated activity and membrane localization of PIPKIγ as well as the formation of actin comets and foci induced by PIPKIγ. We also demonstrate that phospholipase D (PLD) generates a pool of PA involved in PIPKIγ regulation by showing that PLD inhibitors blocked the membrane localization of PIPKIγ and its ability to induce actin cytoskeletal reorganization. Targeting the PIPKIγ PA-binding-deficient mutant to membranes by a membrane localization sequence failed to restore the actin reorganization activity of PIPKIγ, suggesting that PA binding is not only involved in recruiting PIPKIγ to membranes but also may induce a conformational change. Taken together, these results reveal a new molecular mechanism through which PA regulates PIPKI and provides direct evidence that PA is important for the localization and functions of PIPKI in intact cells. PMID:22991193

  15. Saturated phosphatidic acids mediate saturated fatty acid–induced vascular calcification and lipotoxicity

    PubMed Central

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L.; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M.; Kuro-o, Makoto; Miyazaki, Makoto

    2015-01-01

    Recent evidence indicates that saturated fatty acid–induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification. PMID:26517697

  16. Phosphatidic Acid Produced by Phospholipase D Promotes RNA Replication of a Plant RNA Virus

    PubMed Central

    Hyodo, Kiwamu; Taniguchi, Takako; Manabe, Yuki; Kaido, Masanori; Mise, Kazuyuki; Sugawara, Tatsuya; Taniguchi, Hisaaki; Okuno, Tetsuro

    2015-01-01

    Eukaryotic positive-strand RNA [(+)RNA] viruses are intracellular obligate parasites replicate using the membrane-bound replicase complexes that contain multiple viral and host components. To replicate, (+)RNA viruses exploit host resources and modify host metabolism and membrane organization. Phospholipase D (PLD) is a phosphatidylcholine- and phosphatidylethanolamine-hydrolyzing enzyme that catalyzes the production of phosphatidic acid (PA), a lipid second messenger that modulates diverse intracellular signaling in various organisms. PA is normally present in small amounts (less than 1% of total phospholipids), but rapidly and transiently accumulates in lipid bilayers in response to different environmental cues such as biotic and abiotic stresses in plants. However, the precise functions of PLD and PA remain unknown. Here, we report the roles of PLD and PA in genomic RNA replication of a plant (+)RNA virus, Red clover necrotic mosaic virus (RCNMV). We found that RCNMV RNA replication complexes formed in Nicotiana benthamiana contained PLDα and PLDβ. Gene-silencing and pharmacological inhibition approaches showed that PLDs and PLDs-derived PA are required for viral RNA replication. Consistent with this, exogenous application of PA enhanced viral RNA replication in plant cells and plant-derived cell-free extracts. We also found that a viral auxiliary replication protein bound to PA in vitro, and that the amount of PA increased in RCNMV-infected plant leaves. Together, our findings suggest that RCNMV hijacks host PA-producing enzymes to replicate. PMID:26020241

  17. Phosphatidic acid produced by phospholipase D is required for tobacco pollen tube growth.

    PubMed

    Potocký, Martin; Eliás, Marek; Profotová, Bronislava; Novotná, Zuzana; Valentová, Olga; Zárský, Viktor

    2003-05-01

    Phospholipase D (PLD) and its product phosphatidic acid (PA) are involved in a number of signalling pathways regulating cell proliferation, membrane vesicle trafficking and defence responses in eukaryotic cells. Here we report that PLD and PA have a role in the process of polarised plant cell expansion as represented by pollen tube growth. Both phosphatidylinositol-4,5-bisphosphate-dependent and independent PLD activities were identified in pollen tube extracts, and activity levels during pollen tube germination and growth were measured. PLD-mediated PA production in vivo can be blocked by primary alcohols, which serve as a substrate for the transphosphatidylation reaction. Both pollen germination and tube growth are stopped in the presence 0.5% 1-butanol, whereas secondary and tertiary isomers do not show any effect. This inhibition could be overcome by addition of exogenous PA-containing liposomes. In the absence of n-butanol, addition of a micromolar concentration of PA specifically stimulates pollen germination and tube elongation. Furthermore, a recently established link between PLD and microtubule dynamics was supported by taxol-mediated partial rescue of the 1-butanol-inhibited pollen tubes. The potential signalling role for PLD-derived PA in plant cell expansion is discussed.

  18. Phosphatidic acid stimulates cardiac KATP channels like phosphatidylinositols, but with novel gating kinetics.

    PubMed

    Fan, Zheng; Gao, Lizhi; Wang, Wenxia

    2003-01-01

    Membrane-bound anionic phospholipids such as phosphatidylinositols have the capacity to modulate ATP-sensitive potassium (K(ATP)) channels through a mechanism involving long-range electrostatic interaction between the lipid headgroup and channel. However, it has not yet been determined whether the multiple effects of phosphatidylinositols reported in the literature all result from this general electrostatic interaction or require a specific headgroup structure. The present study investigated whether phosphatidic acid (PA), an anionic phospholipid substantially different in structure from phosphatidylinositols, evokes effects similar to phosphatidylinositols on native K(ATP) channels of rat heart and heterogeneous Kir6.2/SUR2A channels. Channels treated with PA (0.2-1 mg/ml applied to the cytoplasmic side of the membrane) exhibited higher activity, lower sensitivity to ATP inhibition, less Mg(2+)-dependent nucleotide stimulation, and poor sulfonylurea inhibition. These effects match the spectrum of phosphatidylinositols' effects, but, in addition, PA also induced a novel pattern in gating kinetics, represented by a decreased mean open time (from 12.2 +/- 2.0 to 3.3 +/- 0.7 ms). This impact on gating kinetics clearly distinguishes PA's effects from those of phosphatidylinositols. Results indicate that multiple effects of anionic phospholipids on K(ATP) channels are related phenomena and can likely be attributed to a common mechanism, but additional specific effects due to other mechanisms may also coincide.

  19. Role of phosphatidic acid in carbachol-induced contraction in guinea pig Taenia coli.

    PubMed

    Ohata, H; Nobe, K; Momose, K

    1991-01-01

    Carbachol (CCh, 10(-8)-10(-4) M) increased in concentration-dependent manner the mass of phosphatidic acid (PA), but not the mass of diacylglycerol (DG) in the Taenia coli from guinea pig. The increase in the amount of PA caused by CCh was maintained for 20 min. Release of choline from choline phospholipids labeled with [methyl-3H]choline was not changed by CCh. A DG kinase inhibitor, R59022, inhibited the CCh-induced increase in the mass of PA. These results indicate that the increase in the mass of PA by CCh is due to immediate phosphorylation by DG kinase to PA, of the DG produced by phospholipase C (PLC). It is not due to formation of PA by the direct action of phospholipase D. CCh increased 45Ca2+ uptake into the tissue. R59022 inhibited the sustained phase of CCh-induced contraction and 45Ca2+ uptake into the tissue, but only slightly inhibited the initial phase of the CCh-induced contraction. This inhibition by R59022 may result from the inhibitory effect on the CCh-induced increase in PA. These results suggest that CCh activates both PLC and DG kinase and the resultant increase in the mass of PA contributes to the regulation of the sustained phase of CCh-induced contraction which is related to Ca2+ influx.

  20. Increase in norepinephrine-induced formation of phosphatidic acid in rat vas deferens after denervation.

    PubMed

    Takenawa, T; Masaki, T; Goto, K

    1983-01-01

    Surgical denervation of rat vas deferens causes supersensitivity in that the tissue sensitivity and the maximum response to a variety of agonists increase. To understand the molecular mechanism of supersensitivity in smooth muscle, norepinephrine(NE)-induced alteration in phospholipid metabolism was studied using control and denervated vasa deferentia. When the tissue was stimulated by NE, only [32P]Pi incorporation into phosphatidic acid(PA) was increased in proportion to the increase in NE concentration without any significant effect on that into other phospholipids. This PA labeling was significantly accelerated by denervation. In the denervated tissue, PA labeling was stimulated by lower concentrations of NE and the maximum response to NE was increased compared to the control. The breakdown of phosphatidylinositol 4-monophosphate(DPI) and phosphatidylinositol 4,5-diphosphate (TPI) was also accelerated by NE. But the influence of denervation on this NE-induced DPI and TPI was not marked. Therefore, it is likely that denervation clearly enhanced NE-induced PA labeling without an appreciable effect on that of the other phospholipids. Furthermore, the absolute amount of PA was also increased by NE, and this increase was exaggerated by denervation. Considering that PA can behave as a Ca2+ ionophore in the plasma membrane, these results suggest that the stimulated accumulation of PA plays an important role in receptor-linked supersensitivity in smooth muscle.

  1. Phospholipase D2-dependent inhibition of the nuclear hormone receptor PPARgamma by cyclic phosphatidic acid.

    PubMed

    Tsukahara, Tamotsu; Tsukahara, Ryoko; Fujiwara, Yuko; Yue, Junming; Cheng, Yunhui; Guo, Huazhang; Bolen, Alyssa; Zhang, Chunxiang; Balazs, Louisa; Re, Fabio; Du, Guangwei; Frohman, Michael A; Baker, Daniel L; Parrill, Abby L; Uchiyama, Ayako; Kobayashi, Tetsuyuki; Murakami-Murofushi, Kimiko; Tigyi, Gabor

    2010-08-13

    Cyclic phosphatidic acid (1-acyl-2,3-cyclic-glycerophosphate, CPA), one of nature's simplest phospholipids, is found in cells from slime mold to humans and has a largely unknown function. We find here that CPA is generated in mammalian cells in a stimulus-coupled manner by phospholipase D2 (PLD2) and binds to and inhibits the nuclear hormone receptor PPARgamma with nanomolar affinity and high specificity through stabilizing its interaction with the corepressor SMRT. CPA production inhibits the PPARgamma target-gene transcription that normally drives adipocytic differentiation of 3T3-L1 cells, lipid accumulation in RAW264.7 cells and primary mouse macrophages, and arterial wall remodeling in a rat model in vivo. Inhibition of PLD2 by shRNA, a dominant-negative mutant, or a small molecule inhibitor blocks CPA production and relieves PPARgamma inhibition. We conclude that CPA is a second messenger and a physiological inhibitor of PPARgamma, revealing that PPARgamma is regulated by endogenous agonists as well as by antagonists. PMID:20705243

  2. High specificity of human secretory class II phospholipase A2 for phosphatidic acid.

    PubMed

    Snitko, Y; Yoon, E T; Cho, W

    1997-02-01

    Lysophosphatidic acid (LPA) is a potent lipid second messenger which stimulates platelet aggregation, cell proliferation and smooth-muscle contraction. The phospholipase A2 (PLA2)-catalysed hydrolysis of phosphatidic acid (PA) is thought to be a primary synthetic route for LPA. Of the multiple forms of PLA2 present in human tissues, human secretory class-II PLA2 (hs-PLA2) has been implicated in the production of LPA from platelets and whole blood cells challenged with inflammatory stimuli. To explore further the possibility that hs-PLA2 is involved in the production of LPA, we rigorously measured the phospholipid head group specificity of hs-PLA2 by a novel PLA2 kinetic system using polymerized mixed liposomes. Kinetic analysis of recombinant hs-PLA2 demonstrates that hs-PLA2 strongly prefers PA as substrate over other phospholipids found in the mammalian plasma membrane including phosphatidylserine (PS), phosphatidylcholine (PC) and phosphatidylethanolamine (PE). The order of preference is PA > PE approximately PS > PC. To identify amino acid residues of hs-PLA2 that are involved in its unique substrate specificity, we mutated two residues, Glu-56 and Lys-69, which were shown to interact with the phospholipid head group in the X-ray-crystallographic structure of the hs-PLA2-transition-state-analogue complex. The K69Y mutant showed selective inactivation toward PA whereas the E56K mutant displayed a most pronounced inactivation to PE. Thus it appears that Lys-69 is at least partially involved in the PA specificity of hs-PLA2 and Glu-56 in the distinction between PE and PC. In conjunction with a recent cell study [Fourcade, Simon, Viode, Rugani, Leballe, Ragab, Fournie, Sarda and Chap (1995) Cell 80, 919-927], these studies suggest that hs-PLA2 can rapidly hydrolyse PA molecules exposed to the outer layer of cell-derived microvesicles and thereby produce LPA.

  3. Phosphatidic acid mediates activation of mTORC1 through the ERK signaling pathway

    PubMed Central

    Winter, Jeremiah N.; Fox, Todd E.; Kester, Mark; Jefferson, Leonard S.

    2010-01-01

    The mammalian target of rapamycin (mTOR) assembles into two distinct multiprotein complexes known as mTORC1 and mTORC2. Of the two complexes, mTORC1 acts to integrate a variety of positive and negative signals to downstream targets that regulate cell growth. The lipid second messenger, phosphatidic acid (PA), represents one positive input to mTORC1, and it is thought to act by binding directly to mTOR, thereby enhancing the protein kinase activity of mTORC1. Support for this model includes findings that PA binds directly to mTOR and addition of PA to the medium of cells in culture results in activation of mTORC1. In contrast, the results of the present study do not support a model in which PA activates mTORC1 through direct interaction with the protein kinase but, instead, show that the lipid promotes mTORC1 signaling through activation of the ERK pathway. Moreover, rather than acting directly on mTORC1, the results suggest that exogenous PA must be metabolized to lysophosphatidic acid (LPA), which subsequently activates the LPA receptor endothelial differentiation gene (EDG-2). Finally, in contrast to previous studies, the results of the present study demonstrate that leucine does not act through phospholipase D and PA to activate mTORC1 and, instead, show that the two mediators act through parallel upstream signaling pathways to activate mTORC1. Overall, the results demonstrate that leucine and PA signal through parallel pathways to activate mTORC1 and that PA mediates its effect through the ERK pathway, rather than through direct binding to mTOR. PMID:20427710

  4. Phosphatidic acid inhibits blue light-induced stomatal opening via inhibition of protein phosphatase 1 [corrected].

    PubMed

    Takemiya, Atsushi; Shimazaki, Ken-ichiro

    2010-08-01

    Stomata open in response to blue light under a background of red light. The plant hormone abscisic acid (ABA) inhibits blue light-dependent stomatal opening, an effect essential for promoting stomatal closure in the daytime to prevent water loss. However, the mechanisms and molecular targets of this inhibition in the blue light signaling pathway remain unknown. Here, we report that phosphatidic acid (PA), a phospholipid second messenger produced by ABA in guard cells, inhibits protein phosphatase 1 (PP1), a positive regulator of blue light signaling, and PA plays a role in stimulating stomatal closure in Vicia faba. Biochemical analysis revealed that PA directly inhibited the phosphatase activity of the catalytic subunit of V. faba PP1 (PP1c) in vitro. PA inhibited blue light-dependent stomatal opening but did not affect red light- or fusicoccin-induced stomatal opening. PA also inhibited blue light-dependent H(+) pumping and phosphorylation of the plasma membrane H(+)-ATPase. However, PA did not inhibit the autophosphorylation of phototropins, blue light receptors for stomatal opening. Furthermore, 1-butanol, a selective inhibitor of phospholipase D, which produces PA via hydrolysis of phospholipids, diminished the ABA-induced inhibition of blue light-dependent stomatal opening and H(+) pumping. We also show that hydrogen peroxide and nitric oxide, which are intermediates in ABA signaling, inhibited the blue light responses of stomata and that 1-butanol diminished these inhibitions. From these results, we conclude that PA inhibits blue light signaling in guard cells by PP1c inhibition, accelerating stomatal closure, and that PP1 is a cross talk point between blue light and ABA signaling pathways in guard cells.

  5. Phosphatidylinositol and phosphatidic acid transport between the ER and plasma membrane during PLC activation requires the Nir2 protein.

    PubMed

    Kim, Yeun Ju; Guzman-Hernandez, Maria Luisa; Wisniewski, Eva; Echeverria, Nicolas; Balla, Tamas

    2016-02-01

    Phospholipase C (PLC)-mediated hydrolysis of the limited pool of plasma membrane (PM) phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] requires replenishment from a larger pool of phosphatidylinositol (PtdIns) via sequential phosphorylation by PtdIns 4-kinases and phosphatidylinositol 4-phosphate (PtdIns4P) 5-kinases. Since PtdIns is synthesized in the endoplasmic reticulum (ER) and PtdIns(4,5)P2 is generated in the PM, it has been postulated that PtdIns transfer proteins (PITPs) provide the means for this lipid transfer function. Recent studies identified the large PITP protein, Nir2 as important for PtdIns transfer from the ER to the PM. It was also found that Nir2 was required for the transfer of phosphatidic acid (PtdOH) from the PM to the ER. In Nir2-depleted cells, activation of PLC leads to PtdOH accumulation in the PM and PtdIns synthesis becomes severely impaired. In quiescent cells, Nir2 is localized to the ER via interaction of its FFAT domain with ER-bound VAMP-associated proteins VAP-A and-B. After PLC activation, Nir2 also binds to the PM via interaction of its C-terminal domains with diacylglycerol (DAG) and PtdOH. Through these interactions, Nir2 functions in ER-PM contact zones. Mutations in VAP-B that have been identified in familial forms of amyotrophic lateral sclerosis (ALS or Lou-Gehrig's disease) cause aggregation of the VAP-B protein, which then impairs its binding to several proteins, including Nir2. These findings have shed new lights on the importance of non-vesicular lipid transfer of PtdIns and PtdOH in ER-PM contact zones with a possible link to a devastating human disease.

  6. TGD4 involved in endoplasmic reticulum-to-chloroplast lipid trafficking is a phosphatidic acid binding protein

    SciTech Connect

    Wang Z.; Xu C.; Benning, C.

    2012-05-01

    The synthesis of galactoglycerolipids, which are prevalent in photosynthetic membranes, involves enzymes at the endoplasmic reticulum (ER) and the chloroplast envelope membranes. Genetic analysis of trigalactosyldiacylglycerol (TGD) proteins in Arabidopsis has demonstrated their role in polar lipid transfer from the ER to the chloroplast. The TGD1, 2, and 3 proteins resemble components of a bacterial-type ATP-binding cassette (ABC) transporter, with TGD1 representing the permease, TGD2 the substrate binding protein, and TGD3 the ATPase. However, the function of the TGD4 protein in this process is less clear and its location in plant cells remains to be firmly determined. The predicted C-terminal {beta}-barrel structure of TGD4 is weakly similar to proteins of the outer cell membrane of Gram-negative bacteria. Here, we show that, like TGD2, the TGD4 protein when fused to DsRED specifically binds phosphatidic acid (PtdOH). As previously shown for tgd1 mutants, tgd4 mutants have elevated PtdOH content, probably in extraplastidic membranes. Using highly purified and specific antibodies to probe different cell fractions, we demonstrated that the TGD4 protein was present in the outer envelope membrane of chloroplasts, where it appeared to be deeply buried within the membrane except for the N-terminus, which was found to be exposed to the cytosol. It is proposed that TGD4 is either directly involved in the transfer of polar lipids, possibly PtdOH, from the ER to the outer chloroplast envelope membrane or in the transfer of PtdOH through the outer envelope membrane.

  7. Activation of Src and release of intracellular calcium by phosphatidic acid during Xenopus laevis fertilization

    PubMed Central

    Bates, Ryan C.; Fees, Colby P.; Holland, William L.; Winger, Courtney C.; Batbayar, Khulan; Ancar, Rachel; Bergren, Todd; Petcoff, Douglas; Stith, Bradley J.

    2014-01-01

    We report a new step in the fertilization in Xenopus laevis which has been found to involve activation of Src tyrosine kinase to stimulate phospholipase C-γ (PLC- γ) which increases inositol 1,4,5-trisphosphate (IP3) to release intracellular calcium ([Ca]i). Molecular species analysis and mass measurements suggested that sperm activate phospholipase D (PLD) to elevate phosphatidic acid (PA). We now report that PA mass increased 2.7 fold by 1 minute after insemination and inhibition of PA production by two methods inhibited activation of Src and PLCγ, increased [Ca]i and other fertilization events. As compared to 14 other lipids, PA strongly bound Xenopus Src but not PLCγ. Addition of synthetic PA activated egg Src (an action requiring intact lipid rafts) and PLCγ as well as doubling the amount of PLCγ in rafts. In the absence of elevated [Ca]i, PA addition elevated IP3 mass to levels equivalent to that induced by sperm (but twice that achieved by calcium ionophore). Finally, PA induced [Ca]i release that was blocked by an IP3 receptor inhibitor. As only PLD1b message was detected, and Western blotting did not detect PLD2, we suggest that sperm activate PLD1b to elevate PA which then binds to and activates Src leading to PLCγ stimulation, IP3 elevation and [Ca]i release. Due to these and other studies, PA may also play a role in membrane fusion events such as sperm-egg fusion, cortical granule exocytosis, the elevation of phosphatidylinositol 4,5-bisphosphate and the large, late increase in sn 1,2-diacylglycerol in fertilization. PMID:24269904

  8. Diacylglycerol Kinase ϵ Is Selective for Both Acyl Chains of Phosphatidic Acid or Diacylglycerol*

    PubMed Central

    Lung, Michael; Shulga, Yulia V.; Ivanova, Pavlina T.; Myers, David S.; Milne, Stephen B.; Brown, H. Alex; Topham, Matthew K.; Epand, Richard M.

    2009-01-01

    The phosphatidylinositol (PI) cycle mediates many cellular events by controlling the metabolism of many lipid second messengers. Diacylglycerol kinase ϵ (DGKϵ) has an important role in this cycle. DGKϵ is the only DGK isoform to show inhibition by its product phosphatidic acid (PA) as well as substrate specificity for sn-2 arachidonoyl-diacylglycerol (DAG). Here, we show that this inhibition and substrate specificity are both determined by selectivity for a combination of the sn-1 and sn-2 acyl chains of PA or DAG, respectively, preferring the most prevalent acyl chain composition of lipids involved specifically in the PI cycle, 1-stearoyl-2-arachidonoyl. Although the difference in rate for closely related lipid species is small, there is a significant enrichment of 1-stearoyl-2-arachidonoyl PI because of the cyclical nature of PI turnover. We also show that the inhibition of DGKϵ by PA is competitive and that the deletion of the hydrophobic segment and cationic cluster of DGKϵ does not affect its selectivity for the acyl chains of PA or DAG. Thus, this active site not only recognizes the lipid headgroup but also a combination of the two acyl chains in PA or DAG. We propose a mechanism of DGKϵ regulation where its dual acyl chain selectivity is used to negatively regulate its enzymatic activity in a manner that ensures DGKϵ remains committed to the PI turnover cycle. This novel mechanism of enzyme regulation within a signaling pathway could serve as a template for the regulation of enzymes in other pathways in the cell. PMID:19744926

  9. Phosphatidic acid enhances mTOR signaling and resistance exercise induced hypertrophy

    PubMed Central

    2014-01-01

    Introduction The lipid messenger phosphatidic acid (PA) plays a critical role in the stimulation of mTOR signaling. However, the mechanism by which PA stimulates mTOR is currently unknown. Therefore, the purpose of this study was to compare the effects of various PA precursors and phospholipids on their ability to stimulate mTOR signaling and its ability to augment resistance training-induced changes in body composition and performance. Methods In phase one, C2C12 myoblasts cells were stimulated with different phospholipids and phospholipid precursors derived from soy and egg sources. The ratio of phosphorylated p70 (P-p70-389) to total p70 was then used as readout for mTOR signaling. In phase two, resistance trained subjects (n = 28, 21 ± 3 years, 77 ± 4 kg, 176 ± 9 cm) consumed either 750 mg PA daily or placebo and each took part in an 8 week periodized resistance training program. Results In phase one, soy-phosphatidylserine, soy-Lyso-PA, egg-PA, and soy-PA stimulated mTOR signaling, and the effects of soy-PA (+636%) were significantly greater than egg-PA (+221%). In phase two, PA significantly increased lean body mass (+2.4 kg), cross sectional area (+1.0 cm), and leg press strength (+51.9 kg) over placebo. Conclusion PA significantly activates mTOR and significantly improved responses in skeletal muscle hypertrophy, lean body mass, and maximal strength to resistance exercise. PMID:24959196

  10. Studies on the formation by rat brain preparations of CDP-diglyceride from CTP and phosphatidic acids of varying fatty acid compositions.

    PubMed

    Bishop, H H; Strickland, K P

    1976-03-01

    The enzyme, CTP:phosphatidate cytidylyltransferase (EC2.7.7.41) which catalyses formation of CDP-diglyceride from CTP and phosphatidic acid has been studied in rat brain preparations and other tissues. Improvement, as judged by the higher tissue activities obtained, in the assay method for this enzyme was achieved through use of phosphatidic acids sonicated in buffer-detergent solution saturated with ether and containing bovine serum albumin and use of short incubation times which essentially provided a measure of initial rates. The enzyme of rat brain microsomes yielded with 1,2-dioleolphosphatidic acid as substrate a pH optimum of 6.8 with maleate buffer and optimal concentrations of 60mM for MG2+, 6MM for CTP and 250 mug per 0.8 ml for phosphatidic acid. Enzyme activity was mainly located in the 90,000 X g fraction (microsomal) with small but significant activity in the 12,000 X g fraction. Comparison of activities (nanomoles CTP incorporated per milligram protein per minute) amongst tissues showed the following order: brain, 1.87; liver, 1.32; lung, 1.19; small intestine, 1.00; kidney, 0.69; heart, 0.41; diaphragm, 0.07; skeletal muscle, 0.02. Examination of the effect of varying the fatty acid composition in the phosphatidic acids added exogenously gave the following order (activities in parentheses); 1-stearoyl-2-oleoyl- (5.58), 1-oleoyl-2-stearoyl- (5.37), 1,2-dioleoyl- (4.49) 1-palmitoyl-2-oleoyl-(3.85), 1-stearoyl-2-arachidonoyl-(3.31), 1-arachidonoyl-2-stearoyl-(3.16), 1,2-diarachidonoyl-(0.72), 1,2-dicaproyl-(0.67), 1,2-dipalmitoyl-(0.67) and 1,2-distearoyl-(0.18). The single bis- and lysophosphatidic acids tested were inactive as substrates. Apart from a possible preference for one or more unsaturated fatty acids the transferase enzyme showed no selectivity in respect to the fatty acid distribution of phosphatidic acids.

  11. Phosphatidic acid increases intracellular free Ca2+ and cardiac contractile force.

    PubMed

    Xu, Y J; Panagia, V; Shao, Q; Wang, X; Dhalla, N S

    1996-08-01

    Although phosphatidic acid (PA) is mainly formed due to the hydrolysis of phosphatidylcholine by myocardial phospholipase D, its functional significance in the heart is not fully understood. The present study was designed to determine the effects of PA on intracellular free Ca2+ level ([Ca2+]i) in freshly isolated adult rat cardiomyocytes by using fura 2-acextoxmethylester and free fura 2 technique. Addition of PA at concentrations of 1-200 microM produced a concentration-dependent increase in [Ca2+]i from the basal level of 117 +/- 8 nM; maximal increase in [Ca2+]i was 233 +/- 50 nM, whereas median effective concentration (EC50) for PA was 45 +/- 1.2 microM. This increase in [Ca2+]i was abolished by the removal of extracellular Ca2+ with ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid and was partially attenuated by Ca2+ channel blockers, verapamil or diltiazem. Preincubation of cardiomyocytes with cyclopiazonic acid and thapsigargin or with ryanodine [to deplete sarcoplasmic reticulum (SR) Ca2+] attenuated the PA-induced increase in [Ca2+]i by 66, 37, and 43%, respectively. Furthermore, the response of [Ca2+]i to PA was blunted by 2-nitro-4 carboxyphenylcarbonate, an inhibitor of phospholipase C, but was unaffected by staurosporine, a protein kinase C inhibitor. PA was also observed to induce Ca2+ efflux from the myocytes. In addition, an injection of PA (0.34 microgram/100 g body wt i.v.) in rats produced a significant increase of the left ventricular developed pressure as well as the maximum rates of cardiac contraction and relaxation within 5 min. These data suggest that the PA-induced increase in [Ca2+]i in cardiomyocytes is a consequence of both Ca2+ influx from the extracellular source and Ca2+ release from the intracellular SR stores. Furthermore, these in vitro data suggest the possibility that PA may regulate [Ca2+]i and contractile parameters in the heart.

  12. Rapid attenuation of receptor-induced diacylglycerol and phosphatidic acid by phospholipase D-mediated transphosphatidylation: formation of bisphosphatidic acid.

    PubMed Central

    van Blitterswijk, W J; Hilkmann, H

    1993-01-01

    Generation and attenuation of lipid second messengers are key processes in cellular signalling. Receptor-mediated increase in 1,2-diacylglycerol (DG) levels is attenuated by DG kinase and DG lipase. We here report a novel mechanism of DG attenuation by phospholipase D (PLD), which also precludes the production of another (putative) second messenger, phosphatidic acid (PA). In the presence of an alcohol, PLD converts phosphatidylcholine (PC) into a phosphatidylalcohol (by transphosphatidylation) rather than into PA. We found in bradykinin-stimulated human fibroblasts that PLD mediates transphosphatidylation from PC (donor) to the endogenous 'alcohol' DG (acceptor), yielding bis(1,2-diacylglycero)-3-sn-phosphate (bisphosphatidic acid; bisPA). This uncommon phospholipid is thus a condensation product of the phospholipase C (PLC) and PLD signalling pathways, where PLC produces DG and PLD couples this DG to a phosphatidyl moiety. Long-term phorbol ester treatment blocks bradykinin-induced activation of PLD and consequent bisPA formation, thereby unveiling rapid formation of DG. BisPA formation is rapid (15 s) and transient (peaks at 2-10 min) and is also induced by other stimuli capable of raising DG and activating PLD simultaneously, e.g. endothelin, lysophosphatidic acid, fetal calf serum, phorbol ester, dioctanoylglycerol or bacterial PLC. This novel metabolic route counteracts rapid accumulation of receptor-induced DG and PA, and assigns for the first time a physiological role to the transphosphatidylation activity of PLD, that is signal attenuation. Images PMID:8392931

  13. A HPLC-fluorescence detection method for determination of phosphatidic acid phosphohydrolase activity: application in human myocardium.

    PubMed

    Burgdorf, Christof; Prey, Antje; Richardt, Gert; Kurz, Thomas

    2008-03-15

    Phosphatidic acid phosphohydrolase (PAP) catalyzes the dephosphorylation of phosphatidic acid (PA) to diacylglycerol, the second messenger responsible for activation of protein kinase C. Despite the crucial role of PAP lipid signaling, there are no data on PAP signaling function in the human heart. Here we present a nonradioactive assay for the investigation of PAP activity in human myocardium using a fluorescent derivative of PA, 2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphate (BODIPY-PA), as substrate in an in vitro PAP-catalyzed reaction. Unreacted BODIPY-PA was resolved from the PAP products by a binary gradient HPLC system and BODIPY-diacylglycerol was detected by fluorimetry. The reaction proceeded at a linear rate for up to 60 min and increased linearly with increasing amounts of cardiac protein in a range of 0.25 to 8.0 microg. This assay proved to be sensitive for accurate quantitation of total PAP activity, PAP-1 activity, and PAP-2 activity in human atrial tissue and right ventricular endomyocardial biopsies. Total PAP activity was approximately fourfold higher in ventricular myocardium than in atrial tissue. There was negligible PAP-1 activity in atrial myocardium compared with ventricular myocardium, indicating regional differences in activities and distribution pattern of PAP-1 and PAP-2 in the human heart. PMID:18023403

  14. A HPLC-fluorescence detection method for determination of phosphatidic acid phosphohydrolase activity: application in human myocardium.

    PubMed

    Burgdorf, Christof; Prey, Antje; Richardt, Gert; Kurz, Thomas

    2008-03-15

    Phosphatidic acid phosphohydrolase (PAP) catalyzes the dephosphorylation of phosphatidic acid (PA) to diacylglycerol, the second messenger responsible for activation of protein kinase C. Despite the crucial role of PAP lipid signaling, there are no data on PAP signaling function in the human heart. Here we present a nonradioactive assay for the investigation of PAP activity in human myocardium using a fluorescent derivative of PA, 2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphate (BODIPY-PA), as substrate in an in vitro PAP-catalyzed reaction. Unreacted BODIPY-PA was resolved from the PAP products by a binary gradient HPLC system and BODIPY-diacylglycerol was detected by fluorimetry. The reaction proceeded at a linear rate for up to 60 min and increased linearly with increasing amounts of cardiac protein in a range of 0.25 to 8.0 microg. This assay proved to be sensitive for accurate quantitation of total PAP activity, PAP-1 activity, and PAP-2 activity in human atrial tissue and right ventricular endomyocardial biopsies. Total PAP activity was approximately fourfold higher in ventricular myocardium than in atrial tissue. There was negligible PAP-1 activity in atrial myocardium compared with ventricular myocardium, indicating regional differences in activities and distribution pattern of PAP-1 and PAP-2 in the human heart.

  15. Raf-1 kinase possesses distinct binding domains for phosphatidylserine and phosphatidic acid. Phosphatidic acid regulates the translocation of Raf-1 in 12-O-tetradecanoylphorbol-13-acetate-stimulated Madin-Darby canine kidney cells.

    PubMed

    Ghosh, S; Strum, J C; Sciorra, V A; Daniel, L; Bell, R M

    1996-04-01

    Previous studies demonstrated that the cysteine-rich amino-terminal domain of Raf-1 kinase interacts selectively with phosphatidylserine (Ghosh, S., Xie, W. Q., Quest, A. F. G., Mabrouk, G. M., Strum, J. C., and Bell, R. M. (1994) J. Biol. Chem. 269, 10000-10007). Further analysis showed that full-length Raf-1 bound to both phosphatidylserine and phosphatidic acid (PA). Specifically, a carboxyl-terminal domain of Raf-1 kinase (RafC; residues 295 648 of human Raf-1) interacted strongly with phosphatidic acid. The binding of RafC to PA displayed positive cooperativity with Hill numbers between 3.3 and 6.2; the apparent Kd ranged from 4.9 +/- 0.6 to 7.8 +/- 0.9 mol % PA. The interaction of RafC with PA displayed a pH dependence distinct from the interaction between the cysteine-rich domain of Raf-1 and PA. Also, the RafC-PA interaction was unaffected at high ionic strength. Of all the lipids tested, only PA and cardiolipin exhibited high affinity binding; other acidic lipids were either ineffective or weakly effective. By deletion mutagenesis, the PA binding site within RafC was narrowed down to a 35-amino acid segment between residues 389 and 423. RafC did not bind phosphatidyl alcohols; also, inhibition of PA formation in Madin-Darby canine kidney cells by treatment with 1% ethanol significantly reduced the translocation of Raf-1 from the cytosol to the membrane following stimulation with 12-O-tetradecanoylphorbol-13-acetate. These results suggest a potential role of the lipid second messenger, PA, in the regulation of translocation and subsequent activation of Raf-1 in vivo.

  16. Overexpression of a phosphatidic acid phosphatase type 2 leads to an increase in triacylglycerol production in oleaginous Rhodococcus strains.

    PubMed

    Hernández, Martín A; Comba, Santiago; Arabolaza, Ana; Gramajo, Hugo; Alvarez, Héctor M

    2015-03-01

    Oleaginous Rhodococcus strains are able to accumulate large amounts of triacylglycerol (TAG). Phosphatidic acid phosphatase (PAP) enzyme catalyzes the dephosphorylation of phosphatidic acid (PA) to yield diacylglycerol (DAG), a key precursor for TAG biosynthesis. Studies to establish its role in lipid metabolism have been mainly focused in eukaryotes but not in bacteria. In this work, we identified and characterized a putative PAP type 2 (PAP2) encoded by the ro00075 gene in Rhodococcus jostii RHA1. Heterologous expression of ro00075 in Escherichia coli resulted in a fourfold increase in PAP activity and twofold in DAG content. The conditional deletion of ro00075 in RHA1 led to a decrease in the content of DAG and TAG, whereas its overexpression in both RHA1 and Rhodococcus opacus PD630 promoted an increase up to 10 to 15 % by cellular dry weight in TAG content. On the other hand, expression of ro00075 in the non-oleaginous strain Rhodococcus fascians F7 promoted an increase in total fatty acid content up to 7 % at the expense of free fatty acid (FFA), DAG, and TAG fractions. Moreover, co-expression of ro00075/atf2 genes resulted in a fourfold increase in total fatty acid content by a further increase of the FFA and TAG fractions. The results of this study suggest that ro00075 encodes for a PAP2 enzyme actively involved in TAG biosynthesis. Overexpression of this gene, as single one or with an atf gene, provides an alternative approach to increase the biosynthesis and accumulation of bacterial oils as a potential source of raw material for biofuel production.

  17. A Novel Phosphatidic Acid-Protein-tyrosine Phosphatase D2 Axis Is Essential for ERBB2 Signaling in Mammary Epithelial Cells*

    PubMed Central

    Ramesh, Mathangi; Krishnan, Navasona; Muthuswamy, Senthil K.; Tonks, Nicholas K.

    2015-01-01

    We used a loss-of-function screen to investigate the role of classical protein-tyrosine phosphatases (PTPs) in three-dimensional mammary epithelial cell morphogenesis and ERBB2 signaling. The study revealed a novel role for PTPD2 as a positive regulator of ERBB2 signaling. Suppression of PTPD2 attenuated the ERBB2-induced multiacinar phenotype in three-dimensional cultures specifically by inhibiting ERBB2-mediated loss of polarity and lumen filling. In contrast, overexpression of PTPD2 enhanced the ERBB2 phenotype. We also found that a lipid second messenger, phosphatidic acid, bound PTPD2 in vitro and enhanced its catalytic activity. Small molecule inhibitors of phospholipase D (PLD), an enzyme that produces phosphatidic acid in cells, also attenuated the ERBB2 phenotype. Exogenously added phosphatidic acid rescued the PLD-inhibition phenotype, but only when PTPD2 was present. These findings illustrate a novel pathway involving PTPD2 and the lipid second messenger phosphatidic acid that promotes ERBB2 function. PMID:25681440

  18. Agonist-induced production of 1,2-diacylglycerol and phosphatidic acid in intact resistance arteries. Evidence that accumulation of diacylglycerol is not a prerequisite for contraction.

    PubMed

    Ohanian, J; Ollerenshaw, J; Collins, P; Heagerty, A

    1990-05-25

    The production of total amounts of 1,2-diacylglycerol as well as those specifically derived from inositol lipid hydrolysis was studied in intact rat resistance arteries stimulated with either noradrenaline, vasopressin, or angiotensin II at 20 s when the onset of contraction would be nearing its maximum, and at 5 min during the sustained phase of contraction. Total amounts of 1,2-diacylglycerol were not altered by any agonist at 20 s, or at 5 min. However, arachidonate-containing species of 1,2-diacylglycerol were differentially influenced being increased at 5 min by noradrenaline, and decreased at 20 s and 5 min by vasopressin. Only angiotensin II produced substantial increases in this class of 1,2-diacylglycerol at both time points. In order to investigate the fate of this second messenger total and inositol lipid derived phosphatidic acids were then measured at both 20 s and 5 min. Noradrenaline induced a rise in both total and arachidonate-containing phosphatidic acid at both times as did vasopressin. Only small increases were induced by angiotensin II at 20 s. These data demonstrate that the accumulation of 1,2-diacylglycerol generated from inositol lipid breakdown is only observed with activation by angiotensin II. Other agonists produced phosphatidic acids with time and the rate of generation of these lipids is agonist-specific. Thus phosphatidic acid may play a more prominent role during the sustained phase of contraction than previously anticipated.

  19. PERK Utilizes Intrinsic Lipid Kinase Activity To Generate Phosphatidic Acid, Mediate Akt Activation, and Promote Adipocyte Differentiation

    PubMed Central

    Bobrovnikova-Marjon, Ekaterina; Pytel, Dariusz; Riese, Matthew J.; Vaites, Laura Pontano; Singh, Nickpreet; Koretzky, Gary A.; Witze, Eric S.

    2012-01-01

    The endoplasmic reticulum (ER) resident PKR-like kinase (PERK) is necessary for Akt activation in response to ER stress. We demonstrate that PERK harbors intrinsic lipid kinase, favoring diacylglycerol (DAG) as a substrate and generating phosphatidic acid (PA). This activity of PERK correlates with activation of mTOR and phosphorylation of Akt on Ser473. PERK lipid kinase activity is regulated in a phosphatidylinositol 3-kinase (PI3K) p85α-dependent manner. Moreover, PERK activity is essential during adipocyte differentiation. Because PA and Akt regulate many cellular functions, including cellular survival, proliferation, migratory responses, and metabolic adaptation, our findings suggest that PERK has a more extensive role in insulin signaling, insulin resistance, obesity, and tumorigenesis than previously thought. PMID:22493067

  20. PERK utilizes intrinsic lipid kinase activity to generate phosphatidic acid, mediate Akt activation, and promote adipocyte differentiation.

    PubMed

    Bobrovnikova-Marjon, Ekaterina; Pytel, Dariusz; Riese, Matthew J; Vaites, Laura Pontano; Singh, Nickpreet; Koretzky, Gary A; Witze, Eric S; Diehl, J Alan

    2012-06-01

    The endoplasmic reticulum (ER) resident PKR-like kinase (PERK) is necessary for Akt activation in response to ER stress. We demonstrate that PERK harbors intrinsic lipid kinase, favoring diacylglycerol (DAG) as a substrate and generating phosphatidic acid (PA). This activity of PERK correlates with activation of mTOR and phosphorylation of Akt on Ser473. PERK lipid kinase activity is regulated in a phosphatidylinositol 3-kinase (PI3K) p85α-dependent manner. Moreover, PERK activity is essential during adipocyte differentiation. Because PA and Akt regulate many cellular functions, including cellular survival, proliferation, migratory responses, and metabolic adaptation, our findings suggest that PERK has a more extensive role in insulin signaling, insulin resistance, obesity, and tumorigenesis than previously thought.

  1. Phosphatidic acid interacts with a MYB transcription factor and regulates its nuclear localization and function in Arabidopsis.

    PubMed

    Yao, Hongyan; Wang, Geliang; Guo, Liang; Wang, Xuemin

    2013-12-01

    Phosphatidic acid (PA) has emerged as a class of cellular mediators involved in various cellular and physiological processes, but little is known about its mechanism of action. Here we show that PA interacts with werewolf (WER), a R2R3 MYB transcription factor involved in root hair formation. The PA-interacting region is confined to the end of the R2 subdomain. The ablation of the PA binding motif has no effect on WER binding to DNA, but abolishes its nuclear localization and its function in regulating epidermal cell fate. Inhibition of PA production by phospholipase Dζ also suppresses WER's nuclear localization, root hair formation, and elongation. These results suggest a role for PA in promoting protein nuclear localization.

  2. Phosphatidic Acid Interacts with a MYB Transcription Factor and Regulates Its Nuclear Localization and Function in Arabidopsis[C][W

    PubMed Central

    Yao, Hongyan; Wang, Geliang; Guo, Liang; Wang, Xuemin

    2013-01-01

    Phosphatidic acid (PA) has emerged as a class of cellular mediators involved in various cellular and physiological processes, but little is known about its mechanism of action. Here we show that PA interacts with WEREWOLF (WER), a R2R3 MYB transcription factor involved in root hair formation. The PA-interacting region is confined to the end of the R2 subdomain. The ablation of the PA binding motif has no effect on WER binding to DNA, but abolishes its nuclear localization and its function in regulating epidermal cell fate. Inhibition of PA production by phospholipase Dζ also suppresses WER’s nuclear localization, root hair formation, and elongation. These results suggest a role for PA in promoting protein nuclear localization. PMID:24368785

  3. Mechanical stimulation induces mTOR signaling via an ERK-independent mechanism: implications for a direct activation of mTOR by phosphatidic acid.

    PubMed

    You, Jae Sung; Frey, John W; Hornberger, Troy A

    2012-01-01

    Signaling by mTOR is a well-recognized component of the pathway through which mechanical signals regulate protein synthesis and muscle mass. However, the mechanisms involved in the mechanical regulation of mTOR signaling have not been defined. Nevertheless, recent studies suggest that a mechanically-induced increase in phosphatidic acid (PA) may be involved. There is also evidence which suggests that mechanical stimuli, and PA, utilize ERK to induce mTOR signaling. Hence, we reasoned that a mechanically-induced increase in PA might promote mTOR signaling via an ERK-dependent mechanism. To test this, we subjected mouse skeletal muscles to mechanical stimulation in the presence or absence of a MEK/ERK inhibitor, and then measured several commonly used markers of mTOR signaling. Transgenic mice expressing a rapamycin-resistant mutant of mTOR were also used to confirm the validity of these markers. The results demonstrated that mechanically-induced increases in p70(s6k) T389 and 4E-BP1 S64 phosphorylation, and unexpectedly, a loss in total 4E-BP1, were fully mTOR-dependent signaling events. Furthermore, we determined that mechanical stimulation induced these mTOR-dependent events, and protein synthesis, through an ERK-independent mechanism. Similar to mechanical stimulation, exogenous PA also induced mTOR-dependent signaling via an ERK-independent mechanism. Moreover, PA was able to directly activate mTOR signaling in vitro. Combined, these results demonstrate that mechanical stimulation induces mTOR signaling, and protein synthesis, via an ERK-independent mechanism that potentially involves a direct interaction of PA with mTOR. Furthermore, it appears that a decrease in total 4E-BP1 may be part of the mTOR-dependent mechanism through which mechanical stimuli activate protein synthesis. PMID:23077579

  4. Mechanical stimulation induces mTOR signaling via an ERK-independent mechanism: implications for a direct activation of mTOR by phosphatidic acid.

    PubMed

    You, Jae Sung; Frey, John W; Hornberger, Troy A

    2012-01-01

    Signaling by mTOR is a well-recognized component of the pathway through which mechanical signals regulate protein synthesis and muscle mass. However, the mechanisms involved in the mechanical regulation of mTOR signaling have not been defined. Nevertheless, recent studies suggest that a mechanically-induced increase in phosphatidic acid (PA) may be involved. There is also evidence which suggests that mechanical stimuli, and PA, utilize ERK to induce mTOR signaling. Hence, we reasoned that a mechanically-induced increase in PA might promote mTOR signaling via an ERK-dependent mechanism. To test this, we subjected mouse skeletal muscles to mechanical stimulation in the presence or absence of a MEK/ERK inhibitor, and then measured several commonly used markers of mTOR signaling. Transgenic mice expressing a rapamycin-resistant mutant of mTOR were also used to confirm the validity of these markers. The results demonstrated that mechanically-induced increases in p70(s6k) T389 and 4E-BP1 S64 phosphorylation, and unexpectedly, a loss in total 4E-BP1, were fully mTOR-dependent signaling events. Furthermore, we determined that mechanical stimulation induced these mTOR-dependent events, and protein synthesis, through an ERK-independent mechanism. Similar to mechanical stimulation, exogenous PA also induced mTOR-dependent signaling via an ERK-independent mechanism. Moreover, PA was able to directly activate mTOR signaling in vitro. Combined, these results demonstrate that mechanical stimulation induces mTOR signaling, and protein synthesis, via an ERK-independent mechanism that potentially involves a direct interaction of PA with mTOR. Furthermore, it appears that a decrease in total 4E-BP1 may be part of the mTOR-dependent mechanism through which mechanical stimuli activate protein synthesis.

  5. Modification of intracellular free calcium in cultured A10 vascular smooth muscle cells by exogenous phosphatidic acid.

    PubMed

    Bhugra, Praveen; Xu, Yan-Jun; Rathi, Satyajeet; Dhalla, Naranjan S

    2003-06-15

    Exogenous phosphatidic acid (PA) was observed to produce a concentration-dependent increase in [Ca(2+)](i) in cultured A10 vascular smooth muscle cells. Preincubation of cells with sarcoplasmic reticulum Ca(2+)-ATPase inhibitors (cyclopiazonic acid and thapsigargin), a phospholipase C inhibitor (2-nitro-4-carboxyphenyl-N,N-diphenylcarbamate), inositol 1,4,5-trisphosphate receptor antagonists (2-aminoethoxydiphenyl borate and xestospongin), and an activator of protein kinase C (PKC) (phorbol 12-myristate 13-acetate) depressed the PA-evoked increase in [Ca(2+)](i). Although EGTA, an extracellular Ca(2+) chelator, decreased the PA-induced increase in [Ca(2+)](i), sarcolemmal Ca(2+)-channel blockers (verapamil or diltiazem) did not alter the action of PA. On the other hand, inhibitors of PKC (bisindolylmaleimide I) and G(i)-protein (pertussis toxin) potentiated the increase in [Ca(2+)](i) evoked by PA significantly. These results suggest that the PA-induced increase in [Ca(2+)](i) in vascular smooth muscle cells may occur upon the activation of phospholipase C and the subsequent release of Ca(2+) from the inositol 1,4,5-trisphosphate-sensitive Ca(2+) pool in the sarcoplasmic reticulum. This action of PA may be mediated through the involvement of PKC. PMID:12787890

  6. Modification of intracellular free calcium in cultured A10 vascular smooth muscle cells by exogenous phosphatidic acid.

    PubMed

    Bhugra, Praveen; Xu, Yan-Jun; Rathi, Satyajeet; Dhalla, Naranjan S

    2003-06-15

    Exogenous phosphatidic acid (PA) was observed to produce a concentration-dependent increase in [Ca(2+)](i) in cultured A10 vascular smooth muscle cells. Preincubation of cells with sarcoplasmic reticulum Ca(2+)-ATPase inhibitors (cyclopiazonic acid and thapsigargin), a phospholipase C inhibitor (2-nitro-4-carboxyphenyl-N,N-diphenylcarbamate), inositol 1,4,5-trisphosphate receptor antagonists (2-aminoethoxydiphenyl borate and xestospongin), and an activator of protein kinase C (PKC) (phorbol 12-myristate 13-acetate) depressed the PA-evoked increase in [Ca(2+)](i). Although EGTA, an extracellular Ca(2+) chelator, decreased the PA-induced increase in [Ca(2+)](i), sarcolemmal Ca(2+)-channel blockers (verapamil or diltiazem) did not alter the action of PA. On the other hand, inhibitors of PKC (bisindolylmaleimide I) and G(i)-protein (pertussis toxin) potentiated the increase in [Ca(2+)](i) evoked by PA significantly. These results suggest that the PA-induced increase in [Ca(2+)](i) in vascular smooth muscle cells may occur upon the activation of phospholipase C and the subsequent release of Ca(2+) from the inositol 1,4,5-trisphosphate-sensitive Ca(2+) pool in the sarcoplasmic reticulum. This action of PA may be mediated through the involvement of PKC.

  7. Phosphatidic acid mediates the targeting of tBid to induce lysosomal membrane permeabilization and apoptosis[S

    PubMed Central

    Zhao, Kai; Zhou, Hejiang; Zhao, Xingyu; Wolff, Dennis W.; Tu, Yaping; Liu, Huili; Wei, Taotao; Yang, Fuyu

    2012-01-01

    Upon apoptotic stimuli, lysosomal proteases, including cathepsins and chymotrypsin, are released into cytosol due to lysosomal membrane permeabilization (LMP), where they trigger apoptosis via the lysosomal-mitochondrial pathway of apoptosis. Herein, the mechanism of LMP was investigated. We found that caspase 8-cleaved Bid (tBid) could result in LMP directly. Although Bax or Bak might modestly enhance tBid-triggered LMP, they are not necessary for LMP. To study this further, large unilamellar vesicles (LUVs), model membranes mimicking the lipid constitution of lysosomes, were used to reconstitute the membrane permeabilization process in vitro. We found that phosphatidic acid (PA), one of the major acidic phospholipids found in lysosome membrane, is essential for tBid-induced LMP. PA facilitates the insertion of tBid deeply into lipid bilayers, where it undergoes homo-oligomerization and triggers the formation of highly curved nonbilayer lipid phases. These events induce LMP via pore formation mechanisms because encapsulated fluorescein-conjugated dextran (FD)-20 was released more significantly than FD-70 or FD-250 from LUVs due to its smaller molecular size. On the basis of these data, we proposed tBid-PA interactions in the lysosomal membranes form lipidic pores and result in LMP. We further noted that chymotrypsin-cleaved Bid is more potent than tBid at binding to PA, inserting into the lipid bilayer, and promoting LMP. This amplification mechanism likely contributes to the culmination of apoptotic signaling. PMID:22761256

  8. Phosphatidic Acid (PA) can Displace PPARα/LXRα Binding to The EGFR Promoter Causing its Transrepression in Luminal Cancer Cells

    PubMed Central

    Mahankali, Madhu; Farkaly, Terry; Bedi, Shimpi; Hostetler, Heather A.; Gomez-Cambronero, Julian

    2015-01-01

    The expression of the epidermal growth factor receptor (EGFR) is highly regulated in normal cells, whereas some cancer cells have high constitutive levels. Understanding naturally-occurring ways of downregulating EGFR in cancer cells was investigated. Phosphatidic acid (PA) or Nuclear Receptors (NR) PPARα/RXRα/LXRα, enhance EGFR expression, mediated by the promoter region -856(A) to -226(T). Unexpectedly, the combination of NRs and PA caused repression. PA induces a conformational change in the nuclear receptor PPARα (increase of alpha-helices at the expense of decreasing beta-sheets), as evidenced by circular dichroism. This represses the naturally-enhancing capability of PPARα on EGFR transcription. PPARα-overexpressing cells in the presence of PA > 300 nM or the enzyme that produces it, phospholipase D (PLD), downregulate EGFR expression. The reasons are two-fold. First, PA displaces PPARα binding to the EGFR promoter at those concentrations. Second, NR heterodimer-dependent promoter activity is weakened in the presence of PA in vivo. Since other genes considered (β-catenin, cyclin D3, PLD2 and ACOX-1) are also downregulated with a PA + PPARα combination, the transrepression appears to be a global phenomenon. Lastly, the reported effect is greater in MCF-7 than in MDA-MB-231 breast cancer cells, which could provide a novel basis for regulating excessive expression of EGFR in luminal cancer cells. PMID:26493292

  9. The brown adipocyte protein CIDEA promotes lipid droplet fusion via a phosphatidic acid-binding amphipathic helix

    PubMed Central

    Barneda, David; Planas-Iglesias, Joan; Gaspar, Maria L; Mohammadyani, Dariush; Prasannan, Sunil; Dormann, Dirk; Han, Gil-Soo; Jesch, Stephen A; Carman, George M; Kagan, Valerian; Parker, Malcolm G; Ktistakis, Nicholas T; Klein-Seetharaman, Judith; Dixon, Ann M; Henry, Susan A; Christian, Mark

    2015-01-01

    Maintenance of energy homeostasis depends on the highly regulated storage and release of triacylglycerol primarily in adipose tissue, and excessive storage is a feature of common metabolic disorders. CIDEA is a lipid droplet (LD)-protein enriched in brown adipocytes promoting the enlargement of LDs, which are dynamic, ubiquitous organelles specialized for storing neutral lipids. We demonstrate an essential role in this process for an amphipathic helix in CIDEA, which facilitates embedding in the LD phospholipid monolayer and binds phosphatidic acid (PA). LD pairs are docked by CIDEA trans-complexes through contributions of the N-terminal domain and a C-terminal dimerization region. These complexes, enriched at the LD–LD contact site, interact with the cone-shaped phospholipid PA and likely increase phospholipid barrier permeability, promoting LD fusion by transference of lipids. This physiological process is essential in adipocyte differentiation as well as serving to facilitate the tight coupling of lipolysis and lipogenesis in activated brown fat. DOI: http://dx.doi.org/10.7554/eLife.07485.001 PMID:26609809

  10. Phosphatidic Acid (PA) can Displace PPARα/LXRα Binding to The EGFR Promoter Causing its Transrepression in Luminal Cancer Cells.

    PubMed

    Mahankali, Madhu; Farkaly, Terry; Bedi, Shimpi; Hostetler, Heather A; Gomez-Cambronero, Julian

    2015-10-23

    The expression of the epidermal growth factor receptor (EGFR) is highly regulated in normal cells, whereas some cancer cells have high constitutive levels. Understanding naturally-occurring ways of downregulating EGFR in cancer cells was investigated. Phosphatidic acid (PA) or Nuclear Receptors (NR) PPARα/RXRα/LXRα, enhance EGFR expression, mediated by the promoter region -856(A) to -226(T). Unexpectedly, the combination of NRs and PA caused repression. PA induces a conformational change in the nuclear receptor PPARα (increase of alpha-helices at the expense of decreasing beta-sheets), as evidenced by circular dichroism. This represses the naturally-enhancing capability of PPARα on EGFR transcription. PPARα-overexpressing cells in the presence of PA > 300 nM or the enzyme that produces it, phospholipase D (PLD), downregulate EGFR expression. The reasons are two-fold. First, PA displaces PPARα binding to the EGFR promoter at those concentrations. Second, NR heterodimer-dependent promoter activity is weakened in the presence of PA in vivo. Since other genes considered (β-catenin, cyclin D3, PLD2 and ACOX-1) are also downregulated with a PA + PPARα combination, the transrepression appears to be a global phenomenon. Lastly, the reported effect is greater in MCF-7 than in MDA-MB-231 breast cancer cells, which could provide a novel basis for regulating excessive expression of EGFR in luminal cancer cells.

  11. Long-chain bases, phosphatidic acid, MAPKs, and reactive oxygen species as nodal signal transducers in stress responses in Arabidopsis

    PubMed Central

    Saucedo-García, Mariana; Gavilanes-Ruíz, Marina; Arce-Cervantes, Oscar

    2015-01-01

    Due to their sessile condition, plants have developed sensitive, fast, and effective ways to contend with environmental changes. These mechanisms operate as informational wires conforming extensive and intricate networks that are connected in several points. The responses are designed as pathways orchestrated by molecules that are transducers of protein and non-protein nature. Their chemical nature imposes selective features such as specificity, formation rate, and generation site to the informational routes. Enzymes such as mitogen-activated protein kinases and non-protein, smaller molecules, such as long-chain bases, phosphatidic acid, and reactive oxygen species are recurrent transducers in the pleiotropic responses to biotic and abiotic stresses in plants. In this review, we considered these four components as nodal points of converging signaling pathways that start from very diverse stimuli and evoke very different responses. These pleiotropic effects may be explained by the potentiality that every one of these four mediators can be expressed from different sources, cellular location, temporality, or magnitude. Here, we review recent advances in our understanding of the interplay of these four specific signaling components in Arabidopsis cells, with an emphasis on drought, cold and pathogen stresses. PMID:25763001

  12. Relationship between stimulated phosphatidic acid production and inositol lipid hydrolysis in intestinal longitudinal smooth muscle from guinea pig.

    PubMed

    Mallows, R S; Bolton, T B

    1987-06-15

    Accumulation of [32P]phosphatidic acid (PA) and total [3H]inositol phosphates (IPs) was measured in the longitudinal smooth-muscle layer from guinea-pig small intestine. Stimulation with carbachol, histamine and substance P produced increases in accumulation of both [3H]IPs and [32P]PA over the same concentration range. The increase in [32P]PA accumulation in response to carbachol (1 microM-0.1 mM) was inhibited in the presence of atropine (0.5 microM). Buffering the external free [Ca2+] to 10 nM did not prevent the carbachol-stimulated increase in [32P]PA accumulation. Carbachol and Ca2+ appear to act synergistically to increase accumulation of [32P]PA. In contrast, although incubation with noradrenaline also increased accumulation of [3H]IPs, no increase in accumulation of [32P]PA could be detected. These results suggest that an increase in formation of IPs is not necessarily accompanied by an increase in PA formation, and imply the existence of receptor-modulated pathways regulating PA concentrations other than by phospholipase-C-catalysed inositol phospholipid hydrolysis.

  13. A reappraisal of the dog-heart infarct plasmalogen, its conception as a bis-phosphatidic acid and current recognition as an N-acyl phosphatidyl ethanolamine.

    PubMed

    Hack, M H; Helmy, F M

    1982-01-01

    1. We have re-examined the lipids from myocardial infarcts of cat, dog, rabbit and man, mainly through TLC methods, and confirm the identity of cat and dog "infarct plasmalogen" as an N-acyl phosphatidyl ethanolamine (NAPE). This substance was not detected in infarcts of rabbit and man. 2. We have extended our observations on a similar phosphatide, as the plasmalogen form, naturally occurring in the brain and optic nerve of fish. 3. Supporting evidence for the NAPE identity was provided from non-plasmalogen forms isolated from peas and lentils. 4. NAPE in all of its forms was shown to be a reluctant substrate for the phospholipase A2 of snake venoms. 5. Co-chromatography problems involving NAPE, semi-lyso cardiolipin and bis-phosphatidic acid are documented and their relationship to the infarct phenomenon discussed.

  14. Phosphatidic acid increases inositol-1,4,5,-trisphosphate and [Ca2+]i levels in neonatal rat cardiomyocytes.

    PubMed

    Liu, P; Xu, Y; Hopfner, R L; Gopalakrishnan, V

    1999-08-25

    Phosphatidic acid (PA), which can be synthesized de novo, or as a product of phosphatidylcholine hydrolysis and/or phosphorylation of 1,2-diacylglycerol (DAG), mediates diverse cellular functions in various cell types, including cardiomyocytes. We set out to characterize the effect of PA on intracellular free calcium ([Ca2+]i) and inositol-1,4,5-trisphosphate (IP(3)) levels in primary cultures of neonatal rat cardiomyocytes. Addition of PA led to rapid, concentration and time dependent increases in both IP(3) and [Ca2+]i levels in adherent cells. There was strong correlation in the concentration-response relationships between IP(3) and [Ca2+]i increases evoked by PA. Incubation with the sarcoplasmic reticulum (SR) Ca2+ pump inhibitor, cyclopiazonic acid (CPA), significantly attenuated the PA evoked [Ca2+]i increase but had no significant effect on IP(3) accumulation. The phospholipase C (PLC) inhibitor, D-609, attenuated both IP(3) and [Ca2+]i elevations evoked by PA whereas staurosporine (STS), a potent and non-selective PKC inhibitor, had no significant effect on either. Another PLC inhibitor, U73122, but not its inactive analog, U73343, also inhibited PA evoked increases in [Ca2+]i. Depletion of extracellular calcium attenuated both basal and PA evoked increases in [Ca2+]i. The PLA(2) inhibitors, bromophenylacyl-bromide (BPB) and CDP-choline, had no effect on PA evoked [Ca2+]i responses. Neither the DAG analog, dioctanoylglycerol, nor the DAG kinase inhibitor, R59949, affected PA evoked changes in [Ca2+]i. Taken together, these data indicate that PA, in a manner independent of PKC, DAG, or PLA(2), may enhance Ca2+ release from IP(3) sensitive SR Ca(2+) stores via activation of PLC in neonatal rat cardiomyocytes.

  15. The role of diacylglycerol kinase ζ and phosphatidic acid in the mechanical activation of mammalian target of rapamycin (mTOR) signaling and skeletal muscle hypertrophy.

    PubMed

    You, Jae-Sung; Lincoln, Hannah C; Kim, Chan-Ran; Frey, John W; Goodman, Craig A; Zhong, Xiao-Ping; Hornberger, Troy A

    2014-01-17

    The activation of mTOR signaling is essential for mechanically induced changes in skeletal muscle mass, and previous studies have suggested that mechanical stimuli activate mTOR (mammalian target of rapamycin) signaling through a phospholipase D (PLD)-dependent increase in the concentration of phosphatidic acid (PA). Consistent with this conclusion, we obtained evidence which further suggests that mechanical stimuli utilize PA as a direct upstream activator of mTOR signaling. Unexpectedly though, we found that the activation of PLD is not necessary for the mechanically induced increases in PA or mTOR signaling. Motivated by this observation, we performed experiments that were aimed at identifying the enzyme(s) that promotes the increase in PA. These experiments revealed that mechanical stimulation increases the concentration of diacylglycerol (DAG) and the activity of DAG kinases (DGKs) in membranous structures. Furthermore, using knock-out mice, we determined that the ζ isoform of DGK (DGKζ) is necessary for the mechanically induced increase in PA. We also determined that DGKζ significantly contributes to the mechanical activation of mTOR signaling, and this is likely driven by an enhanced binding of PA to mTOR. Last, we found that the overexpression of DGKζ is sufficient to induce muscle fiber hypertrophy through an mTOR-dependent mechanism, and this event requires DGKζ kinase activity (i.e. the synthesis of PA). Combined, these results indicate that DGKζ, but not PLD, plays an important role in mechanically induced increases in PA and mTOR signaling. Furthermore, this study suggests that DGKζ could be a fundamental component of the mechanism(s) through which mechanical stimuli regulate skeletal muscle mass. PMID:24302719

  16. The role of diacylglycerol kinase ζ and phosphatidic acid in the mechanical activation of mammalian target of rapamycin (mTOR) signaling and skeletal muscle hypertrophy.

    PubMed

    You, Jae-Sung; Lincoln, Hannah C; Kim, Chan-Ran; Frey, John W; Goodman, Craig A; Zhong, Xiao-Ping; Hornberger, Troy A

    2014-01-17

    The activation of mTOR signaling is essential for mechanically induced changes in skeletal muscle mass, and previous studies have suggested that mechanical stimuli activate mTOR (mammalian target of rapamycin) signaling through a phospholipase D (PLD)-dependent increase in the concentration of phosphatidic acid (PA). Consistent with this conclusion, we obtained evidence which further suggests that mechanical stimuli utilize PA as a direct upstream activator of mTOR signaling. Unexpectedly though, we found that the activation of PLD is not necessary for the mechanically induced increases in PA or mTOR signaling. Motivated by this observation, we performed experiments that were aimed at identifying the enzyme(s) that promotes the increase in PA. These experiments revealed that mechanical stimulation increases the concentration of diacylglycerol (DAG) and the activity of DAG kinases (DGKs) in membranous structures. Furthermore, using knock-out mice, we determined that the ζ isoform of DGK (DGKζ) is necessary for the mechanically induced increase in PA. We also determined that DGKζ significantly contributes to the mechanical activation of mTOR signaling, and this is likely driven by an enhanced binding of PA to mTOR. Last, we found that the overexpression of DGKζ is sufficient to induce muscle fiber hypertrophy through an mTOR-dependent mechanism, and this event requires DGKζ kinase activity (i.e. the synthesis of PA). Combined, these results indicate that DGKζ, but not PLD, plays an important role in mechanically induced increases in PA and mTOR signaling. Furthermore, this study suggests that DGKζ could be a fundamental component of the mechanism(s) through which mechanical stimuli regulate skeletal muscle mass.

  17. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initia...

  18. Rapid phosphatidic acid accumulation in response to low temperature stress in Arabidopsis is generated through diacylglycerol kinase.

    PubMed

    Arisz, Steven A; van Wijk, Ringo; Roels, Wendy; Zhu, Jian-Kang; Haring, Michel A; Munnik, Teun

    2013-01-01

    Phosphatidic acid (PtdOH) is emerging as an important signaling lipid in abiotic stress responses in plants. The effect of cold stress was monitored using (32)P-labeled seedlings and leaf discs of Arabidopsis thaliana. Low, non-freezing temperatures were found to trigger a very rapid (32)P-PtdOH increase, peaking within 2 and 5 min, respectively. In principle, PtdOH can be generated through three different pathways, i.e., (1) via de novo phospholipid biosynthesis (through acylation of lyso-PtdOH), (2) via phospholipase D hydrolysis of structural phospholipids, or (3) via phosphorylation of diacylglycerol (DAG) by DAG kinase (DGK). Using a differential (32)P-labeling protocol and a PLD-transphosphatidylation assay, evidence is provided that the rapid (32)P-PtdOH response was primarily generated through DGK. A simultaneous decrease in the levels of (32)P-PtdInsP, correlating in time, temperature dependency, and magnitude with the increase in (32)P-PtdOH, suggested that a PtdInsP-hydrolyzing PLC generated the DAG in this reaction. Testing T-DNA insertion lines available for the seven DGK genes, revealed no clear changes in (32)P-PtdOH responses, suggesting functional redundancy. Similarly, known cold-stress mutants were analyzed to investigate whether the PtdOH response acted downstream of the respective gene products. The hos1, los1, and fry1 mutants were found to exhibit normal PtdOH responses. Slight changes were found for ice1, snow1, and the overexpression line Super-ICE1, however, this was not cold-specific and likely due to pleiotropic effects. A tentative model illustrating direct cold effects on phospholipid metabolism is presented.

  19. The role of phospholipase D and phosphatidic acid in the mechanical activation of mTOR signaling in skeletal muscle.

    PubMed

    Hornberger, T A; Chu, W K; Mak, Y W; Hsiung, J W; Huang, S A; Chien, S

    2006-03-21

    Signaling by the mammalian target of rapamycin (mTOR) has been reported to be necessary for mechanical load-induced growth of skeletal muscle. The mechanisms involved in the mechanical activation of mTOR signaling are not known, but several studies indicate that a unique [phosphotidylinositol-3-kinase (PI3K)- and nutrient-independent] mechanism is involved. In this study, we have demonstrated that a regulatory pathway for mTOR signaling that involves phospholipase D (PLD) and the lipid second messenger phosphatidic acid (PA) plays a critical role in the mechanical activation of mTOR signaling. First, an elevation in PA concentration was sufficient for the activation of mTOR signaling. Second, the isozymes of PLD (PLD1 and PLD2) are localized to the z-band in skeletal muscle (a critical site of mechanical force transmission). Third, mechanical stimulation of skeletal muscle with intermittent passive stretch ex vivo induced PLD activation, PA accumulation, and mTOR signaling. Finally, pharmacological inhibition of PLD blocked the mechanically induced increase in PA and the activation of mTOR signaling. Combined, these results indicate that mechanical stimuli activate mTOR signaling through a PLD-dependent increase in PA. Furthermore, we showed that mTOR signaling was partially resistant to rapamycin in muscles subjected to mechanical stimulation. Because rapamycin and PA compete for binding to the FRB domain on mTOR, these results suggest that mechanical stimuli activate mTOR signaling through an enhanced binding of PA to the FRB domain on mTOR. PMID:16537399

  20. Phosphatidic acid (PA) binds PP2AA1 to regulate PP2A activity and PIN1 polar localization.

    PubMed

    Gao, Hong-Bo; Chu, Yu-Jia; Xue, Hong-Wei

    2013-09-01

    Phospholipase D (PLD) exerts broad biological functions in eukaryotes through regulating downstream effectors by its product, phosphatidic acid (PA). Protein kinases and phosphatases, such as mammalian target of rapamycin (mTOR), Protein Phosphatase 1 (PP1) and Protein Phosphatase 2C (PP2C), are PA-binding proteins that execute crucial regulatory functions in both animals and plants. PA participates in many signaling pathways by modulating the enzymatic activity and/or subcellular localization of bound proteins. In this study, we demonstrated that PLD-derived PA interacts with the scaffolding A1 subunit of Protein Phosphatase 2A (PP2A) and regulates PP2A-mediated PIN1 dephosphorylation in Arabidopsis. Genetic and pharmacological studies showed that both PA and PP2A participate in the regulation of auxin distribution. In addition, both the phosphorylation status and polar localization of PIN1 protein were affected by PLD inhibitors. Exogenous PA triggered the membrane accumulation of PP2AA1 and enhanced the PP2A activity at membrane, while PLD inhibition resulted in the reduced endosomal localization and perinuclear aggregation of PP2AA1. These results demonstrate the important role of PLD-derived PA in normal PP2A-mediated PIN dephosphorylation and reveal a novel mechanism, in which PA recruits PP2AA1 to the membrane system and regulates PP2A function on membrane-targeted proteins. As PA and PP2A are conserved among eukaryotes, other organisms might use similar mechanisms to mediate multiple biological processes.

  1. The role of phospholipase D and phosphatidic acid in the mechanical activation of mTOR signaling in skeletal muscle.

    PubMed

    Hornberger, T A; Chu, W K; Mak, Y W; Hsiung, J W; Huang, S A; Chien, S

    2006-03-21

    Signaling by the mammalian target of rapamycin (mTOR) has been reported to be necessary for mechanical load-induced growth of skeletal muscle. The mechanisms involved in the mechanical activation of mTOR signaling are not known, but several studies indicate that a unique [phosphotidylinositol-3-kinase (PI3K)- and nutrient-independent] mechanism is involved. In this study, we have demonstrated that a regulatory pathway for mTOR signaling that involves phospholipase D (PLD) and the lipid second messenger phosphatidic acid (PA) plays a critical role in the mechanical activation of mTOR signaling. First, an elevation in PA concentration was sufficient for the activation of mTOR signaling. Second, the isozymes of PLD (PLD1 and PLD2) are localized to the z-band in skeletal muscle (a critical site of mechanical force transmission). Third, mechanical stimulation of skeletal muscle with intermittent passive stretch ex vivo induced PLD activation, PA accumulation, and mTOR signaling. Finally, pharmacological inhibition of PLD blocked the mechanically induced increase in PA and the activation of mTOR signaling. Combined, these results indicate that mechanical stimuli activate mTOR signaling through a PLD-dependent increase in PA. Furthermore, we showed that mTOR signaling was partially resistant to rapamycin in muscles subjected to mechanical stimulation. Because rapamycin and PA compete for binding to the FRB domain on mTOR, these results suggest that mechanical stimuli activate mTOR signaling through an enhanced binding of PA to the FRB domain on mTOR.

  2. [Fat-stabilizing properties of phosphatides. 1. Response of selected phosphatides to oxygen].

    PubMed

    Linow, F; Mieth, G

    1975-01-01

    The authors investigated the formation of hydroperoxides and carbonyl compounds in raw phosphatides from soya-beans and rape-seeds during storage at 50 degrees C. According to the results obtained, the chemical deterioration of the raw phosphatides depends upon their intrinsic contents of prooxidative and antioxidative compounds and upon the consituent fatty acids. Purified preparations are considerably more stable as comparable fatty acid methyl esters; and phosphatides containing nitrogenous bases are less sensitive to atmospheric oxygen than their nitrogen-free analogues. PMID:1171372

  3. Exercise-induced translocation of protein kinase C and production of diacylglycerol and phosphatidic acid in rat skeletal muscle in vivo. Relationship to changes in glucose transport.

    PubMed

    Cleland, P J; Appleby, G J; Rattigan, S; Clark, M G

    1989-10-25

    Contraction-induced translocation of protein kinase C (Richter E.A., Cleland, P.J.F., Rattigan, S., and Clark, M.G. (1987) FEBS Lett. 217, 232-236) implies a role for this enzyme in muscle contraction or the associated metabolic adjustments. In the present study, this role is further examined particularly in relation to changes in glucose transport. Electrical stimulation of the sciatic nerve of the anesthetized rat in vivo led to a time-dependent translocation of protein kinase C and a 2-fold increase in the concentrations of both diacylglycerol and phosphatidic acid. Maximum values for the latter were reached at 2 min and preceded the maximum translocation of protein kinase C (10 min). Stimulation of muscles in vitro increased the rate of glucose transport, but this required 20 min to reach maximum. There was no reversal of translocation or decrease in the concentrations of diacylglycerol and phosphatidic acid even after 30 min of rest following a 5-min period of stimulation in vivo. Translocation was not influenced by variations in applied load at maximal fiber recruitment but was dependent on the frequency of nontetanic stimuli, reaching a maximum at 4 Hz. The relationship between protein kinase C and glucose transport was also explored by varying the number of tetanic stimuli. Whereas only one train of stimuli (200 ms, 100 Hz) was required for maximal effects on protein kinase C, diacylglycerol, and phosphatidic acid, more than 35 trains of stimuli were required to activate glucose transport. It is concluded that the production of diacylglycerol and the translocation of protein kinase C may be causally related. However, if the translocated protein kinase C is involved in the activation of glucose transport during muscle contractions, an accumulated exposure to Ca2+, resulting from multiple contractions, would appear to be necessary.

  4. Delta 6- and delta 12-desaturase activities and phosphatidic acid formation in microsomal preparations from the developing cotyledons of common borage (Borago officinalis).

    PubMed

    Griffiths, G; Stobart, A K; Stymne, S

    1988-06-15

    Microsomal membrane preparations from the maturing cotyledons of common borage (Borago officinalis) exhibit delta 12- and delta 6-desaturase activities, which resulted in the synthesis of linoleate and gamma-linolenate respectively. The desaturase enzymes utilized the complex lipid substrate phosphatidylcholine. The activity of these enzymes was sufficiently high to allow the monitoring of the mass changes in the endogenous oleate, linoleate and gamma-linolenate in the microsomal phosphatidylcholine in the presence of NADH (i.e. under desaturating conditions). The results illustrate that the delta 12-desaturase uses the oleate substrate at both the sn-1 and -2 positions of sn-phosphatidylcholine, whereas the delta 6-desaturase is almost totally restricted to the linoleate at position 2 of the complex lipid. Estimate of the acyl-substrate pool size at position 2 of sn-phosphatidylcholine for both desaturases indicated that some 50% of the oleate and linoleate was available to the enzymes. The microsomes (microsomal fractions) had a somewhat impaired Kennedy [(1961) Fed. Proc. Fed. Am. Soc. Exp. Biol. 20, 934-940] pathway for the formation of triacylglycerols when compared with other oil-rich plant species that have been studied [Stymne & Stobart (1987) The Biochemistry of Plants: a Comprehensive Treatise (Stumpf, P.K., ed.), vol. 10, chapter 8, pp. 175-214, Academic Press, New York]. In the presence of sn-glycerol 3-phosphate and acyl-CoA, large quantities of phosphatidic acid accumulated in the membranes. Acyl-selectivity studies on the glycerol-acylating enzymes showed that gamma-linolenate could be acylated to both the sn-1 and sn-2 positions of sn-glycerol 3-phosphate. However, stereochemical analysis of the acyl components of the sn-triacylglycerol obtained from mature seeds indicated that, whereas no gamma-linolenate was present at the sn-1 position, it accounted for over 50% of the fatty acids at position sn-3. The results indicate that the diacylglycerol

  5. Molecular species analysis of phosphatidylinositol (PI), phosphatidic acid (PA) and diacylglycerol (DG) in rat mast cells

    SciTech Connect

    Kennerly, D.A.

    1987-05-01

    The metabolism of DG, PA and PI were studied in purified rat mast cells to determine whether generally accepted pathways of PI metabolism could explain the pattern of fatty acids seen in these intermediates. A method was developed to separate and quantitate by mass (for DG) or endogenous labeling (for PA and PI) the different molecular species of each lipid that are defined by their component fatty acids. The resultant molecular species fingerprint for each lipid was examined to see if it was similar to other intermediates in the PI cycle. For each class of compounds the percent in a given subclass was recorded. Stimulation caused a reduction of more saturated subclasses and/or an increase in AA containing compounds in PA, PI and DG. The relative similarity of subclasses of /sup 32/P-PA and /sup 32/P-PI supports the view that they are metabolically related. The relative absence of AA-containing species of DG suggests that most of the stimulated increase of DG was not produced by PI hydrolysis.

  6. Interaction of phosphatidic acid and phosphatidylserine with the Ca2+-ATPase of sarcoplasmic reticulum and the mechanism of inhibition.

    PubMed

    Dalton, K A; East, J M; Mall, S; Oliver, S; Starling, A P; Lee, A G

    1998-02-01

    The sarcoplasmic reticulum of skeletal muscle contains anionic phospholipids as well as the zwitterionic phosphatidylcholine and phosphatidylethanolamine. Here we study the effects of anionic phospholipids on the activity of the Ca2+-ATPase purified from the membrane. Reconstitution of the Ca2+-ATPase into dioleoylphosphatidylserine [di(C18:1)PS] or dioleoylphosphatidic acid [di(C18:1)PA] leads to a decrease in ATPase activity. Measurements of the quenching of the tryptophan fluorescence of the ATPase by brominated phospholipids give a relative binding constant for the anionic lipids compared with dioleoylphosphatidylcholine close to 1 and suggest that phosphatidic acid only binds to the ATPase at the bulk lipid sites around the ATPase. Addition of di(C18:1)PS or di(C18:1)PA to the ATPase in the short-chain dimyristoleoylphosphatidylcholine [di(C14:1)PC] reverse the effects of the short-chain lipid on ATPase activity and on Ca2+ binding, as revealed by the response of tryptophan fluorescence intensity to Ca2+ binding. It is concluded that the lipid headgroup and lipid fatty acyl chains have separate effects on the function of the ATPase. The anionic phospholipids have no significant effect on Ca2+ binding to the ATPase; the level of Ca2+ binding to the ATPase, the affinity of binding and the rate of dissociation of Ca2+ are unchanged by reconstitution into di(C18:1)PA. The major effect of the anionic lipids is a reduction in the maximal level of binding of MgATP. This is attributed to the formation of oligomers of the Ca2+-ATPase, in which only one molecule of the ATPase can bind MgATP dimers in di(C18:1)PS and trimers or tetramers in di(C18:1)PA. The rates of phosphorylation and dephosphorylation for the proportion of the ATPase still able to bind ATP are unaffected by reconstitution. Larger changes were observed in the level of phosphorylation of the ATPase by Pi, which became very low in the anionic phospholipids. The fluorescence response to Mg2+ for the ATPase

  7. Identification of a soluble phosphatidate phosphohydrolase in the developing cotyledons of Morordica charantia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidate phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4), which is also known as PAP, catalyzes the dephosphorylation of phosphatidate (PtdOH) to form diacylglycerol (DAG) and inorganic phosphate. In eukaryotes, PAP driven reaction is the committed step in the synthesis of triacy...

  8. Carbachol induces a rapid and sustained hydrolysis of polyphosphoinositide in bovine tracheal smooth muscle measurements of the mass of polyphosphoinositides, 1,2-diacylglycerol, and phosphatidic acid

    SciTech Connect

    Takuwa, Y.; Takuwa, N.; Rasmussen, H.

    1986-11-05

    The effects of carbachol on polyphosphoinositides and 1,2-diacylglycerol metabolism were investigated in bovine tracheal smooth muscle by measuring both lipid mass and the turnover of (/sup 3/H)inositol-labeled phosphoinositides. Carbachol induces a rapid reduction in the mass of phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate and a rapid increase in the mass of 1,2-diacylglycerol and phosphatidic acid. These changes in lipid mass are sustained for at least 60 min. The level of phosphatidylinositol shows a delayed and progressive decrease during a 60-min period of carbachol stimulation. The addition of atropine reverses these responses completely. Carbachol stimulates a rapid loss in (/sup 3/H)inositol radioactivity from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate associated with production of (/sup 3/H)inositol trisphosphate. The carbachol-induced change in the mass of phosphoinositides and phosphatidic acid is not affected by removal of extracellular Ca/sup 2 +/ and does not appear to be secondary to an increase in intracellular Ca/sup 2 +/. These results indicate that carbachol causes phospholipase C-mediated polyphosphoinositide breakdown, resulting in the production of inositol trisphosphate and a sustained increase in the actual content of 1,2-diacylglycerol. These results strongly suggest that carbachol-induced contraction is mediated by the hydrolysis of polyphosphoinositides with the resulting generation of two messengers: inositol 1,4,5-trisphosphate and 1,2-diacylglycerol.

  9. Carbachol induces a rapid and sustained hydrolysis of polyphosphoinositide in bovine tracheal smooth muscle measurements of the mass of polyphosphoinositides, 1,2-diacylglycerol, and phosphatidic acid.

    PubMed

    Takuwa, Y; Takuwa, N; Rasmussen, H

    1986-11-01

    The effects of carbachol on polyphosphoinositides and 1,2-diacylglycerol metabolism were investigated in bovine tracheal smooth muscle by measuring both lipid mass and the turnover of [3H]inositol-labeled phosphoinositides. Carbachol induces a rapid reduction in the mass of phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate and a rapid increase in the mass of 1,2-diacylglycerol and phosphatidic acid. These changes in lipid mass are sustained for at least 60 min. The level of phosphatidylinositol shows a delayed and progressive decrease during a 60-min period of carbachol stimulation. The addition of atropine reverses these responses completely. Carbachol stimulates a rapid loss in [3H]inositol radioactivity from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate associated with production of [3H]inositol trisphosphate. The carbachol-induced change in the mass of phosphoinositides and phosphatidic acid is not affected by removal of extracellular Ca2+ and does not appear to be secondary to an increase in intracellular Ca2+. These results indicate that carbachol causes phospholipase C-mediated polyphosphoinositide breakdown, resulting in the production of inositol trisphosphate and a sustained increase in the actual content of 1,2-diacylglycerol. These results strongly suggest that carbachol-induced contraction is mediated by the hydrolysis of polyphosphoinositides with the resulting generation of two messengers: inositol 1,4,5-trisphosphate and 1,2-diacylglycerol.

  10. Involvement of lysophosphatidic acid, sphingosine 1-phosphate and ceramide 1-phosphate in the metabolization of phosphatidic acid by lipid phosphate phosphatases in bovine rod outer segments.

    PubMed

    Pasquaré, Susana J; Salvador, Gabriela A; Giusto, Norma Maria

    2008-07-01

    The aim of the present research was to evaluate the generation of [2-3H]diacylglycerol ([2-3H]DAG) from [2-3H]-Phosphatidic acid ([2-3H]PA) by lipid phosphate phosphatases (LPPs) at different concentrations of lysophosphatidic acid (LPA), sphingosine 1-phosphate (S1P), and ceramide 1-phosphate (C1P) in purified ROS obtained from dark-adapted retinas (DROS) or light-adapted retinas (BLROS) as well as in ROS membrane preparations depleted of soluble and peripheral proteins. Western blot analysis revealed the presence of LPP3 exclusively in all membrane preparations. Immunoblots of entire ROS and depleted ROS did not show dark-light differences in LPP3 levels. LPPs activities were diminished by 53% in BLROS with respect to DROS. The major competitive effect on PA hydrolysis was exerted by LPA and S1P in DROS and by C1P in BLROS. LPPs activities in depleted ROS were similar to the activity observed in entire DROS and BLROS, respectively. LPA, S1P and C1P competed at different extent in depleted DROS and BLROS. Sphingosine and ceramide inhibited LPPs activities in entire and depleted DROS. Ceramide also inhibited LPPs activities in entire and in depleted BLROS. Our findings are indicative of a different degree of competition between PA and LPA, S1P and C1P by LPPs depending on the illumination state of the retina. PMID:18288612

  11. Compartmentation of hepatic fatty-acid-binding protein in liver cells and its effect on microsomal phosphatidic acid biosynthesis.

    PubMed

    Bordewick, U; Heese, M; Börchers, T; Robenek, H; Spener, F

    1989-03-01

    Fatty-acid-binding proteins are known to occur in the cytosol of mammalian cells and to bind fatty acids and their CoA-esters. Application of the postembedding protein A-gold labeling method with antibody against the hepatic type fatty-acid-binding protein (hFABP) to cross-sections of liver cells and a newly developed gel-chromatographic immunofluorescence assay established qualitatively (1) that hFABP in mitochondria was confined to outer mitochondrial membranes, (2) the presence of this protein in microsomes and (3) that nuclei were also filled with hFABP. Quantitative data elaborated with a non-competitive ELISA confirmed these results. A significant difference to the distribution of cardiac FABP in heart muscle cells, where this type of protein was found in cytosol, matrix and nuclei, was observed (Börchers et al. (1989) Biochim. Biophys. Acta, in the press). hFABP-containing rat liver microsomes were incubated with long-chain acyl-CoAs in the presence of hFABP (isolated from rat liver cytosol) in a study on the acylation of sn-glycerol-3-phosphate and lysophosphatidic acid. Both acyltransferases were stimulated by addition of hFABP to the incubation medium. The morphological, immunochemical as well as kinetic data infer a direct interaction of hFABP with microsomal membranes in liver cells.

  12. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  13. Phospholipase D and phosphatidic acid in plant defence response: from protein-protein and lipid-protein interactions to hormone signalling.

    PubMed

    Zhao, Jian

    2015-04-01

    Phospholipase Ds (PLDs) and PLD-derived phosphatidic acids (PAs) play vital roles in plant hormonal and environmental responses and various cellular dynamics. Recent studies have further expanded the functions of PLDs and PAs into plant-microbe interaction. The molecular diversities and redundant functions make PLD-PA an important signalling complex regulating lipid metabolism, cytoskeleton dynamics, vesicle trafficking, and hormonal signalling in plant defence through protein-protein and protein-lipid interactions or hormone signalling. Different PLD-PA signalling complexes and their targets have emerged as fast-growing research topics for understanding their numerous but not yet established roles in modifying pathogen perception, signal transduction, and downstream defence responses. Meanwhile, advanced lipidomics tools have allowed researchers to reveal further the mechanisms of PLD-PA signalling complexes in regulating lipid metabolism and signalling, and their impacts on jasmonic acid/oxylipins, salicylic acid, and other hormone signalling pathways that essentially mediate plant defence responses. This review attempts to summarize the progress made in spatial and temporal PLD/PA signalling as well as PLD/PA-mediated modification of plant defence. It presents an in-depth discussion on the functions and potential mechanisms of PLD-PA complexes in regulating actin filament/microtubule cytoskeleton, vesicle trafficking, and hormonal signalling, and in influencing lipid metabolism-derived metabolites as critical signalling components in plant defence responses. The discussion puts PLD-PA in a broader context in order to guide future research.

  14. Phospholipase D and phosphatidic acid in plant defence response: from protein–protein and lipid–protein interactions to hormone signalling

    PubMed Central

    Zhao, Jian

    2015-01-01

    Phospholipase Ds (PLDs) and PLD-derived phosphatidic acids (PAs) play vital roles in plant hormonal and environmental responses and various cellular dynamics. Recent studies have further expanded the functions of PLDs and PAs into plant–microbe interaction. The molecular diversities and redundant functions make PLD–PA an important signalling complex regulating lipid metabolism, cytoskeleton dynamics, vesicle trafficking, and hormonal signalling in plant defence through protein–protein and protein–lipid interactions or hormone signalling. Different PLD–PA signalling complexes and their targets have emerged as fast-growing research topics for understanding their numerous but not yet established roles in modifying pathogen perception, signal transduction, and downstream defence responses. Meanwhile, advanced lipidomics tools have allowed researchers to reveal further the mechanisms of PLD–PA signalling complexes in regulating lipid metabolism and signalling, and their impacts on jasmonic acid/oxylipins, salicylic acid, and other hormone signalling pathways that essentially mediate plant defence responses. This review attempts to summarize the progress made in spatial and temporal PLD/PA signalling as well as PLD/PA-mediated modification of plant defence. It presents an in-depth discussion on the functions and potential mechanisms of PLD–PA complexes in regulating actin filament/microtubule cytoskeleton, vesicle trafficking, and hormonal signalling, and in influencing lipid metabolism-derived metabolites as critical signalling components in plant defence responses. The discussion puts PLD–PA in a broader context in order to guide future research. PMID:25680793

  15. Nonideal mixing and phase separation in phosphatidylcholine-phosphatidic acid mixtures as a function of acyl chain length and pH.

    PubMed Central

    Garidel, P; Johann, C; Blume, A

    1997-01-01

    The miscibilities of phosphatidic acids (PAs) and phosphatidylcholines (PCs) with different chain lengths (n = 14, 16) at pH 4, pH 7, and pH 12 were examined by differential scanning calorimetry. Simulation of heat capacity curves was performed using a new approach that incorporates changes of cooperativity of the transition in addition to nonideal mixing in the gel and the liquid-crystalline phase as a function of composition. From the simulations of the heat capacity curves, first estimates for the nonideality parameters for nonideal mixing as a function of composition were obtained, and phase diagrams were constructed using temperatures for onset and end of melting, which were corrected for the broadening effect caused by a decrease in cooperativity. In all cases the composition dependence of the nonideality parameters indicated nonsymmetrical mixing behavior. The phase diagrams were therefore further refined by simulations of the coexistence curves using a four-parameter approximation to account for nonideal and nonsymmetrical mixing in the gel and the liquid-crystalline phase. The mixing behavior was studied at three different pH values to investigate how changes in headgroup charge of the PA influences the miscibility. The experiments showed that at pH 7, where the PA component is negatively charged, the nonideality parameters are in most cases negative, indicating that electrostatic effects favor a mixing of the two components. Partial protonation of the PA component at pH 4 leads to strong changes in miscibility; the nonideality parameters for the liquid-crystalline phase are now in most cases positive, indicating clustering of like molecules. The phase diagram for 1,2-dimyristoyl-sn-glycero-3-phosphatidic acid:1,2-dipalmitoyl-sn-glycero-3-phosphorylcholine mixtures at pH 4 indicates that a fluid-fluid immiscibility is likely. The results show that a decrease in ionization of PAs can induce large changes in mixing behavior. This occurs because of a

  16. Silymarin secretion and its elicitation by methyl jasmonate in cell cultures of Silybum marianum is mediated by phospholipase D-phosphatidic acid.

    PubMed

    Madrid, Elena; Corchete, Purificación

    2010-03-01

    The flavonolignan silymarin is released to the extracellular medium of Silybum marianum cultures and its production can be stimulated by the elicitor methyljasmonate (MeJA). The sequence of the signalling processes leading to this response is unknown at present. It is reported in this work that MeJA increased the activity of the enzyme phospholipase D (PLD). Treatment with mastoparan (Mst), a PLD activity stimulator, also enhanced PLD and caused a substantial increase in silymarin production. The application of the product of PLD activity, phosphatidic acid (PA) promoted silymarin accumulation. Altering PLD activity by introducing in cultures n-butanol (nBuOH), which inhibits PA production by PLD, prevented silymarin elicitation by MeJA or Mst and also impeded its release in non-elicited cultures. Treatment with iso-, sec- or tert- butanol had no effect on silymarin production. The exogenous addition of PA reversed the inhibitory action of nBuOH, both in control and MeJA-treated cultures. These results suggest that the enzyme PLD and its product PA mediate silymarin secretion to the medium of S. marianum cultures.

  17. RNA Sequencing Identifies Upregulated Kyphoscoliosis Peptidase and Phosphatidic Acid Signaling Pathways in Muscle Hypertrophy Generated by Transgenic Expression of Myostatin Propeptide

    PubMed Central

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-01-01

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition. PMID:25860951

  18. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

    PubMed

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-01-01

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition. PMID:25860951

  19. Structural and functional studies of a phosphatidic acid-binding antifungal plant defensin MtDef4: Identification of an RGFRRR motif governing fungal cell entry

    SciTech Connect

    Sagaram, Uma S.; El-Mounadi, Kaoutar; Buchko, Garry W.; Berg, Howard R.; Kaur, Jagdeep; Pandurangi, Raghoottama; Smith, Thomas J.; Shah, Dilip

    2013-12-04

    A highly conserved plant defensin MtDef4 potently inhibits the growth of a filamentous fungus Fusarium graminearum. MtDef4 is internalized by cells of F. graminearum. To determine its mechanism of fungal cell entry and antifungal action, NMR solution structure of MtDef4 has been determined. The analysis of its structure has revealed a positively charged patch on the surface of the protein consisting of arginine residues in its γ-core signature, a major determinant of the antifungal activity of MtDef4. Here, we report functional analysis of the RGFRRR motif of the γ-core signature of MtDef4. The replacement of RGFRRR to AAAARR or to RGFRAA not only abolishes fungal cell entry but also results in loss of the antifungal activity of MtDef4. MtDef4 binds strongly to phosphatidic acid (PA), a precursor for the biosynthesis of membrane phospholipids and a signaling lipid known to recruit cytosolic proteins to membranes. Mutations of RGFRRR which abolish fungal cell entry of MtDef4 also impair its binding to PA. Our results suggest that RGFRRR motif is a translocation signal for entry of MtDef4 into fungal cells and that this positively charged motif likely mediates interaction of this defensin with PA as part of its antifungal action.

  20. The recruitment of Raf-1 to membranes is mediated by direct interaction with phosphatidic acid and is independent of association with Ras.

    PubMed

    Rizzo, M A; Shome, K; Watkins, S C; Romero, G

    2000-08-01

    The serine/threonine kinase Raf-1 is an essential component of the MAPK cascade. Activation of Raf-1 by extracellular signals is initiated by association with intracellular membranes. Recruitment of Raf-1 to membranes has been reported to be mediated by direct association with Ras and by the phospholipase D product phosphatidic acid (PA). Here we report that insulin stimulation of HIRcB fibroblasts leads to accumulation of Ras, Raf-1, phosphorylated MEK, phosphorylated MAPK, and PA on endosomal membranes. Mutations that disrupt Raf-PA interactions prevented recruitment of Raf-1 to membranes, whereas disruption of Ras-Raf interactions did not affect agonist-dependent translocation. Expression of a dominant-negative Ras mutant did not prevent insulin-dependent Raf-1 translocation, but inhibited phosphorylation of MAPK. Finally, the PA-binding region of Raf-1 was sufficient to target green fluorescent protein to membranes, and its overexpression blocked recruitment of Raf-1 to membranes and disrupted insulin-dependent MAPK phosphorylation. These results indicate that agonist-dependent Raf-1 translocation is primarily mediated by a direct interaction with PA and is independent of association with Ras.

  1. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

    PubMed

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-04-09

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

  2. Involvement of phosphatidate phosphatase in the biosynthesis of triacylglycerols in Chlamydomonas reinhardtii * #

    PubMed Central

    Deng, Xiao-dong; Cai, Jia-jia; Fei, Xiao-wen

    2013-01-01

    Lipid biosynthesis is essential for eukaryotic cells, but the mechanisms of the process in microalgae remain poorly understood. Phosphatidic acid phosphohydrolase or 3-sn-phosphatidate phosphohydrolase (PAP) catalyzes the dephosphorylation of phosphatidic acid to form diacylglycerols and inorganic orthophosphates. This reaction is integral in the synthesis of triacylglycerols. In this study, the mRNA level of the PAP isoform CrPAP2 in a species of Chlamydomonas was found to increase in nitrogen-free conditions. Silencing of the CrPAP2 gene using RNA interference resulted in the decline of lipid content by 2.4%–17.4%. By contrast, over-expression of the CrPAP2 gene resulted in an increase in lipid content by 7.5%–21.8%. These observations indicate that regulation of the CrPAP2 gene can control the lipid content of the algal cells. In vitro CrPAP2 enzyme activity assay indicated that the cloned CrPAP2 gene exhibited biological activities. PMID:24302712

  3. ESI-MS/MS and MALDI-IMS Localization Reveal Alterations in Phosphatidic Acid, Diacylglycerol, and DHA in Glioma Stem Cell Xenografts.

    PubMed

    Wildburger, Norelle C; Wood, Paul L; Gumin, Joy; Lichti, Cheryl F; Emmett, Mark R; Lang, Frederick F; Nilsson, Carol L

    2015-06-01

    Glioblastoma (GBM) is the most common adult primary brain tumor. Despite aggressive multimodal therapy, the survival of patients with GBM remains dismal. However, recent evidence has demonstrated the promise of bone marrow-derived mesenchymal stem cells (BM-hMSCs) as a therapeutic delivery vehicle for anti-glioma agents due to their ability to migrate or home to human gliomas. While several studies have demonstrated the feasibility of harnessing the homing capacity of BM-hMSCs for targeted delivery of cancer therapeutics, it is now also evident, based on clinically relevant glioma stem cell (GSC) models of GBMs, that BM-hMSCs demonstrate variable tropism toward these tumors. In this study, we compared the lipid environment of GSC xenografts that attract BM-hMSCs (N = 9) with those that do not attract (N = 9) to identify lipid modalities that are conducive to homing of BM-hMSC to GBMs. We identified lipids directly from tissue by matrix-assisted laser desorption/ionization (MALDI) imaging mass spectrometry (IMS) and electrospray ionization-tandem mass spectrometry (ESI-MS/MS) of lipid extracts. Several species of signaling lipids, including phosphatidic acid (PA 36:2, PA 40:5, PA 42:5, and PA 42:7) and diacylglycerol (DAG 34:0, DAG 34:1, DAG 36:1, DAG 38:4, DAG 38:6, and DAG 40:6), were lower in attracting xenografts. Molecular lipid images showed that PA (36:2), DAG (40:6), and docosahexaenoic acid (DHA) were decreased within tumor regions of attracting xenografts. Our results provide the first evidence for lipid signaling pathways and lipid-mediated tumor inflammatory responses in the homing of BM-hMSCs to GSC xenografts. Our studies provide new fundamental knowledge on the molecular correlates of the differential homing capacity of BM-hMSCs toward GSC xenografts.

  4. The FKBP-rapamycin binding domain of human TOR undergoes strong conformational changes in the presence of membrane mimetics with and without the regulator phosphatidic acid.

    PubMed

    Rodriguez Camargo, Diana C; Link, Nina M; Dames, Sonja A

    2012-06-19

    The Ser/Thr kinase target of rapamycin (TOR) is a central controller of cellular growth and metabolism. Misregulation of TOR signaling is involved in metabolic and neurological disorders and tumor formation. TOR can be inhibited by association of a complex of rapamycin and FKBP12 to the FKBP12-rapamycin binding (FRB) domain. This domain was further proposed to interact with phosphatidic acid (PA), a lipid second messenger present in cellular membranes. Because mammalian TOR has been localized at various cellular membranes and in the nucleus, the output of TOR signaling may depend on its localization, which is expected to be influenced by the interaction with complex partners and regulators in response to cellular signals. Here, we present a detailed characterization of the interaction of the FRB domain with PA and how it is influenced by the surrounding membrane environment. On the basis of nuclear magnetic resonance- and circular dichroism-monitored binding studies using different neutral and negatively charged lipids as well as different membrane mimetics (micelles, bicelles, and liposomes), the FRB domain may function as a conditional peripheral membrane protein. However, the data for the isolated domain just indicate an increased affinity for negatively charged lipids and membrane patches but no specific preference for PA or PA-enriched regions. The membrane-mimetic environment induces strong conformational changes that largely maintain the α-helical secondary structure content but presumably disperse the helices in the lipidic environment. Consistent with overlapping binding surfaces for different lipids and the FKBP12-rapamycin complex, binding of the inhibitor complex protects the FRB domain from interactions with membrane mimetics at lower lipid concentrations.

  5. A 20-kDa domain is required for phosphatidic acid-induced allosteric activation of phospholipase D from Streptomyces chromofuscus.

    PubMed

    Geng, D; Baker, D P; Foley, S F; Zhou, C; Stieglitz, K; Roberts, M F

    1999-03-19

    Two phospholipase D (PLD) enzymes with both hydrolase and transferase activities were isolated from Streptomyces chromofuscus. There were substantial differences in the kinetic properties of the two PLD enzymes towards monomeric, micellar, and vesicle substrates. The most striking difference was that the higher molecular weight enzyme (PLD57 approximately 57 kDa) could be activated allosterically with a low mole fraction of phosphatidic acid (PA) incorporated into a PC bilayer (Geng et al., J. Biol. Chem. 273 (1998) 12195-12202). PLD42/20, a tightly associated complex of two peptides, one of 42 kDa and the other 20 kDa, had a 4-6-fold higher Vmax toward PC substrates than PLD57 and was not activated by PA. N-Terminal sequencing of both enzymes indicated that both components of PLD42/20 were cleavage products of PLD57. The larger component included the N-terminal segment of PLD57 and contained the active site. The N-terminus of the smaller peptide corresponded to the C-terminal region of PLD57; this peptide had no PLD activity by itself. Increasing the pH of PLD42/20 to 8.9, followed by chromatography of PLD42/20 on a HiTrap Q column at pH 8.5 separated the 42- and 20-kDa proteins. The 42-kDa complex had about the same specific activity with or without the 20-kDa fragment. The lack of PA activation for the 42-kDa protein and for PLD42/20 indicates that an intact C-terminal region of PLD57 is necessary for activation by PA. Furthermore, the mechanism for transmission of the allosteric signal requires an intact PLD57.

  6. Protein kinase A-mediated phosphorylation of Pah1p phosphatidate phosphatase functions in conjunction with the Pho85p-Pho80p and Cdc28p-cyclin B kinases to regulate lipid synthesis in yeast.

    PubMed

    Su, Wen-Min; Han, Gil-Soo; Casciano, Jessica; Carman, George M

    2012-09-28

    Pah1p, which functions as phosphatidate phosphatase (PAP) in the yeast Saccharomyces cerevisiae, plays a crucial role in lipid homeostasis by controlling the relative proportions of its substrate phosphatidate and its product diacylglycerol. The diacylglycerol produced by PAP is used for the synthesis of triacylglycerol as well as for the synthesis of phospholipids via the Kennedy pathway. Pah1p is a highly phosphorylated protein in vivo and has been previously shown to be phosphorylated by the protein kinases Pho85p-Pho80p and Cdc28p-cyclin B. In this work, we showed that Pah1p was a bona fide substrate for protein kinase A, and we identified by mass spectrometry and mutagenesis that Ser-10, Ser-677, Ser-773, Ser-774, and Ser-788 were the target sites of phosphorylation. Protein kinase A-mediated phosphorylation of Pah1p inhibited its PAP activity by decreasing catalytic efficiency, and the inhibitory effect was primarily conferred by phosphorylation at Ser-10. Analysis of the S10A and S10D mutations (mimicking dephosphorylation and phosphorylation, respectively), alone or in combination with the seven alanine (7A) mutations of the sites phosphorylated by Pho85p-Pho80p and Cdc28p-cyclin B, indicated that phosphorylation at Ser-10 stabilized Pah1p abundance and inhibited its association with membranes, PAP activity, and triacylglycerol synthesis. The S10A mutation enhanced the physiological effects imparted by the 7A mutations, whereas the S10D mutations attenuated the effects of the 7A mutations. These data indicated that the protein kinase A-mediated phosphorylation of Ser-10 functions in conjunction with the phosphorylations mediated by Pho85p-Pho80p and Cdc28p-cyclin B and that phospho-Ser-10 should be dephosphorylated for proper PAP function.

  7. Thermodynamics of ion binding to phosphatidic acid bilayers. Titration calorimetry of the heat of dissociation of DMPA.

    PubMed

    Blume, A; Tuchtenhagen, J

    1992-05-19

    The heat of dissociation of the second proton of 1,2-dimyristoylphosphatidic acid (DMPA) was studied as a function of temperature using titration calorimetry. The dissociation of the second proton of DMPA was induced by addition of NaOH. From the calorimetric titration experiment, the intrinsic pK0 for the dissociation reaction could be determined by applying the Gouy-Chapman theory. pK0 decreases with temperature from ca. 6.2 at 11 degrees C to 5.4 at 54 degrees C. From the total heat of reaction, the dissociation enthalpy, delta Hdiss, was determined by subtracting the heat of neutralization of water and the heat of dilution of NaOH. In the temperature range between 2 and 23 degrees C, delta Hdiss is endothermic with an average value of ca. 2.5 kcal.mol-1 and shows no clear-cut temperature dependence. In the temperature range between 23 and 52 degrees C, delta Hdiss calculated after subtraction of the heat of neutralization and dilution is not the true dissociation enthalpy but includes contributions from the phase transition enthalpy, delta Htrans, as the pH jump induces a transition from the gel to the liquid-crystalline phase. The delta Cp for the reaction enthalpy observed in this temperature range is positive. Above 53 degrees C, the pH jump induces again only the dissociation of the second proton, and the bilayers stay in the liquid-crystalline phase. In this temperature range, delta Hdiss seems to decrease with temperature. The thermodynamic data from titration calorimetry and differential scanning calorimetry as a function of pH can be combined to construct a complete enthalpy-temperature diagram of DMPA in its two ionization states.

  8. Eight Weeks of Phosphatidic Acid Supplementation in Conjunction with Resistance Training Does Not Differentially Affect Body Composition and Muscle Strength in Resistance-Trained Men

    PubMed Central

    Andre, Thomas L.; Gann, Joshua J.; McKinley-Barnard, Sarah K.; Song, Joon J.; Willoughby, Darryn S.

    2016-01-01

    This study attempted to determine the effects of eight weeks of resistance training (RT) combined with phosphatidic acid (PA) supplementation at a dose of either 250 mg or 375 mg on body composition and muscle size and strength. Twenty-eight resistance-trained men were randomly assigned to ingest 375 mg [PA375 (n = 9)] or 250 mg [PA250 (n = 9)] of PA or 375 mg of placebo [PLC (n = 10)] daily for eight weeks with RT. Supplements were ingested 60 minutes prior to RT and in the morning on non-RT days. Participants’ body composition, muscle size, and lower-body muscle strength were determined before and after training/supplementation. Separate group x time ANOVAs for each criterion variable were used employing an alpha level of ≤ 0.05. Magnitude- based inferences were utilized to determine the likely or unlikely impact of PA on each criterion variable. A significant main effect for time was observed for improvements in total body mass (p = 0.003), lean mass (p = 0.008), rectus femoris cross-sectional area [RF CSA (p = 0.011)], and lower-body strength (p < 0.001), but no significant interactions were present (p > 0.05). Collectively, magnitude-based inferences determined both doses of PA to have a likely impact of increasing body mass (74.2%), lean mass (71.3%), RF CSA (92.2%), and very likely impact on increasing lower-body strength (98.1% beneficial). When combined with RT, it appears that PA has a more than likely impact on improving lower-body strength, whereas a likely impact exists for increasing muscle size and lean mass. Key points In response to eight weeks resistance training and PLC and PA (375 mg and 250 mg) supplementation, similar increases in lower-body muscle strength occurred in all three groups; however, the increases were not different between supplement groups. In response to eight weeks resistance training and PLC and PA (375 mg and 250 mg) supplementation, similar increases in lean mass occurred in all three groups; however, the increases were

  9. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  10. Cloning and characterization of a novel human phosphatidic acid phosphatase type 2, PAP2d, with two different transcripts PAP2d_v1 and PAP2d_v2.

    PubMed

    Sun, Liyun; Gu, Shaohua; Sun, Yaqiong; Zheng, Dan; Wu, Qihan; Li, Xin; Dai, Jianfeng; Dai, Jianliang; Ji, Chaoneng; Xie, Yi; Mao, Yumin

    2005-04-01

    This study reports the cloning and characterization of a novel human phosphatidic acid phosphatase type 2 isoform cDNAs (PAP2d) from the foetal brain cDNA library. The PAP2d gene is localized on chromosome 1p21.3. It contains six exons and spans 112 kb of the genomic DNA. By large-scale cDNA sequencing we found two splice variants of PAP2d, PAP2d_v1 and PAP2d_v2. The PAP2d_v1 cDNA is 1722 bp in length and spans an open reading frame from nucleotide 56 to 1021, encoding a 321aa protein. The PAP2d_v2 cDNA is 1707 bp in length encoding a 316aa protein from nucleotide 56-1006. The PAP2d_v1 cDNA is 15 bp longer than the PAP2d_v2 cDNA in the terminal of the fifth exon and it creates different ORF. Both of the proteins contain a well-conserved PAP2 motif. The PAP2d_v1 is mainly expressed in human brain, lung, kidney, testis and colon, while PAP2d_v2 is restricted to human placenta, skeletal muscle, and kidney. The two splice variants are co-expressed only in kidney. PMID:16010976

  11. Phospholipase D and its product, phosphatidic acid, mediate agonist-dependent raf-1 translocation to the plasma membrane and the activation of the mitogen-activated protein kinase pathway.

    PubMed

    Rizzo, M A; Shome, K; Vasudevan, C; Stolz, D B; Sung, T C; Frohman, M A; Watkins, S C; Romero, G

    1999-01-01

    The primary known function of phospholipase D (PLD) is to generate phosphatidic acid (PA) via the hydrolysis of phosphatidylcholine. However, the functional role of PA is not well understood. We report here evidence that links the activation of PLD by insulin and the subsequent generation of PA to the activation of the Raf-1-mitogen-activated protein kinase (MAPK) cascade. Brefeldin A (BFA), an inhibitor of the activation of ADP-ribosylation factor proteins, inhibited insulin-dependent production of PA and MAPK phosphorylation. The addition of PA reversed the inhibition of MAPK activation by BFA. Overexpression of a catalytically inactive variant of PLD2, but not PLD1, blocked insulin-dependent activation of PLD and phosphorylation of MAPK. Real time imaging analysis showed that insulin induced Raf-1 translocation to cell membranes by a process that was inhibited by BFA. PA addition reversed the effects of BFA on Raf-1 translocation. However, PA did not activate Raf-1 in vitro or in vivo, suggesting that the primary function of PA is to enhance the recruitment of Raf-1 to the plasma membrane where other factors may activate it. Finally, we found that the recruitment of Raf-1 to the plasma membrane was transient, but Raf-1 remained bound to endocytic vesicles.

  12. Cloning and characterization of a novel human phosphatidic acid phosphatase type 2, PAP2d, with two different transcripts PAP2d_v1 and PAP2d_v2.

    PubMed

    Sun, Liyun; Gu, Shaohua; Sun, Yaqiong; Zheng, Dan; Wu, Qihan; Li, Xin; Dai, Jianfeng; Dai, Jianliang; Ji, Chaoneng; Xie, Yi; Mao, Yumin

    2005-04-01

    This study reports the cloning and characterization of a novel human phosphatidic acid phosphatase type 2 isoform cDNAs (PAP2d) from the foetal brain cDNA library. The PAP2d gene is localized on chromosome 1p21.3. It contains six exons and spans 112 kb of the genomic DNA. By large-scale cDNA sequencing we found two splice variants of PAP2d, PAP2d_v1 and PAP2d_v2. The PAP2d_v1 cDNA is 1722 bp in length and spans an open reading frame from nucleotide 56 to 1021, encoding a 321aa protein. The PAP2d_v2 cDNA is 1707 bp in length encoding a 316aa protein from nucleotide 56-1006. The PAP2d_v1 cDNA is 15 bp longer than the PAP2d_v2 cDNA in the terminal of the fifth exon and it creates different ORF. Both of the proteins contain a well-conserved PAP2 motif. The PAP2d_v1 is mainly expressed in human brain, lung, kidney, testis and colon, while PAP2d_v2 is restricted to human placenta, skeletal muscle, and kidney. The two splice variants are co-expressed only in kidney.

  13. Effect of BN 52021, a specific antagonist of platelet activating factor (PAF-acether), on calcium movements and phosphatidic acid production induced by PAF-acether in human platelets

    SciTech Connect

    Simon, M.F.; Chap, H.; Braquet, P.; Douste-Blazy, L.

    1987-02-15

    /sup 32/P-labelled human platelets loaded with quin 2 and pretreated with aspirin were stimulated with 1-100 nM platelet activating factor (PAF-acether or 1-0-alkyl-2-acetyl-sn-glycero-3-phosphocholine) in a medium containing the ADP-scavenging system creatine phosphate/creatine phosphokinase. Under these conditions, PAF-acether evoked a characteristic fluorescence change allowing to quantify elevations in cytoplasmic free Ca/sup 2 +/ from internal stores (Ca/sup 2 +/ mobilization) or from external medium (Ca/sup 2 +/ influx), as well as an increased production of phosphatidic acid, reflecting phospholipase C activation. These effects, which can be attributed to PAF-acether only and not to released products such as ADP or thromboxane A2, were strongly inhibited in a dose-dependent manner by BN 52021, a specific antagonist of PAF-acether isolated from Ginkgo biloba. As the drug remained inactive against the same effects elicited by thrombin, it is concluded that BN 52021 does not interfere directly with the mechanism of transmembrane signalling involving inositol-phospholipids or (and) some putative receptor-operated channels, but rather acts on the binding of PAF-acether to its presumed membrane receptor.

  14. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  15. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  16. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  17. Synthesis and cytotoxic activity of two novel 1-dodecylthio-2-decyloxypropyl-3-phosphatidic acid conjugates with gemcitabine and cytosine arabinoside.

    PubMed

    Alexander, Richard L; Morris-Natschke, Susan L; Ishaq, Khalid S; Fleming, Ronald A; Kucera, Gregory L

    2003-09-11

    Cytosine arabinoside (ara-C) and gemcitabine (dFdC) are two standard chemotherapy drugs used in the treatment of patients with various cancers. To alter the pharmacokinetic and pharmacodynamic properties of these molecules, we conjugated a synthetic phospholipid to both ara-C and dFdC and investigated their chemotherapeutic potential. The dFdC conjugate had greater cytotoxic activity compared with the ara-C conjugate and demonstrated notable cytotoxicity against all human cell lines tested.

  18. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  19. Species differences in the effects of prostaglandins on inositol trisphosphate accumulation, phosphatidic acid formation, myosin light chain phosphorylation and contraction in iris sphincter of the mammalian eye: interaction with the cyclic AMP system.

    PubMed

    Yousufzai, S Y; Chen, A L; Abdel-Latif, A A

    1988-12-01

    Comparative studies on the effects of prostaglandins (PGs) on 1,2-diacylglycerol, measured as phosphatidic acid (PA), and inositol trisphosphate (IP3) production, cyclic AMP (cAMP) formation, myosin light chain (MLC) phosphorylation and contraction in the iris sphincter smooth muscle of rabbit, bovine and other mammalian species were undertaken and functional and biochemical relationships between the IP3-Ca++ and cAMP second messenger systems were demonstrated. The findings obtained from these studies can be summarized as follows: 1) all PGs investigated, including PGE2, PGF2 alpha, PGF2 alpha-ester, PGE1 and PGA2 increased IP3 accumulation and PA formation, and the extent of stimulation was dependent on the animal species. Thus, PGF2 alpha-ester (1 microM), the most potent of the PGs, increased IP3 accumulation in rabbit and bovine sphincters by 33 and 58%, respectively, and increased PA formation by 67 and 56%, respectively. The PG increased IP3 accumulation in both rabbit and bovine sphincters very rapidly (T1/2 values about 26 sec) and in a dose-dependent manner. 2) The PG had no effect on MLC phosphorylation in the rabbit sphincter, but it increased that of the bovine by 36%. 3) The PG increased cAMP formation by 75% in the rabbit sphincter but it had no effect on that of the bovine. 4) The PG induced a maximal contractile response in the bovine sphincter but it had no effect on that of the rabbit. 5) In the bovine, PGA2 induced IP3 accumulation and contraction, without an effect on cAMP formation; however, in the rabbit, cat and dog it increased cAMP formation and had no effect on IP3 accumulation and contraction.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  1. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  2. Coupled changes between lipid order and polypeptide conformation at the membrane surface. A sup 2 H NMR and Raman study of polylysine-phosphatidic acid systems

    SciTech Connect

    Laroche, G.; Pezolet, M. ); Dufourc, E.J.; Dufourcq, J. )

    1990-07-10

    Thermotropism and segmental chain order parameters of sn-2-perdeuteriated dimyristoylphosphatidic acid (DMPA)-water dispersions, with and without poly(L-lysine) (PLL) of different molecular weights, have been investigated by solid-state deuterium NMR spectroscopy. The segmental chain order parameter profile of this negatively charged lipid is similar to that already found for other lipids. Addition of long PLL increases the temperature, {Tc}, of the lipid gel-to-fluid phase transition, whereas short PLL has practically no effect on {Tc}. In the fluid phase both varieties of PLL increase the plateau character of segmental order parameters up to carbon position 10. At the same reduced temperature, long PLL more significantly increases the segmental ordering, especially at the methyl terminal position. This leads to the conclusion that polar head-group capping and charge neutralization by PLL induce severe changes in lipid chain ordering, even down to the bilayer core. The structure of PLL bound to the lipid bilayer surface was monitored by Raman spectroscopy, following the amide I bands. Results show that the lipid gel-to-fluid phase transition triggers a conformational transition from ordered {beta}-sheet to random structure of short PLL, while it does not affect the strongly stabilized {beta}-sheet structure of long PLL. It is concluded that both short and long PLL can efficiently cap and neutralize lipid head groups, whatever their structure, and that peptide length is a key parameter in whether lipids or peptides are the driving force in conformationally coupled changes of both partners in the membrane.

  3. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  4. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  5. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  6. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  7. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  8. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  9. Effects of acetylcholine and other agents on /sup 32/P-prelabeled phosphoinositides and phosphatidate in crude synaptosomal preparations

    SciTech Connect

    White, H.L.

    1988-05-01

    Experimental conditions are described which permit effects of various agents on polyphosphoinositides and phosphatidic acid (PA) to be evaluated simultaneously in crude nerve-ending preparations from rat brain. Acetylcholine (3-100 microM) or carbachol (30-1,000 microM) induced the hydrolysis of prelabeled polyphosphoinositides and, at the same time, stimulated the net label incorporated in phosphatidic acid. All muscarinic effects were blocked by atropine or pirenzepine. Non-muscarinic agonists (glutamate, adenosine, norepinephrine) stimulated polyphosphoinositide hydrolysis in this preparation, but of these only norepinephrine affected phosphatidic acid turnover. A potentiation of acetylcholine-induced phosphoinositide turnover by KCl was observed, as well as an apparent selective inhibition of PIP2 hydrolysis by LiCl. Acetylcholine-stimulated turnover of PA was not necessarily coupled to phosphoinositide hydrolysis.

  10. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  11. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  12. Phosphorylation of Yeast Pah1 Phosphatidate Phosphatase by Casein Kinase II Regulates Its Function in Lipid Metabolism.

    PubMed

    Hsieh, Lu-Sheng; Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2016-05-01

    Pah1 phosphatidate phosphatase in Saccharomyces cerevisiae catalyzes the penultimate step in the synthesis of triacylglycerol (i.e. the production of diacylglycerol by dephosphorylation of phosphatidate). The enzyme playing a major role in lipid metabolism is subject to phosphorylation (e.g. by Pho85-Pho80, Cdc28-cyclin B, and protein kinases A and C) and dephosphorylation (e.g. by Nem1-Spo7) that regulate its cellular location, catalytic activity, and stability/degradation. In this work, we show that Pah1 is a substrate for casein kinase II (CKII); its phosphorylation was time- and dose-dependent and was dependent on the concentrations of Pah1 (Km = 0.23 μm) and ATP (Km = 5.5 μm). By mass spectrometry, truncation analysis, site-directed mutagenesis, phosphopeptide mapping, and phosphoamino acid analysis, we identified that >90% of its phosphorylation occurs on Thr-170, Ser-250, Ser-313, Ser-705, Ser-814, and Ser-818. The CKII-phosphorylated Pah1 was a substrate for the Nem1-Spo7 protein phosphatase and was degraded by the 20S proteasome. The prephosphorylation of Pah1 by protein kinase A or protein kinase C reduced its subsequent phosphorylation by CKII. The prephosphorylation of Pah1 by CKII reduced its subsequent phosphorylation by protein kinase A but not by protein kinase C. The expression of Pah1 with combined mutations of S705D and 7A, which mimic its phosphorylation by CKII and lack of phosphorylation by Pho85-Pho80, caused an increase in triacylglycerol content and lipid droplet number in cells expressing the Nem1-Spo7 phosphatase complex. PMID:27044741

  13. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  14. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  15. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  16. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  17. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  18. Chromatographic analysis of the neutral and phosphatide glyceryl ethers from various biological sources.

    PubMed

    Hack, M H; Helmy, F M

    1975-04-01

    A method of analysis is described which permits the facile evaluation of the neutral glyceryl ether lipids (mild alkaline hydrolysis) and total glyceryl ether lipid (Vitride reduction) thereby allowing an assessment of the phosphatide contribution. The alkyl and alk-enyl glyceryl ethers are chromatographically resolvable on Gelman glass-fiber type SG and Whatman SG-81 and detected by the periodic acid-Schiff and plasmal reaction, respectively. The attending problems and interpretation are discussed with examples from a number of unicellular organisms and animal tissues.

  19. Yeast Pah1p phosphatidate phosphatase is regulated by proteasome-mediated degradation.

    PubMed

    Pascual, Florencia; Hsieh, Lu-Sheng; Soto-Cardalda, Aníbal; Carman, George M

    2014-04-01

    Yeast PAH1-encoded phosphatidate phosphatase is the enzyme responsible for the production of the diacylglycerol used for the synthesis of triacylglycerol that accumulates in the stationary phase of growth. Paradoxically, the growth phase-mediated inductions of PAH1 and phosphatidate phosphatase activity do not correlate with the amount of Pah1p; enzyme abundance declined in a growth phase-dependent manner. Pah1p from exponential phase cells was a relatively stable protein, and its abundance was not affected by incubation with an extract from stationary phase cells. Recombinant Pah1p was degraded upon incubation with the 100,000 × g pellet fraction of stationary phase cells, although the enzyme was stable when incubated with the same fraction of exponential phase cells. MG132, an inhibitor of proteasome function, prevented degradation of the recombinant enzyme. Endogenously expressed and plasmid-mediated overexpressed levels of Pah1p were more abundant in the stationary phase of cells treated with MG132. Pah1p was stabilized in mutants with impaired proteasome (rpn4Δ, blm10Δ, ump1Δ, and pre1 pre2) and ubiquitination (hrd1Δ, ubc4Δ, ubc7Δ, ubc8Δ, and doa4Δ) functions. The pre1 pre2 mutations that eliminate nearly all chymotrypsin-like activity of the 20 S proteasome had the greatest stabilizing effect on enzyme levels. Taken together, these results supported the conclusion that Pah1p is subject to proteasome-mediated degradation in the stationary phase. That Pah1p abundance was stabilized in pah1Δ mutant cells expressing catalytically inactive forms of Pah1p and dgk1Δ mutant cells with induced expression of DGK1-encoded diacylglycerol kinase indicated that alteration in phosphatidate and/or diacylglycerol levels might be the signal that triggers Pah1p degradation.

  20. Apicoplast-Localized Lysophosphatidic Acid Precursor Assembly Is Required for Bulk Phospholipid Synthesis in Toxoplasma gondii and Relies on an Algal/Plant-Like Glycerol 3-Phosphate Acyltransferase.

    PubMed

    Amiar, Souad; MacRae, James I; Callahan, Damien L; Dubois, David; van Dooren, Giel G; Shears, Melanie J; Cesbron-Delauw, Marie-France; Maréchal, Eric; McConville, Malcolm J; McFadden, Geoffrey I; Yamaryo-Botté, Yoshiki; Botté, Cyrille Y

    2016-08-01

    Most apicomplexan parasites possess a non-photosynthetic plastid (the apicoplast), which harbors enzymes for a number of metabolic pathways, including a prokaryotic type II fatty acid synthesis (FASII) pathway. In Toxoplasma gondii, the causative agent of toxoplasmosis, the FASII pathway is essential for parasite growth and infectivity. However, little is known about the fate of fatty acids synthesized by FASII. In this study, we have investigated the function of a plant-like glycerol 3-phosphate acyltransferase (TgATS1) that localizes to the T. gondii apicoplast. Knock-down of TgATS1 resulted in significantly reduced incorporation of FASII-synthesized fatty acids into phosphatidic acid and downstream phospholipids and a severe defect in intracellular parasite replication and survival. Lipidomic analysis demonstrated that lipid precursors are made in, and exported from, the apicoplast for de novo biosynthesis of bulk phospholipids. This study reveals that the apicoplast-located FASII and ATS1, which are primarily used to generate plastid galactolipids in plants and algae, instead generate bulk phospholipids for membrane biogenesis in T. gondii. PMID:27490259

  1. Apicoplast-Localized Lysophosphatidic Acid Precursor Assembly Is Required for Bulk Phospholipid Synthesis in Toxoplasma gondii and Relies on an Algal/Plant-Like Glycerol 3-Phosphate Acyltransferase

    PubMed Central

    Callahan, Damien L.; Dubois, David; van Dooren, Giel G.; Shears, Melanie J.; Cesbron-Delauw, Marie-France; Maréchal, Eric; McConville, Malcolm J.; McFadden, Geoffrey I.; Yamaryo-Botté, Yoshiki; Botté, Cyrille Y.

    2016-01-01

    Most apicomplexan parasites possess a non-photosynthetic plastid (the apicoplast), which harbors enzymes for a number of metabolic pathways, including a prokaryotic type II fatty acid synthesis (FASII) pathway. In Toxoplasma gondii, the causative agent of toxoplasmosis, the FASII pathway is essential for parasite growth and infectivity. However, little is known about the fate of fatty acids synthesized by FASII. In this study, we have investigated the function of a plant-like glycerol 3-phosphate acyltransferase (TgATS1) that localizes to the T. gondii apicoplast. Knock-down of TgATS1 resulted in significantly reduced incorporation of FASII-synthesized fatty acids into phosphatidic acid and downstream phospholipids and a severe defect in intracellular parasite replication and survival. Lipidomic analysis demonstrated that lipid precursors are made in, and exported from, the apicoplast for de novo biosynthesis of bulk phospholipids. This study reveals that the apicoplast-located FASII and ATS1, which are primarily used to generate plastid galactolipids in plants and algae, instead generate bulk phospholipids for membrane biogenesis in T. gondii. PMID:27490259

  2. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  3. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  4. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  5. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  6. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  7. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  8. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  9. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  10. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  11. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  12. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  13. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  14. Differential changes in phospholipase D and phosphatidate phosphohydrolase activities in ischemia-reperfusion of rat heart.

    PubMed

    Asemu, Girma; Dent, Melissa R; Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2005-04-01

    Phospholipase D (PLD2) produces phosphatidic acid (PA), which is converted to 1,2 diacylglycerol (DAG) by phosphatidate phosphohydrolase (PAP2). Since PA and DAG regulate Ca(2+) movements, we examined PLD2 and PAP2 in the sarcolemma (SL) and sarcoplasmic reticular (SR) membranes from hearts subjected to ischemia and reperfusion (I-R). Although SL and SR PLD2 activities were unaltered after 30 min ischemia, 5 min reperfusion resulted in a 36% increase in SL PLD2 activity, whereas 30 min reperfusion resulted in a 30% decrease in SL PLD2 activity, as compared to the control value. SR PLD2 activity was decreased (39%) after 5 min reperfusion, but returned to control levels after 30 min reperfusion. Ischemia for 60 min resulted in depressed SL and SR PLD2 activities, characterized with reduced V(max) and increased K(m) values, which were not reversed during reperfusion. Although the SL PAP2 activity was decreased (31%) during ischemia and at 30 min reperfusion (28%), the SR PAP2 activity was unchanged after 30 min ischemia, but was decreased after 5 min reperfusion (25%) and almost completely recovered after 30 min reperfusion. A 60 min period of ischemia followed by reperfusion caused an irreversible depression of SL and SR PAP2 activities. Our results indicate that I-R induced cardiac dysfunction is associated with subcellular changes in PLD2 and PAP2 activities. PMID:15752718

  15. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  16. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  17. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  18. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  19. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  20. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  1. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  2. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  3. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  4. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  5. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  6. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  7. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  8. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  9. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  10. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  11. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  12. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  13. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  14. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  15. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  16. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  17. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  18. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  19. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  20. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  1. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  2. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  3. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  4. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  5. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  6. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  7. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  8. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  9. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  10. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  11. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  12. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  13. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  14. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  15. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  16. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  17. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  18. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  19. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  20. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  1. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  2. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  3. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  4. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  5. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  6. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  7. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  8. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  9. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  10. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  11. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures.

    PubMed

    Rodas-Junco, Beatriz A; Cab-Guillén, Yahaira; Muñoz-Sánchez, J Armando; Vázquez-Flota, Felipe; Monforte-González, Miriam; Hernández-Sotomayor, S M Teresa

    2013-10-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  12. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  13. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  14. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  15. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  16. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  17. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  18. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  19. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  20. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  1. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  2. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  3. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  4. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  5. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  6. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  7. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  8. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  9. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  10. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  11. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  12. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  13. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  14. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  15. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  16. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  17. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  18. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  19. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  20. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  1. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  2. Versatile Multicomponent Reaction Macrocycle Synthesis Using α-Isocyano-ω-carboxylic Acids.

    PubMed

    Liao, George P; Abdelraheem, Eman M M; Neochoritis, Constantinos G; Kurpiewska, Katarzyna; Kalinowska-Tłuścik, Justyna; McGowan, David C; Dömling, Alexander

    2015-10-16

    The direct macrocycle synthesis of α-isocyano-ω-carboxylic acids via an Ugi multicomponent reaction is introduced. This multicomponent reaction (MCR) protocol differs by being especially short, convergent, and versatile, giving access to 12-22 membered rings.

  3. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  4. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  5. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  6. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  7. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  8. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement. PMID:21157681

  9. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  10. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  11. Fluorine containing amino acids: synthesis and peptide coupling of amino acids containing the all-cis tetrafluorocyclohexyl motif.

    PubMed

    Ayoup, Mohammed Salah; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David

    2015-05-28

    A synthesis of two (S)-phenylalanine derivatives is described which have the all-cis, 2,3,5,6-tetrafluorocyclohexyl motif attached to the aromatic ring at the meta and para positions; the para substituted isomer is elaborated into illustrative dipeptides via the free amine and carboxylate respectively demonstrating its utility as a novel amino acid for peptide synthesis and offering a vehicle for incorporation of this unique and facially polarized ring system into bioactive compounds.

  12. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  13. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  14. Highly efficient procedure for the synthesis of fructone fragrance using a novel carbon based acid.

    PubMed

    Hu, Baowei; Li, Chunqing; Zhao, Sheng-Xian; Rong, Lin-Mei; Lv, Shao-Qin; Liang, Xuezheng; Qi, Chenze

    2010-08-01

    The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and beta-keto esters make this novel carbon based acid one of the best choices for the reaction.

  15. The role of submarine hydrothermal systems in the synthesis of amino acids.

    PubMed

    Aubrey, A D; Cleaves, H J; Bada, Jeffrey L

    2009-04-01

    There is little consensus regarding the plausibility of organic synthesis in submarine hydrothermal systems (SHSs) and its possible relevance to the origin of life. The primary reason for the persistence of this debate is that most experimental high temperature and high-pressure organic synthesis studies have neglected important geochemical constraints with respect to source material composition. We report here the results of experiments exploring the potential for amino acid synthesis at high temperature from synthetic seawater solutions of varying composition. The synthesis of amino acids was examined as a function of temperature, heating time, starting material composition and concentration. Using very favorable reactant conditions (high concentrations of reactive, reduced species), small amounts of a limited set of amino acids are generated at moderate temperature conditions ( approximately 125-175 degrees C) over short heating times of a few days, but even these products are significantly decomposed after exposure times of approximately 1 week. The high concentration dependence observed for these synthetic reactions are demonstrated by the fact that a 10-fold drop in concentration results in orders of magnitude lower yields of amino acids. There may be other synthetic mechanisms not studied herein that merit investigation, but the results are likely to be similar. We conclude that although amino acids can be generated from simple likely environmentally available precursors under SHS conditions, the equilibrium at high temperatures characteristic of SHSs favors net amino acid degradation rather than synthesis, and that synthesis at lower temperatures may be more favorable. PMID:19034685

  16. Synthesis and characterization of Fatty acid/amino Acid self-assemblies.

    PubMed

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; Fray, Miroslawa El

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as "R" (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196-239 nm and critical micelle concentration (CMC) of 0.125-0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  17. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  18. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  19. Synthesis of amino-acid derivatives and dipeptides with an original peptidase enzyme.

    PubMed

    Auriol, D; Paul, F; Yoshpe, I; Gripon, J C; Monsan, P

    1991-01-01

    A peptidase from the non pathogenic Staphylococcus sp. strain BEC 299 was purified to a final specific activity of 84,400 U/mg protein. Its molecular weight is 450 kDa and optimum pH 10.0. This enzyme catalyzes the synthesis of dipeptides (aspartame) and alpha-amino acid derivatives (N-L-malyl-L-tyrosine ethyl ester). The influence of cosolvents and pH on dipeptides and alpha-amino acid derivative synthesis is described. Finally, we detail the use of the peptidase as a reagent in protease-catalyzed peptide synthesis.

  20. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    NASA Astrophysics Data System (ADS)

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-01

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

  1. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  2. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  3. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  4. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  5. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition.

  6. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  7. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  8. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  9. Synthesis of Long Chain Unsaturated-alpha,omega-Dicarboxylic Acids from Renewable Materials via Olefin Metathesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The self-metathesis reaction of soy, rapeseed, tall, and linseed oil fatty acids was investigated for the synthesis of symmetrical long-chain unsaturated-alpha,omega-dicarboxylic acids. The metathesis reactions were carried out in the presence of a Grubbs catalyst under solvent-free conditions at a...

  10. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  11. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    PubMed Central

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity. PMID:24363888

  12. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  13. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective.

  14. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  15. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  16. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  17. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  18. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity. PMID:23230650

  19. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  20. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  1. De novo synthesis of amino acids by the ruminal anaerobic fungi, Piromyces communis and Neocallimastix frontalis.

    PubMed

    Atasoglu, Cengiz; Wallace, R John

    2002-07-01

    Anaerobic fungi are an important component of the cellulolytic ruminal microflora. Ammonia alone as N source supports growth, but amino acid mixtures are stimulatory. In order to evaluate the extent of de novo synthesis of individual amino acids in Piromyces communis and Neocallimastix frontalis, isotope enrichment in amino acids was determined during growth on (15)NH(4)Cl in different media. Most cell N (0.78 and 0.63 for P. communis and N. frontalis, respectively) and amino acid N (0.73 and 0.59) continued to be formed de novo from ammonia when 1 g l(-1) trypticase was added to the medium; this concentration approximates the peak concentration of peptides in the rumen after feeding. Higher peptide/amino acid concentrations decreased de novo synthesis. Lysine was exceptional, in that its synthesis decreased much more than other amino acids when Trypticase or amino acids were added to the medium, suggesting that lysine synthesis might limit fungal growth in the rumen.

  2. Synthesis and optical resolution of an allenoic acid by diastereomeric salt formation induced by chiral alkaloids.

    PubMed

    Nyhlén, Jonas; Eriksson, Lars; Bäckvall, Jan-E

    2008-01-01

    A synthetic procedure for the preparation of 4-cyclohexyl-2-methyl-buta-2,3-dienoic acid in the two optically active forms has been developed. Synthesis of the racemic allenoic acid was made by an efficient route with good overall yield. Resolution of the enantiomers was achieved by forming the cinchonidine and cinchonine diastereomeric salt, respectively, and the enantiomers were isolated in up to 95% enantiomeric excess. The absolute configuration of the allenoic acid was determined by X-ray crystallography.

  3. Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

    PubMed

    Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

    2016-09-01

    α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

  4. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  5. Direct microwave-assisted amino acid synthesis by reaction of succinic acid and ammonia in the presence of magnetite

    NASA Astrophysics Data System (ADS)

    Jiang, Nan; Liu, Dandan; Shi, Weiguang; Hua, Yingjie; Wang, Chongtai; Liu, Xiaoyang

    2013-10-01

    Since the discovery of submarine hot vents in the late 1970s, it has been postulated that submarine hydrothermal environments would be suitable for emergence of life on Earth. To simulate warm spring conditions, we designed a series of microwave-assisted amino acid synthesis involving direct reactions between succinic acid and ammonia in the presence of the magnetite catalyst. These reactions which generated aspartic acid and glycine were carried out under mild temperatures and pressures (90-180 °C, 4-19 bar). We studied this specific reaction inasmuch as succinic acid and ammonia were traditionally identified as prebiotic compounds in primitive deep-sea hydrothermal systems on Earth. The experimental results were discussed in both biochemical and geochemical context to offer a possible route for abiotic amino acid synthesis. With extremely diluted starting materials (0.002 M carboxylic acid and 0.002 M ammonia) and catalyst loading, an obvious temperature dependency was observed in both cases [neither product was detected at 90 °C in comparison with 21.08 μmol L-1 (aspartic acid) and 70.25 umol L-1 (glycine) in 180 °C]. However, an opposite trend presented for reaction time factor, namely a positive correlation for glycine, but a negative one for aspartic acid.

  6. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  7. Thematic Review Series: Glycerolipids. Acyltransferases in bacterial glycerophospholipid synthesis*

    PubMed Central

    Zhang, Yong-Mei; Rock, Charles O.

    2008-01-01

    Phospholipid biosynthesis is a vital facet of bacterial physiology that begins with the synthesis of the fatty acids by a soluble type II fatty acid synthase. The bacterial glycerol-phosphate acyltransferases utilize the completed fatty acid chains to form the first membrane phospholipid and thus play a critical role in the regulation of membrane biogenesis. The first bacterial acyltransferase described was PlsB, a glycerol-phosphate acyltransferase. PlsB is a key regulatory point that coordinates membrane phospholipid formation with cell growth and macromolecular synthesis. Phosphatidic acid is then produced by PlsC, a 1-acylglycerol-phosphate acyltransferase. These two acyltransferases use thioesters of either CoA or acyl carrier protein (ACP) as the acyl donors and have homologs that perform the same reactions in higher organisms. However, the most prevalent glycerol-phosphate acyltransferase in the bacterial world is PlsY, which uses a recently discovered acyl-phosphate fatty acid intermediate as an acyl donor. This unique activated fatty acid is formed from the acyl-ACP end products of the fatty acid biosynthetic pathway by PlsX, an acyl-ACP:phosphate transacylase. PMID:18369234

  8. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-05-17

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids.

  9. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  10. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  11. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  12. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.

    PubMed

    Klisch, M; Häder, D-P

    2002-02-01

    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption.

  13. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  14. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )

    1989-12-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  15. Approach to Merosesquiterpenes via Lewis Acid Catalyzed Nazarov-Type Cyclization: Total Synthesis of Akaol A.

    PubMed

    Kakde, Badrinath N; Kumar, Nivesh; Mondal, Pradip Kumar; Bisai, Alakesh

    2016-04-15

    A Lewis acid catalyzed Nazarov-type cyclization of arylvinylcarbinol has been developed for the asymmetric synthesis of carbotetracyclic core of merosesquiterpenes. The reaction works only in the presence of 2 mol % of Sn(OTf)2 and Bi(OTf)3 in dichloroethane under elevated temperature. The methodology offers the synthesis of a variety of enantioenriched arylvinylcarbinols from commercially available (3aR)-sclareolide 9 in six steps with an eventual concise total synthesis of marine sesquiterpene quinol, akaol A (1a). PMID:27028314

  16. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis.

    PubMed Central

    Duester, G; Shean, M L; McBride, M S; Stewart, M J

    1991-01-01

    Retinoic acid regulation of one member of the human class I alcohol dehydrogenase (ADH) gene family was demonstrated, suggesting that the retinol dehydrogenase function of ADH may play a regulatory role in the biosynthetic pathway for retinoic acid. Promoter activity of human ADH3, but not ADH1 or ADH2, was shown to be activated by retinoic acid in transient transfection assays of Hep3B human hepatoma cells. Deletion mapping experiments identified a region in the ADH3 promoter located between -328 and -272 bp which confers retinoic acid activation. This region was also demonstrated to confer retinoic acid responsiveness on the ADH1 and ADH2 genes in heterologous promoter fusions. Within a 34-bp stretch, the ADH3 retinoic acid response element (RARE) contains two TGACC motifs and one TGAAC motif, both of which exist in RAREs controlling other genes. A block mutation of the TGACC sequence located at -289 to -285 bp eliminated the retinoic acid response. As assayed by gel shift DNA binding studies, the RARE region (-328 to -272 bp) of ADH3 bound the human retinoic acid receptor beta (RAR beta) and was competed for by DNA containing a RARE present in the gene encoding RAR beta. Since ADH catalyzes the conversion of retinol to retinal, which can be further converted to retinoic acid by aldehyde dehydrogenase, these results suggest that retinoic acid activation of ADH3 constitutes a positive feedback loop regulating retinoic acid synthesis. Images PMID:1996113

  17. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures

    PubMed Central

    Rodas-Junco, Beatriz A; Cab-Guillen, Yahaira; Muñoz-Sanchez, J Armando; Vázquez-Flota, Felipe; Monforte-Gonzalez, Miriam; Hérnandez-Sotomayor, S M Teresa

    2013-01-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  18. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  19. Solvent-free lipase-catalyzed synthesis of a novel hydroxyl-fatty acid derivative of kojic acid.

    PubMed

    El-Boulifi, Noureddin; Ashari, Siti Efliza; Serrano, Marta; Aracil, Jose; Martínez, Mercedes

    2014-02-01

    The aim of this work was the synthesis of a novel hydroxyl-fatty acid derivative of kojic acid rich in kojic acid monoricinoleate (KMR) which can be widely used in the cosmetic and food industry. The synthesis of KMR was carried out by lipase-catalysed esterification of ricinoleic and kojic acids in solvent-free system. Three immobilized lipases were tested and the best KMR yields were attained with Lipozyme TL IM and Novozym 435. Since Lipozyme TL IM is the cheapest, it was selected to optimize the reaction conditions. The optimal reaction conditions were 80 °C for the temperature, 1:1 for the alcohol/acid molar ratio, 600 rpm for stirring speed and 7.8% for the catalyst concentration. Under these conditions, the reaction was scaled up in a 5×10⁻³ m³ stirred tank reactor. ¹H-¹³C HMBC-NMR showed that the primary hydroxyl group of kojic acid was regioselectively esterified. The KMR has more lipophilicity than kojic acid and showed antioxidant activity that improves the oxidation stability of biodiesel.

  20. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-01

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  1. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.

    PubMed

    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György

    2016-01-01

    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  2. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  3. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  4. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  5. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  6. Selenium Catalyzed Oxidation of Aldehydes: Green Synthesis of Carboxylic Acids and Esters.

    PubMed

    Sancineto, Luca; Tidei, Caterina; Bagnoli, Luana; Marini, Francesca; Lenardão, Eder J; Santi, Claudio

    2015-01-01

    The stoichiometric use of hydrogen peroxide in the presence of a selenium-containing catalyst in water is here reported as a new ecofriendly protocol for the synthesis of variously functionalized carboxylic acids and esters. The method affords the desired products in good to excellent yields under very mild conditions starting directly from commercially available aldehydes. Using benzaldehyde as a prototype the gram scale synthesis of benzoic acid is described, in which the aqueous medium and the catalyst could be recycled at last five times while achieving an 87% overall yield.

  7. Communic acids: occurrence, properties and use as chirons for the synthesis of bioactive compounds.

    PubMed

    Barrero, Alejandro F; Herrador, M Mar; Arteaga, Pilar; Arteaga, Jesús F; Arteaga, Alejandro F

    2012-01-01

    Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae). In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.). This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal), abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  8. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  9. Effects of omega-3 fatty acids on vascular smooth muscle cells: reduction in arachidonic acid incorporation into inositol phospholipids.

    PubMed

    Yerram, N R; Spector, A A

    1989-07-01

    A rapid increase in arachidonic acid incorporation into phosphatidylinositol (PI) occurred following exposure of cultured porcine pulmonary artery smooth muscle cells to calcium ionophore A23187. This response was specific for PI and phosphatidic acid; none of the other phosphoglycerides showed any increase in arachidonic acid incorporation. The incorporation of [3H]inositol also was increased, indicating that complete synthesis of PI rather than only fatty acylation occurred in response to the ionophore. The presence of omega-3 fatty acids, especially eicosapentaenoic acid (EPA), reduced arachidonic acid but not inositol incorporation into PI. Stimulated incorporation of EPA also occurred under these conditions, suggesting that EPA replaces arachidonic acid in the newly synthesized pool of PI. Although much less arachidonic acid was incorporated into the polyphosphoinositides following exposure to the ionophore, arachidonic acid incorporation into these phosphorylated derivatives also decreased when EPA was present. These findings suggest that when omega-3 fatty acids are available, less arachidonic acid is channeled into the inositol phospholipids of activated smooth muscle cells because of replacement by EPA. This may represent a mechanism whereby omega-3 fatty acids, especially EPA, can accumulate in the metabolically active pools of inositol phospholipids and thereby possibly influence the properties or responsiveness of vascular smooth muscle.

  10. Squaric acid ester-based total synthesis of echinochrome A.

    PubMed

    Peña-Cabrera, Eduardo; Liebeskind, Lanny S

    2002-03-01

    The total synthesis of echinochrome A is described. Both key intermediates 5 and 8 were efficiently prepared from diisopropyl squarate 7. Nucleophilic addition of aryllithium 8 to 5, followed by thermal ring-expansion/cyclization of the 1,2-adduct 4, furnished hydroquinone 3. Oxidation and full deprotection of 3 gave the title compound.

  11. MAFG is a transcriptional repressor of bile acid synthesis and metabolism.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Ahn, Hannah; Hagey, Lee R; Romanoski, Casey E; Lee, Richard G; Graham, Mark J; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A

    2015-02-01

    Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis, and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG(+/-) mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR.

  12. MAFG Is a Transcriptional Repressor of Bile Acid Synthesis and Metabolism

    PubMed Central

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Ahn, Hannah; Hagey, Lee R.; Romanoski, Casey E.; Lee, Richard G.; Graham, Mark J.; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A.

    2015-01-01

    Summary Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway, and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG+/− mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-Seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR. PMID:25651182

  13. Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

    PubMed

    Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

    2014-07-01

    The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

  14. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  15. A Nitrogen-Assisted One-Pot Heteroaryl Ketone Synthesis from Carboxylic Acids and Heteroaryl Halides.

    PubMed

    Demkiw, Krystyna; Araki, Hirofumi; Elliott, Eric L; Franklin, Christopher L; Fukuzumi, Yoonjoo; Hicks, Frederick; Hosoi, Kazushi; Hukui, Tadashi; Ishimaru, Yoichiro; O'Brien, Erin; Omori, Yoshimasa; Mineno, Masahiro; Mizufune, Hideya; Sawada, Naotaka; Sawai, Yasuhiro; Zhu, Lei

    2016-04-15

    A practical and highly effective one-pot synthesis of versatile heteroaryl ketones directly from carboxylic acids and heteroaryl halides under mild conditions is reported. This method does not require derivatization of carboxylic acids (preparation of acid chlorides, Weinreb amides, etc.) or the use of any additives/catalysts. A wide substrate scope of carboxylic acids with high functional group tolerance has also been demonstrated. The results reveal that the presence of an α-nitrogen on the halide substrate greatly improves the desired ketone formation.

  16. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  17. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849

  18. Bacterial synthesis of polysialic acid lactosides in recombinant Escherichia coli K-12.

    PubMed

    Richard, Emeline; Buon, Laurine; Drouillard, Sophie; Fort, Sébastien; Priem, Bernard

    2016-07-01

    Bacterial polysialyltransferases (PSTs) are processive enzymes involved in the synthesis of polysialic capsular polysaccharides. They can also synthesize polysialic acid in vitro from disialylated and trisialylated lactoside acceptors, which are the carbohydrate moieties of GD3 and GT3 gangliosides, respectively. Here, we engineered a non-pathogenic Escherichia coli strain that overexpresses recombinant sialyltransferases and sialic acid synthesis genes and can convert an exogenous lactoside into polysialyl lactosides. Several PSTs were assayed for their ability to synthesize polysialyl lactosides in the recombinant strains. Fed-batch cultures produced α-2,8 polysialic acid or alternate α-2,8-2,9 polysialic acid in quantities reaching several grams per liter. Bacterial culture in the presence of propargyl-β-lactoside as the exogenous acceptor led to the production of conjugatable polysaccharides by means of copper-assisted click chemistry. PMID:26927318

  19. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  20. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  1. Polymers from fatty acids: poly(ω-hydroxyl tetradecanoic acid) synthesis and physico-mechanical studies.

    PubMed

    Liu, Chen; Liu, Fei; Cai, Jiali; Xie, Wenchun; Long, Timothy E; Turner, S Richard; Lyons, Alan; Gross, Richard A

    2011-09-12

    This Article describes the synthesis and physicomechanical properties of bioplastics prepared from methyl ω-hydroxytetradecanoic acid (Me-ω-OHC14), a new monomer available by a fermentation process using an engineered Candida tropicalis strain. Melt-condensation experiments were conducted using titanium tetraisopropoxide (Ti[OiPr](4)) as a catalyst in a two-stage polymerization (2 h at 200 °C under N(2), 4 h at 220 °C under 0.1 mmHg). Poly(ω-hydroxytetradecanoate), P(ω-OHC14), M(w), determined by SEC-MALLS, increased from 53K to 110K as the Ti(OiPr)(4) concentration increased from 50 to 300 ppm. By varying the polymerization conditions (catalyst concentration, reaction time, second-stage reaction temperature) a series of P(ω-OHC14) samples were prepared with M(w) values from 53K to 140K. The synthesized polyesters with M(w) ranging from 53K to 140K were subjected to characterization by DSC, TGA, DMTA, and tensile testing. Influences of P(ω-OHC14) molecular weight, melting point, and enthalpies of melting/crystallization on material tensile properties were explored. Cold-drawing tensile tests at room temperature for P(ω-OHC14) with M(w) 53K-78K showed a brittle-to-ductile transition. In contrast, P(ω-OHC14) with M(w) 53K undergoes brittle fracture. Increasing P(ω-OHC14) M(w) above 78K resulted in a strain-hardening phenomena and tough properties with elongation at break ~700% and true tensile strength of ~50 MPa. Comparisons between high density polyethylene and P(ω-OHC14) mechanical and thermal properties as a function of their respective molecular weights are discussed. PMID:21793591

  2. [Synthesis, characterization and application of polyglycerols and polyglycerol fatty acid esters].

    PubMed

    Behrens, H; Mieth, G

    1984-01-01

    The current state of knowledge in the field of synthesis and properties of polyglycerols and polyglycerol fatty acid esters is presented. Alternatives for the analytical characterization of these families by means of physico-chemical methods, with special reference to chromatography and spectroscopy, are described. Furthermore, the use of polyglycerol fatty acid esters as food additives is considered from the view-points of the physiology of nutrition and of processing technology.

  3. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  4. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  5. Novel enzymatic synthesis of 4-O-cinnamoyl quinic and shikimic acid derivatives.

    PubMed

    Armesto, Nuria; Ferrero, Miguel; Fernández, Susana; Gotor, Vicente

    2003-07-11

    The first direct synthesis of 4-O-cinnamoyl derivatives of quinic and shikimic acids were accomplished by regioselective esterification with Candida antarctica lipase A. For hydrocinnamic esters, enzymatic transesterification with vinyl esters gave excellent yields. However, more reactive acylating agents such as anhydrides were used to synthesize cinnamic derivatives of both acids. An inhibitory effect was observed with this lipase for p-methoxy, p-hydroxy, and p-acetoxy vinyl ester and anhydride derivatives (coumarate and ferulate derivatives).

  6. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  7. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs.

    PubMed

    Suryawan, Agus; O'Connor, Pamela M J; Bush, Jill A; Nguyen, Hanh V; Davis, Teresa A

    2009-05-01

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose-amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8-12/group) with insulin at 0, 10, 22, and 110 ng kg(-0.66) min(-1) to achieve approximately 0, 2, 6 and 30 muU ml(-1) insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L: -[4-(3)H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids.

  8. Mutation affecting regulation of synthesis of acetohydroxy acid synthetase in Escherichia coli K-12.

    PubMed Central

    Jackson, J H; Henderson, E K

    1975-01-01

    Altered regulation of synthesis of acetohydroxy acid synthetase (AHAS) was previously reported in a mutant of Escherichia coli strain K-12. The mutant strain, growing in minimal medium, exhibits a partial growth limiatation and derepression of AHAS, owing to deficient synthesis of isoleucine. The genetic lesion (ilvE503) causing the isoleucine limitation was shown to cause derepression of a valine-sensitive AHAS activity. The derepression effect of the ilvE503 mutation upon synthesis of AHAS was conclusively demonstrated by introducing both the ilvE503 allele and an altered AHAS (ilv-521) into the same cell. Evidence is presented that suggests the presence of multiple genetic regions for synthesis and control of the valine-sensitive AHAS activity. PMID:1089632

  9. Glycerophospholipid synthesis: improved general method and new analogs containing photoactivable groups.

    PubMed Central

    Gupta, C M; Radhakrishnan, R; Khorana, H G

    1977-01-01

    Current methods for phospholipid synthesis involving acylation of sn-glycero-3-phosphorylcholine, lysolecithins, and related glycerophosphate esters are not satisfactory. With N,N-dimethyl-4-aminopyridine as a catalyst and moderate amounts of fatty acid anhydrides (1.2-1.5 mol equiv per OH group), diacyl or 1,2-mixed diacylphosphatidylcholines, N-protected phosphatidylethanolamines, and phosphatide acids now can be conveniently prepared in high yields (75-90%). New phospholipids containing photoactivable groups, such as trifluorodiazopropionyl, diazirinophenoxy, 2-nitro-4-azidophenoxy, m-azidophenoxy, and alpha, beta-unsaturated keto groups, in the fatty acyl chains have been prepared. These phospholipids are of interest in studies of lipid-lipid and lipid-protein interactions in biological membranes. PMID:270675

  10. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  11. Oxidative allylic rearrangement of cycloalkenols: Formal total synthesis of enantiomerically pure trisporic acid B

    PubMed Central

    Dubberke, Silke; Abbas, Muhammad

    2011-01-01

    Summary Enantiomerically highly enriched unsaturated β-ketoesters bearing a quaternary stereocenter can be utilized as building blocks for the synthesis of natural occurring terpenes, i. a., trisporic acid and its derivatives. An advanced building block has been synthesized in a short reaction sequence, which involves an oxidative allylic rearrangement initiated by pyridinium dichromate (PDC) as the key step. PMID:21512603

  12. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  13. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  14. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides.

  15. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  16. Efficient Enantioselective Synthesis of Oxahelicenes Using Redox/Acid Cooperative Catalysts.

    PubMed

    Sako, Makoto; Takeuchi, Yoshiki; Tsujihara, Tetsuya; Kodera, Junpei; Kawano, Tomikazu; Takizawa, Shinobu; Sasai, Hiroaki

    2016-09-14

    An efficient and enantioselective synthesis of oxa[9]helicenes has been established via vanadium(V)-catalyzed oxidative coupling/intramolecular cyclization of polycyclic phenols. A newly developed vanadium complex cooperatively functions as both a redox and Lewis acid catalyst to promote the present sequential reaction and afford oxa[9]helicenes in good yields with up to 94% ee. PMID:27574874

  17. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  18. Synthesis and transdermal properties of acetylsalicylic acid and selected esters.

    PubMed

    Gerber, Minja; Breytenbach, Jaco C; Hadgraft, Jonathan; du Plessis, Jeanetta

    2006-03-01

    The primary aim of this study was to determine the transdermal penetration of acetylsalicylic acid and some of its derivatives, to establish a correlation, if any, with selected physicochemical properties and to determine if transdermal application of acetylsalicylic acid and its derivatives will give therapeutic drug concentrations with respect to transdermal flux. Ten derivatives of acetylsalicylic acid were prepared by esterification of acetylsalicyloyl chloride with ten different alcohols. The experimental aqueous solubility, logD and transdermal flux values were determined for acetylsalicylic acid and its derivatives at pH 4.5. In vitro penetration was measured through excised female human abdominal skin in diffusion cells. The experimental aqueous solubility of acetylsalicylic acid (6.56 mg/ml) was higher than that of the synthesised acetylsalicylate derivatives (ranging from 1.76 x 10(-3) to 3.32 mg/ml), and the logD of acetylsalicylic acid (-0.85) was lower than that of its derivatives (ranging from -0.25 to 1.95). There was thus an inverse correlation between the aqueous solubility data and the logD values. The experimental transdermal flux of acetylsalicylic acid (263.83 nmol/cm(2)h) was much higher than that of its derivatives (ranging from 0.12 to 136.02 nmol/cm(2)h).

  19. [Asymmetric synthesis of aromatic L-amino acids catalyzed by transaminase].

    PubMed

    Xia, Wenna; Sun, Yu; Min, Cong; Han, Wei; Wu, Sheng

    2012-11-01

    Aromatic L-Amino acids are important chiral building blocks for the synthesis of many drugs, pesticides, fine chemicals and food additives. Due to the high activity and steroselectivity, enzymatic synthesis of chiral building blocks has become the main research direction in asymmetric synthesis field. Guided by the phylogenetic analysis of transaminases from different sources, two representative aromatic transaminases TyrB and Aro8 in type I subfamily, from the prokaryote Escherichia coli and eukaryote Saccharomyces cerevisia, respectively, were applied for the comparative study of asymmetric transamination reaction process and catalytic efficiency of reversely converting keto acids to the corresponding aromatic L-amino acid. Both TyrB and Aro8 could efficiently synthesize the natural aromatic amino acids phenylalanine and tyrosine as well as non-natural amino acid phenylglycine. The chiral HPLC analysis showed the produced amino acids were L-configuration and the e.e value was 100%. L-alanine was the optimal amino donor, and the transaminase TyrB and Aro8 could not use D-amino acids as amino donor. The optimal molar ratio of amino donor (L-alanine) and amino acceptor (aromatic alpha-keto acids) was 4:1. Both of the substituted group on the aromatic ring and the length of fatty acid carbon chain part in the molecular structure of aromatic substrate alpha-keto acid have the significant impact on the enzyme-catalyzed transamination efficiency. In the experiments of preparative-scale transamination synthesis of L-phenylglycine, L-phenylalanine and L-tyrosine, the specific production rate catalyzed by TryB were 0.28 g/(g x h), 0.31 g/(g x h) and 0.60 g/(g x h) and the specific production rate catalyzed by Aro8 were 0.61 g/(g x h), 0.48 g/(g x h) and 0.59 g/(g x h). The results obtained here were useful for applying the transaminases to asymmetric synthesis of L-amino acids by reversing the reaction balance in industry.

  20. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA. PMID:17263304

  1. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA.

  2. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  3. Synthesis and biological evaluation of novel lipoamino acid derivatives.

    PubMed

    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C

    2016-01-01

    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  4. New multifunctional phosphonic acid for metal phosphonate synthesis

    NASA Astrophysics Data System (ADS)

    Garczarek, Piotr; Janczak, Jan; Zoń, Jerzy

    2013-03-01

    A new heterotopic phosphonic acid, 3-amino-5-(dihydroxyphosphoryl)benzoic acid (1) has been synthesized and obtained in the crystalline form. Second multifunctional phosphonic acid - namely 3-(dihydroxyphosphoryl)-5-nitrobenzoic acid (2) has also been obtained, following a different synthetic route than previously reported. Compound 1 crystallizes in a centrosymmetric space group of the triclinic system as monohydrate, sbnd C6H3(NH2)(COOH)PO3H2·H2O -1a. The molecule in the crystal exists in a zwitterionic form, in which one of the proton of the phosphonic group is transferred to the amine group. The zwitterionic molecules interact to each other and with water molecules via Nsbnd H…O and Osbnd H…O hydrogen bonds forming a three-dimensional network.

  5. Synthesis and evaluation of dioleoyl glyceric acids showing antitrypsin activity.

    PubMed

    Habe, Hiroshi; Fukuoka, Tokuma; Sato, Shun; Kitamoto, Dai; Sakaki, Keiji

    2011-01-01

    Previously, Lešová et al. reported the isolation and identification of metabolite OR-1, showing antitrypsin activity, produced during fermentation by Penicillium funiculosum. The structure of OR-1 was a mixture of glyceric acid (GA), esterified with C(14)-C(18) fatty acids, and oleic acid (C18:1) as the most predominant fatty acid (Folia Microbiol. 46, 21-23, 2001). In this study, dioleoyl D-GA and dioleoyl L-GA were synthesized via diesterification with oleoyl chloride, and their antitrypsin activities were evaluated using both a disk diffusion method and spectral absorption measurements. The results show that both compounds and their equivalent mixtures possess antitrypsin activities; however, their IC(50) values (approximately 2 mM) are much higher than that of OR-1 (4.25 µM), suggesting that dioleoyl GA does not play a major role in the OR-1 antitrypsin activity. PMID:21606621

  6. Selection on synthesis cost affects interprotein amino acid usage in all three domains of life.

    PubMed

    Swire, Jonathan

    2007-05-01

    Most investigations of the forces shaping protein evolution have focused on protein function. However, cells are typically 50%-75% protein by dry weight, with protein expression levels distributed over five orders of magnitude. Cells may, therefore, be under considerable selection pressure to incorporate amino acids that are cheap to synthesize into proteins that are highly expressed. Such selection pressure has been demonstrated to alter amino acid usage in a few organisms, but whether "cost selection" is a general phenomenon remains unknown. One reason for this is that reliable protein expression level data is not available for most organisms. Accordingly, I have developed a new method for detecting cost selection. This method depends solely on interprotein gradients in amino acid usage. Applying it to an analysis of 43 whole genomes from all three domains of life, I show that selection on the synthesis cost of amino acids is a pervasive force in shaping the composition of proteins. Moreover, some amino acids have different price tags for different organisms--the cost of amino acids is changed for organisms living in hydrothermal vents compared with those living at the sea surface or for organisms that have difficulty acquiring elements such as nitrogen compared with those that do not--so I also investigated whether differences between organisms in amino acid usage might reflect differences in synthesis or acquisition costs. The results suggest that organisms evolve to alter amino acid usage in response to environmental conditions.

  7. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  8. Synthesis and antifungal activity of cinnamic acid esters.

    PubMed

    Tawata, S; Taira, S; Kobamoto, N; Zhu, J; Ishihara, M; Toyama, S

    1996-05-01

    Cinnamic, p-coumaric and ferulic acids were isolated from pineapple stems (Ananas comosus var. Cayenne). Twenty-four kinds of esters were prepared from these acids, alcohols and the components of Alpinia. Isopropyl 4-hydroxycinnamate (11) and butyl 4-hydroxycinnamate (12) were found to have almost the same effectiveness in antifungal activity against Pythium sp. at 10 ppm as that of the commercial fungicide iprobenfos (kitazin P).

  9. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.

    1981-11-01

    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  10. Mitochondrial acyl carrier protein is involved in lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Brody, S; Oh, C; Hoja, U; Schweizer, E

    1997-05-19

    The yeast gene, ACP1, encoding the mitochondrial acyl carrier protein, was deleted by gene replacement. The resulting acp1-deficient mutants had only 5-10% of the wild-type lipoic acid content remaining, and exhibited a respiratory-deficient phenotype. Upon meiosis, the lipoate deficiency co-segregated with the acp1 deletion. The role of ACP1 in long-chain fatty acid synthesis was studied in fast and fas2 null mutants completely lacking cytoplasmic fatty acid synthase. When grown on odd-chain (13:0 and 15:0) fatty acids, these cells showed less than 1% of C-16 and C-18 acids in their total lipids. Mitochondrial ACP is therefore suggested to be involved with the biosynthesis of octanoate, a precursor to lipoic acid. PMID:9187370

  11. Synthesis of locked cyclohexene and cyclohexane nucleic acids (LCeNA and LCNA) with modified adenosine units.

    PubMed

    Šála, Michal; Dejmek, Milan; Procházková, Eliška; Hřebabecký, Hubert; Rybáček, Jiří; Dračínský, Martin; Novák, Pavel; Rosenbergová, Šárka; Fukal, Jiří; Sychrovský, Vladimír; Rosenberg, Ivan; Nencka, Radim

    2015-03-01

    We describe here the preparation of conformationally locked cyclohexane nucleic acids designed as hybrids between locked nucleic acids (LNAs) and cyclohexene nucleic acids (CeNAs), both of which excel in hybridization with complementary RNAs. We have accomplished the synthesis of these adenine derivatives starting from a simple ketoester and installed all four chiral centres by means of total synthesis. The acquired monomers were incorporated into nonamer oligonucleotides.

  12. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  13. In vitro synthesis of arachidonoyl amino acids by cytochrome c.

    PubMed

    McCue, Jeffrey M; Driscoll, William J; Mueller, Gregory P

    2009-11-01

    Arachidonoyl amino acids are a class of endogenous lipid messengers that are expressed in the mammalian central nervous system and peripherally. While several of their prominent pharmacologic effects have been documented, the mechanism by which arachidonoyl amino acids are biosynthesized has not been defined. We have previously observed that the mitochondrial protein, cytochrome c, is capable of catalyzing the formation of the prototypic arachidonoyl amino acid, arachidonoyl glycine, utilizing arachidonoyl CoA and glycine as substrates, in the presence of hydrogen peroxide. Here we report that cytochrome c is similarly able to catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid from arachidonoyl CoA and the respective amino acids. The identities of the arachidonoyl amino acid products were verified by mass spectral fragmentation pattern analysis. The synthetic reactions exhibited Michaelis-Menten kinetics and continued favorably at physiologic temperature and pH. Spectral data indicate that both cytochrome c protein structure and a +3 heme iron oxidation state are required for the reaction mechanism to proceed optimally. Reactions designed to catalyze the formation of N-arachidonoyl dopamine were not efficient due to the rapid oxidation of dopamine substrate by hydrogen peroxide, consuming both reactants. Finally, under standard assay conditions, arachidonoyl CoA and ethanolamine were found to react spontaneously to form anandamide, independent of cytochrome c and hydrogen peroxide. Accordingly, it was not possible to demonstrate a potential role for cytochrome c in the biosynthetic mechanism for either arachidonoyl dopamine or anandamide. However, the ability of cytochrome c to effectively catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid in vitro highlights its potential role for the generation of these lipid messengers in vivo.

  14. Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

    PubMed

    Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

    2016-09-01

    Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. PMID:27630308

  15. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph

    2013-07-01

    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  16. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids.

    PubMed

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D V S; Sharma, Rohit K

    2014-10-31

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  17. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  18. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  19. QUANTITATIVE CONTRIBUTIONS OF DIET AND LIVER SYNTHESIS TO DOCOSAHEXAENOIC ACID HOMEOSTASIS

    PubMed Central

    Rapoport, Stanley I.; Igarashi, Miki; Gao, Fei

    2010-01-01

    Dietary requirements for maintaining brain and heart docosahexaenoic acid (DHA, 22:6n-3) homeostasis are not agreed on, in part because rates of liver DHA synthesis from circulating α-linolenic acid (α-LNA, 18:2n-3) have not been quantified. These rates can be estimated in vivo using intravenous radiotracer- or heavy isotope-labeled α-LNA infusion. In adult unanesthetized male rats, such infusion shows that liver synthesis-secretion rates of DHA from α-LNA markedly exceed brain and heart DHA synthesis rates and brain DHA consumption rate, and that liver but not heart or brain synthesis is upregulated as dietary n-3 PUFA content is reduced. These differences in rate reflect much higher expression of DHA-synthesizing enzymes in liver, and upregulation of liver but not heart or brain enzyme expression by reduced dietary n-3 PUFA content. A noninvasive intravenous [U-13C]α-LNA infusion method that produces steady-state liver tracer metabolism gives exact liver DHA synthesis-secretion rates and could be extended for human studies. PMID:20226642

  20. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  1. Phosphatidate Kinase, a Novel Enzyme in Phospholipid Metabolism (Purification, Subcellular Localization, and Occurrence in the Plant Kingdom).

    PubMed Central

    Wissing, J. B.; Behrbohm, H.

    1993-01-01

    Microsomal membranes from suspension-cultured Catharanthus roseus cells possess an enzymic activity that catalyzes the ATP-dependent phosphorylation of phosphatidic acid (PA) to form diacylglycerol pyrophosphate (H. Behrbohm, J.B. Wissing [1993] FEBS Lett 315: 95-99). This enzyme activity, PA kinase, was purified and characterized. Plasma membranes, obtained from C. roseus microsomes by aqueous two-phase partitioning, were extracted, and PA kinase was purified 3200-fold by applying different chromatographic steps that resulted in a specific activity of about 10 [mu]mol min-1 mg-1. Sodium dodecyl sulfate-gel electrophoresis of the fractions obtained from the final chromatographic step revealed a 39-kD protein that correlated with the enzyme activity; PA kinase activity could be eluted from this protein band. Subcellular localization, investigated with C. roseus cells, showed that the activity was confined to membrane fractions, and at least 80% was associated with plasma membranes. The data revealed the same distribution within the cellular membranes of PA kinase as reported for diacylglycerol kinase, which is a typical plasma membrane-located enzyme. Furthermore, PA kinase activity was detected in the calli of 16 different plant species and in the different organs of C. roseus plants and obviously occurs ubiquitously in the plant kingdom. PMID:12231900

  2. Studies on chemical modification and biology of a natural product, gambogic acid (II): Synthesis and bioevaluation of gambogellic acid and its derivatives from gambogic acid as antitumor agents.

    PubMed

    Wang, Jinxin; Ma, Junhai; You, Qidong; Zhao, Li; Wang, Fan; Li, Chong; Guo, Qinglong

    2010-09-01

    Gambogic acid (GA) has been reported to be a potent apoptosis inducer. The fact that it is amenable to chemical modification makes GA an attractive molecule for the development of anticancer agents. We firstly reported the synthesis of gambogellic acid, which was generated under acid catalysis from readily available GA by a base-catalyzed diene intramolecular annelation. Sequentially, thirteen new compounds were synthesized and their inhibitory activity on HT-29, Bel-7402, BGC-823, and A549 cell lines were evaluated in vitro by MTT assay, and (38, 40)-epoxy-33-chlorogambogellic acid (4) was identified as a BGC-823 cell apoptosis inducer through MTT cell assay, observations of morphological changes, and Annexin-V/PI double-staining assay. Compound 4 showed significant effects in inducing apoptosis and might serve as a potential lead compound for discovery of new anticancer drugs. Further structure-activity relationships (SARs) of gambogic acid derivatives were discussed.

  3. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  4. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.

    2015-04-01

    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  5. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.

    1974-01-01

    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  6. [Effect of citric acid on synthesis of surfactants in Rhodococcus erythropolis IMV Ac-5017].

    PubMed

    Pyroh, T P; Shevchuk, T A; Shuliakova, M O; Tarasenko, D O

    2011-01-01

    Expediency of sodium citrate (regulator of lipids synthesis) substitution is shown in the medium of cultivation of Rhodococcus erythropolis IMV Ac-5017 with ethanol (or hexadecane) and fumarate (gluconeogenesis precursor) by citric acid for pH maintenance at the level optimal for synthesis of surfactants. It has been established the maximum synthesis of surfactants of R. erythropolis IMV Ac-5017 was observed at pH 8.0. Introduction of 0.2% sodium fumarate at the end of experimental growth phase of the strain IMV Ac-5017 in the medium with 2% of ethanol with further periodic acidification of culture liquid by citric acid up to pH 8.0 was accompanied by the increase of conditional concentration of surfactants by 30, 40 and 95% as compared with an analogous process without pH regulation, by the use of sodium citrate as the regulator of lipids synthesis on the medium with ethanol as well as without organic acids, respectively.

  7. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  8. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  9. Synthesis, structure, and biological applications of α-fluorinated β-amino acids and derivatives.

    PubMed

    March, Taryn L; Johnston, Martin R; Duggan, Peter J; Gardiner, James

    2012-11-01

    This review gives a broad overview of the state of play with respect to the synthesis, conformational properties, and biological activity of α-fluorinated β-amino acids and derivatives. General methods are described for the preparation of monosubstituted α-fluoro-β-amino acids (Scheme 1). Nucleophilic methods for the introduction of fluorine predominantly involve the reaction of DAST with alcohols derived from α-amino acids, whereas electrophilic sources of fluorine such as NFSI have been used in conjunction with Arndt-Eistert homologation, conjugate addition or organocatalyzed Mannich reactions. α,α-Difluoro-β-amino acids have also been prepared using DAST; however, this area of synthesis is largely dominated by the use of difluorinated Reformatsky reagents to introduce the difluoro ester functionality (Scheme 9). α-Fluoro-β-amino acids and derivatives analyzed by X-ray crystal and NMR solution techniques are found to adopt preferred conformations which are thought to result from stereoelectronic effects associated with F located close to amines, amides, and esters (Figs. 2-6). α-Fluoro amide and β-fluoro ethylamide/amine effects can influence the secondary structure of α-fluoro-β-amino acid-containing derivatives including peptides and peptidomimetics (Figs. 7-9). α-Fluoro-β-amino acids are also components of a diverse range of bioactive anticancer (e.g., 5-fluorouracil), antifungal, and antiinsomnia agents as well as protease inhibitors where such fluorinated analogs have shown increased potency and spectrum of activity.

  10. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  11. Enhanced synthesis of alkyl amino acids in Miller's 1958 H2S experiment.

    PubMed

    Parker, Eric T; Cleaves, H James; Callahan, Michael P; Dworkin, Jason P; Glavin, Daniel P; Lazcano, Antonio; Bada, Jeffrey L

    2011-12-01

    Stanley Miller's 1958 H(2)S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH(4)), ammonia (NH(3)), carbon dioxide (CO(2)), and hydrogen sulfide (H(2)S) produced several alkyl amino acids, including the α-, β-, and γ-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H(2)S, aspartic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H(2)S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H(2)S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth. PMID:22139514

  12. Synthesis, antimicrobial evaluation and QSAR studies of stearic acid derivatives.

    PubMed

    Tahlan, S; Kumar, P; Narasimhan, B

    2014-02-01

    A series of Schiff bases (1-17) and esters (18-28) of stearic acid was synthesized and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity by tube dilution method. The antimicrobial screening results indicated that the compounds having electron releasing groups on benzylidene nucleus were found to be more active against bacterial strains and compounds having electron withdrawing groups on benzylidene nucleus were found to be more active against fungal strains. QSAR studies demonstrated that electronic parameters dipole moment (µ) and total energy (Te) were the most important descriptors in describing the antimicrobial activity of synthesized stearic acid derivatives.

  13. Okadaic acid disrupts Golgi structure and impairs enzyme synthesis and secretion in the rat pancreas.

    PubMed

    Waschulewski, I H; Kruse, M L; Agricola, B; Kern, H F; Schmidt, W E

    1996-06-01

    Okadaic acid, a serine/threonine phosphatase inhibitor, has been shown to inhibit rat pancreatic enzyme secretion by interference with late processes in stimulus-secretion coupling. To further characterize its action, we studied the effect of okadaic acid on secretion of newly synthesized proteins, protein synthesis, and cellular ultrastructure in pancreatic lobules derived from rats stimulated in vivo by feeding the synthetic proteinase inhibitor FOY-305. Okadaic acid completely blocked protein secretion at concentrations that inhibit the Ca2+/calmodulin-dependent protein phosphatase 2b, calcineurin. Protein synthesis was abolished at 10(-6) mol/l and reduced by 60% at 5 x 10(-7) mol/l okadaic acid. Pancreatic lobules exposed to 5 x 10(-7) mol/l okadaic acid for 20 min fully restored their secretory capacity on removal of the drug; whereas, after a preincubation with okadaic acid for > 40 min, protein secretion remained impaired during the recovery period. Electron microscopic examination of pancreatic acinar cells treated with 5 x 10(-7) mol/l okadaic acid revealed a dilated Golgi complex after 15 and 30 min and a subsequent fragmentation of Golgi cisternae into clouds of small uniform vesicles after 60 min. Reassembly of Golgi stacks occurred after a 60-min recovery without okadaic acid. These data indicate that serine/threonine phosphatases play an important role not only in the regulation of pancreatic enzyme synthesis and exocytosis but also are crucial for the maintenance of normal Golgi architecture and function in the exocrine rat pancreas. These effects are probably not exclusively mediated via type 2b calcineurin-like protein phosphatases.

  14. Effect of nerve growth factor on the synthesis of amino acids in PC12 cells

    SciTech Connect

    Zielke, H.R.; Tildon, J.T.; Kauffman, F.C.; Baab, P.J. )

    1989-04-01

    Radioactive short-chain fatty acids preferentially label glutamine relative to glutamate in brain due to compartmentation of glutamine and glutamate. To determine whether this phenomenon occurs in a single cell culture model, we examined the effect of fatty acid chain length on the synthesis as well as pool size of selected amino acids in rat pheochromocytoma PC12 cells, a cell culture model of the large glutamate compartment in neurons. Intracellular 14C-amino acids were quantitated by HPLC, and the incorporation of (U-14C)-glucose, (1-14C)-butyrate, (1-14C)-octanoate, and (1-14C)-palmitate into five amino acids was measured in native and NGF-treated PC12 cells. NGF pretreatment decreased the intracellular concentration of amino acids as did addition of fatty acids but these effects were not additive. Specific activities of amino acids in native cells labelled by 14C-octanoate were 1,300 DPM/nmol, 490 DPM/nmol, 200 DPM/nmol, and 110 DPM/nmol for glutamate, aspartate, glutamine, and serine, respectively. No radioactivity was detected in alanine. Similar specific activities were noted when 14C-butyrate was the precursor; however, there was at least 5-fold less if 14C-palmitate was the precursor. Pretreatment of cells with NGF decreased the specific activity of amino acids by 25-65%. Specific activities of amino acids synthesized from 14C-glucose decreased in the following order: glutamate, 1,640 DPM/nmol; aspartate, 1,210 DPM/nmol; alanine, 580 DPM/nmol; glutamine, 275 DPM/nmol; and serine, 80 DPM/nmol for native cells. NGF pretreatment decreased the specific activities of glutamate and glutamine, but not of the other 3 amino acids. The preferred precursor for glutamate synthesis in native PC12 cells was glucose followed by octanoate, butyrate and palmitate (16:6:3:1).

  15. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )

    1990-01-01

    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.

  16. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  17. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  18. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  19. Synthesis and characterization of ultraviolet light-emitting organic acids.

    PubMed

    An, Chun-Ai; Guo, Yanchao; Si, Zhenjun; Duan, Qian

    2014-05-01

    Three ultraviolet light-emitting organic acids of 3,3'-(4-phenyl-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-1), 4,4',4″-(4H-1,2,4-triazole-3,4,5-triyl)tribenzoic acid (Tz-2), and 4,4'-(4-(4'-carboxy-[1,1'-biphenyl]-4-yl)-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-3) were successfully synthesized and fully characterized by the (1)H NMR, the IR absorption spectra, and the X-ray single crystal diffraction. It was found that Tz-1, Tz-2, and Tz-3 could give out the ultraviolet photoluminescent spectra centered at 369 nm, 365 nm and 350 nm, respectively. The luminescence quantum yields of Tz-1 and Tz-2 were measured to be 0.20 and 0.14, respectively. Additionally, the density functional theory (DFT) and the time-dependent DFT calculations were also carried out for Tz-1, Tz-2, and Tz-3.

  20. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  1. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  2. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  3. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  4. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  5. Synthesis and characterization of a pH responsive folic acid functionalized polymeric drug delivery system.

    PubMed

    Li, Xia; McTaggart, Matt; Malardier-Jugroot, Cecile

    2016-01-01

    We report the computational analysis, synthesis and characterization of folate functionalized poly(styrene-alt-maleic anhydride), PSMA for drug delivery purpose. The selection of the proper linker between the polymer and the folic acid group was performed before conducting the synthesis using Density Functional Theory (DFT). The computational results showed the bio-degradable linker 2, 4-diaminobutyric acid, DABA as a good candidate allowing flexibility of the folic acid group while maintaining the pH sensitivity of PSMA, used as a trigger for drug release. The synthesis was subsequently carried out in multi-step experimental procedures. The functionalized polymer was characterized using InfraRed spectroscopy, Nuclear Magnetic Resonance and Dynamic Light Scattering confirming both the chemical structure and the pH responsiveness of PSMA-DABA-Folate polymers. This study provides an excellent example of how computational chemistry can be used in selection process for the functional materials and product characterization. The pH sensitive polymers are expected to be used in delivering anti-cancer drugs to solid tumors with overly expressed folic acid receptors. PMID:27183249

  6. [New biological active derivatives of indomethacin and acetylsalicylic acid. Synthesis, physico-chemical characterisation and structure validation].

    PubMed

    Stan, Catalina; Stefanache, Alina; Dumitrache, M

    2006-01-01

    It is well known that niflumic acid glycinamide has a good antiinflammatory action useful in gum inflammatory diseases. The objective of this study was to obtain new glycinamides of acetylsalicylic acid and indomethacin, which could have a better antiinflammatory action than niflumic acid glycinamide. The study presents the synthesis, physico-chemical characterisation and structure validation of these glycinamides.

  7. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  8. Dihydroasparagusic acid: antioxidant and tyrosinase inhibitory activities and improved synthesis.

    PubMed

    Venditti, Alessandro; Mandrone, Manuela; Serrilli, Anna Maria; Bianco, Armandodoriano; Iannello, Carmelina; Poli, Ferruccio; Antognoni, Fabiana

    2013-07-17

    Dihydroasparagusic acid (DHAA) is the reduced form of asparagusic acid, a sulfur-containing flavor component produced by Asparagus plants. In this work, DHAA was synthetically produced by modifying some published protocols, and the synthesized molecule was tested in several in vitro assays (DPPH, ABTS, FRAP-ferrozine, BCB, deoxyribose assays) to evaluate its radical scavenging activity. Results show that DHAA is endowed with a significant in vitro antioxidant activity, comparable to that of Trolox. DHAA was also evaluated for its inhibitory activity toward tyrosinase, an enzyme involved, among others, in melanogenesis and in browning processes of plant-derived foods. DHAA was shown to exert an inhibitory effect on tyrosinase activity, and the inhibitor kinetics, analyzed by a Lineweaver-Burk plot, exhibited a competitive mechanism. Taken together, these results suggest that DHAA may be considered as a potentially active molecule for use in various fields of application, such as pharmaceutical, cosmetics, agronomic and food. PMID:23790134

  9. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  10. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives. PMID:26827629

  11. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  12. Synthesis and properties of N-hexadecyl ethylenediamine triacetic acid.

    PubMed

    Wang, Xixin; Zhao, Jianling; Yao, Xingzhi; Chen, Wentao

    2004-11-15

    A new kind of surfactant named N-hexadecyl ethylenediamine triacetic acid (HED3A) was synthesized from anhydrous ethylenediamine, 1-bromohexadecane, and chloroacetic acid. Testing showed stability of HED3A in hard water, wetting power, dispersing power, and surface tension increased along with pH value. Stability in hard water of trisodium N-hexadecyl ethylenediamine triacetate (3NaHED3A) was at level 4, which was better than that of sodium dodecylsulfate (SDS) and sodium dodecylbenzene sulfonate (LAS). Other properties of 3NaHED3A including wetting power, dispersing power, emulsifying power, and surface tension had intermediate value between SDS, LAS, AES, peregal-O, and cetyltrimethylammonium chloride (CTAC). The ethylenediamine triacetic acid (ED3A) group in 3NaHED3A can chelate many kinds of metal ions, which indicates a promising application prospect in many fields including metal anticorrosion, corrosion control agent, additives in electroplating solution, and ore selection and solid surface treatment.

  13. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.

    PubMed

    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai

    2015-06-01

    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  14. Fatty Acid Phytyl Ester Synthesis in Chloroplasts of Arabidopsis[W

    PubMed Central

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-01-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. PMID:22623494

  15. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  16. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  17. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  18. Eutectic Phases in Ice Facilitate Nonenzymatic Nucleic Acid Synthesis

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia; Monnard, Pierre-Alain; Deamer, David W.

    2001-09-01

    Polymeric compounds similar to oligonucleotides are relevant to the origin of life and particularly to the concept of an RNA world. Although short oligomers of RNA can be synthesized nonenzymatically under laboratory conditions by second-order reactions in concentrated solutions, there is no consensus on how these polymers could have been synthesized de novo on the early Earth from dilute solutions of monomers. To address this question in the context of an RNA world, we have explored ice eutectic phases as a reaction medium. When an aqueous solution freezes, the solutes become concentrated in the spaces between the ice crystals. The increased concentration offsets the effect of the lower temperature and accelerates the reaction. Here we show that in the presence of metal ions in dilute solutions, frozen samples of phosphoimidazolide-activated uridine react within days at -18°C to form oligouridylates up to 11 bases long. Product yields typically exceed 90%, and ~30% of the oligomers include one or more 3‧-5‧ linkages. These conditions facilitate not only the notoriously difficult oligouridylate synthesis, but also the oligomerization of activated cytidylate, adenylate, and guanylate. To our knowledge, this represents the first report to indicate that ice matrices on the early Earth may have accelerated certain prebiotic polymerization reactions.

  19. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  20. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed. PMID:27677557

  1. Acid gradient across plasma membrane can drive phosphate bond synthesis in cancer cells: acidic tumor milieu as a potential energy source.

    PubMed

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target.

  2. Benign synthesis of 2-ethylhexanoic acid by cytochrome P450cam: enzymatic, crystallographic, and theoretical studies.

    PubMed

    French, K J; Strickler, M D; Rock, D A; Rock, D A; Bennett, G A; Wahlstrom, J L; Goldstein, B M; Jones, J P

    2001-08-14

    This study examines the ability of P450cam to catalyze the formation of 2-ethylhexanoic acid from 2-ethylhexanol relative to its activity on the natural substrate camphor. As is the case for camphor, the P450cam exhibits stereoselectivity for binding (R)- and (S)-2-ethylhexanol. Kinetic studies indicate (R)-2-ethylhexanoic acid is produced 3.5 times as fast as the (S)-enantiomer. In a racemic mixture of 2-ethylhexanol, P450cam produces 50% more (R)-2-ethylhexanoic acid than (S)-2-ethylhexanoic acid. The reason for stereoselective 2-ethylhexanoic acid production is seen in regioselectivity assays, where (R)-2-ethylhexanoic acid comprises 50% of total products while (S)-2-ethylhexanoic acid comprises only 13%. (R)- and (S)-2-ethylhexanol exhibit similar characteristics with respect to the amount of oxygen and reducing equivalents consumed, however, with (S)-2-ethylhexanol turnover producing more water than the (R)-enantiomer. Crystallographic studies of P450cam with (R)- or (S)-2-ethylhexanoic acid suggest that the (R)-enantiomer binds in a more ordered state. These results indicate that wild-type P450cam displays stereoselectivity toward 2-ethylhexanoic acid synthesis, providing a platform for rational active site design. PMID:11583152

  3. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.

    PubMed

    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy

    2016-01-01

    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro.

  4. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  5. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail.

  6. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  7. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  8. Synthesis and Evaluation of Aryl Boronic Acids as Fluorescent Artificial Receptors for Biological Carbohydrates

    PubMed Central

    Craig, Sandra

    2011-01-01

    Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855

  9. Synthesis of Aminoboronic Acid Derivatives from Amines and Amphoteric Boryl Carbonyl Compounds.

    PubMed

    Diaz, Diego B; Scully, Conor C G; Liew, Sean K; Adachi, Shinya; Trinchera, Piera; St Denis, Jeffrey D; Yudin, Andrei K

    2016-10-01

    Herein, we demonstrate the use of α-boryl aldehydes and acyl boronates in the synthesis of aminoboronic acid derivatives. This work highlights the untapped potential of boron-substituted iminium ions and offers insights into the behavior of N-methyliminodiacetyl (MIDA) boronates during condensation and tautomerization processes. The preparative value of this contribution lies in the demonstration that various amines, including linear and cyclic peptides, can be readily conjugated with boron-containing fragments. A mild deprotection of amino MIDA-boronates enables access to α- and β-aminoboronic acids in high chemical yields. This simple process should be applicable to the synthesis of a wide range of bioactive molecules as well as precursors for cross-coupling reactions. PMID:27584917

  10. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  11. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  12. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  13. REGULATION OF CARDIAC AND SKELETAL MUSCLE PROTEIN SYNTHESIS BY INDIVIDUAL BRANCHED-CHAIN AMINO ACIDS IN NEONATAL PIGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle grows at a very rapid rate in the neonatal pig, due in part to an enhanced sensitivity of protein synthesis to the postprandial rise in amino acids. An increase in leucine alone stimulates protein synthesis in skeletal muscle of the neonatal pig; however, the effect of isoleucine and...

  14. Highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids from chiral imines of trifluoropyruvate.

    PubMed

    Min, Qiao-Qiao; He, Chun-Yang; Zhou, Haibing; Zhang, Xingang

    2010-11-14

    An efficient method for highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids was developed via indium mediated allylation of (R)-phenylglycinol methyl ether based imines of trifluoropyruvate in good yields with high diastereoselectivities at room temperature; to illustrate the application of this method in organic synthesis, 2-allyl-2-(trifluoromethyl) aziridine was prepared in an efficient manner.

  15. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  16. A practical synthesis of 3,4-diethoxybenzthioamide based on Friedel-Crafts reaction with potassium thiocyanate in methanesulfonic acid.

    PubMed

    Aki, Shinji; Fujioka, Takafumi; Ishigami, Masashi; Minamikawa, Jun-ichi

    2002-09-01

    The synthesis of 3,4-diethoxybenzthioamide, the key intermediate for OPC-6535, is achieved by employing Friedel-Crafts reaction of 1,2-diethoxybenzene with potassium thiocyanate in methanesulfonic acid at ambient temperature.

  17. Synthesis of Fused Polycyclic Indoles by Brønsted Acid-Catalyzed Intramolecular Alkylation of Indoles with Alcohols.

    PubMed

    Suárez, Anisley; Gohain, Mukut; Fernández-Rodríguez, Manuel A; Sanz, Roberto

    2015-10-16

    An efficient methodology for the synthesis of a series of new fused polyclyclic indoles has been developed by Brønsted acid-catalyzed intramolecular Friedel-Crafts reactions of properly designed indolyl alcohols. PMID:26418556

  18. Green Chemistry in the Organic Teaching Laboratory: An Environmentally Benign Synthesis of Adipic Acid

    NASA Astrophysics Data System (ADS)

    Reed, Scott M.; Hutchison, James E.

    2000-12-01

    Environmentally benign ("green") chemical techniques are growing in importance in academic and industrial research laboratories. Such chemistry has been slow to appear in teaching laboratories, owing in part to a lack of published material on this subject. Recent developments in green synthesis provide opportunities to introduce this material in teaching laboratories. We present a synthesis of adipic acid that utilizes green reagents (hydrogen peroxide as the oxidant), solvents (water), and methods (phase-transfer catalysis, catalyst recycling). The synthesis works well and provides an excellent forum for emphasizing green chemical concepts while teaching laboratory skills. It demonstrates reuse of a product, synthesis using a nonhazardous solvent, elimination of deleterious by-products, and use of a recyclable catalyst. It can be carried out on either the macroscale or microscale and generates little waste if the catalyst solution is recycled. This experiment fits well in a sophomore organic sequence; it covers the topics of oxidation, phase-transfer catalysis, and the technique of recrystallization, reinforces lecture topics such as alkene synthesis and reactivity, and provides an opportunity to introduce polymer chemistry.

  19. Studies on independent synthesis of cytoplasmic ribonucleic acids in Acetabularia mediterranea.

    PubMed

    NAORA, H; BRACHET, J

    1960-07-01

    1. The RNA content of anucleate and nucleate fragments of Acetabularia has been measured. It was found that there is a net synthesis of RNA in nucleate fragments. On the other hand, the RNA content of anucleate fragments did not change significantly after enucleation. 2. Anucleate fragments, however, can readily incorporate (14)C-labeled adenine, orotic acid, and carbon dioxide into their cytoplasmic RNA. 3. The results of experiments on (14)CO(2) incorporation into the RNA of anucleate and nucleate fragments suggest that there is a mechanism for de novo synthesis of RNA in anucleate cytoplasm. 4. In Acetabularia, 81 per cent of the cytoplasmic RNA is bound to a large granule fraction, consisting mainly of chloroplasts. Even after removal of the nucleus, RNA is synthesized in this "chloroplast" fraction. The chloroplasts are thus a major site of RNA synthesis in the cytoplasm of these algae. Synthesis of "chloroplastic" RNA, in anucleate fragments, possibly occurs at the expense of the RNA present in other fractions (microsomes and supernatant). 5. 8-Azaguanine stimulates regeneration and cap formation in anucleate fragments and does not inhibit RNA synthesis in these fragments.

  20. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  1. Enzymatic synthesis of enantiopure alpha- and beta-amino acids by phenylalanine aminomutase-catalysed amination of cinnamic acid derivatives.

    PubMed

    Wu, Bian; Szymanski, Wiktor; Wietzes, Piet; de Wildeman, Stefaan; Poelarends, Gerrit J; Feringa, Ben L; Janssen, Dick B

    2009-01-26

    The phenylalanine aminomutase (PAM) from Taxus chinensis catalyses the conversion of alpha-phenylalanine to beta-phenylalanine, an important step in the biosynthesis of the N-benzoyl phenylisoserinoyl side-chain of the anticancer drug taxol. Mechanistic studies on PAM have suggested that (E)-cinnamic acid is an intermediate in the mutase reaction and that it can be released from the enzyme's active site. Here we describe a novel synthetic strategy that is based on the finding that ring-substituted (E)-cinnamic acids can serve as a substrate in PAM-catalysed ammonia addition reactions for the biocatalytic production of several important beta-amino acids. The enzyme has a broad substrate range and a high enantioselectivity with cinnamic acid derivatives; this allows the synthesis of several non-natural aromatic alpha- and beta-amino acids in excellent enantiomeric excess (ee >99 %). The internal 5-methylene-3,5-dihydroimidazol-4-one (MIO) cofactor is essential for the PAM-catalysed amination reactions. The regioselectivity of amination reactions was influenced by the nature of the ring substituent.

  2. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  3. Synthesis of milk specific fatty acids and proteins by dispersed goat mammary-gland epithelial cells.

    PubMed Central

    Hansen, H O; Tornehave, D; Knudsen, J

    1986-01-01

    The method now described for preparation of dispersed lactating goat mammary-gland cells gives a high yield of morphologically and functionally normal mammary cells. The cells synthesize specific goat milk fatty acids in the right proportions, and they respond to hormones by increased protein synthesis. The cells can be frozen and thawed without losing the above properties, which makes them an excellent tool for metabolic and hormonal studies. Images Fig. 1. Fig. 2. PMID:3800930

  4. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides. PMID:22423599

  5. Synthesis and activity of 2-oxoamides containing long chain beta-amino acids.

    PubMed

    Constantinou-Kokotou, Violetta; Peristeraki, Anna; Kokotos, Christoforos G; Six, David A; Dennis, Edward A

    2005-07-01

    2-Oxoamides based on long chain beta-amino acids were synthesized. 1-Benzyl substituted long chain amines, needed for such synthesis, were synthesized starting from Boc-phenylalaninol. The oxidative conversion of a phenyl group to a carboxyl group was used as the key transformation synthetic step. The compounds synthesized were studied for their activity against GIVA PLA(2), and were proven to be weak inhibitors. PMID:15635664

  6. Synthesis of kojic acid derivatives as secondary binding site probes of D-amino acid oxidase

    PubMed Central

    Raje, Mithun; Hin, Niyada; Duvall, Bridget; Ferraris, Dana V.; Berry, James F.; Thomas, Ajit G.; Alt, Jesse; Rojas, Camilo; Slusher, Barbara S.; Tsukamoto, Takashi

    2013-01-01

    A series of kojic acid (5-hydroxy-2-hydroxymethyl-4H-pyran-4-one) derivatives were synthesized and tested for their ability to inhibit D-amino acid oxidase (DAAO). Various substituents were incorporated into kojic acid at its 2-hydroxymethyl group. These analogs serve as useful molecular probes to explore the secondary binding site, which can be exploited in designing more potent DAAO inhibitors. PMID:23683589

  7. New Insight on the Synthesis of Neurotoxins Domoic Acid and Kainic Acid.

    PubMed

    Mollica, Adriano; Costante, Roberto; Stefanucci, Azzurra; Novellino, Ettore

    2015-01-01

    Mono or di-substituted prolines, namely proline chimeras of natural or synthetic origin, carry the side chain of other specific amino acids on the pyrrolidine ring. Thus, proline chimeras are useful tools for a wide range of chemical and biological applications as chiral synthons or building blocks for peptidomimetic design. We focused our attention on domoic acid and kainic acid and we report here a concise and up to date review on their stereoselective and asymmetric syntheses.

  8. Integrated process of distillation with side reactors for synthesis of organic acid esters

    SciTech Connect

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  9. Enantioselective Synthesis of Dialkylated α-Hydroxy Carboxylic Acids through Asymmetric Phase-Transfer Catalysis.

    PubMed

    Duan, Shaobo; Li, Sanliang; Ye, Xinyi; Du, Nuan-Nuan; Tan, Choon-Hong; Jiang, Zhiyong

    2015-08-01

    In the presence of an L-tert-leucine-derived urea-ammonium salt as phase-transfer catalyst, a highly enantioselective alkylation of 5H-oxazol-4-ones with various benzyl bromides and allylic bromides has been developed to furnish catalytic asymmetric synthesis of biologically important dialkylated α-hydroxy carboxylic acids with a broad scope. This is the first example of an L-amino acid-derived urea-ammonium salt being used as a phase-transfer catalyst with excellent catalytic efficiency.

  10. Synthesis and sintering of nanocrystalline hydroxyapatite powders by citric acid sol-gel combustion method

    SciTech Connect

    Han Yingchao; Li Shipu; Wang Xinyu; Chen Xiaoming

    2004-01-03

    The citric acid sol-gel combustion method has been used for the synthesis of nanocrystalline hydroxyapatite (HAP) powder from calcium nitrate, diammonium hydrogen phosphate and citric acid. The phase composition of HAP powder was characterized by X-ray powder diffraction analysis (XRD). The morphology of HAP powder was observed by transmission electron microscope (TEM). The HAP powder has been sintered into microporous ceramic in air at 1200 deg. C with 3 h soaking time. The microstructure and phase composition of the resulting HAP ceramic were characterized by scanning electron microscope (SEM) and XRD, respectively. The physical characterization of open porosity and flexural strength have also been carried out.

  11. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity.

    PubMed

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna; Dallavalle, Sabrina

    2016-01-01

    The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  12. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    PubMed Central

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna

    2016-01-01

    Summary The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  13. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  14. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  15. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  16. A novel and highly regioselective synthesis of new carbamoylcarboxylic acids from dianhydrides.

    PubMed

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N'-disubstituted 4,4'-carbonylbis(carbamoylbenzoic) acids and N,N'-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3',4,4'-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS.

  17. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  18. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  19. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  20. Metabolic switch during adipogenesis: From branched chain amino acid catabolism to lipid synthesis.

    PubMed

    Halama, Anna; Horsch, Marion; Kastenmüller, Gabriele; Möller, Gabriele; Kumar, Pankaj; Prehn, Cornelia; Laumen, Helmut; Hauner, Hans; Hrabĕ de Angelis, Martin; Beckers, Johannes; Suhre, Karsten; Adamski, Jerzy

    2016-01-01

    Fat cell metabolism has an impact on body homeostasis and its proper function. Nevertheless, the knowledge about simultaneous metabolic processes, which occur during adipogenesis and in mature adipocytes, is limited. Identification of key metabolic events associated with fat cell metabolism could be beneficial in the field of novel drug development, drug repurposing, as well as for the discovery of patterns predicting obesity risk. The main objective of our work was to provide comprehensive characterization of metabolic processes occurring during adipogenesis and in mature adipocytes. In order to globally determine crucial metabolic pathways involved in fat cell metabolism, metabolomics and transcriptomics approaches were applied. We observed significantly regulated metabolites correlating with significantly regulated genes at different stages of adipogenesis. We identified the synthesis of phosphatidylcholines, the metabolism of even and odd chain fatty acids, as well as the catabolism of branched chain amino acids (BCAA; leucine, isoleucine and valine) as key regulated pathways. Our further analysis led to identification of an enzymatic switch comprising the enzymes Hmgcs2 (3-hydroxy-3-methylglutaryl-CoA synthase) and Auh (AU RNA binding protein/enoyl-CoA hydratase) which connects leucine degradation with cholesterol synthesis. In addition, propionyl-CoA, a product of isoleucine degradation, was identified as a putative substrate for odd chain fatty acid synthesis. The uncovered crosstalks between BCAA and lipid metabolism during adipogenesis might contribute to the understanding of molecular mechanisms of obesity and have potential implications in obesity prediction. PMID:26408941

  1. Abolished synthesis of cholic acid reduces atherosclerotic development in apolipoprotein E knockout mice.

    PubMed

    Slätis, Katharina; Gåfvels, Mats; Kannisto, Kristina; Ovchinnikova, Olga; Paulsson-Berne, Gabrielle; Parini, Paolo; Jiang, Zhao-Yan; Eggertsen, Gösta

    2010-11-01

    To investigate the effects of abolished cholic acid (CA) synthesis in the ApoE knockout model [apolipoprotein E (apoE) KO],a double-knockout (DKO) mouse model was created by crossbreeding Cyp8b1 knockout mice (Cyp8b1 KO), unable to synthesize the primary bile acid CA, with apoE KO mice. After 5 months of cholesterol feeding, the development of atherosclerotic plaques in the proximal aorta was 50% less in the DKO mice compared with the apoE KO mice. This effect was associated with reduced intestinal cholesterol absorption, decreased levels of apoB-containing lipoproteins in the plasma, enhanced bile acid synthesis, reduced hepatic cholesteryl esters, and decreased hepatic activity of ACAT2. The upregulation of Cyp7a1 in DKO mice seemed primarily caused by reduced expression of the intestinal peptide FGF15. Treatment of DKO mice with the farnesoid X receptor (FXR) agonist GW4064 did not alter the intestinal cholesterol absorption, suggesting that the action of CA in this process is confined mainly to formation of intraluminal micelles and less to its ability to activate the nuclear receptor FXR. Inhibition of CA synthesis may offer a therapeutic strategy for the treatment of hyperlipidemic conditions that lead to atherosclerosis.

  2. Acid synthesis of luminescent amine-functionalized or erbium-doped silica spheres for biological applications.

    PubMed

    Enrichi, Francesco; Trave, Enrico; Bersani, Marco

    2008-03-01

    In this work we discuss and investigate the morphological and optical properties of luminescent silica spheres which can have interesting applications in bioimaging and biosensing. The spheres are synthesized following an acid route by the hydrolysis and condensation of tetraethylortosilicate (TEOS) and can be functionalized by incorporation of aminopropyl-triethoxysilane (APTES) during the synthesis, inducing a significant luminescence that can be attributed to a recombination mechanism from localized organic defects related to -NH(2) groups. It is shown that the acid synthesis route produces very regular spherical particles, but their diameter vary in the range of 200-4,000 nm. The luminescence properties have been investigated and optimized by variation of the annealing temperature for the functionalized spheres, obtaining the most efficient PL emission after a thermal treatment of 1 h at 600 degrees C in air. Moreover, the possibility to introduce rare earths like erbium in the spheres was also studied and the corresponding Er(3) luminescence emission at 1.53 microm is reported in terms of intensity and lifetime, pointing out that erbium can be easily and efficiently incorporated during the acid synthesis giving high PL intensity with a good lifetime of 3.9 ms.

  3. Synthesis and characterization of agricultural controllable humic acid superabsorbent.

    PubMed

    Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

    2013-12-01

    Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent. PMID:25078843

  4. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  5. Proton donor acidity controls selectivity in nonaromatic nitrogen heterocycle synthesis.

    PubMed

    Duttwyler, Simon; Chen, Shuming; Takase, Michael K; Wiberg, Kenneth B; Bergman, Robert G; Ellman, Jonathan A

    2013-02-01

    Piperidines are prevalent in natural products and pharmaceutical agents and are important synthetic targets for drug discovery and development. We report on a methodology that provides highly substituted piperidine derivatives with regiochemistry selectively tunable by varying the strength of acid used in the reaction. Readily available starting materials are first converted to dihydropyridines via a cascade reaction initiated by rhodium-catalyzed carbon-hydrogen bond activation. Subsequent divergent regio- and diastereoselective protonation of the dihydropyridines under either kinetic or thermodynamic control provides two distinct iminium ion intermediates that then undergo highly diastereoselective nucleophilic additions. X-ray structural characterization of both the kinetically and thermodynamically favored iminium ions along with density functional theory calculations provide a theoretical underpinning for the high selectivities achieved for the reaction sequences.

  6. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter.

  7. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter. PMID:25900811

  8. Synthesis and degradation test of hyaluronic acid hydrogels.

    PubMed

    Hahn, Sei Kwang; Park, Jung Kyu; Tomimatsu, Takashi; Shimoboji, Tsuyoshi

    2007-03-10

    Hyaluronic acid (HA) hydrogels prepared with three different crosslinking reagents were assessed by in vitro and in vivo degradation tests for various tissue engineering applications. Adipic acid dihydrazide grafted HA (HA-ADH) was synthesized and used for the preparation of methacrylated HA (HA-MA) with methacrylic anhydride and thiolated HA (HA-SH) with Traut's reagent (imminothiolane). (1)H NMR analysis showed that the degrees of HA-ADH, HA-MA, and HA-SH modification were 69, 29, and 56 mol%, respectively. HA-ADH hydrogel was prepared by the crosslinking with bis(sulfosuccinimidyl) suberate (BS(3)), HA-MA hydrogel with dithiothreitol (DTT) by Michael addition, and HA-SH hydrogel with sodium tetrathionate by disulfide bond formation. According to in vitro degradation tests, HA-SH hydrogel was degraded very fast, compared to HA-ADH and HA-MA hydrogels. HA-ADH hydrogel was degraded slightly faster than HA-MA hydrogel. Based on these results, HA-MA hydrogels and HA-SH hydrogels were implanted in the back of SD rats and their degradation was assessed according to the pre-determined time schedule. As expected from the in vitro degradation test results, HA-SH hydrogel was in vivo degraded completely only in 2 weeks, whereas HA-MA hydrogels were degraded only partially even in 29 days. The degradation rate of HA hydrogels were thought to be controlled by changing the crosslinking reagents and the functional group of HA derivatives. In addition, the state of HA hydrogel was another factor in controlling the degradation rate. Dried HA hydrogel at 37 degrees C for a day resulted in relatively slow degradation compared to the bulk HA hydrogel. There was no adverse effect during the in vivo tests. PMID:17101173

  9. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  10. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  11. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  12. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  13. Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.

    PubMed

    Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula

    2015-01-01

    The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.

  14. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  15. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  16. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  17. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  18. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.

    PubMed

    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens

    2015-12-01

    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC 3.5.2.2) from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  19. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  20. Synthesis and characterization of hybrid hyaluronic acid-gelatin hydrogels.

    PubMed

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-04-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g., cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three-dimensional culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications.