Science.gov

Sample records for phosphatidic acid synthesis

  1. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  2. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  3. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  4. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth

    1985-01-01

    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  5. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  6. Synthesis of dehydroepiandrosterone analogues modified with phosphatidic acid moiety.

    PubMed

    Smuga, Damian A; Smuga, Małgorzata; Swizdor, Alina; Panek, Anna; Wawrzeńczyk, Czesław

    2010-12-12

    Dehydroepiandrosterone (DHEA) and its metabolite 7α-OH DHEA have many diverse physiological, biological and biochemical effects encompassing various cell types, tissues and organs. In in vitro studies, DHEA analogues have myriad biological actions, but in vivo, especially in oral administration, DHEA produces far more limited clinical effects. One of the possible solutions of this problem is conversion of DHEA to active analogues and/or its transformation into prodrug form. In this article, the studies on the conversion of DHEA and 7α-OH DHEA into their phosphatides by the phosphodiester approach are described. In this esterification, N,N-dicyclohexylcarbodiimide (DCC) was the most efficient coupling agent as well as p-toluenesulphonyl chloride (TsCl).

  7. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  8. Synthesis of lyso(bis)phosphatidic acid in rabbit alveolar macrophages

    SciTech Connect

    Thornburg, T.; Roddick, V.; Wykle, R.L.; Waite, M.

    1987-05-01

    Reported here are studies on the biosynthetic pathway used by normal and BCG elicited alveolar macrophages for the synthesis of lyso(bis)phosphatidic acid (L(bis)PA). Earlier observations by this laboratory have shown that although L(bis)PA is abundant in these cells, there is little de novo synthesis of this lipid. Diaceyl phosphatidylglycerol (PG) labeled with either (1,2,3-/sup 3/H) glycerol or /sup 32/P demonstrated that PG is used as an exogenous substrate for L(bis)PA formation; both glycerol moieties are incorporated. Other phospholipids do not have this capacity. BCG-elicited macrophages are capable of only one-quarter the synthesis of L(bis)PA seen with normal cells, and also show a decreased amount of cell associated substrate. In addition, (/sup 3/H) 1-0-alkyl PG was used as a substrate to test the importance of the sn-1 acyl linkage in the synthetic pathway. This substrate produced less L(bis)PA while dramatically increasing the amounts of labelled phosphatidylethanolamine and phosphatidylcholine within the cell. The alkyl substrate also showed increased uptake by the cell. They conclude that the hydrolysis of the acyl group at the sn-1 position of PG is essential in the synthetic pathway leading to the production of L(bis)PA. They further suggest that the PG used by these cells as an exogenous substrate in vitro is obtained from the PG-rich surfactant surrounding the alveolar macrophage.

  9. Polyamines are essential for the synthesis of 2-ricinoleoyl phosphatidic acid in developing seeds of castor.

    PubMed

    Tomosugi, Mitsuhiro; Ichihara, Ken'ichi; Saito, Kazumi

    2006-01-01

    The major fatty acid component of castor (Ricinus communis L.) oil is ricinoleic acid (12-hydroxy-cis-9-octadecenoic acid), and unsaturated hydroxy acid accounts for >85% of the total fatty acids in triacylglycerol (TAG). TAG had a higher ricinoleate content at position 2 than at positions 1 and 3. Although lysophosphatidic acid (LPA) acyltransferase (EC 2.3.1.51), which catalyzes acylation of LPA at position 2, was expected to utilize ricinoleoyl-CoA preferentially over other fatty acyl-CoAs, no activity was found for ricinoleoyl-CoA in vitro at concentrations at which other unsaturated acyl-CoAs were incorporated rapidly. However, activity for ricinoleoyl-CoA appeared with addition of polyamines (putrescine, spermidine, and spermine), while polyamines decreased the rates of incorporation of other acyl-CoAs into position 2. The order of effect of polyamines on LPA acyltransferase activity was spermine > spermidine > putrescine. At concentrations of spermine and spermidine of >0.1 mM, ricinoleoyl-CoA served as an effective substrate for LPA acyltransferase reaction. The concentrations of spermine and spermidine in the developing seeds were estimated at approximately 0.09 and approximately 0.63 mM, respectively. These stimulatory effects for incorporation of ricinoleate were specific to polyamines, but basic amino acids were ineffective as cations. In contrast, in microsomes from safflower seeds that do not contain ricinoleic acid, spermine and spermidine stimulated the LPA acyltransferase reaction for all acyl-CoAs tested, including ricinoleoyl-CoA. Although the fatty acid composition of TAG depends on both acyl-CoA composition in the cell and substrate specificity of acyltransferases, castor bean polyamines are crucial for incorporation of ricinoleate into position 2 of LPA. Polyamines are essential for synthesis of 2-ricinoleoyl phosphatidic acid in developing castor seeds.

  10. Adrenocorticotropin and adenosine 3',5'-monophosphate stimulate de novo synthesis of adrenal phosphatidic acid by a cycloheximide-sensitive, CA++-dependent mechanism

    SciTech Connect

    Farese, R.V.; Sabir, M.A.; Larson, R.E.

    1981-12-01

    We tested further our postulate that enhanced de novo synthesis of phosphatidic acid is responsible for ACTH- and cAMP-induced increases in adrenal phospholipids in the phosphatidate polyphosphoinositide pathway. During incubation of adrenal sections or cells in vitro, ACTH and cAMP increased the concentrations of and incorporation of (3H)glycerol and (14C)palmitate into phosphatidylcholine and phosphatidylethanolamine, two major phospholipids which are derived from phosphatidic acid, but are extrinsic to the inositide pathway. Thus, it is unlikely that ACTH and cAMP increase inositide phospholipids at the expense of other phospholipids. Similar to previously reported effects on phosphatidic acid and inositide phospholipids, cycloheximide blocked the effects of ACTH and cAMP on phosphatidylcholine and phosphatidylethanolamine. In addition, Ca++ was required for these effects, as well as for cAMP-induced increases in phosphatidic acid, inositide phospholipids, and steroidogenesis. Our findings strongly suggest that ACTH, via cAMP, stimulates de novo phosphatidate synthesis by a cycloheximide-sensitive, Ca++-dependent process, and this stimulation causes a rapid generalized increase in adrenal phospholipids. Moreover, the increased incorporation of labeled glycerol and palmitate into phospholipids suggests that ACTH and cAMP may stimulate the glycerol-3'-PO4 acyltransferase reaction. This stimulatory effect may play a central role in the steroidogenic and trophic actions of ACTH and cAMP.

  11. Lyso(bis)phosphatidic acid: a preferred donor of arachidonic acid for macrophage-synthesis of eicosanoids

    SciTech Connect

    Cochran, F.; Roddick, V.; Connor, J.; Waite, M.

    1986-05-01

    In order to dissect mechanisms of arachidonic acid (20:4) metabolism, two cell populations were investigated, resident (AM) and Bacillus Calmette-Guerin-activated (BCG-AM) rabbit alveolar macrophages. After purified AM were labeled overnight with (/sup 3/H)20:4, radioactivity was localized primarily within lyso(bis)phosphatidic acid (L(bis)PA) (13.1%), phosphatidylethanolamine (PE) (22.8%) and phosphatidylcholine (PC) (26.7%), with lesser amounts recovered in phosphatidyl-serine (PS) plus phosphatidylinositol (PI) (9.2%). By contrast, analysis of the phospholipid classes from prelabeled BCG-AM revealed that the mass of L(bis)PA as well as its (/sup 3/H)20:4 content was profoundly decreased while other BCG-AM phospholipids remained unchanged. When (/sup 3/H)20:4-labeled AM were stimulated with 1 ..mu..M 12-0-tetradecanoyl-phorbol-13-acetate (TPA), a loss of (/sup 3/H)20:4 was observed from L(bis)PA, PE, PC, and PS/PI with a corresponding increase in eicosanoid synthesis. BCG-AM exposed to either TPA or 3.8 ..mu..M Ca/sup +2/ ionophore A23187 liberated (/sup 3/H)20:4 solely from Pe and PC. BCG-AM, which exhibited depressed eicosanoid formation, consistently failed to deacylate (/sup 3/H)20:4 from L(bis)PA or PI. Their evidence suggests that the diminution of eicosanoid synthesis by BCG-AM may be due to the reduction of 20:4 contained within specific phospholipid pools, namely L(bis)PA.

  12. PHOSPHATIDIC ACID PHOSPHOHYDROLASE1 and 2 Regulate Phospholipid Synthesis at the Endoplasmic Reticulum in Arabidopsis[W

    PubMed Central

    Eastmond, Peter J.; Quettier, Anne-Laure; Kroon, Johan T.M.; Craddock, Christian; Adams, Nicolette; Slabas, Antoni R.

    2010-01-01

    Phospholipid biosynthesis is essential for the construction of most eukaryotic cell membranes, but how this process is regulated in plants remains poorly understood. Here, we show that in Arabidopsis thaliana, two Mg2+-dependent phosphatidic acid phosphohydrolases called PAH1 and PAH2 act redundantly to repress phospholipid biosynthesis at the endoplasmic reticulum (ER). Leaves from pah1 pah2 double mutants contain ~1.8-fold more phospholipid than the wild type and exhibit gross changes in ER morphology, which are consistent with massive membrane overexpansion. The net rate of incorporation of [methyl-14C]choline into phosphatidylcholine (PC) is ~1.8-fold greater in the double mutant, and the transcript abundance of several key genes that encode enzymes involved in phospholipid synthesis is increased. In particular, we show that PHOSPHORYLETHANOLAMINE N-METHYLTRANSFERASE1 (PEAMT1) is upregulated at the level of transcription in pah1 pah2 leaves. PEAMT catalyzes the first committed step of choline synthesis in Arabidopsis and defines a variant pathway for PC synthesis not found in yeasts or mammals. Our data suggest that PAH1/2 play a regulatory role in phospholipid synthesis that is analogous to that described in Saccharomyces cerevisiae. However, the target enzymes differ, and key components of the signal transduction pathway do not appear to be conserved. PMID:20699392

  13. Acetal phosphatidic acids: novel platelet aggregating agents.

    PubMed

    Brammer, J P; Maguire, M H; Walaszek, E J; Wiley, R A

    1983-05-01

    1 Palmitaldehyde, olealdehyde and linolealdehyde acetal phosphatidic acids induced rapid shape change and dose-dependent biphasic aggregation of human platelets in platelet-rich plasma; aggregation was reversible at low doses and irreversible at high doses of the acetal phosphatidic acids. The palmitaldehyde congener elicited monophasic dose-dependent aggregation of sheep platelets in platelet-rich plasma.2 The threshold concentration for palmitaldehyde acetal phosphatidic acid (PGAP)-induced platelet aggregation was 2.5-5 muM for human platelets and 0.25-0.5 muM for sheep platelets. PGAP was 4-5 times as potent versus human platelets as the olealdehyde and linolealdehyde acetal phosphatidic acids, which were equipotent.3 PGAP-induced irreversible aggregation of [(14)C]-5-hydroxytryptamine ([(14)C]-5-HT)-labelled human platelets in platelet-rich plasma was accompanied by release of 44.0+/-2.4% (s.e.) of the platelet [(14)C]-5-HT; reversible aggregation was not associated with release. In contrast, PGAP-induced release of [(14)C]-5-HT-labelled sheep platelets was dose-dependent.4 The adenosine diphosphate (ADP) antagonist, 2-methylthio-AMP, and the cyclo-oxygenase inhibitor, aspirin, abolished PGAP-induced second phase aggregation and release in human platelets but did not affect the first, reversible, phase of aggregation. Both the first and second phases of PGAP-induced aggregation were abolished by chlorpromazine, by the phospholipase A(2) inhibitor, mepacrine, and by nmolar concentrations of prostaglandin E(1) (PGE(1)); these agents abolished the second, but not the first phase of ADP-induced aggregation.5 The related phospholipids, lecithin, lysolecithin and phosphatidic acid, at <100 muM, neither induced aggregation of human platelets in platelet-rich plasma, nor modified PGAP-induced aggregation; 1-palmityl lysophosphatidic acid elicited aggregation of human platelets at a threshold concentration of 100 muM.6 It is concluded that the acetal phosphatidic acids

  14. Accumulation of Phosphatidic Acid Increases Vancomycin Resistance in Escherichia coli

    PubMed Central

    Sutterlin, Holly A.; Zhang, Sisi

    2014-01-01

    In Gram-negative bacteria, lipopolysaccharide (LPS) contributes to the robust permeability barrier of the outer membrane, preventing entry of toxic molecules such as antibiotics. Mutations in lptD, the beta-barrel component of the LPS transport and assembly machinery, compromise LPS assembly and result in increased antibiotic sensitivity. Here, we report rare vancomycin-resistant suppressors that improve barrier function of a subset of lptD mutations. We find that all seven suppressors analyzed mapped to the essential gene cdsA, which is responsible for the conversion of phosphatidic acid to CDP-diacylglycerol in phospholipid biosynthesis. These cdsA mutations cause a partial loss of function and, as expected, accumulate phosphatidic acid. We show that this suppression is not confined to mutations that cause defects in outer membrane biogenesis but rather that these cdsA mutations confer a general increase in vancomycin resistance, even in a wild-type cell. We use genetics and quadrupole time of flight (Q-TOF) liquid chromatography-mass spectrometry (LC-MS) to show that accumulation of phosphatidic acid by means other than cdsA mutations also increases resistance to vancomycin. We suggest that increased levels of phosphatidic acid change the physical properties of the outer membrane to impede entry of vancomycin into the periplasm, hindering access to its target, an intermediate required for the synthesis of the peptidoglycan cell wall. PMID:24957626

  15. Cyclic phosphatidic acid - a unique bioactive phospholipid.

    PubMed

    Fujiwara, Yuko

    2008-09-01

    Cyclic phosphatidic acid (CPA) is a naturally occurring analog of the growth factor-like phospholipid mediator, lysophosphatidic acid (LPA). The sn-2 hydroxy group of CPA forms a 5-membered ring with the sn-3 phosphate. CPA affects numerous cellular functions, including anti-mitogenic regulation of the cell cycle, induction of stress fiber formation, inhibition of tumor cell invasion and metastasis, and regulation of differentiation and survival of neuronal cells. Interestingly, many of these cellular responses caused by CPA oppose those of LPA despite the activation of apparently overlapping receptor populations. Since the early 1990s, studies on CPA actions gradually developed, and we are now beginning to understand the importance of this lipid. In this review, we focus on the current knowledge about CPA, including enzymatic formation of CPA, unique biological activities and biological targets of CPA, and we also explore metabolically stabilized CPA analogs.

  16. Purification, characterization, and bioinformatics studies of phosphatidic acid phosphohydrolase from Lagenaria siceraria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidic acid phosphohydrolase (PAP), EC 3.1.3.4, is the penultimate step in the Kennedy pathway of triacyl glycerol (TAG) synthesis leading to the formation of diacyl glycerol (DAG), which is a key intermediate in TAG synthesis. We partially purified a soluble PAP from mid maturing seeds of bot...

  17. Angiotensin II induces phosphatidic acid formation in neonatal rat cardiac fibroblasts: evaluation of the roles of phospholipases C and D.

    PubMed

    Booz, G W; Taher, M M; Baker, K M; Singer, H A

    1994-12-21

    Phosphatidic acid has been proposed to contribute to the mitogenic actions of various growth factors. In 32P-labeled neonatal rat cardiac fibroblasts, 100 nM [Sar1]angiotensin II was shown to rapidly induce formation of 32P-phosphatidic acid. Levels peaked at 5 min (1.5-fold above control), but were partially sustained over 2 h. Phospholipase D contributed in part to phosphatidic acid formation, as 32P- or 3H-phosphatidylethanol was produced when cells labeled with [32P]H3PO4 or 1-O-[1,2- 3H]hexadecyl-2-lyso-sn-glycero-3-phosphocholine were stimulated in the presence of 1% ethanol. [Sar1]angiotensin II-induced phospholipase D activity was transient and mainly mediated through protein kinase C (PKC), since PKC downregulation reduced phosphatidylethanol formation by 68%. Residual activity may have been due to increased intracellular Ca2+, as ionomycin also activated phospholipase D in PKC-depleted cells. Phospholipase D did not fully account for [Sar1]angiotensin II-induced phosphatidic acid: 1) compared to PMA, a potent activator of phospholipase D, [Sar1]angiotensin II produced more phosphatidic acid relative to phosphatidylethanol, and 2) PKC downregulation did not affect [Sar1]angiotensin II-induced phosphatidic acid formation. The diacylglycerol kinase inhibitor R59949 depressed [Sar1]angiotensin II-induced phosphatidic acid formation by only 21%, indicating that activation of a phospholipase C and diacylglycerol kinase also can not account for the bulk of phosphatidic acid. Thus, additional pathways not involving phospholipases C and D, such as de novo synthesis, may contribute to [Sar1]angiotensin II-induced phosphatidic acid in these cells. Finally, as previously shown for [Sar1]angiotensin II, phosphatidic acid stimulated mitogen activated protein (MAP) kinase activity.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. The Coffin-Lowry syndrome-associated protein RSK2 regulates neurite outgrowth through phosphorylation of phospholipase D1 (PLD1) and synthesis of phosphatidic acid.

    PubMed

    Ammar, Mohamed-Raafet; Humeau, Yann; Hanauer, André; Nieswandt, Bernard; Bader, Marie-France; Vitale, Nicolas

    2013-12-11

    More than 80 human X-linked genes have been associated with mental retardation and deficits in learning and memory. However, most of the identified mutations induce limited morphological alterations in brain organization and the molecular bases underlying neuronal clinical features remain elusive. We show here that neurons cultured from mice lacking ribosomal S6 kinase 2 (Rsk2), a model for the Coffin-Lowry syndrome (CLS), exhibit a significant delay in growth in a similar way to that shown by neurons cultured from phospholipase D1 (Pld1) knock-out mice. We found that gene silencing of Pld1 or Rsk2 as well as acute pharmacological inhibition of PLD1 or RSK2 in PC12 cells strongly impaired neuronal growth factor (NGF)-induced neurite outgrowth. Expression of a phosphomimetic PLD1 mutant rescued the inhibition of neurite outgrowth in PC12 cells silenced for RSK2, revealing that PLD1 is a major target for RSK2 in neurite formation. NGF-triggered RSK2-dependent phosphorylation of PLD1 led to its activation and the synthesis of phosphatidic acid at sites of neurite growth. Additionally, total internal reflection fluorescence microscopy experiments revealed that RSK2 and PLD1 positively control fusion of tetanus neurotoxin insensitive vesicle-associated membrane protein (TiVAMP)/VAMP-7 vesicles at sites of neurite outgrowth. We propose that the loss of function mutations in RSK2 that leads to CLS and neuronal deficits are related to defects in neuronal growth due to impaired RSK2-dependent PLD1 activity resulting in a reduced vesicle fusion rate and membrane supply.

  19. Thiophosphoester analogs of phosphatidic acids: spectrophotometric substrates for phosphomonoesterases.

    PubMed

    Nyquist, D A

    1988-10-01

    Thiophosphoester analogs of dioctanoyl and didecanoyl phosphatidic acids were synthesized for use as substrates in spectrophotometric assays. These substrates are easily dispersable in aqueous media and release thiodiacylglycerols after phosphomonoesterase catalyzed hydrolysis. The free sulfhydryl of these thiodiacylglycerols reacts with the colorimetric reagent 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), allowing the reaction to be followed. These analogs were shown to be good substrates for calf intestine alkaline phosphatase (highest activity at alkaline pH) and phosphomonoesterases of partially purified beef brain cytosol (highest activity at physiologic pH). Cationic amphiphilic drugs inhibit the actions of alkaline phosphatase on the dioctanoyl analog, but did not inhibit enzymatic hydrolysis of p-nitrophenyl phosphate. In contrast, the beef brain cytosolic fraction p-nitrophenyl phosphate hydrolysis was mildly inhibited, and the phosphatidic acid analog hydrolysis was increased slightly. Tetramisole inhibited all enzyme activities with p-nitrophenyl phosphate, but was inhibitory only to the alkaline-phosphatase activity with the phosphatidic acid analog.

  20. Stimulation and binding of myocardial phospholipase C by phosphatidic acid.

    PubMed

    Henry, R A; Boyce, S Y; Kurz, T; Wolf, R A

    1995-08-01

    Exposure of adult ventricular myocytes to exogenous natural phosphatidic acid results in the production of inositol phosphates by unknown mechanism(s). We characterized stimulation of myocytic phosphoinositide-specific phospholipase C (PLC) by synthetic dioleoyl phosphatidic acid (PA) as a potential mechanism for modulation of inositol phosphate production. Our data demonstrate that exogenous PA, at 10(-8)-10(-5) M, caused a concentration-dependent increase in inositol 1,4,5-trisphosphate in adult rabbit ventricular myocytes. PA also caused a concentration-dependent increase in in vitro activity of myocytic PLC in the presence or absence of ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA). PLC-delta 1, the predominant isozyme of PLC expressed in adult rabbit ventricular myocytes, bound to liposomes of PA with high affinity in the presence of EGTA. The phosphomonoester group of PA was critical to in vitro stimulation of myocytic PLC activity and high-affinity binding of PLC-delta 1. We propose that binding of PLC-delta 1 to phosphatidic acid may be a novel mechanism for dynamic membrane association and modulation of PLC in adult ventricular myocytes.

  1. Phosphatidic acid metabolism in rat liver cell nuclei.

    PubMed

    Gaveglio, Virginia L; Pasquaré, Susana J; Giusto, Norma M

    2013-04-02

    The aim of the present research was to analyze the pathways for phosphatidic acid metabolism in purified nuclei from liver. Lipid phosphate phosphatase, diacylglycerol lipase, monoacylglycerol lipase and PA-phospholipase type A activities were detected. The presence of lysophosphatidic acid significantly reduced DAG production while sphingosine 1-phoshate and ceramide 1-phosphate reduced MAG formation from PA. Using different enzymatic modulators (detergents and ions) an increase in the PA metabolism by phospholipase type A was observed. Our findings evidence an active PA metabolism in purified liver nuclei which generates important lipid second messengers, and which could thus be involved in nuclear processes such as gene transcription.

  2. Phosphorylation of lipin 1 and charge on the phosphatidic acid head group control its phosphatidic acid phosphatase activity and membrane association.

    PubMed

    Eaton, James M; Mullins, Garrett R; Brindley, David N; Harris, Thurl E

    2013-04-05

    The lipin gene family encodes a class of Mg(2+)-dependent phosphatidic acid phosphatases involved in the de novo synthesis of phospholipids and triglycerides. Unlike other enzymes in the Kennedy pathway, lipins are not integral membrane proteins, and they need to translocate from the cytosol to intracellular membranes to participate in glycerolipid synthesis. The movement of lipin 1 within the cell is closely associated with its phosphorylation status. Although cellular analyses have demonstrated that highly phosphorylated lipin 1 is enriched in the cytosol and dephosphorylated lipin 1 is found on membranes, the effects of phosphorylation on lipin 1 activity and binding to membranes has not been recapitulated in vitro. Herein we describe a new biochemical assay for lipin 1 using mixtures of phosphatidic acid (PA) and phosphatidylethanolamine that reflects its physiological activity and membrane interaction. This depends on our observation that lipin 1 binding to PA in membranes is highly responsive to the electrostatic charge of PA. The studies presented here demonstrate that phosphorylation regulates the ability of the polybasic domain of lipin 1 to recognize di-anionic PA and identify mTOR as a crucial upstream signaling component regulating lipin 1 phosphorylation. These results demonstrate how phosphorylation of lipin 1 together with pH and membrane phospholipid composition play important roles in the membrane association of lipin 1 and thus the regulation of its enzymatic activity.

  3. Cyclic Phosphatidic Acid – A Unique Bioactive Phospholipid

    PubMed Central

    Fujiwara, Yuko

    2008-01-01

    Cyclic phosphatidic acid (CPA) is a naturally occurring analog of the growth factor-like phospholipid mediator, lysophosphatidic acid (LPA). The sn-2 hydroxy group of CPA forms a 5-membered ring with the sn-3 phosphate. CPA affects numerous cellular functions, including antimitogenic regulation of the cell cycle, induction of stress fiber formation, inhibition of tumor cell invasion and metastasis, and regulation of differentiation and survival of neuronal cells. Interestingly, many of these cellular responses caused by CPA oppose those of LPA despite the activation of apparently overlapping receptor populations. Since the early 1990s, studies on CPA actions gradually developed, and we are now beginning to understand the importance of this lipid. In this review, we focus on the current knowledge about CPA, including enzymatic formation of CPA, unique biological activities and biological targets of CPA, and we also explore metabolically stabilized CPA analogs. PMID:18554524

  4. Stimulating effect of phosphatidic acid on autophosphorylation of phosphorylase kinase.

    PubMed

    Negami, A I; Sasaki, H; Yamamura, H

    1985-09-16

    Autophosphorylation of phosphorylase kinase from rabbit skeletal muscle was stimulated by acidic phospholipids such as phosphatidic acid (PA), phosphatidylinositol, and phosphatidyl-serine. PA stimulated an initial velocity of autophosphorylation 3.8-fold. When fully autophosphorylated, about 11 mol of phosphate per tetramer (alpha beta gamma delta) were incorporated in the presence of PA and about 6.5 mol in the absence of PA. In the presence of PA (100 micrograms/ml), there was a concomitant enhancement of its kinase activity about 25-fold at pH 6.8. PA (100 micrograms/ml) sharply decreased an apparent Ka for Ca2+ on autophosphorylation from 4.0 X 10(-5) M to 1.0 X 10(-6) M. Available evidence indicates that the Ca2+-activated, PA-dependent autophosphorylation of phosphorylase kinase shows an ability to stimulate glycogen breakdown.

  5. Measuring phosphatidic acid phosphatase (EC 3.1.3.4) activity using two phosphomolybdate-based colorimetric methods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidate phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4), which is also known as PAP, catalyzes the dephosphorylation of phosphatidate (PtdOH) to form diacylglycerol (DAG) and inorganic phosphate. In eukaryotes, PAP driven reaction is the committed step in the synthesis of triacyl...

  6. Defective phosphatidic acid-phospholipase C signaling in diabetic cardiomyopathy.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Dibrov, Elena; Austria, J Alejandro; Sahi, Nidhi; Panagia, Vincenzo; Pierce, Grant N

    2004-03-26

    The effects of exogenous phosphatidic acid (PA) on Ca2+ transients and contractile activity were studied in cardiomyocytes isolated from chronic streptozotocin-induced diabetic rats. In control cells, 25 microM PA induced a significant increase in active cell shortening and Ca2+ transients. PA increased IP3 generation in the control cardiomyocytes and its inotropic effects were blocked by a phospholipase C inhibitor. In cardiomyocytes from diabetic rats, PA induced a 25% decrease in active cell shortening and no significant effect on Ca2+ transients. Basal and PA-induced IP3 generation in diabetic rat cardiomyocytes was 3-fold lower as compared to control cells. Sarcolemmal membrane PLC activity was impaired. Insulin treatment of the diabetic animals resulted in a partial recovery of PA responses. Our results, therefore, identify an important defect in the PA-PLC signaling pathway in diabetic rat cardiomyocytes, which may have significant implications for heart dysfunction during diabetes.

  7. Phosphatidic acid phosphatase and phospholipdase A activities in plasma membranes from fusing muscle cells.

    PubMed

    Kent, C; Vagelos, P R

    1976-06-17

    Plasma membrane from fusing embryonic muscle cells were assayed for phospholipase A activity to determine if this enzyme plays a role in cell fusion. The membranes were assayed under a variety of conditions with phosphatidylcholine as the substrate and no phospholipase A activity was found. The plasma membranes did contain a phosphatidic acid phosphatase which was optimally active in the presence of Triton X-100 and glycerol. The enzyme activity was constant from pH 5.2 to 7.0, and did not require divalent cations. Over 97% of the phosphatidic acid phosphatase activity was in the particulate fraction. The subcellular distribution of the phosphatidic acid phosphatase was the same as the distributions of the plasma membrane markers, (Na+ + k+)-ATPase and the acetylcholine receptor, which indicates that this phosphatase is located exclusively in the plasma membranes. There was no detectable difference in the phosphatidic acid phosphatase activities of plasma membranes from fusing and non-fusing cells.

  8. Phosphatidic acid stimulates inositol 1,4,5-trisphosphate production in adult cardiac myocytes.

    PubMed

    Kurz, T; Wolf, R A; Corr, P B

    1993-03-01

    The cellular content of phosphatidic acid can increase in response to several agonists either by phosphorylation of diacylglycerol after phospholipase C-catalyzed hydrolysis of phospholipids or directly through activation of phospholipase D. Although previous findings indicated that the generation of phosphatidic acid was exclusively a means of regulation of the cellular concentration of diacylglycerol, more recent studies have indicated that phosphatidic acid may also directly regulate several cellular functions. Accordingly, the present study was performed to assess whether phosphatidic acid could stimulate cardiac phospholipase C in intact adult rabbit ventricular myocytes. The mass of inositol 1,4,5-trisphosphate [Ins (1,4,5)P3] was determined by a specific and sensitive binding protein assay and by direct mass measurement using anion exchange chromatography for separation of selected inositol phosphates and gas chromatography and mass spectrometry for quantification of inositol monophosphate (IP1), inositol bisphosphate (IP2), inositol trisphosphate (IP3), and inositol tetrakisphosphate (IP4). Phosphatidic acid (10(-9)-10(-6) M) elicited a rapid concentration-dependent increase in Ins (1,4,5)P3 accumulation, with the peak fourfold to fivefold increase at 30 seconds of stimulation; the concentration required for 50% of maximal stimulation was 4.4 x 10(-8) M. The time course of individual inositol phosphates indicated a successive increase in the mass of IP3, IP4, IP2, and IP1 in response to stimulation with phosphatidic acid. The production of Ins (1,4,5)P3 in response to phosphatidic acid was not altered in the absence of extracellular calcium or in the presence of extracellular EGTA (10(-3) M). Thus, these findings indicate that phosphatidic acid is a potent activator of inositol phosphate production in adult ventricular myocytes.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Phosphatidic acid inhibits ceramide 1-phosphate-stimulated macrophage migration.

    PubMed

    Ouro, Alberto; Arana, Lide; Rivera, Io-Guané; Ordoñez, Marta; Gomez-Larrauri, Ana; Presa, Natalia; Simón, Jorge; Trueba, Miguel; Gangoiti, Patricia; Bittman, Robert; Gomez-Muñoz, Antonio

    2014-12-15

    Ceramide 1-phosphate (C1P) was recently demonstrated to potently induce cell migration. This action could only be observed when C1P was applied exogenously to cells in culture, and was inhibited by pertussis toxin. However, the mechanisms involved in this process are poorly understood. In this work, we found that phosphatidic acid (PA), which is structurally related to C1P, displaced radiolabeled C1P from its membrane-binding site and inhibited C1P-stimulated macrophage migration. This effect was independent of the saturated fatty acid chain length or the presence of a double bond in each of the fatty acyl chains of PA. Treatment of RAW264.7 macrophages with exogenous phospholipase D (PLD), an enzyme that produces PA from membrane phospholipids, also inhibited C1P-stimulated cell migration. Likewise, PA or exogenous PLD inhibited C1P-stimulated extracellularly regulated kinases (ERK) 1 and 2 phosphorylation, leading to inhibition of cell migration. However, PA did not inhibit C1P-stimulated Akt phosphorylation. It is concluded that PA is a physiological regulator of C1P-stimulated macrophage migration. These actions of PA may have important implications in the control of pathophysiological functions that are regulated by C1P, including inflammation and various cellular processes associated with cell migration such as organogenesis or tumor metastasis.

  10. Astrocyte-derived phosphatidic acid promotes dendritic branching.

    PubMed

    Zhu, Yan-Bing; Gao, Weizhen; Zhang, Yongbo; Jia, Feng; Zhang, Hai-Long; Liu, Ying-Zi; Sun, Xue-Fang; Yin, Yuhua; Yin, Dong-Min

    2016-02-17

    Astrocytes play critical roles in neural circuit formation and function. Recent studies have revealed several secreted and contact-mediated signals from astrocytes which are essential for neurite outgrowth and synapse formation. However, the mechanisms underlying the regulation of dendritic branching by astrocytes remain elusive. Phospholipase D1 (PLD1), which catalyzes the hydrolysis of phosphatidylcholine (PC) to generate phosphatidic acid (PA) and choline, has been implicated in the regulation of neurite outgrowth. Here we showed that knockdown of PLD1 selectively in astrocytes reduced dendritic branching of neurons in neuron-glia mixed culture. Further studies from sandwich-like cocultures and astrocyte conditioned medium suggested that astrocyte PLD1 regulated dendritic branching through secreted signals. We later demonstrated that PA was the key mediator for astrocyte PLD1 to regulate dendritic branching. Moreover, PA itself was sufficient to promote dendritic branching of neurons. Lastly, we showed that PA could activate protein kinase A (PKA) in neurons and promote dendritic branching through PKA signaling. Taken together, our results demonstrate that astrocyte PLD1 and its lipid product PA are essential regulators of dendritic branching in neurons. These results may provide new insight into mechanisms underlying how astrocytes regulate dendrite growth of neurons.

  11. Depressed phosphatidic acid-induced contractile activity of failing cardiomyocytes.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Panagia, Vincenzo; Pierce, Grant N

    2003-01-10

    The effects of phosphatidic acid (PA), a known inotropic agent, on Ca(2+) transients and contractile activity of cardiomyocytes in congestive heart failure (CHF) due to myocardial infarction were examined. In control cells, PA induced a significant increase (25%) in active cell shortening and Ca(2+) transients. The phospholipase C (PLC) inhibitor, 2-nitro-4-carboxyphenyl N,N-diphenylcarbonate, blocked the positive inotropic action induced by PA, indicating that PA induces an increase in contractile activity and Ca(2+) transients through stimulation of PLC. Conversely, in failing cardiomyocytes there was a loss of PA-induced increase in active cell shortening and Ca(2+) transients. PA did not alter resting cell length. Both diastolic and systolic [Ca(2+)] were significantly elevated in the failing cardiomyocytes. In vitro assessment of the cardiac sarcolemmal (SL) PLC activity revealed that the impaired failing cardiomyocyte response to PA was associated with a diminished stimulation of SL PLC activity by PA. Our results identify an important defect in the PA-PLC signaling pathway in failing cardiomyocytes, which may have significant implications for the depressed contractile function during CHF.

  12. New roles for Smad signaling and phosphatidic acid in the regulation of skeletal muscle mass.

    PubMed

    Goodman, Craig A; Hornberger, Troy A

    2014-01-01

    Skeletal muscle is essential for normal bodily function and the loss of skeletal muscle (i.e. muscle atrophy/wasting) can have a major impact on mobility, whole-body metabolism, disease resistance, and quality of life. Thus, there is a clear need for the development of therapies that can prevent the loss, or increase, of skeletal muscle mass. However, in order to develop such therapies, we will first have to develop a thorough understanding of the molecular mechanisms that regulate muscle mass. Fortunately, our knowledge is rapidly advancing, and in this review, we will summarize recent studies that have expanded our understanding of the roles that Smad signaling and the synthesis of phosphatidic acid play in the regulation of skeletal muscle mass.

  13. Phosphatidic acid and phosphatidylinositol labelling in adipose tissue. Relationship to the metabolic effects of insulin and insulin-like agents.

    PubMed Central

    Honeyman, T W; Strohsnitter, W; Scheid, C R; Schimmel, R J

    1983-01-01

    Exposure to phospholipase C increased the incorporation of [32P]Pi into phosphatidate, CMP-phosphatidate and phosphatidylinositol in rat adipose tissue and isolated adipocytes. A similar effect was observed in response to insulin and oxytocin. Theophylline, 3-isobutyl-1-methylxanthine and adenosine deaminase decreased [32P]Pi incorporation, and adenosine and N6-phenylisopropyladenosine reversed these effects. As with insulin, exposure of adipose tissue to phospholipase C stimulated oxidation of glucose, pyruvate and leucine and activated pyruvate dehydrogenase. Oxytocin and adenosine also mimicked the effects of insulin on leucine oxidation and pyruvate dehydrogenase. However, only insulin stimulated glycogen synthase activity, indicating that the regulation of synthase may be achieved by intracellular events distinct from those regulating changes in phospholipid metabolism, sugar transport and mitochondrial enzyme activities. It is postulated that exposure to phospholipase C forms diacylglycerol, which is phosphorylated to yield phosphatidate. The increased labelling of CMP-phosphatidate and phosphatidylinositol results from the conversion of phosphatidate into these lipids. The correlation between the effects of phospholipase C on phosphatidate synthesis and changes in adipose-tissue metabolism suggests the possibility that increased phosphatidate may directly or indirectly produce changes in membrane transport and enzyme activities. The pattern of phospholipid labelling produced by insulin, adenosine and oxytocin suggests that these stimuli may also increase phosphatidate synthesis, and, if so, changes in phospholipid metabolism could account for some of the metabolic actions of these stimuli. PMID:6411068

  14. The selective activation of the cardiac sarcolemmal sodium-calcium exchanger by plasmalogenic phosphatidic acid produced by phospholipase D.

    PubMed

    Hale, C C; Ebeling, E G; Hsu, F F; Ford, D A

    1998-01-30

    Since plasmalogens are the predominant phospholipid of cardiac sarcolemma, the activation of the sodium-calcium exchanger by either plasmenylethanolamine or plasmalogenic phosphatidic acid generated by phospholipase D was explored. Sodium-calcium exchange activity was 7-fold greater in proteoliposomes comprised of plasmenylethanolamine compared to proteoliposomes comprised of only plasmenylcholine. Phospholipase D treatment of proteoliposomes resulted in 1 mol % conversion of plasmenylcholine or phosphatidylcholine to their respective phosphatidic acid molecular species with a concomitant 8-fold or 2-fold activation of sodium-calcium exchange activity, respectfully. Thus, phospholipase D-mediated hydrolysis of plasmalogens to phosphatidic acid may be an important mechanism for the regulation of the sodium-calcium exchanger.

  15. Phosphatidic Acid Binds to Cytosolic Glyceraldehyde-3-phosphate Dehydrogenase and Promotes Its Cleavage in Arabidopsis *

    PubMed Central

    Kim, Sang-Chul; Guo, Liang; Wang, Xuemin

    2013-01-01

    Phosphatidic acid (PA) is a class of lipid messengers involved in a variety of physiological processes. To understand how PA mediates cell functions in plants, we used a PA affinity membrane assay to isolate PA-binding proteins from Camelina sativa followed by mass spectrometric sequencing. A cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPC) was identified to bind to PA, and detailed analysis was carried out subsequently using GAPC1 and GAPC1 from Arabidopsis. The PA and GAPC binding was abolished by the cation zinc whereas oxidation of GAPCs promoted the PA binding. PA had little impact on the GAPC catalytic activity in vitro, but the PA treatment of Arabidopsis seedlings induced proteolytic cleavage of GAPC2 and inhibited Arabidopsis seedling growth. The extent of PA inhibition was greater in GAPC-overexpressing than wild-type seedlings, but the greater PA inhibition was abolished by application of zinc to the seedling. The PA treatment also reduced the expression of genes involved in PA synthesis and utilization, and the PA-reduced gene expression was partially recovered by zinc treatment. These data suggest that PA binds to oxidized GAPDH and promotes its cleavage and that the PA and GAPC interaction may provide a signaling link coordinating carbohydrate and lipid metabolism. PMID:23504314

  16. Activation of phosphatidic acid metabolism of human erythrocyte membranes by perfringolysin O

    SciTech Connect

    Saito, M.; Ando, S.; Mitsui, K.; Homma, Y.; Takenawa, T.

    1986-05-29

    The effect of perfringolysin O on the lipid metabolism of human erythrocyte membranes was investigated. Erythrocytes were prelabeled with (/sup 3/H)arachidonic acid and (/sup 32/P)inorganic phosphate. In the presence of calcium ion (5.5 mM), the effect of perfringolysin O on lipid metabolism was very similar to that of an calcium-ionophore A23187. In the absence of calcium ion, the accumulation of phosphatidic acid and its following decreasing trend were observed during the reaction with the toxin. Such changes were not caused by filipin. These results suggest that perfringolysin O causes the activation of a diglyceride-phosphatidic acid cycle, which might be involved in the calcium transport.

  17. Characterization of a Soluble Phosphatidic Acid Phosphatase in Bitter Melon (Momordica charantia)

    PubMed Central

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C.; Ullah, Abul H. J.

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and Pi. PAPs are typically categorized into two subfamilies: Mg2+-dependent soluble PAP and Mg2+-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg2+-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53–60°C and unaffected by up to 0.3 mM MgCl2. The Km and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na3VO4, Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg2+-independent enzyme in plants. PMID:25203006

  18. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia).

    PubMed

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C; Ullah, Abul H J

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and P(i). PAPs are typically categorized into two subfamilies: Mg(2+)-dependent soluble PAP and Mg(2+)-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg(2+)-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53-60 °C and unaffected by up to 0.3 mM MgCl2. The K(m) and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na(3)VO(4), Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg(2+)-independent enzyme in plants.

  19. Phosphatidic acid phosphatase activity in subcellular fractions of normal and dystrophic human muscle.

    PubMed

    Kunze, D; Rüstow, B; Olthoff, D; Jung, K

    1985-03-15

    Biopsy samples from normal and dystrophic human muscle (Duchenne type) were fractionated by differential centrifugation and microsomes, mitochondria and cytosol were assayed for phosphatidic acid phosphatase (EC 3.1.3.4) and marker enzymes of mitochondria and cytosol. The activity of phosphatidic acid phosphatase was significantly lower in microsomes and higher in cytosol and mitochondria of dystrophic muscle than in the corresponding subcellular fractions of normal muscle. The results support an explanation of earlier findings that there is reduced G3P incorporation into diglycerides and phosphatidylcholine and a qualitative and quantitative change in the amount of phosphatidylcholine in dystrophic microsomes. The possible reasons for the reduction in the activity of only microsomal PA-P-ase were discussed.

  20. Altered Lipid Synthesis by Lack of Yeast Pah1 Phosphatidate Phosphatase Reduces Chronological Life Span.

    PubMed

    Park, Yeonhee; Han, Gil-Soo; Mileykovskaya, Eugenia; Garrett, Teresa A; Carman, George M

    2015-10-16

    In Saccharomyces cerevisiae, Pah1 phosphatidate phosphatase, which catalyzes the dephosphorylation of phosphatidate to yield diacylglycerol, plays a crucial role in the synthesis of the storage lipid triacylglycerol. This evolutionarily conserved enzyme also plays a negative regulatory role in controlling de novo membrane phospholipid synthesis through its consumption of phosphatidate. We found that the pah1Δ mutant was defective in the utilization of non-fermentable carbon sources but not in oxidative phosphorylation; the mutant did not exhibit major changes in oxygen consumption rate, mitochondrial membrane potential, F1F0-ATP synthase activity, or gross mitochondrial morphology. The pah1Δ mutant contained an almost normal complement of major mitochondrial phospholipids with some alterations in molecular species. Although oxidative phosphorylation was not compromised in the pah1Δ mutant, the cellular levels of ATP in quiescent cells were reduced by 2-fold, inversely correlating with a 4-fold increase in membrane phospholipids. In addition, the quiescent pah1Δ mutant cells had 3-fold higher levels of mitochondrial superoxide and cellular lipid hydroperoxides, had reduced activities of superoxide dismutase 2 and catalase, and were hypersensitive to hydrogen peroxide. Consequently, the pah1Δ mutant had a shortened chronological life span. In addition, the loss of Tsa1 thioredoxin peroxidase caused a synthetic growth defect with the pah1Δ mutation. The shortened chronological life span of the pah1Δ mutant along with its growth defect on non-fermentable carbon sources and hypersensitivity to hydrogen peroxide was suppressed by the loss of Dgk1 diacylglycerol kinase, indicating that the underpinning of pah1Δ mutant defects was the excess synthesis of membrane phospholipids.

  1. Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer

    PubMed Central

    Bruntz, Ronald C.; Lindsley, Craig W.

    2014-01-01

    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928

  2. Phospholipase D signaling pathways and phosphatidic acid as therapeutic targets in cancer.

    PubMed

    Bruntz, Ronald C; Lindsley, Craig W; Brown, H Alex

    2014-10-01

    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein-coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions.

  3. Darmstoff analogues. 3. Actions of choline esters of acetal phosphatidic acids on visceral smooth muscle.

    PubMed

    Marx, M H; Wiley, R A; Satchell, D G; Maguire, M H

    1989-06-01

    A number of naturally occurring phospholipids, e.g. the acetal phosphatidic acid derivatives that comprise Darmstoff (1) and the phosphatidylcholine derivative platelet activating factor (PAF), cause contraction of certain visceral smooth muscles and cause platelet activation. Because the Darmstoff phosphatidic acids and PAF are structurally similar, it was of interest to compare the biological actions of choline esters of Darmstoff with those of PAF and of the parent Darmstoff phosphatidic acids. To this end, [(2-pentadecyl-1,3-dioxolan-4-yl)methyl]phosphocholine (3a), [[2-(cis-8-heptadecenyl)-1,3-dioxolan-4-yl]methyl]phosphocho line (3b), and [[2-(cis-8-pentadecenyl)-1,3-dioxolan-4-yl]methyl]phosphocho line (3c) were synthesized. Compounds 3a, 3b, 3c, and PAF caused dose-dependent relaxation of taenia coli strips. In contrast, the unesterified materials 1a and 1b, as well as lyso-PAF, caused contraction in taenia coli strips. Thus, the contractile effect of Darmstoff is reversed on esterification with choline. In preparations of whole trachea, both 1a and 3a had contractile effects similar to those of PAF.

  4. The mechanistic and ergogenic effects of phosphatidic acid in skeletal muscle.

    PubMed

    Shad, Brandon James; Smeuninx, Benoit; Atherton, Philip James; Breen, Leigh

    2015-12-01

    Skeletal muscle mass plays a vital role in locomotion, whole-body metabolic health, and is a positive predictor of longevity. It is well established the mammalian target of rapamycin (mTOR) is a central regulator of skeletal muscle protein turnover. The pursuit to find novel nutrient compounds or functional food sources that possess the ability to activate mTOR and promote skeletal muscle protein accretion has been on going. Over the last decade, a key role has been proposed for the phospholipid phosphatidic acid (PA) in mTOR activation. Mechanical load-induced (i.e., resistance exercise) intramuscular PA can directly bind to and activate mTOR. In addition, PA provided exogenously in cell culture heightens mTOR activity, albeit indirectly. Thus, endogenously generated PA and exogenous provision of PA appear to act through distinct mechanisms that converge on mTOR and, potentially, may amplify muscle protein synthesis. In support of this notion, limited evidence from humans suggests that resistance exercise training combined with oral supplemental PA enhances strength gains and muscle hypertrophy. However, the precise mechanisms underpinning the augmented muscle remodelling response with supplemental PA remain elusive. In this review, we will critically examine available evidence from cell cultures and animal and human experimental models to provide an overview of the mechanisms through which endogenous and exogenous PA may act to promote muscle anabolism, and discuss the potential for PA as a therapeutic tool to maintain or restore skeletal muscle mass in the context of ageing and disease.

  5. Correlation of phospholipid structure with functional effects on the nicotinic acetylcholine receptor. A modulatory role for phosphatidic acid.

    PubMed Central

    Bhushan, A; McNamee, M G

    1993-01-01

    Fourier transform infrared spectroscopy is used to characterize specific interactions between negatively charged lipids, such as phosphatidic acid, and the purified nicotinic acetylcholine receptor from Torpedo californica. The specific interaction of phosphatidic acid with acetylcholine receptor is demonstrated by the receptor-induced perturbation of the lipid ionization state, which is monitored using Fourier transform infrared bands arising from the phosphate head group. The acetylcholine receptor shifts the pKa of phosphatidic acid molecules adjacent to the receptor to a lower value by almost 2 pH units from 8.5 to 6.6. Decreased pH also leads to changes in ion channel function and to changes in the secondary structure of the acetylcholine receptor in membranes containing ionizable phospholipids. Phospholipase D restores functional activity of acetylcholine receptor reconstituted in an unfavorable environment containing phosphatidylcholine by generating phosphatidic acid. Lipids such as phosphatidic acid may serve as allosteric effectors for membrane protein function and the lipid-protein interface could be a site for activity-dependent changes that lead to modulation of synaptic efficacy. PMID:8471723

  6. Saturated phosphatidic acids mediate saturated fatty acid-induced vascular calcification and lipotoxicity.

    PubMed

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M; Kuro-O, Makoto; Miyazaki, Makoto

    2015-10-26

    Recent evidence indicates that saturated fatty acid-induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification.

  7. Suppression of DS1 phosphatidic acid phosphatase confirms resistance to Ralstonia solanacearum in Nicotiana benthamiana.

    PubMed

    Nakano, Masahito; Nishihara, Masahiro; Yoshioka, Hirofumi; Takahashi, Hirotaka; Sawasaki, Tatsuya; Ohnishi, Kouhei; Hikichi, Yasufumi; Kiba, Akinori

    2013-01-01

    Nicotianabenthamiana is susceptible to Ralstonia solanacearum. To analyze molecular mechanisms for disease susceptibility, we screened a gene-silenced plant showing resistance to R. solanacearum, designated as DS1 (Disease suppression 1). The deduced amino acid sequence of DS1 cDNA encoded a phosphatidic acid phosphatase (PAP) 2. DS1 expression was induced by infection with a virulent strain of R. solanacearum in an hrp-gene-dependent manner. DS1 rescued growth defects of the temperature-sensitive ∆lpp1∆dpp1∆pah1 mutant yeast. Recombinant DS1 protein showed Mg(2+)-independent PAP activity. DS1 plants showed reduced PAP activity and increased phosphatidic acid (PA) content. After inoculation with R. solanacearum, DS1 plants showed accelerated cell death, over-accumulation of reactive oxygen species (ROS), and hyper-induction of PR-4 expression. In contrast, DS1-overexpressing tobacco plants showed reduced PA content, greater susceptibility to R. solanacearum, and reduced ROS production and PR-4 expression. The DS1 phenotype was partially compromised in the plants in which both DS1 and NbCoi1 or DS1 and NbrbohB were silenced. These results show that DS1 PAP may affect plant immune responses related to ROS and JA cascades via regulation of PA levels. Suppression of DS1 function or DS1 expression could rapidly activate plant defenses to achieve effective resistance against Ralstonia solanacearum.

  8. Transfer of phosphatidic acid from liposomes to cells is collision dependent

    SciTech Connect

    Longmuir, K.J.; Malinick, L.A.

    1989-03-01

    The kinetics of lipid transfer from unilamellar liposomes to cells in monolayer culture were determined for a fluorescent phosphatidic acid, 1-palmitoyl-2-(6-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)aminocaproyl) -sn-glycerol 3-phosphate (C6-NBD-PA), and for the analogous phosphatidic acid without the fluorescent NBD group, 1-palmitoyl-2-caproyl-sn-(U-14C) glycerol 3-phosphate (C6-(14C)PA). Initial rates of liposome-to-cell transfer were measured at 2 degrees C under conditions in which the concentration of diffusible monomer in the aqueous medium was constant during the course of an experiment and was independent of total liposome concentration. Rates were similar for C6-NBD-PA and C6-(14C)PA, indicating that the NBD group does not significantly alter the transfer kinetics. It was found that liposome-to-cell transfer was dependent on 1) the mole fraction of diffusible lipid in the liposomes, 2) the liposome concentration, and 3) the cell density. The dependence of rate on the liposome concentration (observed under conditions in which aqueous monomer concentration remained constant) cannot be explained by a liposome-to-cell transfer mechanism involving the free diffusion of monomers through the aqueous medium. Instead, the data are consistent with a collision-dependent mechanism of monomer transfer that occurs when liposome and cell membranes come into contact but do not fuse.

  9. Phosphatidic acid signaling mediates lung cytokine expression and lung inflammatory injury after hemorrhage in mice.

    PubMed

    Abraham, E; Bursten, S; Shenkar, R; Allbee, J; Tuder, R; Woodson, P; Guidot, D M; Rice, G; Singer, J W; Repine, J E

    1995-02-01

    Because phosphatidic acid (PA) pathway signaling may mediate many basic reactions involving cytokine-dependent responses, we investigated the effects of CT1501R, a functional inhibitor of the enzyme lysophosphatidic acid acyltransferase (LPAAT) which converts lysophosphatidic acid (Lyso-PA) to PA. We found that CT1501R treatment not only prevented hypoxia-induced PA increases and lyso-PA consumption in human neutrophils, but also prevented neutrophil chemotaxis and adherence in vitro, and lung injury and lung neutrophil accumulation in mice subjected to hemorrhage and resuscitation. In addition, CT1501R treatment prevented increases in mRNA levels and protein production of a variety of proinflammatory cytokines in multiple lung cell populations after blood loss and resuscitation. Our results indicate the fundamental role of PA metabolism in the development of acute inflammatory lung injury after blood loss.

  10. Molecular cloning of magnesium-independent type 2 phosphatidic acid phosphatases from airway smooth muscle.

    PubMed

    Tate, R J; Tolan, D; Pyne, S

    1999-07-01

    Members of the type 2 phosphatidic acid phosphatase (PAP2) family catalyse the dephosphorylation of phosphatidic acid (PA), lysophosphatidate and sphingosine 1-phosphate. Here, we demonstrate the presence of a Mg(2+)-independent and N-ethymaleimide-insensitive PAP2 activity in cultured guinea-pig airway smooth muscle (ASM) cells. Two PAP2 cDNAs of 923 and 926 base pairs were identified and subsequently cloned from these cells. The ORF of the 923 base pair cDNA encoded a protein of 285 amino acids (Mr = 32.1 kDa), which had 94% homology with human PAP2a (hPAP2a) and which probably represents a guinea-pig specific PAP2a (gpPAP2a1). The ORF of the 926 base pair cDNA encoded a protein of 286 amino acids (Mr = 32.1 kDa) which had 84% and 91% homology with hPAP2a and gpPAP2a1, respectively. This protein, termed gpPAP2a2, has two regions (aa 21-33 and 51-74) of marked divergence and altered hydrophobicity compared with hPAP2a and gpPAP2a1. This occurs in the predicted first and second transmembrane domains and at the extremes of the first outer loop. Other significant differences between gpPAP2a1/2 and hPAP2a, hPAP2b and hPAP2c occur at the cytoplasmic C-terminal. Transient expression of gpPAP2a2 in Cos-7 cells resulted in an approx. 4-fold increase in Mg(2+)-independent PAP activity, thereby confirming that gpPAP2a2 is another catalytically active member of an extended PAP2 family.

  11. Phosphatidic acid formation is required for extracellular ATP-mediated nitric oxide production in suspension-cultured tomato cells.

    PubMed

    Sueldo, Daniela J; Foresi, Noelia P; Casalongué, Claudia A; Lamattina, Lorenzo; Laxalt, Ana M

    2010-03-01

    *In animals and plants, extracellular ATP exerts its effects by regulating the second messengers Ca(2+), nitric oxide (NO) and reactive oxygen species (ROS). In animals, phospholipid-derived molecules, such as diacylglycerol, phosphatidic acid (PA) and inositol phosphates, have been associated with the extracellular ATP signaling pathway. The involvement of phospholipids in extracellular ATP signaling in plants, as it is established in animals, is unknown. *In vivo phospholipid signaling upon extracellular ATP treatment was studied in (32)P(i)-labeled suspension-cultured tomato (Solanum lycopersicum) cells. *Here, we report that, in suspension-cultured tomato cells, extracellular ATP induces the formation of the signaling lipid phosphatidic acid. Exogenous ATP at doses of 0.1 and 1 mM induce the formation of phosphatidic acid within minutes. Studies on the enzymatic sources of phosphatidic acid revealed the participation of both phospholipase D and C in concerted action with diacylglycerol kinase. *Our results suggest that extracellular ATP-mediated nitric oxide production is downstream of phospholipase C/diacylglycerol kinase activation.

  12. Rhabdomyolysis-Associated Mutations in Human LPIN1 Lead to Loss of Phosphatidic Acid Phosphohydrolase Activity.

    PubMed

    Schweitzer, George G; Collier, Sara L; Chen, Zhouji; Eaton, James M; Connolly, Anne M; Bucelli, Robert C; Pestronk, Alan; Harris, Thurl E; Finck, Brian N

    2015-01-01

    Rhabdomyolysis is an acute syndrome due to extensive injury of skeletal muscle. Recurrent rhabdomyolysis is often caused by inborn errors in intermediary metabolism, and recent work has suggested that mutations in the human gene encoding lipin 1 (LPIN1) may be a common cause of recurrent rhabdomyolysis in children. Lipin 1 dephosphorylates phosphatidic acid to form diacylglycerol (phosphatidic acid phosphohydrolase; PAP) and acts as a transcriptional regulatory protein to control metabolic gene expression. Herein, a 3-year-old boy with severe recurrent rhabdomyolysis was determined to be a compound heterozygote for a novel c.1904T>C (p.Leu635Pro) substitution and a previously reported genomic deletion of exons 18-19 (E766-S838_del) in LPIN1. Western blotting with patient muscle biopsy lysates demonstrated a marked reduction in lipin 1 protein, while immunohistochemical staining for lipin 1 showed abnormal subcellular localization. We cloned cDNAs to express recombinant lipin 1 proteins harboring pathogenic mutations and showed that the E766-S838_del allele was not expressed at the RNA or protein level. Lipin 1 p.Leu635Pro was expressed, but the protein was less stable, was aggregated in the cytosol, and was targeted for proteosomal degradation. Another pathogenic single amino acid substitution, lipin 1 p.Arg725His, was well expressed and retained its transcriptional regulatory function. However, both p.Leu635Pro and p.Arg725His proteins were found to be deficient in PAP activity. Kinetic analyses demonstrated a loss of catalysis rather than diminished substrate binding. These data suggest that loss of lipin 1-mediated PAP activity may be involved in the pathogenesis of rhabdomyolysis in lipin 1 deficiency.

  13. Phosphatidic acid is a major phospholipid class in reproductive organs of Arabidopsis thaliana.

    PubMed

    Yunus, Ian Sofian; Cazenave-Gassiot, Amaury; Liu, Yu-Chi; Lin, Ying-Chen; Wenk, Markus R; Nakamura, Yuki

    2015-01-01

    Phospholipids are the crucial components of biological membranes and signal transduction. Among different tissues, flower phospholipids are one of the least characterized features of plant lipidome. Here, we report that floral reproductive organs of Arabidopsis thaliana contain high levels of phosphatidic acid (PA), a known lipid second messenger. By using floral homeotic mutants enriched with specific floral organs, lipidomics study showed increased levels of PA species in ap3-3 mutant with enriched pistils. Accompanied gene expression study for 7 diacylglycerol kinases and 11 PA phosphatases revealed distinct floral organ specificity, suggesting an active phosphorylation/dephosphorylation between PA and diacylglycerol in flowers. Our results suggest that PA is a major phospholipid class in floral reproductive organs of A. thaliana.

  14. Insulin controls subcellular localization and multisite phosphorylation of the phosphatidic acid phosphatase, lipin 1.

    PubMed

    Harris, Thurl E; Huffman, Todd A; Chi, An; Shabanowitz, Jeffrey; Hunt, Donald F; Kumar, Anil; Lawrence, John C

    2007-01-05

    Brain, liver, kidney, heart, and skeletal muscle from fatty liver dystrophy (fld/fld) mice, which do not express lipin 1 (lipin), contained much less Mg(2+)-dependent phosphatidic acid phosphatase (PAP) activity than tissues from wild type mice. Lipin harboring the fld(2j) (Gly(84) --> Arg) mutation exhibited relatively little PAP activity. These results indicate that lipin is a major PAP in vivo and that the loss of PAP activity contributes to the fld phenotype. PAP activity was readily detected in immune complexes of lipin from 3T3-L1 adipocytes, where the protein was found both as a microsomal form and a soluble, more highly phosphorylated, form. Fifteen phosphorylation sites were identified by mass spectrometric analyses. Insulin increased the phosphorylation of multiple sites and promoted a gel shift that was due in part to phosphorylation of Ser(106). In contrast, epinephrine and oleic acid promoted dephosphorylation of lipin. The PAP-specific activity of lipin was not affected by the hormones or by dephosphorylation of lipin with protein phosphatase 1. However, the ratio of soluble to microsomal lipin was markedly increased in response to insulin and decreased in response to epinephrine and oleic acid. The results suggest that insulin and epinephrine control lipin primarily by changing localization rather than intrinsic PAP activity.

  15. Phosphatidic acid phosphatase and diacylglycerol acyltransferase: potential targets for metabolic engineering of microorganism oil.

    PubMed

    Jin, Hong-Hao; Jiang, Jian-Guo

    2015-04-01

    Oleaginous microorganism is becoming one of the most promising oil feedstocks for biodiesel production due to its great advantages in triglyceride (TAG) accumulation. Previous studies have shown that de novo TAG biosynthesis can be divided into two parts: the fatty acid biosynthesis pathway (the upstream part which generates acyl-CoAs) and the glycerol-3-phosphate acylation pathway (the downstream part in which three acyl groups are sequentially added onto a glycerol backbone). This review mainly focuses on two enzymes in the G3P pathway, phosphatidic acid phosphatase (PAP) and diacylglycerol acyltransferase (DGAT). The former catalyzes a dephosphorylation reaction, and the latter catalyzes a subsequent acylation reaction. Genes, functional motifs, transmembrane domains, action mechanism, and new studies of the two enzymes are discussed in detail. Furthermore, this review also covers diacylglycerol kinase, an enzyme that catalyzes the reverse reaction of diacylglycerol formation. In addition, PAP and DGAT are the conjunction points of the G3P pathway, the Kennedy pathway, and the CDP-diacylglycerol pathway (CDP-DAG pathway), and the mutual transformation between TAGs and phospholipids is discussed as well. Given that both the Kennedy and CDP-diacylglycerol pathways are in metabolic interlock (MI) with the G3P pathway, it is suggested that, via metabolic engineering, TAG accumulation can be improved by the two pathways based on the pivotal function of PAP and DGAT.

  16. The fusogenic lipid phosphatidic acid promotes the biogenesis of mitochondrial outer membrane protein Ugo1

    PubMed Central

    Keller, Michael; Taskin, Asli A.; Horvath, Susanne E.; Guan, Xue Li; Prinz, Claudia; Opalińska, Magdalena; Zorzin, Carina; van der Laan, Martin; Wenk, Markus R.; Schubert, Rolf; Wiedemann, Nils; Holzer, Martin

    2015-01-01

    Import and assembly of mitochondrial proteins depend on a complex interplay of proteinaceous translocation machineries. The role of lipids in this process has been studied only marginally and so far no direct role for a specific lipid in mitochondrial protein biogenesis has been shown. Here we analyzed a potential role of phosphatidic acid (PA) in biogenesis of mitochondrial proteins in Saccharomyces cerevisiae. In vivo remodeling of the mitochondrial lipid composition by lithocholic acid treatment or by ablation of the lipid transport protein Ups1, both leading to an increase of mitochondrial PA levels, specifically stimulated the biogenesis of the outer membrane protein Ugo1, a component of the mitochondrial fusion machinery. We reconstituted the import and assembly pathway of Ugo1 in protein-free liposomes, mimicking the outer membrane phospholipid composition, and found a direct dependency of Ugo1 biogenesis on PA. Thus, PA represents the first lipid that is directly involved in the biogenesis pathway of a mitochondrial membrane protein. PMID:26347140

  17. Phosphatidylcholine is a major source of phosphatidic acid and diacylglycerol in angiotensin II-stimulated vascular smooth-muscle cells.

    PubMed

    Lassègue, B; Alexander, R W; Clark, M; Akers, M; Griendling, K K

    1993-06-01

    In cultured vascular smooth-muscle cells, angiotensin II produces a sustained formation of diacylglycerol (DG) and phosphatidic acid (PtdOH). Since the fatty acid composition of these molecules is likely to determine their efficacy as second messengers, it is important to ascertain the phospholipid precursors and the biochemical pathways from which they are produced. Our experiments suggest that phospholipase D (PLD)-mediated phosphatidylcholine (PtdCho) hydrolysis is the major source of both DG and PtdOH during the late signalling phase. First, in cells labelled with [3H]myristate, which preferentially labels PtdCho, formation of [3H]PtdOH precedes formation of [3H]DG. Second, in contrast with phospholipase C (PLC) activation, DG mass accumulation is dependent on extracellular Ca2+. Similarly, DG mass accumulation is not attenuated by protein kinase C activation, which we have previously shown to inhibit the phosphoinositide-specific PLC. Third, the fatty acid composition of late-phase DG and PtdOH more closely resembles that of PtdCho than that of phosphatidylinositol. Finally, in cells labelled for a short time with [3H]glycerol, the radioactivity incorporated into [3H]DG and PtdOH was greater than that incorporated into PtdIns, but not into PtdCho. We found no evidence that synthesis de novo or phosphatidylethanolamine breakdown contributes to sustained DG and PtdOH formation. Thus, in angiotensin II-stimulated cultured vascular smooth-muscle cells, PLD-mediated PtdCho hydrolysis is the major source of sustained DG and PtdOH, whereas phosphoinositide breakdown is a minor contributor. Furthermore, PtdOH phosphohydrolase, which determines the relative levels of DG and PtdOH, appears to be regulated by protein kinase C. These results have important implications for the role of these second messengers in growth and contraction.

  18. The role of phosphoinositide 3-kinase and phosphatidic acid in the regulation of mammalian target of rapamycin following eccentric contractions.

    PubMed

    O'Neil, T K; Duffy, L R; Frey, J W; Hornberger, T A

    2009-07-15

    Resistance exercise induces a hypertrophic response in skeletal muscle and recent studies have begun to shed light on the molecular mechanisms involved in this process. For example, several studies indicate that signalling by the mammalian target of rapamycin (mTOR) is necessary for a hypertrophic response. Furthermore, resistance exercise has been proposed to activate mTOR signalling through an upstream pathway involving the phosphoinositide 3-kinase (PI3K) and protein kinase B (PKB); however, this hypothesis has not been thoroughly tested. To test this hypothesis, we first evaluated the temporal pattern of signalling through PI3K-PKB and mTOR following a bout of resistance exercise with eccentric contractions (EC). Our results indicated that the activation of signalling through PI3K-PKB is a transient event (<15 min), while the activation of mTOR is sustained for a long duration (>12 h). Furthermore, inhibition of PI3K-PKB activity did not prevent the activation of mTOR signalling by ECs, indicating that PI3K-PKB is not part of the upstream regulatory pathway. These observations led us to investigate an alternative pathway for the activation of mTOR signalling involving the synthesis of phosphatidic acid (PA) by phospholipase D (PLD). Our results demonstrate that ECs induce a sustained elevation in [PA] and inhibiting the synthesis of PA by PLD prevented the activation of mTOR. Furthermore, we determined that similar to ECs, PA activates mTOR signalling through a PI3K-PKB-independent mechanism. Combined, the results of this study indicate that the activation of mTOR following eccentric contractions occurs through a PI3K-PKB-independent mechanism that requires PLD and PA.

  19. Saturated phosphatidic acids mediate saturated fatty acid–induced vascular calcification and lipotoxicity

    PubMed Central

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L.; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M.; Kuro-o, Makoto; Miyazaki, Makoto

    2015-01-01

    Recent evidence indicates that saturated fatty acid–induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification. PMID:26517697

  20. Phosphatidic Acid Induces Ligand-independent Epidermal Growth Factor Receptor Endocytic Traffic through PDE4 Activation

    PubMed Central

    Norambuena, Andrés; Metz, Claudia; Jung, Juan E.; Silva, Antonia; Otero, Carolina; Cancino, Jorge; Retamal, Claudio; Valenzuela, Juan C.; Soza, Andrea

    2010-01-01

    Endocytosis modulates EGFR function by compartmentalizing and attenuating or enhancing its ligand-induced signaling. Here we show that it can also control the cell surface versus intracellular distribution of empty/inactive EGFR. Our previous observation that PKA inhibitors induce EGFR internalization prompted us to test phosphatidic acid (PA) generated by phospholipase D (PLD) as an endogenous down-regulator of PKA activity, which activates rolipram-sensitive type 4 phosphodiesterases (PDE4) that degrade cAMP. We found that inhibition of PA hydrolysis by propranolol, in the absence of ligand, provokes internalization of inactive (neither tyrosine-phosphorylated nor ubiquitinated) EGFR, accompanied by a transient increase in PA levels and PDE4s activity. This EGFR internalization is mimicked by PA micelles and is strongly counteracted by PLD2 silencing, rolipram or forskolin treatment, and PKA overexpression. Accelerated EGFR endocytosis seems to be mediated by clathrin-dependent and -independent pathways, leading to receptor accumulation in juxtanuclear recycling endosomes, also due to a decreased recycling. Internalized EGFR can remain intracellular without degradation for several hours or return rapidly to the cell surface upon discontinuation of the stimulus. This novel regulatory mechanism of EGFR, also novel function of signaling PA, can transmodulate receptor accessibility in response to heterologous stimuli. PMID:20554760

  1. Diacylglycerol Kinases: Shaping Diacylglycerol and Phosphatidic Acid Gradients to Control Cell Polarity

    PubMed Central

    Baldanzi, Gianluca; Bettio, Valentina; Malacarne, Valeria; Graziani, Andrea

    2016-01-01

    Diacylglycerol kinases (DGKs) terminate diacylglycerol (DAG) signaling and promote phosphatidic acid (PA) production. Isoform specific regulation of DGKs activity and localization allows DGKs to shape the DAG and PA gradients. The capacity of DGKs to constrain the areas of DAG signaling is exemplified by their role in defining the contact interface between T cells and antigen presenting cells: the immune synapse. Upon T cell receptor engagement, both DGK α and ζ metabolize DAG at the immune synapse thus constraining DAG signaling. Interestingly, their activity and localization are not fully redundant because DGKζ activity metabolizes the bulk of DAG in the cell, whereas DGKα limits the DAG signaling area localizing specifically at the periphery of the immune synapse. When DGKs terminate DAG signaling, the local PA production defines a new signaling domain, where PA recruits and activates a second wave of effector proteins. The best-characterized example is the role of DGKs in protrusion elongation and cell migration. Indeed, upon growth factor stimulation, several DGK isoforms, such as α, ζ, and γ, are recruited and activated at the plasma membrane. Here, local PA production controls cell migration by finely modulating cytoskeletal remodeling and integrin recycling. Interestingly, DGK-produced PA also controls the localization and activity of key players in cell polarity such as aPKC, Par3, and integrin β1. Thus, T cell polarization and directional migration may be just two instances of the general contribution of DGKs to the definition of cell polarity by local specification of membrane identity signaling. PMID:27965956

  2. Phosphatidic acid stimulates cardiac KATP channels like phosphatidylinositols, but with novel gating kinetics.

    PubMed

    Fan, Zheng; Gao, Lizhi; Wang, Wenxia

    2003-01-01

    Membrane-bound anionic phospholipids such as phosphatidylinositols have the capacity to modulate ATP-sensitive potassium (K(ATP)) channels through a mechanism involving long-range electrostatic interaction between the lipid headgroup and channel. However, it has not yet been determined whether the multiple effects of phosphatidylinositols reported in the literature all result from this general electrostatic interaction or require a specific headgroup structure. The present study investigated whether phosphatidic acid (PA), an anionic phospholipid substantially different in structure from phosphatidylinositols, evokes effects similar to phosphatidylinositols on native K(ATP) channels of rat heart and heterogeneous Kir6.2/SUR2A channels. Channels treated with PA (0.2-1 mg/ml applied to the cytoplasmic side of the membrane) exhibited higher activity, lower sensitivity to ATP inhibition, less Mg(2+)-dependent nucleotide stimulation, and poor sulfonylurea inhibition. These effects match the spectrum of phosphatidylinositols' effects, but, in addition, PA also induced a novel pattern in gating kinetics, represented by a decreased mean open time (from 12.2 +/- 2.0 to 3.3 +/- 0.7 ms). This impact on gating kinetics clearly distinguishes PA's effects from those of phosphatidylinositols. Results indicate that multiple effects of anionic phospholipids on K(ATP) channels are related phenomena and can likely be attributed to a common mechanism, but additional specific effects due to other mechanisms may also coincide.

  3. Phosphatidic Acid Produced by Phospholipase D Promotes RNA Replication of a Plant RNA Virus

    PubMed Central

    Hyodo, Kiwamu; Taniguchi, Takako; Manabe, Yuki; Kaido, Masanori; Mise, Kazuyuki; Sugawara, Tatsuya; Taniguchi, Hisaaki; Okuno, Tetsuro

    2015-01-01

    Eukaryotic positive-strand RNA [(+)RNA] viruses are intracellular obligate parasites replicate using the membrane-bound replicase complexes that contain multiple viral and host components. To replicate, (+)RNA viruses exploit host resources and modify host metabolism and membrane organization. Phospholipase D (PLD) is a phosphatidylcholine- and phosphatidylethanolamine-hydrolyzing enzyme that catalyzes the production of phosphatidic acid (PA), a lipid second messenger that modulates diverse intracellular signaling in various organisms. PA is normally present in small amounts (less than 1% of total phospholipids), but rapidly and transiently accumulates in lipid bilayers in response to different environmental cues such as biotic and abiotic stresses in plants. However, the precise functions of PLD and PA remain unknown. Here, we report the roles of PLD and PA in genomic RNA replication of a plant (+)RNA virus, Red clover necrotic mosaic virus (RCNMV). We found that RCNMV RNA replication complexes formed in Nicotiana benthamiana contained PLDα and PLDβ. Gene-silencing and pharmacological inhibition approaches showed that PLDs and PLDs-derived PA are required for viral RNA replication. Consistent with this, exogenous application of PA enhanced viral RNA replication in plant cells and plant-derived cell-free extracts. We also found that a viral auxiliary replication protein bound to PA in vitro, and that the amount of PA increased in RCNMV-infected plant leaves. Together, our findings suggest that RCNMV hijacks host PA-producing enzymes to replicate. PMID:26020241

  4. Dependence on the Lazaro phosphatidic acid phosphatase for the maximum light response.

    PubMed

    Kwon, Young; Montell, Craig

    2006-04-04

    The Drosophila phototransduction cascade serves as a paradigm for characterizing the regulation of sensory signaling and TRP channels in vivo . Activation of these channels requires phospholipase C (PLC) and may depend on subsequent production of diacylglycerol (DAG) and downstream metabolites . DAG could potentially be produced through a second pathway involving the combined activities of a phospholipase D (PLD) and a phosphatidic acid (PA) phosphatase (PAP). However, a role for a PAP in the regulation of TRP channels has not been described. Here, we report the identification of a PAP, referred to as Lazaro (Laza). Mutations in laza caused a reduction in the light response and faster termination kinetics. Loss of laza suppressed the severity of the phenotype caused by mutation of the DAG kinase, RDGA , indicating that Laza functions in opposition to RDGA. We also showed that the retinal degeneration resulting from overexpression of the PLD was suppressed by elimination of Laza. These data demonstrate a requirement for a PLD/PAP-dependent pathway for achieving the maximal light response. The genetic interactions with both rdgA and Pld indicate that Laza functions in the convergence of both PLC- and PLD-coupled signaling in vivo.

  5. Mechanisms of xylanase-induced nitric oxide and phosphatidic acid production in tomato cells.

    PubMed

    Lanteri, M Luciana; Lamattina, Lorenzo; Laxalt, Ana M

    2011-10-01

    The second messenger nitric oxide (NO), phosphatidic acid (PA) and reactive oxygen species (ROS) are involved in the plant defense response during plant-pathogen interactions. NO has been shown to participate in PA production in response to the pathogen-associated molecular pattern xylanase in tomato cell suspensions. Defense responses downstream of PA include ROS production. The goal of this work was to study the signaling mechanisms involved in PA production during the defense responses triggered by xylanase and mediated by NO in the suspension-cultured tomato cells. We analyzed the participation of protein kinases, guanylate cyclase and the NO-mediated posttranslational modification S-nitrosylation, by means of pharmacology and biochemistry. We showed that NO, PA and ROS levels are significantly diminished by treatment with the general protein kinase inhibitor staurosporine. This indicates that xylanase-induced protein phosphorylation events might be the important components leading to NO formation, and hence for the downstream regulation of PA and ROS levels. When assayed, a guanylate cyclase inhibitor or a cGMP analog did not alter the PA accumulation. These results suggest that a cGMP-mediated pathway is not involved in xylanase-induced PA formation. Finally, the inhibition of protein S-nitrosylation did not affect NO formation but compromised PA and ROS production. Data collectively indicate that upon xylanase perception, cells activate a protein kinase pathway required for NO formation and that, S-nitrosylation-dependent mechanisms are involved in downstream signaling leading to PA and ROS.

  6. High specificity of human secretory class II phospholipase A2 for phosphatidic acid.

    PubMed

    Snitko, Y; Yoon, E T; Cho, W

    1997-02-01

    Lysophosphatidic acid (LPA) is a potent lipid second messenger which stimulates platelet aggregation, cell proliferation and smooth-muscle contraction. The phospholipase A2 (PLA2)-catalysed hydrolysis of phosphatidic acid (PA) is thought to be a primary synthetic route for LPA. Of the multiple forms of PLA2 present in human tissues, human secretory class-II PLA2 (hs-PLA2) has been implicated in the production of LPA from platelets and whole blood cells challenged with inflammatory stimuli. To explore further the possibility that hs-PLA2 is involved in the production of LPA, we rigorously measured the phospholipid head group specificity of hs-PLA2 by a novel PLA2 kinetic system using polymerized mixed liposomes. Kinetic analysis of recombinant hs-PLA2 demonstrates that hs-PLA2 strongly prefers PA as substrate over other phospholipids found in the mammalian plasma membrane including phosphatidylserine (PS), phosphatidylcholine (PC) and phosphatidylethanolamine (PE). The order of preference is PA > PE approximately PS > PC. To identify amino acid residues of hs-PLA2 that are involved in its unique substrate specificity, we mutated two residues, Glu-56 and Lys-69, which were shown to interact with the phospholipid head group in the X-ray-crystallographic structure of the hs-PLA2-transition-state-analogue complex. The K69Y mutant showed selective inactivation toward PA whereas the E56K mutant displayed a most pronounced inactivation to PE. Thus it appears that Lys-69 is at least partially involved in the PA specificity of hs-PLA2 and Glu-56 in the distinction between PE and PC. In conjunction with a recent cell study [Fourcade, Simon, Viode, Rugani, Leballe, Ragab, Fournie, Sarda and Chap (1995) Cell 80, 919-927], these studies suggest that hs-PLA2 can rapidly hydrolyse PA molecules exposed to the outer layer of cell-derived microvesicles and thereby produce LPA.

  7. Phosphatidylinositol and phosphatidic acid transport between the ER and plasma membrane during PLC activation requires the Nir2 protein.

    PubMed

    Kim, Yeun Ju; Guzman-Hernandez, Maria Luisa; Wisniewski, Eva; Echeverria, Nicolas; Balla, Tamas

    2016-02-01

    Phospholipase C (PLC)-mediated hydrolysis of the limited pool of plasma membrane (PM) phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] requires replenishment from a larger pool of phosphatidylinositol (PtdIns) via sequential phosphorylation by PtdIns 4-kinases and phosphatidylinositol 4-phosphate (PtdIns4P) 5-kinases. Since PtdIns is synthesized in the endoplasmic reticulum (ER) and PtdIns(4,5)P2 is generated in the PM, it has been postulated that PtdIns transfer proteins (PITPs) provide the means for this lipid transfer function. Recent studies identified the large PITP protein, Nir2 as important for PtdIns transfer from the ER to the PM. It was also found that Nir2 was required for the transfer of phosphatidic acid (PtdOH) from the PM to the ER. In Nir2-depleted cells, activation of PLC leads to PtdOH accumulation in the PM and PtdIns synthesis becomes severely impaired. In quiescent cells, Nir2 is localized to the ER via interaction of its FFAT domain with ER-bound VAMP-associated proteins VAP-A and-B. After PLC activation, Nir2 also binds to the PM via interaction of its C-terminal domains with diacylglycerol (DAG) and PtdOH. Through these interactions, Nir2 functions in ER-PM contact zones. Mutations in VAP-B that have been identified in familial forms of amyotrophic lateral sclerosis (ALS or Lou-Gehrig's disease) cause aggregation of the VAP-B protein, which then impairs its binding to several proteins, including Nir2. These findings have shed new lights on the importance of non-vesicular lipid transfer of PtdIns and PtdOH in ER-PM contact zones with a possible link to a devastating human disease.

  8. Phosphatidic acid enhances mTOR signaling and resistance exercise induced hypertrophy

    PubMed Central

    2014-01-01

    Introduction The lipid messenger phosphatidic acid (PA) plays a critical role in the stimulation of mTOR signaling. However, the mechanism by which PA stimulates mTOR is currently unknown. Therefore, the purpose of this study was to compare the effects of various PA precursors and phospholipids on their ability to stimulate mTOR signaling and its ability to augment resistance training-induced changes in body composition and performance. Methods In phase one, C2C12 myoblasts cells were stimulated with different phospholipids and phospholipid precursors derived from soy and egg sources. The ratio of phosphorylated p70 (P-p70-389) to total p70 was then used as readout for mTOR signaling. In phase two, resistance trained subjects (n = 28, 21 ± 3 years, 77 ± 4 kg, 176 ± 9 cm) consumed either 750 mg PA daily or placebo and each took part in an 8 week periodized resistance training program. Results In phase one, soy-phosphatidylserine, soy-Lyso-PA, egg-PA, and soy-PA stimulated mTOR signaling, and the effects of soy-PA (+636%) were significantly greater than egg-PA (+221%). In phase two, PA significantly increased lean body mass (+2.4 kg), cross sectional area (+1.0 cm), and leg press strength (+51.9 kg) over placebo. Conclusion PA significantly activates mTOR and significantly improved responses in skeletal muscle hypertrophy, lean body mass, and maximal strength to resistance exercise. PMID:24959196

  9. Activation of Src and release of intracellular calcium by phosphatidic acid during Xenopus laevis fertilization.

    PubMed

    Bates, Ryan C; Fees, Colby P; Holland, William L; Winger, Courtney C; Batbayar, Khulan; Ancar, Rachel; Bergren, Todd; Petcoff, Douglas; Stith, Bradley J

    2014-02-01

    We report a new step in the fertilization in Xenopus laevis which has been found to involve activation of Src tyrosine kinase to stimulate phospholipase C-γ (PLC-γ) which increases inositol 1,4,5-trisphosphate (IP3) to release intracellular calcium ([Ca](i)). Molecular species analysis and mass measurements suggested that sperm activate phospholipase D (PLD) to elevate phosphatidic acid (PA). We now report that PA mass increased 2.7 fold by 1 min after insemination and inhibition of PA production by two methods inhibited activation of Src and PLCγ, increased [Ca](i) and other fertilization events. As compared to 14 other lipids, PA specifically bound Xenopus Src but not PLCγ. Addition of synthetic PA activated egg Src (an action requiring intact lipid rafts) and PLCγ as well as doubling the amount of PLCγ in rafts. In the absence of elevated [Ca](i), PA addition elevated IP3 mass to levels equivalent to that induced by sperm (but twice that achieved by calcium ionophore). Finally, PA induced [Ca](i) release that was blocked by an IP3 receptor inhibitor. As only PLD1b message was detected, and Western blotting did not detect PLD2, we suggest that sperm activate PLD1b to elevate PA which then binds to and activates Src leading to PLCγ stimulation, IP3 elevation and [Ca](i) release. Due to these and other studies, PA may also play a role in membrane fusion events such as sperm-egg fusion, cortical granule exocytosis, the elevation of phosphatidylinositol 4,5-bisphosphate and the large, late increase in sn 1,2-diacylglycerol in fertilization.

  10. Studies on the formation by rat brain preparations of CDP-diglyceride from CTP and phosphatidic acids of varying fatty acid compositions.

    PubMed

    Bishop, H H; Strickland, K P

    1976-03-01

    The enzyme, CTP:phosphatidate cytidylyltransferase (EC2.7.7.41) which catalyses formation of CDP-diglyceride from CTP and phosphatidic acid has been studied in rat brain preparations and other tissues. Improvement, as judged by the higher tissue activities obtained, in the assay method for this enzyme was achieved through use of phosphatidic acids sonicated in buffer-detergent solution saturated with ether and containing bovine serum albumin and use of short incubation times which essentially provided a measure of initial rates. The enzyme of rat brain microsomes yielded with 1,2-dioleolphosphatidic acid as substrate a pH optimum of 6.8 with maleate buffer and optimal concentrations of 60mM for MG2+, 6MM for CTP and 250 mug per 0.8 ml for phosphatidic acid. Enzyme activity was mainly located in the 90,000 X g fraction (microsomal) with small but significant activity in the 12,000 X g fraction. Comparison of activities (nanomoles CTP incorporated per milligram protein per minute) amongst tissues showed the following order: brain, 1.87; liver, 1.32; lung, 1.19; small intestine, 1.00; kidney, 0.69; heart, 0.41; diaphragm, 0.07; skeletal muscle, 0.02. Examination of the effect of varying the fatty acid composition in the phosphatidic acids added exogenously gave the following order (activities in parentheses); 1-stearoyl-2-oleoyl- (5.58), 1-oleoyl-2-stearoyl- (5.37), 1,2-dioleoyl- (4.49) 1-palmitoyl-2-oleoyl-(3.85), 1-stearoyl-2-arachidonoyl-(3.31), 1-arachidonoyl-2-stearoyl-(3.16), 1,2-diarachidonoyl-(0.72), 1,2-dicaproyl-(0.67), 1,2-dipalmitoyl-(0.67) and 1,2-distearoyl-(0.18). The single bis- and lysophosphatidic acids tested were inactive as substrates. Apart from a possible preference for one or more unsaturated fatty acids the transferase enzyme showed no selectivity in respect to the fatty acid distribution of phosphatidic acids.

  11. Phosphatidic acid increases intracellular free Ca2+ and cardiac contractile force.

    PubMed

    Xu, Y J; Panagia, V; Shao, Q; Wang, X; Dhalla, N S

    1996-08-01

    Although phosphatidic acid (PA) is mainly formed due to the hydrolysis of phosphatidylcholine by myocardial phospholipase D, its functional significance in the heart is not fully understood. The present study was designed to determine the effects of PA on intracellular free Ca2+ level ([Ca2+]i) in freshly isolated adult rat cardiomyocytes by using fura 2-acextoxmethylester and free fura 2 technique. Addition of PA at concentrations of 1-200 microM produced a concentration-dependent increase in [Ca2+]i from the basal level of 117 +/- 8 nM; maximal increase in [Ca2+]i was 233 +/- 50 nM, whereas median effective concentration (EC50) for PA was 45 +/- 1.2 microM. This increase in [Ca2+]i was abolished by the removal of extracellular Ca2+ with ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid and was partially attenuated by Ca2+ channel blockers, verapamil or diltiazem. Preincubation of cardiomyocytes with cyclopiazonic acid and thapsigargin or with ryanodine [to deplete sarcoplasmic reticulum (SR) Ca2+] attenuated the PA-induced increase in [Ca2+]i by 66, 37, and 43%, respectively. Furthermore, the response of [Ca2+]i to PA was blunted by 2-nitro-4 carboxyphenylcarbonate, an inhibitor of phospholipase C, but was unaffected by staurosporine, a protein kinase C inhibitor. PA was also observed to induce Ca2+ efflux from the myocytes. In addition, an injection of PA (0.34 microgram/100 g body wt i.v.) in rats produced a significant increase of the left ventricular developed pressure as well as the maximum rates of cardiac contraction and relaxation within 5 min. These data suggest that the PA-induced increase in [Ca2+]i in cardiomyocytes is a consequence of both Ca2+ influx from the extracellular source and Ca2+ release from the intracellular SR stores. Furthermore, these in vitro data suggest the possibility that PA may regulate [Ca2+]i and contractile parameters in the heart.

  12. Effects of phosphatidic acid supplementation on muscle thickness and strength in resistance-trained men.

    PubMed

    Gonzalez, Adam M; Sell, Katie M; Ghigiarelli, Jamie J; Kelly, Christopher F; Shone, Edward W; Accetta, Matthew R; Baum, Jamie B; Mangine, Gerald T

    2017-04-01

    The purpose of this study was to investigate the effects of phosphatidic acid (PA) supplementation on muscle thickness and strength following an 8 week supervised resistance-training program. Fifteen resistance trained men (22.8 ± 3.5 years; 80.6 ± 8.7 kg; 178.1 ± 5.6 cm; 14.6% ± 8.8% body fat) were randomly assigned to a group that either consumed 750 mg of PA or a placebo (PL). Testing was carried out before (PRE) and after (POST) training/supplementation for muscle thickness and strength. Muscle thickness of the rectus femoris (RF), vastus lateralis (VL), biceps brachii (BB), and triceps brachii (TB) muscles were measured via ultrasonography, along with 1 repetition maximum (1RM) of squat, deadlift, and bench press. Analysis of covariance (ANCOVA), using PRE values as the covariate, did not reveal any group differences for measures of muscle thickness in the RF (PA: 3.6% ± 5.2%; PL: 3.2% ± 4.2%, p = 0.97), VL (PA: 23.4% ± 18.1%, PL: 12.5% ± 15.4%, p = 0.37), BB (PA: 3.7% ± 6.4%, PL: 9.6% ± 12.4%, p = 0.86), or TB (PA: 15.1% ± 17.9%, PL: 10.7% ± 19.3%, p = 0.79). Likewise, no group differences were observed in changes in squat (PA: 8.4% ± 4.1%, PL: 8.1% ± 4.2%, p = 0.79), deadlift (PA: 10.1% ± 10.1%, PL: 8.9% ± 9.5%, p = 0.66), or bench press (PA: 5.7% ± 5.5%, PL: 5.1% ± 3.0%, p = 0.76) exercises. Collectively, however, all participants experienced significant (p < 0.05) improvements in each measure of muscle thickness and strength. Results of this study suggest that PA supplementation, in combination with a 3 days·week(-1) resistance-training program for 8 weeks, did not have a differential effect compared with PL on changes in muscle thickness or 1RM strength.

  13. A HPLC-fluorescence detection method for determination of phosphatidic acid phosphohydrolase activity: application in human myocardium.

    PubMed

    Burgdorf, Christof; Prey, Antje; Richardt, Gert; Kurz, Thomas

    2008-03-15

    Phosphatidic acid phosphohydrolase (PAP) catalyzes the dephosphorylation of phosphatidic acid (PA) to diacylglycerol, the second messenger responsible for activation of protein kinase C. Despite the crucial role of PAP lipid signaling, there are no data on PAP signaling function in the human heart. Here we present a nonradioactive assay for the investigation of PAP activity in human myocardium using a fluorescent derivative of PA, 2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphate (BODIPY-PA), as substrate in an in vitro PAP-catalyzed reaction. Unreacted BODIPY-PA was resolved from the PAP products by a binary gradient HPLC system and BODIPY-diacylglycerol was detected by fluorimetry. The reaction proceeded at a linear rate for up to 60 min and increased linearly with increasing amounts of cardiac protein in a range of 0.25 to 8.0 microg. This assay proved to be sensitive for accurate quantitation of total PAP activity, PAP-1 activity, and PAP-2 activity in human atrial tissue and right ventricular endomyocardial biopsies. Total PAP activity was approximately fourfold higher in ventricular myocardium than in atrial tissue. There was negligible PAP-1 activity in atrial myocardium compared with ventricular myocardium, indicating regional differences in activities and distribution pattern of PAP-1 and PAP-2 in the human heart.

  14. Raf-1 kinase possesses distinct binding domains for phosphatidylserine and phosphatidic acid. Phosphatidic acid regulates the translocation of Raf-1 in 12-O-tetradecanoylphorbol-13-acetate-stimulated Madin-Darby canine kidney cells.

    PubMed

    Ghosh, S; Strum, J C; Sciorra, V A; Daniel, L; Bell, R M

    1996-04-05

    Previous studies demonstrated that the cysteine-rich amino-terminal domain of Raf-1 kinase interacts selectively with phosphatidylserine (Ghosh, S., Xie, W. Q., Quest, A. F. G., Mabrouk, G. M., Strum, J. C., and Bell, R. M. (1994) J. Biol. Chem. 269, 10000-10007). Further analysis showed that full-length Raf-1 bound to both phosphatidylserine and phosphatidic acid (PA). Specifically, a carboxyl-terminal domain of Raf-1 kinase (RafC; residues 295 648 of human Raf-1) interacted strongly with phosphatidic acid. The binding of RafC to PA displayed positive cooperativity with Hill numbers between 3.3 and 6.2; the apparent Kd ranged from 4.9 +/- 0.6 to 7.8 +/- 0.9 mol % PA. The interaction of RafC with PA displayed a pH dependence distinct from the interaction between the cysteine-rich domain of Raf-1 and PA. Also, the RafC-PA interaction was unaffected at high ionic strength. Of all the lipids tested, only PA and cardiolipin exhibited high affinity binding; other acidic lipids were either ineffective or weakly effective. By deletion mutagenesis, the PA binding site within RafC was narrowed down to a 35-amino acid segment between residues 389 and 423. RafC did not bind phosphatidyl alcohols; also, inhibition of PA formation in Madin-Darby canine kidney cells by treatment with 1% ethanol significantly reduced the translocation of Raf-1 from the cytosol to the membrane following stimulation with 12-O-tetradecanoylphorbol-13-acetate. These results suggest a potential role of the lipid second messenger, PA, in the regulation of translocation and subsequent activation of Raf-1 in vivo.

  15. Overexpression of a phosphatidic acid phosphatase type 2 leads to an increase in triacylglycerol production in oleaginous Rhodococcus strains.

    PubMed

    Hernández, Martín A; Comba, Santiago; Arabolaza, Ana; Gramajo, Hugo; Alvarez, Héctor M

    2015-03-01

    Oleaginous Rhodococcus strains are able to accumulate large amounts of triacylglycerol (TAG). Phosphatidic acid phosphatase (PAP) enzyme catalyzes the dephosphorylation of phosphatidic acid (PA) to yield diacylglycerol (DAG), a key precursor for TAG biosynthesis. Studies to establish its role in lipid metabolism have been mainly focused in eukaryotes but not in bacteria. In this work, we identified and characterized a putative PAP type 2 (PAP2) encoded by the ro00075 gene in Rhodococcus jostii RHA1. Heterologous expression of ro00075 in Escherichia coli resulted in a fourfold increase in PAP activity and twofold in DAG content. The conditional deletion of ro00075 in RHA1 led to a decrease in the content of DAG and TAG, whereas its overexpression in both RHA1 and Rhodococcus opacus PD630 promoted an increase up to 10 to 15 % by cellular dry weight in TAG content. On the other hand, expression of ro00075 in the non-oleaginous strain Rhodococcus fascians F7 promoted an increase in total fatty acid content up to 7 % at the expense of free fatty acid (FFA), DAG, and TAG fractions. Moreover, co-expression of ro00075/atf2 genes resulted in a fourfold increase in total fatty acid content by a further increase of the FFA and TAG fractions. The results of this study suggest that ro00075 encodes for a PAP2 enzyme actively involved in TAG biosynthesis. Overexpression of this gene, as single one or with an atf gene, provides an alternative approach to increase the biosynthesis and accumulation of bacterial oils as a potential source of raw material for biofuel production.

  16. A 25-Amino Acid Sequence of the Arabidopsis TGD2 Protein Is Sufficient for Specific Binding of Phosphatidic Acid*

    PubMed Central

    Lu, Binbin; Benning, Christoph

    2009-01-01

    Genetic analysis suggests that the TGD2 protein of Arabidopsis is required for the biosynthesis of endoplasmic reticulum derived thylakoid lipids. TGD2 is proposed to be the substrate-binding protein of a presumed lipid transporter consisting of the TGD1 (permease) and TGD3 (ATPase) proteins. The TGD1, -2, and -3 proteins are localized in the inner chloroplast envelope membrane. TGD2 appears to be anchored with an N-terminal membrane-spanning domain into the inner envelope membrane, whereas the C-terminal domain faces the intermembrane space. It was previously shown that the C-terminal domain of TGD2 binds phosphatidic acid (PtdOH). To investigate the PtdOH binding site of TGD2 in detail, the C-terminal domain of the TGD2 sequence lacking the transit peptide and transmembrane sequences was fused to the C terminus of the Discosoma sp. red fluorescent protein (DR). This greatly improved the solubility of the resulting DR-TGD2C fusion protein following production in Escherichia coli. The DR-TGD2C protein bound PtdOH with high specificity, as demonstrated by membrane lipid-protein overlay and liposome association assays. Internal deletion and truncation mutagenesis identified a previously undescribed minimal 25-amino acid fragment in the C-terminal domain of TGD2 that is sufficient for PtdOH binding. Binding characteristics of this 25-mer were distinctly different from those of TGD2C, suggesting that additional sequences of TGD2 providing the proper context for this 25-mer are needed for wild type-like PtdOH binding. PMID:19416982

  17. A Novel Phosphatidic Acid-Protein-tyrosine Phosphatase D2 Axis Is Essential for ERBB2 Signaling in Mammary Epithelial Cells*

    PubMed Central

    Ramesh, Mathangi; Krishnan, Navasona; Muthuswamy, Senthil K.; Tonks, Nicholas K.

    2015-01-01

    We used a loss-of-function screen to investigate the role of classical protein-tyrosine phosphatases (PTPs) in three-dimensional mammary epithelial cell morphogenesis and ERBB2 signaling. The study revealed a novel role for PTPD2 as a positive regulator of ERBB2 signaling. Suppression of PTPD2 attenuated the ERBB2-induced multiacinar phenotype in three-dimensional cultures specifically by inhibiting ERBB2-mediated loss of polarity and lumen filling. In contrast, overexpression of PTPD2 enhanced the ERBB2 phenotype. We also found that a lipid second messenger, phosphatidic acid, bound PTPD2 in vitro and enhanced its catalytic activity. Small molecule inhibitors of phospholipase D (PLD), an enzyme that produces phosphatidic acid in cells, also attenuated the ERBB2 phenotype. Exogenously added phosphatidic acid rescued the PLD-inhibition phenotype, but only when PTPD2 was present. These findings illustrate a novel pathway involving PTPD2 and the lipid second messenger phosphatidic acid that promotes ERBB2 function. PMID:25681440

  18. Agonist-induced production of 1,2-diacylglycerol and phosphatidic acid in intact resistance arteries. Evidence that accumulation of diacylglycerol is not a prerequisite for contraction.

    PubMed

    Ohanian, J; Ollerenshaw, J; Collins, P; Heagerty, A

    1990-05-25

    The production of total amounts of 1,2-diacylglycerol as well as those specifically derived from inositol lipid hydrolysis was studied in intact rat resistance arteries stimulated with either noradrenaline, vasopressin, or angiotensin II at 20 s when the onset of contraction would be nearing its maximum, and at 5 min during the sustained phase of contraction. Total amounts of 1,2-diacylglycerol were not altered by any agonist at 20 s, or at 5 min. However, arachidonate-containing species of 1,2-diacylglycerol were differentially influenced being increased at 5 min by noradrenaline, and decreased at 20 s and 5 min by vasopressin. Only angiotensin II produced substantial increases in this class of 1,2-diacylglycerol at both time points. In order to investigate the fate of this second messenger total and inositol lipid derived phosphatidic acids were then measured at both 20 s and 5 min. Noradrenaline induced a rise in both total and arachidonate-containing phosphatidic acid at both times as did vasopressin. Only small increases were induced by angiotensin II at 20 s. These data demonstrate that the accumulation of 1,2-diacylglycerol generated from inositol lipid breakdown is only observed with activation by angiotensin II. Other agonists produced phosphatidic acids with time and the rate of generation of these lipids is agonist-specific. Thus phosphatidic acid may play a more prominent role during the sustained phase of contraction than previously anticipated.

  19. Phosphatidic acid phosphatase in neonatal rat lung: effects of prenatal dexamethasone or terbutaline treatment on basal activity and on responsiveness to beta adrenergic stimulation.

    PubMed

    Kudlacz, E M; Navarro, H A; Slotkin, T A

    1989-07-01

    Phosphatidic acid phosphatase (PAPase) is a key enzyme in the synthesis of lung surfactant. This study compares the effects of prenatal exposure (gestational days 17, 18 and 19) to two drugs which enhance surfactant synthesis: dexamethasone (0.2 mg/kg) and terbutaline (2 or 10 mg/kg). Maternal dexamethasone treatment did not cause an initial stimulation of lung PAPase but did eventually evoke a small increase after the 1st postnatal week. The effect was selective in that brain PAPase activity was generally unaffected; liver PAPase was stimulated during the early neonatal period only. Dexamethasone also prolonged the developmental period of peak reactivity of lung PAPase to beta developmental period of peak reactivity of lung PAPase to beta adrenergic stimulation (tested with acute isoproterenol challenge), which ordinarily accompanies genesis of alveoli in the 2nd to 3rd postnatal week. Significant growth retardation was present even at this low dose of dexamethasone. In contrast, maternal administration of the beta adrenergic agonist, terbutaline, resulted in a large increase in basal enzyme activity in the lung during the immediate perinatal period and enhanced the responsiveness to isoproterenol challenge. The effect of terbutaline was accompanied by little or no growth impairment. Thus, although prenatal administration of either glucocorticoids or beta adrenergic agonists can enhance lung PAPase activity and reactivity to stimulation, the two classes of drugs differ substantially in time course of effect and in the propensity to retard growth.

  20. Phosphatidic Acid Produced by RalA-activated PLD2 Stimulates Caveolae-mediated Endocytosis and Trafficking in Endothelial Cells.

    PubMed

    Jiang, Ying; Sverdlov, Maria S; Toth, Peter T; Huang, Long Shuang; Du, Guangwei; Liu, Yiyao; Natarajan, Viswanathan; Minshall, Richard D

    2016-09-23

    Caveolae are the primary route for internalization and transendothelial transport of macromolecules, such as insulin and albumin. Caveolae-mediated endocytosis is activated by Src-dependent caveolin-1 (Cav-1) phosphorylation and subsequent recruitment of dynamin-2 and filamin A (FilA), which facilitate vesicle fission and trafficking, respectively. Here, we tested the role of RalA and phospholipase D (PLD) signaling in the regulation of caveolae-mediated endocytosis and trafficking. The addition of albumin to human lung microvascular endothelial cells induced the activation of RalA within minutes, and siRNA-mediated down-regulation of RalA abolished fluorescent BSA uptake. Co-immunoprecipitation studies revealed that albumin induced the association between RalA, Cav-1, and FilA; however, RalA knockdown with siRNA did not affect FilA recruitment to Cav-1, suggesting that RalA was not required for FilA and Cav-1 complex formation. Rather, RalA probably facilitates caveolae-mediated endocytosis by activating downstream effectors. PLD2 was shown to be activated by RalA, and inhibition of PLD2 abolished Alexa-488-BSA uptake, indicating that phosphatidic acid (PA) generated by PLD2 may facilitate caveolae-mediated endocytosis. Furthermore, using a PA biosensor, GFP-PASS, we observed that BSA induced an increase in PA co-localization with Cav-1-RFP, which could be blocked by a dominant negative PLD2 mutant. Total internal reflection fluorescence microscopy studies of Cav-1-RFP also showed that fusion of caveolae with the basal plasma membrane was dependent on PLD2 activity. Thus, our results suggest that the small GTPase RalA plays an important role in promoting invagination and trafficking of caveolae, not by potentiating the association between Cav-1 and FilA but by stimulating PLD2-mediated generation of phosphatidic acid.

  1. Mechanical stimulation induces mTOR signaling via an ERK-independent mechanism: implications for a direct activation of mTOR by phosphatidic acid.

    PubMed

    You, Jae Sung; Frey, John W; Hornberger, Troy A

    2012-01-01

    Signaling by mTOR is a well-recognized component of the pathway through which mechanical signals regulate protein synthesis and muscle mass. However, the mechanisms involved in the mechanical regulation of mTOR signaling have not been defined. Nevertheless, recent studies suggest that a mechanically-induced increase in phosphatidic acid (PA) may be involved. There is also evidence which suggests that mechanical stimuli, and PA, utilize ERK to induce mTOR signaling. Hence, we reasoned that a mechanically-induced increase in PA might promote mTOR signaling via an ERK-dependent mechanism. To test this, we subjected mouse skeletal muscles to mechanical stimulation in the presence or absence of a MEK/ERK inhibitor, and then measured several commonly used markers of mTOR signaling. Transgenic mice expressing a rapamycin-resistant mutant of mTOR were also used to confirm the validity of these markers. The results demonstrated that mechanically-induced increases in p70(s6k) T389 and 4E-BP1 S64 phosphorylation, and unexpectedly, a loss in total 4E-BP1, were fully mTOR-dependent signaling events. Furthermore, we determined that mechanical stimulation induced these mTOR-dependent events, and protein synthesis, through an ERK-independent mechanism. Similar to mechanical stimulation, exogenous PA also induced mTOR-dependent signaling via an ERK-independent mechanism. Moreover, PA was able to directly activate mTOR signaling in vitro. Combined, these results demonstrate that mechanical stimulation induces mTOR signaling, and protein synthesis, via an ERK-independent mechanism that potentially involves a direct interaction of PA with mTOR. Furthermore, it appears that a decrease in total 4E-BP1 may be part of the mTOR-dependent mechanism through which mechanical stimuli activate protein synthesis.

  2. Hydrophilic interaction liquid chromatography-mass spectrometry of (lyso)phosphatidic acids, (lyso)phosphatidylserines and other lipid classes.

    PubMed

    Cífková, Eva; Hájek, Roman; Lísa, Miroslav; Holčapek, Michal

    2016-03-25

    The goal of this work is a systematic optimization of hydrophilic interaction liquid chromatography (HILIC) separation of acidic lipid classes (namely phosphatidic acids-PA, lysophosphatidic acids-LPA, phosphatidylserines-PS and lysophosphatidylserines-LPS) and other lipid classes under mass spectrometry (MS) compatible conditions. The main parameters included in this optimization are the type of stationary phases used in HILIC, pH of the mobile phase, the type and concentration of mobile phase additives. Nine HILIC columns with different chemistries (unmodified silica, modified silica using diol, 2-picolylamine, diethylamine and 1-aminoanthracene and hydride silica) are compared with the emphasis on peak shapes of acidic lipid classes. The optimization of pH is correlated with the theoretical calculation of acidobasic equilibria of studied lipid classes. The final method using the hydride column, pH 4 adjusted by formic acid and the gradient of acetonitrile and 40 mmol/L of aqueous ammonium formate provides good peak shapes for all analyzed lipid classes including acidic lipids. This method is applied for the identification of lipids in real samples of porcine brain and kidney extracts.

  3. Levels of Arabidopsis thaliana Leaf Phosphatidic Acids, Phosphatidylserines, and Most Trienoate-Containing Polar Lipid Molecular Species Increase during the Dark Period of the Diurnal Cycle.

    PubMed

    Maatta, Sara; Scheu, Brad; Roth, Mary R; Tamura, Pamela; Li, Maoyin; Williams, Todd D; Wang, Xuemin; Welti, Ruth

    2012-01-01

    Previous work has demonstrated that plant leaf polar lipid fatty acid composition varies during the diurnal (dark-light) cycle. Fatty acid synthesis occurs primarily during the light, but fatty acid desaturation continues in the absence of light, resulting in polyunsaturated fatty acids reaching their highest levels toward the end of the dark period. In this work, Arabidopsis thaliana were grown at constant (21°C) temperature with 12-h light and 12-h dark periods. Collision induced dissociation time-of-flight mass spectrometry (MS) demonstrated that 16:3 and 18:3 fatty acid content in membrane lipids of leaves are higher at the end of the dark than at the end of the light period, while 16:1, 16:2, 18:0, and 18:1 content are higher at the end of the light period. Lipid profiling of membrane galactolipids, phospholipids, and lysophospholipids by electrospray ionization triple quadrupole MS indicated that the monogalactosyldiacylglycerol, phosphatidylglycerol, and phosphatidylcholine classes include molecular species whose levels are highest at end of the light period and others that are highest at the end of the dark period. The levels of phosphatidic acid (PA) and phosphatidylserine classes were higher at the end of the dark period, and molecular species within these classes either followed the class pattern or were not significantly changed in the diurnal cycle. Phospholipase D (PLD) is a family of enzymes that hydrolyzes phospholipids to produce PA. Analysis of several PLD mutant lines suggests that PLDζ2 and possibly PLDα1 may contribute to diurnal cycling of PA. The polar lipid compositional changes are considered in relation to recent data that demonstrate phosphatidylcholine acyl editing.

  4. Phospholipase D1 production of phosphatidic acid at the plasma membrane promotes exocytosis of large dense-core granules at a late stage.

    PubMed

    Zeniou-Meyer, Maria; Zabari, Naama; Ashery, Uri; Chasserot-Golaz, Sylvette; Haeberlé, Anne-Marie; Demais, Valérie; Bailly, Yannick; Gottfried, Irit; Nakanishi, Hideki; Neiman, Aaron M; Du, Guangwei; Frohman, Michael A; Bader, Marie-France; Vitale, Nicolas

    2007-07-27

    Substantial efforts have recently been made to demonstrate the importance of lipids and lipid-modifying enzymes in various membrane trafficking processes, including calcium-regulated exocytosis of hormones and neurotransmitters. Among bioactive lipids, phosphatidic acid (PA) is an attractive candidate to promote membrane fusion through its ability to change membrane topology. To date, however, the biosynthetic pathway, the dynamic location, and actual function of PA in secretory cells remain unknown. Using a short interference RNA strategy on chromaffin and PC12 cells, we demonstrate here that phospholipase D1 is activated in secretagogue-stimulated cells and that it produces PA at the plasma membrane at the secretory granule docking sites. We show that phospholipase D1 activation and PA production represent key events in the exocytotic progression. Membrane capacitance measurements indicate that reduction of endogenous PA impairs the formation of fusion-competent granules. Finally, we show that the PLD1 short interference RNA-mediated inhibition of exocytosis can be rescued by exogenous provision of a lipid that favors the transition of opposed bi-layer membranes to hemifused membranes having the outer leaflets fused. Our findings demonstrate that PA synthesis is required during exocytosis to facilitate a late event in the granule fusion pathway. We propose that the underlying mechanism is related to the ability of PA to alter membrane curvature and promote hemi-fusion.

  5. Phosphatidic acid: biosynthesis, pharmacokinetics, mechanisms of action and effect on strength and body composition in resistance-trained individuals.

    PubMed

    Bond, Peter

    2017-01-01

    The mechanistic target of rapamycin complex 1 (mTORC1) has received much attention in the field of exercise physiology as a master regulator of skeletal muscle hypertrophy. The multiprotein complex is regulated by various signals such as growth factors, energy status, amino acids and mechanical stimuli. Importantly, the glycerophospholipid phosphatidic acid (PA) appears to play an important role in mTORC1 activation by mechanical stimulation. PA has been shown to modulate mTOR activity by direct binding to its FKBP12-rapamycin binding domain. Additionally, it has been suggested that exogenous PA activates mTORC1 via extracellular conversion to lysophosphatidic acid and subsequent binding to endothelial differentiation gene receptors on the cell surface. Recent trials have therefore evaluated the effects of PA supplementation in resistance-trained individuals on strength and body composition. As research in this field is rapidly evolving, this review attempts to provide a comprehensive overview of its biosynthesis, pharmacokinetics, mechanisms of action and effect on strength and body composition in resistance-trained individuals.

  6. Modification of intracellular free calcium in cultured A10 vascular smooth muscle cells by exogenous phosphatidic acid.

    PubMed

    Bhugra, Praveen; Xu, Yan-Jun; Rathi, Satyajeet; Dhalla, Naranjan S

    2003-06-15

    Exogenous phosphatidic acid (PA) was observed to produce a concentration-dependent increase in [Ca(2+)](i) in cultured A10 vascular smooth muscle cells. Preincubation of cells with sarcoplasmic reticulum Ca(2+)-ATPase inhibitors (cyclopiazonic acid and thapsigargin), a phospholipase C inhibitor (2-nitro-4-carboxyphenyl-N,N-diphenylcarbamate), inositol 1,4,5-trisphosphate receptor antagonists (2-aminoethoxydiphenyl borate and xestospongin), and an activator of protein kinase C (PKC) (phorbol 12-myristate 13-acetate) depressed the PA-evoked increase in [Ca(2+)](i). Although EGTA, an extracellular Ca(2+) chelator, decreased the PA-induced increase in [Ca(2+)](i), sarcolemmal Ca(2+)-channel blockers (verapamil or diltiazem) did not alter the action of PA. On the other hand, inhibitors of PKC (bisindolylmaleimide I) and G(i)-protein (pertussis toxin) potentiated the increase in [Ca(2+)](i) evoked by PA significantly. These results suggest that the PA-induced increase in [Ca(2+)](i) in vascular smooth muscle cells may occur upon the activation of phospholipase C and the subsequent release of Ca(2+) from the inositol 1,4,5-trisphosphate-sensitive Ca(2+) pool in the sarcoplasmic reticulum. This action of PA may be mediated through the involvement of PKC.

  7. Phospholipase D2 specifically regulates TREK potassium channels via direct interaction and local production of phosphatidic acid.

    PubMed

    Comoglio, Yannick; Levitz, Joshua; Kienzler, Michael A; Lesage, Florian; Isacoff, Ehud Y; Sandoz, Guillaume

    2014-09-16

    Membrane lipids serve as second messengers and docking sites for proteins and play central roles in cell signaling. A major question about lipid signaling is whether diffusible lipids can selectively target specific proteins. One family of lipid-regulated membrane proteins is the TWIK-related K channel (TREK) subfamily of K2P channels: TREK1, TREK2, and TWIK-related arachdonic acid stimulated K(+) channel (TRAAK). We investigated the regulation of TREK channels by phosphatidic acid (PA), which is generated by phospholipase D (PLD) via hydrolysis of phosphatidylcholine. Even though all three of the channels are sensitive to PA, we found that only TREK1 and TREK2 are potentiated by PLD2 and that none of these channels is modulated by PLD1, indicating surprising selectivity. We found that PLD2, but not PLD1, directly binds to the C terminus of TREK1 and TREK2, but not to TRAAK. The results have led to a model for selective lipid regulation by localization of phospholipid enzymes to specific effector proteins. Finally, we show that regulation of TREK channels by PLD2 occurs natively in hippocampal neurons.

  8. Phosphatidic acid-mediated activation and translocation to the cell surface of sialidase NEU3, promoting signaling for cell migration.

    PubMed

    Shiozaki, Kazuhiro; Takahashi, Kohta; Hosono, Masahiro; Yamaguchi, Kazunori; Hata, Keiko; Shiozaki, Momo; Bassi, Rosaria; Prinetti, Alessandro; Sonnino, Sandro; Nitta, Kazuo; Miyagi, Taeko

    2015-05-01

    The plasma membrane-associated sialidase NEU3 plays crucial roles in regulation of transmembrane signaling, and its aberrant up-regulation in various cancers contributes to malignancy. However, it remains uncertain how NEU3 is naturally activated and locates to plasma membranes, because of its Triton X-100 requirement for the sialidase activity in vitro and its often changing subcellular location. Among phospholipids examined, we demonstrate that phosphatidic acid (PA) elevates its sialidase activity 4 to 5 times at 50 μM in vitro at neutral pH and promotes translocation to the cell surface and cell migration through Ras-signaling in HeLa and COS-1 cells. NEU3 was found to interact selectively with PA as assessed by phospholipid array, liposome coprecipitation, and ELISA assays and to colocalize with phospholipase D (PLD) 1 in response to epidermal growth factor (EGF) or serum stimulation. Studies using tagged NEU3 fragments with point mutations identified PA- and calmodulin (CaM)-binding sites around the N terminus and confirmed its participation in translocation and catalytic activity. EGF induced PLD1 activation concomitantly with enhanced NEU3 translocation to the cell surface, as assessed by confocal microscopy. These results suggest that interactions of NEU3 with PA produced by PLD1 are important for regulation of transmembrane signaling, this aberrant acceleration probably promoting malignancy in cancers.

  9. Arabidopsis phospholipase D alpha 1-derived phosphatidic acid regulates microtubule organization and cell development under microtubule-interacting drugs treatment.

    PubMed

    Zhang, Qun; Qu, Yana; Wang, Qing; Song, Ping; Wang, Peipei; Jia, Qianru; Guo, Jinhe

    2017-01-01

    Phospholipase D (PLD) and its product phosphatidic acid (PA) are emerging as essential regulators of cytoskeleton organization in plants. However, the underlying molecular mechanisms of PA-mediated microtubule reorganization in plants remain largely unknown. In this study, we used pharmacological and genetic approaches to analyze the function of Arabidopsis thaliana PLDα1 in the regulation of microtubule organization and cell development in response to microtubule-affecting drugs. Treatment with the microtubule-stabilizing drug paclitaxel resulted in less growth inhibition and decreased rightward slant of roots, longitudinal alignment of microtubules, and enhanced length of hypocotyl epidermal cells in the pldα1 mutant, the phenotype of which was rescued by exogenous application of PA. Moreover, the pldα1 mutant was sensitive to the microtubule-disrupting drugs oryzalin and propyzamide in terms of seedling survival ratio, left-skewing angle of roots and microtubule organization. In addition, both disruption and stabilization of microtubules induced by drugs activated PLDα1 activity. Our findings demonstrate that in A. thaliana, PLDα1/PA might regulate cell development by modulating microtubule organization in an activity-dependent manner.

  10. Regulation of Phospholipase D Activity and Phosphatidic Acid Production after Purinergic (P2Y6) Receptor Stimulation*

    PubMed Central

    Scott, Sarah A.; Xiang, Yun; Mathews, Thomas P.; Cho, Hyekyung P.; Myers, David S.; Armstrong, Michelle D.; Tallman, Keri A.; O'Reilly, Matthew C.; Lindsley, Craig W.; Brown, H. Alex

    2013-01-01

    Phosphatidic acid (PA) is a lipid second messenger located at the intersection of several lipid metabolism and cell signaling events including membrane trafficking, survival, and proliferation. Generation of signaling PA has long been primarily attributed to the activation of phospholipase D (PLD). PLD catalyzes the hydrolysis of phosphatidylcholine into PA. A variety of both receptor-tyrosine kinase and G-protein-coupled receptor stimulations have been shown to lead to PLD activation and PA generation. This study focuses on profiling the PA pool upon P2Y6 receptor signaling manipulation to determine the major PA producing enzymes. Here we show that PLD, although highly active, is not responsible for the majority of stable PA being produced upon UDP stimulation of the P2Y6 receptor and that PA levels are tightly regulated. By following PA flux in the cell we show that PLD is involved in an initial increase in PA upon receptor stimulation; however, when PLD is blocked, the cell compensates by increasing PA production from other sources. We further delineate the P2Y6 signaling pathway showing that phospholipase Cβ3 (PLCβ3), PLCδ1, DGKζ and PLD are all downstream of receptor activation. We also show that DGKζ is a novel negative regulator of PLD activity in this system that occurs through an inhibitory mechanism with PKCα. These results further define the downstream events resulting in PA production in the P2Y6 receptor signaling pathway. PMID:23723068

  11. The brown adipocyte protein CIDEA promotes lipid droplet fusion via a phosphatidic acid-binding amphipathic helix

    PubMed Central

    Barneda, David; Planas-Iglesias, Joan; Gaspar, Maria L; Mohammadyani, Dariush; Prasannan, Sunil; Dormann, Dirk; Han, Gil-Soo; Jesch, Stephen A; Carman, George M; Kagan, Valerian; Parker, Malcolm G; Ktistakis, Nicholas T; Klein-Seetharaman, Judith; Dixon, Ann M; Henry, Susan A; Christian, Mark

    2015-01-01

    Maintenance of energy homeostasis depends on the highly regulated storage and release of triacylglycerol primarily in adipose tissue, and excessive storage is a feature of common metabolic disorders. CIDEA is a lipid droplet (LD)-protein enriched in brown adipocytes promoting the enlargement of LDs, which are dynamic, ubiquitous organelles specialized for storing neutral lipids. We demonstrate an essential role in this process for an amphipathic helix in CIDEA, which facilitates embedding in the LD phospholipid monolayer and binds phosphatidic acid (PA). LD pairs are docked by CIDEA trans-complexes through contributions of the N-terminal domain and a C-terminal dimerization region. These complexes, enriched at the LD–LD contact site, interact with the cone-shaped phospholipid PA and likely increase phospholipid barrier permeability, promoting LD fusion by transference of lipids. This physiological process is essential in adipocyte differentiation as well as serving to facilitate the tight coupling of lipolysis and lipogenesis in activated brown fat. DOI: http://dx.doi.org/10.7554/eLife.07485.001 PMID:26609809

  12. Relationship between stimulated phosphatidic acid production and inositol lipid hydrolysis in intestinal longitudinal smooth muscle from guinea pig.

    PubMed

    Mallows, R S; Bolton, T B

    1987-06-15

    Accumulation of [32P]phosphatidic acid (PA) and total [3H]inositol phosphates (IPs) was measured in the longitudinal smooth-muscle layer from guinea-pig small intestine. Stimulation with carbachol, histamine and substance P produced increases in accumulation of both [3H]IPs and [32P]PA over the same concentration range. The increase in [32P]PA accumulation in response to carbachol (1 microM-0.1 mM) was inhibited in the presence of atropine (0.5 microM). Buffering the external free [Ca2+] to 10 nM did not prevent the carbachol-stimulated increase in [32P]PA accumulation. Carbachol and Ca2+ appear to act synergistically to increase accumulation of [32P]PA. In contrast, although incubation with noradrenaline also increased accumulation of [3H]IPs, no increase in accumulation of [32P]PA could be detected. These results suggest that an increase in formation of IPs is not necessarily accompanied by an increase in PA formation, and imply the existence of receptor-modulated pathways regulating PA concentrations other than by phospholipase-C-catalysed inositol phospholipid hydrolysis.

  13. Physiological Role for Phosphatidic Acid in the Translocation of the Novel Protein Kinase C Apl II in Aplysia Neurons▿

    PubMed Central

    Farah, Carole A.; Nagakura, Ikue; Weatherill, Daniel; Fan, Xiaotang; Sossin, Wayne S.

    2008-01-01

    In Aplysia californica, the serotonin-mediated translocation of protein kinase C (PKC) Apl II to neuronal membranes is important for synaptic plasticity. The orthologue of PKC Apl II, PKCɛ, has been reported to require phosphatidic acid (PA) in conjunction with diacylglycerol (DAG) for translocation. We find that PKC Apl II can be synergistically translocated to membranes by the combination of DAG and PA. We identify a mutation in the C1b domain (arginine 273 to histidine; PKC Apl II-R273H) that removes the effects of exogenous PA. In Aplysia neurons, the inhibition of endogenous PA production by 1-butanol inhibited the physiological translocation of PKC Apl II by serotonin in the cell body and at the synapse but not the translocation of PKC Apl II-R273H. The translocation of PKC Apl II-R273H in the absence of PA was explained by two additional effects of this mutation: (i) the mutation removed C2 domain-mediated inhibition, and (ii) the mutation decreased the concentration of DAG required for PKC Apl II translocation. We present a model in which, under physiological conditions, PA is important to activate the novel PKC Apl II both by synergizing with DAG and removing C2 domain-mediated inhibition. PMID:18505819

  14. Phospholipase Dα1-mediated phosphatidic acid change is a key determinant of desiccation-induced viability loss in seeds.

    PubMed

    Chen, Hongying; Yu, Xiaomei; Zhang, Xudong; Yang, Lan; Huang, Xing; Zhang, Jie; Pritchard, Hugh W; Li, Weiqi

    2017-02-02

    High sensitivity of seeds to water loss is a widespread phenomenon in the world's plant species. The molecular basis of this trait is poorly understood but thought to be associated with critical changes in membrane function. We profiled membrane lipids of seeds in eight species with varying levels of desiccation tolerance and found a close association between reducing seed viability and increasing phosphatidic acid (PA). We applied hydration-dehydration cycles to Arabidopsis seeds, which are normally desiccation tolerant, to mimic the onset of desiccation sensitivity with progression towards germination and examined the role of phospholipase D (PLD) in desiccation stress-induced production of PA. We found that PLDα1 became more abundant and migrated from the cytosol to the membrane during desiccation, whereas PLDδ did not change, and that all desiccation-induced PA was derived from PLDα1 hydrolysis. When PLDα1 was suppressed, the germination level after each hydration-dehydration cycle improved significantly. We further demonstrated that PLDα1-mediated PA formation modulates desiccation sensitivity as applying its inhibitor improved seed desiccation tolerance and its suppression in protoplasts enhanced survival under dehydration. The insights provided by comparative lipidomics enable us to propose a new membrane-based model for seed desiccation stress and survival.

  15. Quantification of phosphatidylserine, phosphatidic acid and free fatty acids in an ultrasound contrast agent by normal-phase high-performance liquid chromatography with evaporative light scattering detection.

    PubMed

    Hvattum, Erlend; Uran, Steinar; Sandbaek, Anne Gunvor; Karlsson, Anders A; Skotland, Tore

    2006-10-11

    Sonazoid is a new contrast agent for ultrasound imaging. The product is an aqueous suspension of perfluorobutane microbubbles coated with phospholipids obtained from hydrogenated egg phosphatidylserine (H-EPS). A normal-phase high-performance liquid chromatographic (HPLC) method with evaporative light scattering detection was developed for quantification of free fatty acids, phosphatidylserine and phosphatidic acid in H-EPS and Sonazoid. Separation of the lipids was carried out on an HPLC diol column and a gradient of chloroform and methanol with 0.2% formic acid titrated to pH 7.5 with ammonia. The calibration standards contained stearic acid, distearoyl-phosphatidic acid (DSPA) and distearoyl-phosphatidylserine (DSPS) in the concentration range of 0.016-1.0mg/ml (0.4-25microg injected). The method was validated with a limit of quantification of the three lipids set to 0.4microg (approximately 20-60microM). The best fit of the three calibration curves were obtained when the logarithmic transformed theoretical lipid concentration was plotted against the logarithmic transformed area under the peak and fitted to a second order polynomial equation. Stearic acid, DSPA and DSPS were analysed with an intermediate precision ranging from 4.4% to 5.3% R.S.D. and they were extracted from an aqueous suspension with a recovery ranging from 103.3% to 113.3%. The sum of total phospholipid concentration determined in H-EPS ranged from 96.4% to 103.2% of the theoretical values. The lipids in the ultrasound product were quantitated with a repeatability ranging from 6.2% to 11.7% R.S.D.

  16. Lysophosphatidic Acid Regulation and Roles in Human Prostate Cancer

    DTIC Science & Technology

    2005-01-01

    be generated by other pathways. LPA is produced from phosphatidic acid 4 ") (PA) in activated platelets and ovarian and prostate cancer cells by...material. Appendix 1 JCB in revision 2 ABSTRACT The bioactive phospholipids, lysophosphatidic acid (LPA) and phosphatidic acid (PA), regulate pivotal...glycerolipid synthesis, abundant evidence now indicates that bioactive LPA can also be generated by other pathways. LPA is produced from phosphatidic acid (PA

  17. Phosphatidic acid increases inositol-1,4,5,-trisphosphate and [Ca2+]i levels in neonatal rat cardiomyocytes.

    PubMed

    Liu, P; Xu, Y; Hopfner, R L; Gopalakrishnan, V

    1999-08-25

    Phosphatidic acid (PA), which can be synthesized de novo, or as a product of phosphatidylcholine hydrolysis and/or phosphorylation of 1,2-diacylglycerol (DAG), mediates diverse cellular functions in various cell types, including cardiomyocytes. We set out to characterize the effect of PA on intracellular free calcium ([Ca2+]i) and inositol-1,4,5-trisphosphate (IP(3)) levels in primary cultures of neonatal rat cardiomyocytes. Addition of PA led to rapid, concentration and time dependent increases in both IP(3) and [Ca2+]i levels in adherent cells. There was strong correlation in the concentration-response relationships between IP(3) and [Ca2+]i increases evoked by PA. Incubation with the sarcoplasmic reticulum (SR) Ca2+ pump inhibitor, cyclopiazonic acid (CPA), significantly attenuated the PA evoked [Ca2+]i increase but had no significant effect on IP(3) accumulation. The phospholipase C (PLC) inhibitor, D-609, attenuated both IP(3) and [Ca2+]i elevations evoked by PA whereas staurosporine (STS), a potent and non-selective PKC inhibitor, had no significant effect on either. Another PLC inhibitor, U73122, but not its inactive analog, U73343, also inhibited PA evoked increases in [Ca2+]i. Depletion of extracellular calcium attenuated both basal and PA evoked increases in [Ca2+]i. The PLA(2) inhibitors, bromophenylacyl-bromide (BPB) and CDP-choline, had no effect on PA evoked [Ca2+]i responses. Neither the DAG analog, dioctanoylglycerol, nor the DAG kinase inhibitor, R59949, affected PA evoked changes in [Ca2+]i. Taken together, these data indicate that PA, in a manner independent of PKC, DAG, or PLA(2), may enhance Ca2+ release from IP(3) sensitive SR Ca(2+) stores via activation of PLC in neonatal rat cardiomyocytes.

  18. Protection of neuroblastoma Neuro2A cells from hypoxia-induced apoptosis by cyclic phosphatidic acid (cPA).

    PubMed

    Gotoh, Mari; Sano-Maeda, Katsura; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2012-01-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator with a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We have previously shown that cPA significantly suppresses ischemia-induced delayed neuronal death and the accumulation of glial fibrillary acidic protein in the CA1 region of the rat hippocampus. These results indicated that the systemic administration of cPA can protect hippocampal neurons against ischemia-induced delayed neuronal cell death. In the current study, we investigated the effects of cPA on neuronal cell death caused by hypoxia in vitro and the molecular mechanisms underlying these effects. We used cobalt chloride (CoCl(2)) to expose cells to hypoxic conditions in vitro. Treating mouse neuroblastoma (Neuro2A) cells with CoCl(2) induced nuclear DNA condensation and phosphatidylserine exposure. However, adding cPA led to the suppression of CoCl(2)-induced apoptosis in a cPA dose-dependent manner and attenuated the increase in the Bax/Bcl-2 ratio caused by CoCl(2). Quantitative PCR analysis showed that Neuro2A cells strongly express the LPA(1), LPA(2), and LPA(6), which are G-protein coupled receptors that can be activated by cPA. To date, LPA(1) and LPA(2) have been reported to exhibit antiapoptotic activity. Therefore, to assess the roles of LPA(1) and LPA(2) on cPA-induced neuroprotective functions, Ki16425, a selective LPA(1) and LPA(3) antagonist, was adopted to know the LPA(1) function and siRNA was used to knockdown the expression of LPA(2). On the basis of our results, we propose that cPA-induced protection of Neuro2A cells from CoCl(2)-induced hypoxia damage is mediated via LPA(2).

  19. Antinociceptive effect of cyclic phosphatidic acid and its derivative on animal models of acute and chronic pain

    PubMed Central

    2011-01-01

    1. Abstract Background Cyclic phosphatidic acid (cPA) is a structural analog of lysophosphatidic acid (LPA), but possesses different biological functions, such as the inhibition of autotaxin (ATX), an LPA-synthesizing enzyme. As LPA is a signaling molecule involved in nociception in the peripheral and central systems, cPA is expected to possess analgesic activity. We characterized the effects of cPA and 2-carba-cPA (2ccPA), a chemically stable cPA analog, on acute and chronic pain. Results (1) The systemic injection of 2ccPA significantly inhibited somato-cardiac and somato-somatic C-reflexes but not the corresponding A-reflexes in anesthetized rats. (2) 2ccPA reduced sensitivity measured as the paw withdrawal response to electrical stimulation applied to the hind paws of mice through the C-fiber, but not Aδ or Aβ. (3) In mice, pretreatment with 2ccPA dose-dependently inhibited the second phase of formalin-induced licking and biting responses. (4) In mice, pretreatment and repeated post-treatments with 2ccPA significantly attenuated thermal hyperalgesia and mechanical allodynia following partial ligation of the sciatic nerve. (5) In rats, repeated post-treatments with 2ccPA also significantly attenuated thermal hyperalgesia and mechanical allodynia following chronic sciatic nerve constriction. Conclusions Our results suggest that cPA and its stable analog 2ccPA inhibit chronic and acute inflammation-induced C-fiber stimulation, and that the central effects of 2ccPA following repeated treatments attenuate neuropathic pain. PMID:21569544

  20. The role of diacylglycerol kinase ζ and phosphatidic acid in the mechanical activation of mammalian target of rapamycin (mTOR) signaling and skeletal muscle hypertrophy.

    PubMed

    You, Jae-Sung; Lincoln, Hannah C; Kim, Chan-Ran; Frey, John W; Goodman, Craig A; Zhong, Xiao-Ping; Hornberger, Troy A

    2014-01-17

    The activation of mTOR signaling is essential for mechanically induced changes in skeletal muscle mass, and previous studies have suggested that mechanical stimuli activate mTOR (mammalian target of rapamycin) signaling through a phospholipase D (PLD)-dependent increase in the concentration of phosphatidic acid (PA). Consistent with this conclusion, we obtained evidence which further suggests that mechanical stimuli utilize PA as a direct upstream activator of mTOR signaling. Unexpectedly though, we found that the activation of PLD is not necessary for the mechanically induced increases in PA or mTOR signaling. Motivated by this observation, we performed experiments that were aimed at identifying the enzyme(s) that promotes the increase in PA. These experiments revealed that mechanical stimulation increases the concentration of diacylglycerol (DAG) and the activity of DAG kinases (DGKs) in membranous structures. Furthermore, using knock-out mice, we determined that the ζ isoform of DGK (DGKζ) is necessary for the mechanically induced increase in PA. We also determined that DGKζ significantly contributes to the mechanical activation of mTOR signaling, and this is likely driven by an enhanced binding of PA to mTOR. Last, we found that the overexpression of DGKζ is sufficient to induce muscle fiber hypertrophy through an mTOR-dependent mechanism, and this event requires DGKζ kinase activity (i.e. the synthesis of PA). Combined, these results indicate that DGKζ, but not PLD, plays an important role in mechanically induced increases in PA and mTOR signaling. Furthermore, this study suggests that DGKζ could be a fundamental component of the mechanism(s) through which mechanical stimuli regulate skeletal muscle mass.

  1. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initia...

  2. A novel class of PTEN protein in Arabidopsis displays unusual phosphoinositide phosphatase activity and efficiently binds phosphatidic acid.

    PubMed

    Pribat, Anne; Sormani, Rodnay; Rousseau-Gueutin, Mathieu; Julkowska, Magdalena M; Testerink, Christa; Joubès, Jerôme; Castroviejo, Michel; Laguerre, Michel; Meyer, Christian; Germain, Véronique; Rothan, Christophe

    2012-01-01

    PTEN (phosphatase and tensin homologue deleted on chromosome ten) proteins are dual phosphatases with both protein and phosphoinositide phosphatase activity. They modulate signalling pathways controlling growth, metabolism and apoptosis in animals and are implied in several human diseases. In the present paper we describe a novel class of PTEN pro-teins in plants, termed PTEN2, which comprises the AtPTEN (Arabidopsis PTEN) 2a and AtPTEN2b proteins in Arabidopsis. Both display low in vitro tyrosine phosphatase activity. In addition, AtPTEN2a actively dephosphorylates in vitro the 3' phosphate group of PI3P (phosphatidylinositol 3-phosphate), PI(3,4)P2 (phosphatidylinositol 3,4-bisphosphate) and PI(3,5)P2 (phosphatidylinositol 3,5-bisphosphate). In contrast with animal PTENs, PI(3,4,5)P3 (phosphatidylinositol 3,4,5-trisphosphate) is a poor substrate. Site-directed mutagenesis of AtPTEN2a and molecular modelling of protein-phosphoinositide interactions indicated that substitutions at the PTEN2 core catalytic site of the Lys267 and Gly268 residues found in animals, which are critical for animal PTEN activity, by Met267 and Ala268 found in the eudicot PTEN2 are responsible for changes in substrate specificity. Remarkably, the AtPTEN2a protein also displays strong binding activity for PA (phosphatidic acid), a major lipid second messenger in plants. Promoter::GUS (β-glucuronidase) fusion, transcript and protein analyses further showed the transcriptional regulation of the ubiquitously expressed AtPTEN2a and AtPTEN2b by salt and osmotic stress. The results of the present study suggest a function for this novel class of plant PTEN proteins as an effector of lipid signalling in plants.

  3. Turnover of Phosphatidic Acid through Distinct Signaling Pathways Affects Multiple Aspects of Pollen Tube Growth in Tobacco

    PubMed Central

    Pleskot, Roman; Pejchar, Přemysl; Bezvoda, Radek; Lichtscheidl, Irene K.; Wolters-Arts, Mieke; Marc, Jan; Žárský, Viktor; Potocký, Martin

    2012-01-01

    Phosphatidic acid (PA) is an important intermediate in membrane lipid metabolism that acts as a key component of signaling networks, regulating the spatio-temporal dynamics of the endomembrane system and the cytoskeleton. Using tobacco pollen tubes as a model, we addressed the signaling effects of PA by probing the functions of three most relevant enzymes that regulate the production and degradation of PA, namely, phospholipases D (PLD), diacylglycerol kinases (DGKs), and lipid phosphate phosphatases (LPPs). Phylogenetic analysis indicated a highly dynamic evolution of all three lipid-modifying enzymes in land plants, with many clade-specific duplications or losses and massive diversification of the C2-PLD family. In silico transcriptomic survey revealed increased levels of expression of all three PA-regulatory genes in pollen development (particularly the DGKs). Using specific inhibitors we were able to distinguish the contributions of PLDs, DGKs, and LPPs into PA-regulated processes. Thus, suppressing PA production by inhibiting either PLD or DGK activity compromised membrane trafficking except early endocytosis, disrupted tip-localized deposition of cell wall material, especially pectins, and inhibited pollen tube growth. Conversely, suppressing PA degradation by inhibiting LPP activity using any of three different inhibitors significantly stimulated pollen tube growth, and similar effect was achieved by suppressing the expression of tobacco pollen LPP4 using antisense knock-down. Interestingly, inhibiting specifically DGK changed vacuolar dynamics and the morphology of pollen tubes, whereas inhibiting specifically PLD disrupted the actin cytoskeleton. Overall, our results demonstrate the critical importance of all three types of enzymes involved in PA production and degradation, with strikingly different roles of PA produced by the PLD and DGK pathways, in pollen tube growth. PMID:22639652

  4. A Phosphatidic Acid (PA) conveyor system of continuous intracellular transport from cell membrane to nucleus maintains EGF receptor homeostasis

    PubMed Central

    Henkels, Karen M.; Miller, Taylor E.; Ganesan, Ramya; Wilkins, Brandon A.; Fite, Kristen; Gomez-Cambronero, Julian

    2016-01-01

    The intracellular concentration of the mitogen phosphatidic acid (PA) must be maintained at low levels until the need arises for cell proliferation. How temporal and spatial trafficking of PA affects its target proteins in the different cellular compartments is not fully understood. We report that in cancer cells, PA cycles back and forth from the cellular membrane to the nucleus, affecting the function of epidermal growth factor (EGF), in a process that involves PPARα/LXRα signaling. Upon binding to its ligand, EGF receptor (EGFR)-initiated activation of phospholipase D (PLD) causes a spike in intracellular PA production that forms vesicles transporting EGFR from early endosomes (EEA1 marker) and prolonged internalization in late endosomes and Golgi (RCAS marker). Cells incubated with fluorescent-labeled PA (NBD-PA) show PA in “diffuse” locations throughout the cytoplasm, punctae (small, <0.1 μm) vesicles) and large (>0.5 μm) vesicles that co-localize with EGFR. We also report that PPARα/LXRα form heterodimers that bind to new Responsive Elements (RE) in the EGFR promoter. Nuclear PA enhances EGFR expression, a role compatible with the mitogenic ability of the phospholipid. Newly made EGFR is packaged into PA recycling vesicles (Rab11 marker) and transported back to the cytoplasm and plasma membrane. However, a PLD+PA combination impedes binding of PPARα/LXRα to the EGFR promoter. Thus, if PA levels inside the nucleus reach a certain threshold (>100 nM) PA outcompetes the nuclear receptors and transcription is inhibited. This new signaling function of PLD-PA targeting EGFR trafficking and biphasically modulating its transcription, could explain cell proliferation initiation and its maintenance in cancer cells. PMID:27256981

  5. The role of phospholipase D and phosphatidic acid in the mechanical activation of mTOR signaling in skeletal muscle.

    PubMed

    Hornberger, T A; Chu, W K; Mak, Y W; Hsiung, J W; Huang, S A; Chien, S

    2006-03-21

    Signaling by the mammalian target of rapamycin (mTOR) has been reported to be necessary for mechanical load-induced growth of skeletal muscle. The mechanisms involved in the mechanical activation of mTOR signaling are not known, but several studies indicate that a unique [phosphotidylinositol-3-kinase (PI3K)- and nutrient-independent] mechanism is involved. In this study, we have demonstrated that a regulatory pathway for mTOR signaling that involves phospholipase D (PLD) and the lipid second messenger phosphatidic acid (PA) plays a critical role in the mechanical activation of mTOR signaling. First, an elevation in PA concentration was sufficient for the activation of mTOR signaling. Second, the isozymes of PLD (PLD1 and PLD2) are localized to the z-band in skeletal muscle (a critical site of mechanical force transmission). Third, mechanical stimulation of skeletal muscle with intermittent passive stretch ex vivo induced PLD activation, PA accumulation, and mTOR signaling. Finally, pharmacological inhibition of PLD blocked the mechanically induced increase in PA and the activation of mTOR signaling. Combined, these results indicate that mechanical stimuli activate mTOR signaling through a PLD-dependent increase in PA. Furthermore, we showed that mTOR signaling was partially resistant to rapamycin in muscles subjected to mechanical stimulation. Because rapamycin and PA compete for binding to the FRB domain on mTOR, these results suggest that mechanical stimuli activate mTOR signaling through an enhanced binding of PA to the FRB domain on mTOR.

  6. Soybean MAPK, GMK1 is dually regulated by phosphatidic acid and hydrogen peroxide and translocated to nucleus during salt stress.

    PubMed

    Im, Jong Hee; Lee, Hyoungseok; Kim, Jitae; Kim, Ho Bang; An, Chung Sun

    2012-09-01

    Mitogen-activated protein kinase (MAPK) is activated by various biotic and abiotic stresses. Salt stress induces two well-characterized MAPK activating signaling molecules, phosphatidic acid (PA) via phospholipase D and phospholipase C, and reactive oxygen species (ROS) via nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase. In our previous study, the activity of soybean MAPK, GMK1 was strongly induced within 5 min of 300 mM NaCl treatment and this early activity was regulated by PA. In this study, we focused on the regulation of GMK1 at the later stage of the salt stress, because its activity was strongly persistent for up to 30 min. H(2)O(2) activated GMK1 even in the presence of PA generation inhibitors, but GMK1 activity was greatly decreased in the presence of diphenyleneiodonium, an inhibitor of NADPH-oxidase after 5 min of the treatment. On the contrary, the n-butanol and neomycin reduced GMK1 activity within 5 min of the treatment. Thus, GMK1 activity may be sustained by H(2)O(2) 10 min after the treatment. Further, GMK1 was translocated into the nucleus 60 min after NaCl treatment. In the relationship between GMK1 and ROS generation, ROS generation was reduced by SB202190, a MAPK inhibitor, but was increased in protoplast overexpressing TESD-GMKK1. However, these effects were occurred at prolonged time of NaCl treatment. These data suggest that GMK1 indirectly regulates ROS generation. Taken together, we propose that soybean GMK1 is dually regulated by PA and H(2)O(2) at a time dependant manner and translocated to the nucleus by the salt stress signal.

  7. Evidence for coupling of Clostridium perfringens alpha-toxin-induced hemolysis to stimulated phosphatidic acid formation in rabbit erythrocytes.

    PubMed Central

    Sakurai, J; Ochi, S; Tanaka, H

    1993-01-01

    When rabbit erythrocytes were exposed to low concentrations of Clostridium perfringens alpha-toxin, hot-cold hemolysis was observed. The toxin induced production of phosphatidic acid (PA) in a dose-dependent manner when incubated with erythrocytes at 37 degrees C. When erythrocyte membranes were incubated with the toxin and [gamma-32P]ATP in the presence or absence of ethanol, [32P]PA formation was maximal within 30 s, then sharply decreased, and began again after 5 min of incubation. Ethanol had no effect on the early appearance (at approximately 5 min) of PA formation induced by the toxin but significantly inhibited formation of PA over 10 min of incubation. Treatment of erythrocyte membranes with alpha-toxin resulted in the biphasic formation of 1,2-diacylglycerol and PA as well as an increase of inositol-1,4,5-trisphosphate (IP3) and decrease of phosphatidylinositol-4,5-bisphosphate (PIP2) within 30 s. Neomycin inhibited the toxin-induced increase in turbidity of egg yolk suspensions but did not inhibit the toxin-induced hemolysis of intact erythrocytes. On the other hand, neomycin inhibited the toxin-induced hemolysis of saponin-treated erythrocytes. In addition, neomycin inhibited PA formation induced by the toxin in erythrocyte membranes. IP3 was released by incubation of PIP2 with erythrocyte membranes but not by incubation of PIP2 with the toxin. The toxin stimulated the membrane-induced release of IP3 from PIP2. These data suggest that the toxin-induced hemolysis is dependent on the action of phospholipase C in erythrocyte membranes. PMID:8395469

  8. A Phosphatidic Acid (PA) conveyor system of continuous intracellular transport from cell membrane to nucleus maintains EGF receptor homeostasis.

    PubMed

    Henkels, Karen M; Miller, Taylor E; Ganesan, Ramya; Wilkins, Brandon A; Fite, Kristen; Gomez-Cambronero, Julian

    2016-07-26

    The intracellular concentration of the mitogen phosphatidic acid (PA) must be maintained at low levels until the need arises for cell proliferation. How temporal and spatial trafficking of PA affects its target proteins in the different cellular compartments is not fully understood. We report that in cancer cells, PA cycles back and forth from the cellular membrane to the nucleus, affecting the function of epidermal growth factor (EGF), in a process that involves PPARα/LXRα signaling. Upon binding to its ligand, EGF receptor (EGFR)-initiated activation of phospholipase D (PLD) causes a spike in intracellular PA production that forms vesicles transporting EGFR from early endosomes (EEA1 marker) and prolonged internalization in late endosomes and Golgi (RCAS marker). Cells incubated with fluorescent-labeled PA (NBD-PA) show PA in "diffuse" locations throughout the cytoplasm, punctae (small, <0.1 μm) vesicles) and large (>0.5 μm) vesicles that co-localize with EGFR. We also report that PPARα/LXRα form heterodimers that bind to new Responsive Elements (RE) in the EGFR promoter. Nuclear PA enhances EGFR expression, a role compatible with the mitogenic ability of the phospholipid. Newly made EGFR is packaged into PA recycling vesicles (Rab11 marker) and transported back to the cytoplasm and plasma membrane. However, a PLD+PA combination impedes binding of PPARα/LXRα to the EGFR promoter. Thus, if PA levels inside the nucleus reach a certain threshold (>100 nM) PA outcompetes the nuclear receptors and transcription is inhibited. This new signaling function of PLD-PA targeting EGFR trafficking and biphasically modulating its transcription, could explain cell proliferation initiation and its maintenance in cancer cells.

  9. Exercise-induced translocation of protein kinase C and production of diacylglycerol and phosphatidic acid in rat skeletal muscle in vivo. Relationship to changes in glucose transport.

    PubMed

    Cleland, P J; Appleby, G J; Rattigan, S; Clark, M G

    1989-10-25

    Contraction-induced translocation of protein kinase C (Richter E.A., Cleland, P.J.F., Rattigan, S., and Clark, M.G. (1987) FEBS Lett. 217, 232-236) implies a role for this enzyme in muscle contraction or the associated metabolic adjustments. In the present study, this role is further examined particularly in relation to changes in glucose transport. Electrical stimulation of the sciatic nerve of the anesthetized rat in vivo led to a time-dependent translocation of protein kinase C and a 2-fold increase in the concentrations of both diacylglycerol and phosphatidic acid. Maximum values for the latter were reached at 2 min and preceded the maximum translocation of protein kinase C (10 min). Stimulation of muscles in vitro increased the rate of glucose transport, but this required 20 min to reach maximum. There was no reversal of translocation or decrease in the concentrations of diacylglycerol and phosphatidic acid even after 30 min of rest following a 5-min period of stimulation in vivo. Translocation was not influenced by variations in applied load at maximal fiber recruitment but was dependent on the frequency of nontetanic stimuli, reaching a maximum at 4 Hz. The relationship between protein kinase C and glucose transport was also explored by varying the number of tetanic stimuli. Whereas only one train of stimuli (200 ms, 100 Hz) was required for maximal effects on protein kinase C, diacylglycerol, and phosphatidic acid, more than 35 trains of stimuli were required to activate glucose transport. It is concluded that the production of diacylglycerol and the translocation of protein kinase C may be causally related. However, if the translocated protein kinase C is involved in the activation of glucose transport during muscle contractions, an accumulated exposure to Ca2+, resulting from multiple contractions, would appear to be necessary.

  10. Identification of a soluble phosphatidate phosphohydrolase in the developing cotyledons of Morordica charantia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidate phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4), which is also known as PAP, catalyzes the dephosphorylation of phosphatidate (PtdOH) to form diacylglycerol (DAG) and inorganic phosphate. In eukaryotes, PAP driven reaction is the committed step in the synthesis of triacy...

  11. Delta 6- and delta 12-desaturase activities and phosphatidic acid formation in microsomal preparations from the developing cotyledons of common borage (Borago officinalis).

    PubMed Central

    Griffiths, G; Stobart, A K; Stymne, S

    1988-01-01

    Microsomal membrane preparations from the maturing cotyledons of common borage (Borago officinalis) exhibit delta 12- and delta 6-desaturase activities, which resulted in the synthesis of linoleate and gamma-linolenate respectively. The desaturase enzymes utilized the complex lipid substrate phosphatidylcholine. The activity of these enzymes was sufficiently high to allow the monitoring of the mass changes in the endogenous oleate, linoleate and gamma-linolenate in the microsomal phosphatidylcholine in the presence of NADH (i.e. under desaturating conditions). The results illustrate that the delta 12-desaturase uses the oleate substrate at both the sn-1 and -2 positions of sn-phosphatidylcholine, whereas the delta 6-desaturase is almost totally restricted to the linoleate at position 2 of the complex lipid. Estimate of the acyl-substrate pool size at position 2 of sn-phosphatidylcholine for both desaturases indicated that some 50% of the oleate and linoleate was available to the enzymes. The microsomes (microsomal fractions) had a somewhat impaired Kennedy [(1961) Fed. Proc. Fed. Am. Soc. Exp. Biol. 20, 934-940] pathway for the formation of triacylglycerols when compared with other oil-rich plant species that have been studied [Stymne & Stobart (1987) The Biochemistry of Plants: a Comprehensive Treatise (Stumpf, P.K., ed.), vol. 10, chapter 8, pp. 175-214, Academic Press, New York]. In the presence of sn-glycerol 3-phosphate and acyl-CoA, large quantities of phosphatidic acid accumulated in the membranes. Acyl-selectivity studies on the glycerol-acylating enzymes showed that gamma-linolenate could be acylated to both the sn-1 and sn-2 positions of sn-glycerol 3-phosphate. However, stereochemical analysis of the acyl components of the sn-triacylglycerol obtained from mature seeds indicated that, whereas no gamma-linolenate was present at the sn-1 position, it accounted for over 50% of the fatty acids at position sn-3. The results indicate that the diacylglycerol

  12. Delta 6- and delta 12-desaturase activities and phosphatidic acid formation in microsomal preparations from the developing cotyledons of common borage (Borago officinalis).

    PubMed

    Griffiths, G; Stobart, A K; Stymne, S

    1988-06-15

    Microsomal membrane preparations from the maturing cotyledons of common borage (Borago officinalis) exhibit delta 12- and delta 6-desaturase activities, which resulted in the synthesis of linoleate and gamma-linolenate respectively. The desaturase enzymes utilized the complex lipid substrate phosphatidylcholine. The activity of these enzymes was sufficiently high to allow the monitoring of the mass changes in the endogenous oleate, linoleate and gamma-linolenate in the microsomal phosphatidylcholine in the presence of NADH (i.e. under desaturating conditions). The results illustrate that the delta 12-desaturase uses the oleate substrate at both the sn-1 and -2 positions of sn-phosphatidylcholine, whereas the delta 6-desaturase is almost totally restricted to the linoleate at position 2 of the complex lipid. Estimate of the acyl-substrate pool size at position 2 of sn-phosphatidylcholine for both desaturases indicated that some 50% of the oleate and linoleate was available to the enzymes. The microsomes (microsomal fractions) had a somewhat impaired Kennedy [(1961) Fed. Proc. Fed. Am. Soc. Exp. Biol. 20, 934-940] pathway for the formation of triacylglycerols when compared with other oil-rich plant species that have been studied [Stymne & Stobart (1987) The Biochemistry of Plants: a Comprehensive Treatise (Stumpf, P.K., ed.), vol. 10, chapter 8, pp. 175-214, Academic Press, New York]. In the presence of sn-glycerol 3-phosphate and acyl-CoA, large quantities of phosphatidic acid accumulated in the membranes. Acyl-selectivity studies on the glycerol-acylating enzymes showed that gamma-linolenate could be acylated to both the sn-1 and sn-2 positions of sn-glycerol 3-phosphate. However, stereochemical analysis of the acyl components of the sn-triacylglycerol obtained from mature seeds indicated that, whereas no gamma-linolenate was present at the sn-1 position, it accounted for over 50% of the fatty acids at position sn-3. The results indicate that the diacylglycerol

  13. Stimulation of insulin release by phospholipase D. A potential role for endogenous phosphatidic acid in pancreatic islet function.

    PubMed

    Metz, S A; Dunlop, M

    1990-09-01

    Although exogenous phosphatidic acid (PA) has been shown to promote insulin release, the effects of endogenous PA on endocrine function are largely unexplored. In order to generate PA in situ, intact adult-rat islets were treated with exogenous phospholipases of the D type (PLD), and their effects on phospholipid metabolism and on insulin release were studied in parallel. Chromatographically purified PLD from Streptomyces chromofuscus stimulated the accumulation of PA in [14C]arachidonate- or [14C]myristate-prelabelled islets, and also promoted insulin secretion over an identical concentration range. During 30 min incubations, insulin release correlated closely with the accumulation of [14C]arachidonate-labelled PA (r2 = 0.98; P less than 0.01) or [14C]myristate-labelled PA (r2 = 0.97; P less than 0.01). Similar effects were seen both in freshly isolated and in overnight-cultured intact islets. In contrast, PLDs (from cabbage or peanut) which do not support phospholipid hydrolysis at the pH of the extracellular medium also did not promote insulin release. The effects on secretion of the active PLD preparation were inhibited by modest cooling (to 30 degrees C); dantrolene or Co2+ also inhibited PLD-induced secretion without decreasing PLD-induced PA formation. Additionally, the removal of PLD left the subsequent islet responsiveness to glucose intact, further supporting an exocytotic non-toxic mechanism. PLD-induced insulin release did not appear to require influx of extracellular Ca2+, nor could the activation of protein kinase C clearly be implicated. During incubations of 30 min, PLD selectively generated PA; however, more prolonged incubations (60 min) also led to production of some diacyglycerol and free arachidonic acid concomitant with progressive insulin release. These data suggest that PLD activation has both rapid and direct effects (via PA) and more delayed, secondary, effects (via other effects of PA or the generation of other lipid signals). Taken in

  14. Interaction of phosphatidic acid and phosphatidylserine with the Ca2+-ATPase of sarcoplasmic reticulum and the mechanism of inhibition.

    PubMed

    Dalton, K A; East, J M; Mall, S; Oliver, S; Starling, A P; Lee, A G

    1998-02-01

    The sarcoplasmic reticulum of skeletal muscle contains anionic phospholipids as well as the zwitterionic phosphatidylcholine and phosphatidylethanolamine. Here we study the effects of anionic phospholipids on the activity of the Ca2+-ATPase purified from the membrane. Reconstitution of the Ca2+-ATPase into dioleoylphosphatidylserine [di(C18:1)PS] or dioleoylphosphatidic acid [di(C18:1)PA] leads to a decrease in ATPase activity. Measurements of the quenching of the tryptophan fluorescence of the ATPase by brominated phospholipids give a relative binding constant for the anionic lipids compared with dioleoylphosphatidylcholine close to 1 and suggest that phosphatidic acid only binds to the ATPase at the bulk lipid sites around the ATPase. Addition of di(C18:1)PS or di(C18:1)PA to the ATPase in the short-chain dimyristoleoylphosphatidylcholine [di(C14:1)PC] reverse the effects of the short-chain lipid on ATPase activity and on Ca2+ binding, as revealed by the response of tryptophan fluorescence intensity to Ca2+ binding. It is concluded that the lipid headgroup and lipid fatty acyl chains have separate effects on the function of the ATPase. The anionic phospholipids have no significant effect on Ca2+ binding to the ATPase; the level of Ca2+ binding to the ATPase, the affinity of binding and the rate of dissociation of Ca2+ are unchanged by reconstitution into di(C18:1)PA. The major effect of the anionic lipids is a reduction in the maximal level of binding of MgATP. This is attributed to the formation of oligomers of the Ca2+-ATPase, in which only one molecule of the ATPase can bind MgATP dimers in di(C18:1)PS and trimers or tetramers in di(C18:1)PA. The rates of phosphorylation and dephosphorylation for the proportion of the ATPase still able to bind ATP are unaffected by reconstitution. Larger changes were observed in the level of phosphorylation of the ATPase by Pi, which became very low in the anionic phospholipids. The fluorescence response to Mg2+ for the ATPase

  15. Increasing cellular level of phosphatidic acid enhances FGF-1 production in long term-cultured rat astrocytes.

    PubMed

    Nagayasu, Yuko; Morita, Shin-Ya; Hayashi, Hideki; Miura, Yutaka; Yokoyama, Kazuki; Michikawa, Makoto; Ito, Jin-Ichi

    2014-05-14

    We found in a previous study that both mRNA expression and release of fibroblast growth factor 1 (FGF-1) are greater in rat astrocytes that are long term-cultured for one month (W/M cells) than in the cells cultured for one week (W/W cells). However, FGF-1 does not enhance phosphorylation of Akt, MEK, and ERK in W/M cells, while it does in W/W cells. In this work we studied the mechanism to cause these differences between W/W and W/M cells in culture. As it is known that long term culture generates oxidative stress, we characterized the stresses which W/M cells undergo in comparison with W/W cells. The levels of superoxide dismutase 1 (SOD1) and mitochondrial Bax were higher in W/M cells than in W/W cells. W/M cells recovered their ability to respond to FGF-1 to enhance phosphorylation of Akt, MEK, and ERK in the presence of antioxidants. Oxidative stress induced by hydrogen peroxide (H2O2) had no effect on mRNA expression of FGF-1 in W/W cells, although H2O2 enhances release of FGF-1 from W/W cells without inducing apoptosis. The influence of cell density was studied on mRNA expression of FGF-1 and cellular response to FGF-1, as an increasing cell density is observed in W/M cells. The increasing cell density enhanced mRNA expression of FGF-1 in W/W cells without suppression of responses to FGF-1. The decrease in cell density lowered the FGF-1 mRNA expression in W/M cells without recovery of the response to FGF-1 to enhance phosphorylation of Akt, MEK, and ERK. These findings suggest that oxidative stress attenuate sensitivity to FGF-1 and higher cell density may enhance FGF-1 expression in W/M cells. In addition, we found that the cellular level of phosphatidic acid (PA) increased in H2O2-treated W/W and W/M cells and decreased by the treatment with antioxidants, and that PA enhances the mRNA expression of FGF-1 in the W/W cells. These findings suggest that the increasing PA production may enhance FGF-1 expression to protect astrocytes against oxidative stress

  16. Carbachol induces a rapid and sustained hydrolysis of polyphosphoinositide in bovine tracheal smooth muscle measurements of the mass of polyphosphoinositides, 1,2-diacylglycerol, and phosphatidic acid.

    PubMed

    Takuwa, Y; Takuwa, N; Rasmussen, H

    1986-11-05

    The effects of carbachol on polyphosphoinositides and 1,2-diacylglycerol metabolism were investigated in bovine tracheal smooth muscle by measuring both lipid mass and the turnover of [3H]inositol-labeled phosphoinositides. Carbachol induces a rapid reduction in the mass of phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate and a rapid increase in the mass of 1,2-diacylglycerol and phosphatidic acid. These changes in lipid mass are sustained for at least 60 min. The level of phosphatidylinositol shows a delayed and progressive decrease during a 60-min period of carbachol stimulation. The addition of atropine reverses these responses completely. Carbachol stimulates a rapid loss in [3H]inositol radioactivity from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate associated with production of [3H]inositol trisphosphate. The carbachol-induced change in the mass of phosphoinositides and phosphatidic acid is not affected by removal of extracellular Ca2+ and does not appear to be secondary to an increase in intracellular Ca2+. These results indicate that carbachol causes phospholipase C-mediated polyphosphoinositide breakdown, resulting in the production of inositol trisphosphate and a sustained increase in the actual content of 1,2-diacylglycerol. These results strongly suggest that carbachol-induced contraction is mediated by the hydrolysis of polyphosphoinositides with the resulting generation of two messengers: inositol 1,4,5-trisphosphate and 1,2-diacylglycerol.

  17. Carbachol induces a rapid and sustained hydrolysis of polyphosphoinositide in bovine tracheal smooth muscle measurements of the mass of polyphosphoinositides, 1,2-diacylglycerol, and phosphatidic acid

    SciTech Connect

    Takuwa, Y.; Takuwa, N.; Rasmussen, H.

    1986-11-05

    The effects of carbachol on polyphosphoinositides and 1,2-diacylglycerol metabolism were investigated in bovine tracheal smooth muscle by measuring both lipid mass and the turnover of (/sup 3/H)inositol-labeled phosphoinositides. Carbachol induces a rapid reduction in the mass of phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate and a rapid increase in the mass of 1,2-diacylglycerol and phosphatidic acid. These changes in lipid mass are sustained for at least 60 min. The level of phosphatidylinositol shows a delayed and progressive decrease during a 60-min period of carbachol stimulation. The addition of atropine reverses these responses completely. Carbachol stimulates a rapid loss in (/sup 3/H)inositol radioactivity from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate associated with production of (/sup 3/H)inositol trisphosphate. The carbachol-induced change in the mass of phosphoinositides and phosphatidic acid is not affected by removal of extracellular Ca/sup 2 +/ and does not appear to be secondary to an increase in intracellular Ca/sup 2 +/. These results indicate that carbachol causes phospholipase C-mediated polyphosphoinositide breakdown, resulting in the production of inositol trisphosphate and a sustained increase in the actual content of 1,2-diacylglycerol. These results strongly suggest that carbachol-induced contraction is mediated by the hydrolysis of polyphosphoinositides with the resulting generation of two messengers: inositol 1,4,5-trisphosphate and 1,2-diacylglycerol.

  18. Galectin-8 Induces Apoptosis in Jurkat T Cells by Phosphatidic Acid-mediated ERK1/2 Activation Supported by Protein Kinase A Down-regulation*

    PubMed Central

    Norambuena, Andrés; Metz, Claudia; Vicuña, Lucas; Silva, Antonia; Pardo, Evelyn; Oyanadel, Claudia; Massardo, Loreto; González, Alfonso; Soza, Andrea

    2009-01-01

    Galectins have been implicated in T cell homeostasis playing complementary pro-apoptotic roles. Here we show that galectin-8 (Gal-8) is a potent pro-apoptotic agent in Jurkat T cells inducing a complex phospholipase D/phosphatidic acid signaling pathway that has not been reported for any galectin before. Gal-8 increases phosphatidic signaling, which enhances the activity of both ERK1/2 and type 4 phosphodiesterases (PDE4), with a subsequent decrease in basal protein kinase A activity. Strikingly, rolipram inhibition of PDE4 decreases ERK1/2 activity. Thus Gal-8-induced PDE4 activation releases a negative influence of cAMP/protein kinase A on ERK1/2. The resulting strong ERK1/2 activation leads to expression of the death factor Fas ligand and caspase-mediated apoptosis. Several conditions that decrease ERK1/2 activity also decrease apoptosis, such as anti-Fas ligand blocking antibodies. In addition, experiments with freshly isolated human peripheral blood mononuclear cells, previously stimulated with anti-CD3 and anti-CD28, show that Gal-8 is pro-apoptotic on activated T cells, most likely on a subpopulation of them. Anti-Gal-8 autoantibodies from patients with systemic lupus erythematosus block the apoptotic effect of Gal-8. These results implicate Gal-8 as a novel T cell suppressive factor, which can be counterbalanced by function-blocking autoantibodies in autoimmunity. PMID:19276072

  19. Phospholipase D and phosphatidic acid in plant defence response: from protein-protein and lipid-protein interactions to hormone signalling.

    PubMed

    Zhao, Jian

    2015-04-01

    Phospholipase Ds (PLDs) and PLD-derived phosphatidic acids (PAs) play vital roles in plant hormonal and environmental responses and various cellular dynamics. Recent studies have further expanded the functions of PLDs and PAs into plant-microbe interaction. The molecular diversities and redundant functions make PLD-PA an important signalling complex regulating lipid metabolism, cytoskeleton dynamics, vesicle trafficking, and hormonal signalling in plant defence through protein-protein and protein-lipid interactions or hormone signalling. Different PLD-PA signalling complexes and their targets have emerged as fast-growing research topics for understanding their numerous but not yet established roles in modifying pathogen perception, signal transduction, and downstream defence responses. Meanwhile, advanced lipidomics tools have allowed researchers to reveal further the mechanisms of PLD-PA signalling complexes in regulating lipid metabolism and signalling, and their impacts on jasmonic acid/oxylipins, salicylic acid, and other hormone signalling pathways that essentially mediate plant defence responses. This review attempts to summarize the progress made in spatial and temporal PLD/PA signalling as well as PLD/PA-mediated modification of plant defence. It presents an in-depth discussion on the functions and potential mechanisms of PLD-PA complexes in regulating actin filament/microtubule cytoskeleton, vesicle trafficking, and hormonal signalling, and in influencing lipid metabolism-derived metabolites as critical signalling components in plant defence responses. The discussion puts PLD-PA in a broader context in order to guide future research.

  20. Phosphatidic acid and phosphoinositides facilitate liposome association of Yas3p and potentiate derepression of ARE1 (alkane-responsive element one)-mediated transcription control.

    PubMed

    Kobayashi, Satoshi; Hirakawa, Kiyoshi; Horiuchi, Hiroyuki; Fukuda, Ryouichi; Ohta, Akinori

    2013-12-01

    In the n-alkane assimilating yeast Yarrowia lipolytica, the expression of ALK1, encoding a cytochrome P450 that catalyzes terminal mono-oxygenation of n-alkanes, is induced by n-alkanes. The transcription of ALK1 is regulated by a heterocomplex that comprises the basic helix-loop-helix transcription activators, Yas1p and Yas2p, and binds to alkane-responsive element 1 (ARE1) in the ALK1 promoter. An Opi1 family transcription repressor, Yas3p, represses transcription by binding to Yas2p. Yas3p localizes in the nucleus when Y. lipolytica is grown on glucose but localizes to the endoplasmic reticulum (ER) upon the addition of n-alkanes. In this study, we showed that recombinant Yas3p binds to the acidic phospholipids, phosphatidic acid (PA) and phosphoinositides (PIPs), in vitro. The ARE1-mediated transcription was enhanced in vivo in mutants defective in an ortholog of the Saccharomyces cerevisiae gene PAH1, encoding PA phosphatase, and in an ortholog of SAC1, encoding PIP phosphatase in the ER. Truncation mutation analyses for Yas3p revealed two regions that bound to PA and PIPs. These results suggest that the interaction with acidic phospholipids is important for the n-alkane-induced association of Yas3p with the ER membrane.

  1. Nonideal mixing and phase separation in phosphatidylcholine-phosphatidic acid mixtures as a function of acyl chain length and pH.

    PubMed Central

    Garidel, P; Johann, C; Blume, A

    1997-01-01

    The miscibilities of phosphatidic acids (PAs) and phosphatidylcholines (PCs) with different chain lengths (n = 14, 16) at pH 4, pH 7, and pH 12 were examined by differential scanning calorimetry. Simulation of heat capacity curves was performed using a new approach that incorporates changes of cooperativity of the transition in addition to nonideal mixing in the gel and the liquid-crystalline phase as a function of composition. From the simulations of the heat capacity curves, first estimates for the nonideality parameters for nonideal mixing as a function of composition were obtained, and phase diagrams were constructed using temperatures for onset and end of melting, which were corrected for the broadening effect caused by a decrease in cooperativity. In all cases the composition dependence of the nonideality parameters indicated nonsymmetrical mixing behavior. The phase diagrams were therefore further refined by simulations of the coexistence curves using a four-parameter approximation to account for nonideal and nonsymmetrical mixing in the gel and the liquid-crystalline phase. The mixing behavior was studied at three different pH values to investigate how changes in headgroup charge of the PA influences the miscibility. The experiments showed that at pH 7, where the PA component is negatively charged, the nonideality parameters are in most cases negative, indicating that electrostatic effects favor a mixing of the two components. Partial protonation of the PA component at pH 4 leads to strong changes in miscibility; the nonideality parameters for the liquid-crystalline phase are now in most cases positive, indicating clustering of like molecules. The phase diagram for 1,2-dimyristoyl-sn-glycero-3-phosphatidic acid:1,2-dipalmitoyl-sn-glycero-3-phosphorylcholine mixtures at pH 4 indicates that a fluid-fluid immiscibility is likely. The results show that a decrease in ionization of PAs can induce large changes in mixing behavior. This occurs because of a

  2. Defense activation triggers differential expression of phospholipase-C (PLC) genes and elevated temperature induces phosphatidic acid (PA) accumulation in tomato

    PubMed Central

    Abd-El-Haliem, Ahmed; Meijer, Harold J.G.; Tameling, Wladimir I.L.; Vossen, Jack H.; Joosten, Matthieu H.A.J.

    2012-01-01

    Recently, we provided the first genetic evidence for the requirement of tomato PLC4 and PLC6 genes in defense activation and disease resistance. The encoded enzymes were catalytically active as they were able to degrade phosphatidylinositol (PI), thereby producing diacylglycerol (DG). Here we report differential PLC gene expression following the initiation of defense signaling by the interaction between Cladosporium fulvum resistance (R) protein Cf-4 and its matching effector Avr4 in tomato hybrid seedlings that express both Cf-4 and Avr4. Furthermore, we observed that PLC3 and PLC6 gene expression is upregulated by elevated temperature in the control seedlings. This upregulation coincides with an increase in the levels of phosphatidic acid (PA) and a decrease in the levels of PI and phosphatidylinositol phosphate (PIP). The decrease in PI and PIP levels matches with the activation of PLC. In addition, the levels of the structural phospholipids phosphatidylcholine (PC), phosphatidylethanolamine (PE) and phosphatidylglycerol (PG) declined transiently during recovery after the exposure to elevated temperature., Further studies will be required to explain the mechanism causing the sustained accumulation of PA during recovery, combined with a reduction in the levels of structural phospholipids. PMID:22899083

  3. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

    PubMed

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-04-09

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

  4. RNA Sequencing Identifies Upregulated Kyphoscoliosis Peptidase and Phosphatidic Acid Signaling Pathways in Muscle Hypertrophy Generated by Transgenic Expression of Myostatin Propeptide

    PubMed Central

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-01-01

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition. PMID:25860951

  5. Cyclic phosphatidic acid inhibits alkyl-glycerophosphate-induced downregulation of histone deacetylase 2 expression and suppresses the inflammatory response in human coronary artery endothelial cells.

    PubMed

    Tsukahara, Tamotsu; Haniu, Hisao; Matsuda, Yoshikazu

    2014-01-01

    Activation of the endothelium by alkyl-glycerophosphate (AGP) has been implicated in the development of atherosclerosis. Our previous study suggested that cyclic phosphatidic acid (cPA) inhibits arterial wall remodeling in a rat model in vivo. However, the mechanisms through which specific target genes are regulated during this process remain unclear. Here, we examined whether cPA inhibited AGP-induced expression of class I histone deacetylases (HDACs, namely HDAC1, HDAC2, HDAC3, and HDAC8), which may affect subsequent transcriptional activity of target genes. Our experimental results showed that human coronary artery endothelial cells (HCAECs) expressed high levels of HDAC2 and low levels HDAC1, HDAC3, and HDAC8. Moreover, AGP treatment induced downregulation of HDAC2 expression in HCAECs. However, cotreatment with cPA inhibited this downregulation of HDAC2 expression. Interestingly, treatment with AGP increased the expression and secretion of endogenous interleukin (IL)-6 and IL-8; however, this effect was inhibited when HCAECs were cotreated with cPA or the synthetic peroxisome proliferator-activator receptor gamma (PPARγ) antagonist T0070907. Thus, our data suggested that cPA may have beneficial effects in inflammation-related cardiovascular disease by controlling HDAC2 regulation.

  6. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. The FKBP-rapamycin binding domain of human TOR undergoes strong conformational changes in the presence of membrane mimetics with and without the regulator phosphatidic acid.

    PubMed

    Rodriguez Camargo, Diana C; Link, Nina M; Dames, Sonja A

    2012-06-19

    The Ser/Thr kinase target of rapamycin (TOR) is a central controller of cellular growth and metabolism. Misregulation of TOR signaling is involved in metabolic and neurological disorders and tumor formation. TOR can be inhibited by association of a complex of rapamycin and FKBP12 to the FKBP12-rapamycin binding (FRB) domain. This domain was further proposed to interact with phosphatidic acid (PA), a lipid second messenger present in cellular membranes. Because mammalian TOR has been localized at various cellular membranes and in the nucleus, the output of TOR signaling may depend on its localization, which is expected to be influenced by the interaction with complex partners and regulators in response to cellular signals. Here, we present a detailed characterization of the interaction of the FRB domain with PA and how it is influenced by the surrounding membrane environment. On the basis of nuclear magnetic resonance- and circular dichroism-monitored binding studies using different neutral and negatively charged lipids as well as different membrane mimetics (micelles, bicelles, and liposomes), the FRB domain may function as a conditional peripheral membrane protein. However, the data for the isolated domain just indicate an increased affinity for negatively charged lipids and membrane patches but no specific preference for PA or PA-enriched regions. The membrane-mimetic environment induces strong conformational changes that largely maintain the α-helical secondary structure content but presumably disperse the helices in the lipidic environment. Consistent with overlapping binding surfaces for different lipids and the FKBP12-rapamycin complex, binding of the inhibitor complex protects the FRB domain from interactions with membrane mimetics at lower lipid concentrations.

  8. Structural Insights into the Inhibition of Actin-Capping Protein by Interactions with Phosphatidic Acid and Phosphatidylinositol (4,5)-Bisphosphate

    PubMed Central

    Pleskot, Roman; Pejchar, Přemysl; Žárský, Viktor; Staiger, Christopher J.; Potocký, Martin

    2012-01-01

    The actin cytoskeleton is a dynamic structure that coordinates numerous fundamental processes in eukaryotic cells. Dozens of actin-binding proteins are known to be involved in the regulation of actin filament organization or turnover and many of these are stimulus-response regulators of phospholipid signaling. One of these proteins is the heterodimeric actin-capping protein (CP) which binds the barbed end of actin filaments with high affinity and inhibits both addition and loss of actin monomers at this end. The ability of CP to bind filaments is regulated by signaling phospholipids, which inhibit the activity of CP; however, the exact mechanism of this regulation and the residues on CP responsible for lipid interactions is not fully resolved. Here, we focus on the interaction of CP with two signaling phospholipids, phosphatidic acid (PA) and phosphatidylinositol (4,5)-bisphosphate (PIP2). Using different methods of computational biology such as homology modeling, molecular docking and coarse-grained molecular dynamics, we uncovered specific modes of high affinity interaction between membranes containing PA/phosphatidylcholine (PC) and plant CP, as well as between PIP2/PC and animal CP. In particular, we identified differences in the binding of membrane lipids by animal and plant CP, explaining previously published experimental results. Furthermore, we pinpoint the critical importance of the C-terminal part of plant CPα subunit for CP–membrane interactions. We prepared a GST-fusion protein for the C-terminal domain of plant α subunit and verified this hypothesis with lipid-binding assays in vitro. PMID:23133367

  9. Phospholipase D-modified low density lipoprotein is taken up by macrophages at increased rate. A possible role for phosphatidic acid.

    PubMed Central

    Aviram, M; Maor, I

    1993-01-01

    Macrophage uptake of modified forms of LDL leads to cellular cholesterol accumulation. Upon incubation of LDL with phospholipase D (PLase D), a time- and enzyme dose-dependent production of phosphatidic acid (PA), paralleled by a rapid reduction in LDL phosphatidyl choline content (up to 65% within 15 min of incubation) was noted. No lipid peroxidation could be found in PLase D-modified LDL. Upon in vitro incubation of PLase D-LDL with copper ions, however, this modified LDL was substantially oxidized. The addition of 100 micrograms PA/ml to native LDL for the period of its in vitro oxidation resulted in a 63% elevation in the lipoprotein peroxides content. Incubation of PLase D-LDL with J-774A.1 macrophage-like cell line resulted in an increase in its cellular binding and degradation (up to 91 and 110%, respectively) in comparison with native LDL (via the LDL receptor). When PA was added to LDL before its incubation with the macrophages, a PA dose-dependent elevation in the cellular uptake of LDL (by up to twofold) was noted in comparison with LDL that was incubated without PA, suggesting that PA production in PLase D-LDL may be involved in the increased cellular uptake of PLase D-LDL. PLase D activity towards LDL was demonstrated in J-774A.1 macrophages. Human plasma was also shown to possess PLase D activity. Thus, PLase D modification of LDL may take place under certain pathological conditions and PLase D-LDL interaction with arterial wall macrophages can potentially lead to foam cell formation. PMID:8486764

  10. Eight Weeks of Phosphatidic Acid Supplementation in Conjunction with Resistance Training Does Not Differentially Affect Body Composition and Muscle Strength in Resistance-Trained Men.

    PubMed

    Andre, Thomas L; Gann, Joshua J; McKinley-Barnard, Sarah K; Song, Joon J; Willoughby, Darryn S

    2016-09-01

    This study attempted to determine the effects of eight weeks of resistance training (RT) combined with phosphatidic acid (PA) supplementation at a dose of either 250 mg or 375 mg on body composition and muscle size and strength. Twenty-eight resistance-trained men were randomly assigned to ingest 375 mg [PA375 (n = 9)] or 250 mg [PA250 (n = 9)] of PA or 375 mg of placebo [PLC (n = 10)] daily for eight weeks with RT. Supplements were ingested 60 minutes prior to RT and in the morning on non-RT days. Participants' body composition, muscle size, and lower-body muscle strength were determined before and after training/supplementation. Separate group x time ANOVAs for each criterion variable were used employing an alpha level of ≤ 0.05. Magnitude- based inferences were utilized to determine the likely or unlikely impact of PA on each criterion variable. A significant main effect for time was observed for improvements in total body mass (p = 0.003), lean mass (p = 0.008), rectus femoris cross-sectional area [RF CSA (p = 0.011)], and lower-body strength (p < 0.001), but no significant interactions were present (p > 0.05). Collectively, magnitude-based inferences determined both doses of PA to have a likely impact of increasing body mass (74.2%), lean mass (71.3%), RF CSA (92.2%), and very likely impact on increasing lower-body strength (98.1% beneficial). When combined with RT, it appears that PA has a more than likely impact on improving lower-body strength, whereas a likely impact exists for increasing muscle size and lean mass.

  11. The acylation of sn-glycerol 3-phosphate and the metabolism of phosphatidate in microsomal preparations from the developing cotyledons of safflower (Carthamus tinctorius L.) seed.

    PubMed

    Griffiths, G; Stobart, A K; Stymne, S

    1985-09-01

    Microsomal preparations from the developing cotyledons of safflower (Carthamus tinctorius) catalysed the acylation of sn-glycerol 3-phosphate in the presence of acyl-CoA. The resulting phosphatidate was further utilized in the synthesis of diacyl- and tri-acylglycerol by the reactions of the so-called 'Kennedy pathway' [Kennedy (1961) Fed. Proc. Fed. Am. Soc. Exp. Biol. 20, 934-940]. Diacylglycerol equilibrated with the phosphatidylcholine pool when glycerol backbone, with the associated acyl groups, flowed from phosphatidate to triacylglycerol. The formation of diacylglycerol from phosphatidate through the action of a phosphatidate phosphohydrolase (phosphatidase) was substantially inhibited by EDTA and, under these conditions, phosphatidate accumulated in the microsomal membranes. The inhibition of the phosphatidase by EDTA was alleviated by Mg2+. The presence of Mg2+ in all incubation mixtures stimulated quite considerably the synthesis of triacylglycerol in vitro. Microsomal preparations incubated with acyl-CoA, sn-glycerol 3-phosphate and EDTA synthesized sufficient phosphatidate for the reliable analysis of its intramolecular fatty acid distribution. In the presence of mixed acyl-CoA substrates the sn-glycerol 3-phosphate was acylated exclusively in position 1 with the saturated fatty acids, palmitate and stearate. The polyunsaturated fatty acid linoleate was, however, utilized largely in the acylation of position 2 of sn-glycerol 3-phosphate. The affinity of the enzymes involved in the acylation of positions 1 and 2 of sn-glycerol 3-phosphate for specific species of acyl-CoA therefore governs the non-random distribution of the different acyl groups in the seed triacylglycerols. The acylation of sn-glycerol 3-phosphate in position 1 with saturated acyl components also accounts for the presence of these groups in position 1 of sn-phosphatidylcholine through the equilibration of diacylglycerol with the phosphatidylcholine pool, which occurs when phosphatidate

  12. Eight Weeks of Phosphatidic Acid Supplementation in Conjunction with Resistance Training Does Not Differentially Affect Body Composition and Muscle Strength in Resistance-Trained Men

    PubMed Central

    Andre, Thomas L.; Gann, Joshua J.; McKinley-Barnard, Sarah K.; Song, Joon J.; Willoughby, Darryn S.

    2016-01-01

    This study attempted to determine the effects of eight weeks of resistance training (RT) combined with phosphatidic acid (PA) supplementation at a dose of either 250 mg or 375 mg on body composition and muscle size and strength. Twenty-eight resistance-trained men were randomly assigned to ingest 375 mg [PA375 (n = 9)] or 250 mg [PA250 (n = 9)] of PA or 375 mg of placebo [PLC (n = 10)] daily for eight weeks with RT. Supplements were ingested 60 minutes prior to RT and in the morning on non-RT days. Participants’ body composition, muscle size, and lower-body muscle strength were determined before and after training/supplementation. Separate group x time ANOVAs for each criterion variable were used employing an alpha level of ≤ 0.05. Magnitude- based inferences were utilized to determine the likely or unlikely impact of PA on each criterion variable. A significant main effect for time was observed for improvements in total body mass (p = 0.003), lean mass (p = 0.008), rectus femoris cross-sectional area [RF CSA (p = 0.011)], and lower-body strength (p < 0.001), but no significant interactions were present (p > 0.05). Collectively, magnitude-based inferences determined both doses of PA to have a likely impact of increasing body mass (74.2%), lean mass (71.3%), RF CSA (92.2%), and very likely impact on increasing lower-body strength (98.1% beneficial). When combined with RT, it appears that PA has a more than likely impact on improving lower-body strength, whereas a likely impact exists for increasing muscle size and lean mass. Key points In response to eight weeks resistance training and PLC and PA (375 mg and 250 mg) supplementation, similar increases in lower-body muscle strength occurred in all three groups; however, the increases were not different between supplement groups. In response to eight weeks resistance training and PLC and PA (375 mg and 250 mg) supplementation, similar increases in lean mass occurred in all three groups; however, the increases were

  13. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  14. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  15. Effect of BN 52021, a specific antagonist of platelet activating factor (PAF-acether), on calcium movements and phosphatidic acid production induced by PAF-acether in human platelets

    SciTech Connect

    Simon, M.F.; Chap, H.; Braquet, P.; Douste-Blazy, L.

    1987-02-15

    /sup 32/P-labelled human platelets loaded with quin 2 and pretreated with aspirin were stimulated with 1-100 nM platelet activating factor (PAF-acether or 1-0-alkyl-2-acetyl-sn-glycero-3-phosphocholine) in a medium containing the ADP-scavenging system creatine phosphate/creatine phosphokinase. Under these conditions, PAF-acether evoked a characteristic fluorescence change allowing to quantify elevations in cytoplasmic free Ca/sup 2 +/ from internal stores (Ca/sup 2 +/ mobilization) or from external medium (Ca/sup 2 +/ influx), as well as an increased production of phosphatidic acid, reflecting phospholipase C activation. These effects, which can be attributed to PAF-acether only and not to released products such as ADP or thromboxane A2, were strongly inhibited in a dose-dependent manner by BN 52021, a specific antagonist of PAF-acether isolated from Ginkgo biloba. As the drug remained inactive against the same effects elicited by thrombin, it is concluded that BN 52021 does not interfere directly with the mechanism of transmembrane signalling involving inositol-phospholipids or (and) some putative receptor-operated channels, but rather acts on the binding of PAF-acether to its presumed membrane receptor.

  16. Cloning and characterization of a novel human phosphatidic acid phosphatase type 2, PAP2d, with two different transcripts PAP2d_v1 and PAP2d_v2.

    PubMed

    Sun, Liyun; Gu, Shaohua; Sun, Yaqiong; Zheng, Dan; Wu, Qihan; Li, Xin; Dai, Jianfeng; Dai, Jianliang; Ji, Chaoneng; Xie, Yi; Mao, Yumin

    2005-04-01

    This study reports the cloning and characterization of a novel human phosphatidic acid phosphatase type 2 isoform cDNAs (PAP2d) from the foetal brain cDNA library. The PAP2d gene is localized on chromosome 1p21.3. It contains six exons and spans 112 kb of the genomic DNA. By large-scale cDNA sequencing we found two splice variants of PAP2d, PAP2d_v1 and PAP2d_v2. The PAP2d_v1 cDNA is 1722 bp in length and spans an open reading frame from nucleotide 56 to 1021, encoding a 321aa protein. The PAP2d_v2 cDNA is 1707 bp in length encoding a 316aa protein from nucleotide 56-1006. The PAP2d_v1 cDNA is 15 bp longer than the PAP2d_v2 cDNA in the terminal of the fifth exon and it creates different ORF. Both of the proteins contain a well-conserved PAP2 motif. The PAP2d_v1 is mainly expressed in human brain, lung, kidney, testis and colon, while PAP2d_v2 is restricted to human placenta, skeletal muscle, and kidney. The two splice variants are co-expressed only in kidney.

  17. Acetylglyceryl ether phosphorylcholine (AGEPC; platelet-activating factor)-induced stimulation of rabbit platelets: correlation between phosphatidic acid level, 45Ca2+ uptake, and (3H)serotonin secretion

    SciTech Connect

    Shukla, S.D.; Hanahan, D.J.

    1984-08-01

    When 32P-labeled rabbits platelet were incubated with 5 X 10(-10) M 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine (AGEPC), either in the presence or absence (0.1 mM EGTA) of added Ca2+, there was a three- to five-fold increase in the (32P)phosphatidic acid (PA) pool within 15 to 20 s. This event was followed by a gradual decrease in the (32P)PA level to near basal level in 5 min. AGEPC effected this change in (32P)PA in a characteristic dose- and time-dependent manner. Polar head group analogs of AGEPC, such as AGEDME and AGEMME, also effected an increase in PA labeling at levels comparable to those previously reported for their activity toward rabbit platelets. Other analogs, i.e., lysoGEPC and the enantiomer, sn-1-AGEPC, which are inactive toward rabbit platelets, also showed no effect on the level of (32P)PA. The finding that the PA level in rabbit platelets could be manipulated by the addition of AGEPC, without any added Ca2+, provided an excellent model system for establishing a correlation between the uptake of Ca2+, serotonin release, and PA level. Thus, PA must be regarded as a sensitive indicator of a reaction mechanism important to the platelet response to AGEPC, and could be the focal point in promoting calcium uptake during the stimulation process.

  18. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  19. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  20. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  1. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  2. Identification of an Mg2+-independent soluble phosphatidate phosphatase in cottonseed (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton (Gossypium hirsutum L.) provides a major source of oil for food and feed industries, but little was known about the oil biosynthesis pathway in cottonseed. Towards understanding the biochemical pathway of oil accumulation in cottonseed, this study focused on phosphatidic acid phosphatase (PAP...

  3. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  4. Effects of acetylcholine and other agents on /sup 32/P-prelabeled phosphoinositides and phosphatidate in crude synaptosomal preparations

    SciTech Connect

    White, H.L.

    1988-05-01

    Experimental conditions are described which permit effects of various agents on polyphosphoinositides and phosphatidic acid (PA) to be evaluated simultaneously in crude nerve-ending preparations from rat brain. Acetylcholine (3-100 microM) or carbachol (30-1,000 microM) induced the hydrolysis of prelabeled polyphosphoinositides and, at the same time, stimulated the net label incorporated in phosphatidic acid. All muscarinic effects were blocked by atropine or pirenzepine. Non-muscarinic agonists (glutamate, adenosine, norepinephrine) stimulated polyphosphoinositide hydrolysis in this preparation, but of these only norepinephrine affected phosphatidic acid turnover. A potentiation of acetylcholine-induced phosphoinositide turnover by KCl was observed, as well as an apparent selective inhibition of PIP2 hydrolysis by LiCl. Acetylcholine-stimulated turnover of PA was not necessarily coupled to phosphoinositide hydrolysis.

  5. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  6. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  7. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  8. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  9. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  10. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  11. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  12. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  13. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  14. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  15. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  16. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  17. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  18. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  19. Resynthesis of phosphatidylinositol in permeabilized neutrophils following phospholipase Cbeta activation: transport of the intermediate, phosphatidic acid, from the plasma membrane to the endoplasmic reticulum for phosphatidylinositol resynthesis is not dependent on soluble lipid carriers or vesicular transport.

    PubMed Central

    Whatmore, J; Wiedemann, C; Somerharju, P; Swigart, P; Cockcroft, S

    1999-01-01

    Receptor-mediated phospholipase C (PLC) hydrolysis of phosphoinositides is accompanied by the resynthesis of phosphatidylinositol (PI). Hydrolysis of phosphoinositides occurs at the plasma membrane, and the resulting diacylglycerol (DG) is converted into phosphatidate (PA). Two enzymes located at the endoplasmic reticulum (ER) function sequentially to convert PA back into PI. We have established an assay whereby the resynthesis of PI could be followed in permeabilized cells. In the presence of [gamma-32P]ATP, DG generated by PLC activation accumulates label when converted into PA. The 32P-labelled PA is subsequently converted into labelled PI. The formation of labelled PI reports the arrival of labelled PA from the plasma membrane to the ER. Cytosol-depleted, permeabilized human neutrophils are capable of PI resynthesis following stimulation of PLCbeta (in the presence of phosphatidylinositol-transfer protein), provided that CTP and inositol are also present. We also found that wortmannin, an inhibitor of endocytosis, or cooling the cells to 15 degrees C did not stop PI resynthesis. We conclude that PI resynthesis is dependent neither on vesicular transport mechanisms nor on freely diffusible, soluble transport proteins. Phosphatidylcholine-derived PA generated by the ADP-ribosylation-factor-stimulated phospholipase D pathway was found to accumulate label, reflecting the rapid cycling of PA to DG, and back. This labelled PA was not converted into PI. We conclude that PA derived from the PLC pathway is selected for PI resynthesis, and its transfer to the ER could be membrane-protein-mediated at sites of close membrane contact. PMID:10393103

  20. Synthesis of phosphatidylcholine under possible primitive earth conditions

    NASA Technical Reports Server (NTRS)

    Rao, M.; Eichberg, J.; Oro, J.

    1982-01-01

    Using a primitive earth evaporating pond model, the synthesis of phosphatidylcholine was accomplished when a reaction mixture of choline chloride and disodium phosphatidate, in the presence of cyanamide and traces of acid, was evaporated and heated at temperatures ranging from 25 to 100 C for 7 hours. Optimum yields of about 15% were obtained at 80 C. Phosphatidylcholine was identified by chromatographic, chemical and enzymatic degradation methods. On enzymatic hydrolysis with phospholipase A2 and phospholipase C, lysophosphatidylcholine and phosphorylcholine were formed, respectively. Alkaline hydrolysis gave glycerophosphorylcholine. The synthesis of phosphatidylcholine as the major compound was accompanied by the formation of lysophosphatidylcholine in smaller amounts. Cyanamide was found to be essential for the formation of phosphatidylcholine, and only traces of HCl, of the order of that required to convert the disodium phosphatidate to free phosphatidic acid were found necessary for the synthesis. This work suggests that phosphatidylcholine, which is an essential component of most biological membranes, could have been synthesized on the primitive earth.

  1. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  2. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  3. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  4. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  5. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  6. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  7. Apicoplast-Localized Lysophosphatidic Acid Precursor Assembly Is Required for Bulk Phospholipid Synthesis in Toxoplasma gondii and Relies on an Algal/Plant-Like Glycerol 3-Phosphate Acyltransferase

    PubMed Central

    Callahan, Damien L.; Dubois, David; van Dooren, Giel G.; Shears, Melanie J.; Cesbron-Delauw, Marie-France; Maréchal, Eric; McConville, Malcolm J.; McFadden, Geoffrey I.; Yamaryo-Botté, Yoshiki; Botté, Cyrille Y.

    2016-01-01

    Most apicomplexan parasites possess a non-photosynthetic plastid (the apicoplast), which harbors enzymes for a number of metabolic pathways, including a prokaryotic type II fatty acid synthesis (FASII) pathway. In Toxoplasma gondii, the causative agent of toxoplasmosis, the FASII pathway is essential for parasite growth and infectivity. However, little is known about the fate of fatty acids synthesized by FASII. In this study, we have investigated the function of a plant-like glycerol 3-phosphate acyltransferase (TgATS1) that localizes to the T. gondii apicoplast. Knock-down of TgATS1 resulted in significantly reduced incorporation of FASII-synthesized fatty acids into phosphatidic acid and downstream phospholipids and a severe defect in intracellular parasite replication and survival. Lipidomic analysis demonstrated that lipid precursors are made in, and exported from, the apicoplast for de novo biosynthesis of bulk phospholipids. This study reveals that the apicoplast-located FASII and ATS1, which are primarily used to generate plastid galactolipids in plants and algae, instead generate bulk phospholipids for membrane biogenesis in T. gondii. PMID:27490259

  8. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  9. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  10. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  11. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  12. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  13. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  14. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  15. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  16. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  17. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  18. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  19. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  20. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  1. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  2. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  3. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  4. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  5. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  6. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  7. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  8. The He(I) photoelectron spectra of lipid phosphatides

    NASA Astrophysics Data System (ADS)

    Ballard, R. E.; Jones, Jimmy; Read, Derek; Inchley, Andrew

    1986-12-01

    Complete layers of some lipids are formed spontaneously on the surfaces of solutions of sufficient concentration in certain solvents, e.g. phosphatidylcholine (egg lecithin) and phosphatidylinositol (wheat germ) dissolved in hydroxypropionitrile. The He(I) photoelectron spectra of phosphatides in such layers contain: (1) a broad band, assigned to alkyl groups, with maximum intensity at about 11 eV, (2) another broad band at about 8 eV, assigned to the PO -4 group with about 1 % of the band area of (1).

  9. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  10. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  11. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  12. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  13. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  14. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  15. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  16. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  17. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  18. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  19. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  20. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  1. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  2. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  3. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  4. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  5. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  6. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  7. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  8. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  9. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  10. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  11. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  12. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  13. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  14. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  15. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  16. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  17. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  18. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  19. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  20. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  1. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  2. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  3. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  4. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  5. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  6. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  7. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  8. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  9. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  10. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  11. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  12. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  13. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  14. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  15. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  16. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  17. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  18. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  19. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  20. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  1. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  2. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  3. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  4. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  5. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  6. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  7. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  8. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  9. Epidermal growth factor receptor endocytic traffic perturbation by phosphatidate phosphohydrolase inhibition: new strategy against cancer.

    PubMed

    Shaughnessy, Ronan; Retamal, Claudio; Oyanadel, Claudia; Norambuena, Andrés; López, Alejandro; Bravo-Zehnder, Marcela; Montecino, Fabian J; Metz, Claudia; Soza, Andrea; González, Alfonso

    2014-05-01

    Epidermal growth factor receptor (EGFR) exaggerated (oncogenic) function is currently targeted in cancer treatment with drugs that block receptor ligand binding or tyrosine kinase activity. Because endocytic trafficking is a crucial regulator of EGFR function, its pharmacological perturbation might provide a new anti-tumoral strategy. Inhibition of phosphatidic acid (PA) phosphohydrolase (PAP) activity has been shown to trigger PA signaling towards type 4 phosphodiesterase (PDE4) activation and protein kinase A inhibition, leading to internalization of empty/inactive EGFR. Here, we used propranolol, its l- and d- isomers and desipramine as PAP inhibitors to further explore the effects of PAP inhibition on EGFR endocytic trafficking and its consequences on EGFR-dependent cancer cell line models. PAP inhibition not only made EGFR inaccessible to stimuli but also prolonged the signaling lifetime of ligand-activated EGFR in recycling endosomes. Strikingly, such endocytic perturbations applied in acute/intermittent PAP inhibitor treatments selectively impaired cell proliferation/viability sustained by an exaggerated EGFR function. Phospholipase D inhibition with FIPI (5-fluoro-2-indolyl des-chlorohalopemide) and PDE4 inhibition with rolipram abrogated both the anti-tumoral and endocytic effects of PAP inhibition. Prolonged treatments with a low concentration of PAP inhibitors, although without detectable endocytic effects, still counteracted cell proliferation, induced apoptosis and decreased anchorage-independent growth of cells bearing EGFR oncogenic influences. Overall, our results show that PAP inhibitors can counteract EGFR oncogenic traits, including receptor overexpression or activating mutations resistant to current tyrosine kinase inhibitors, perturbing EGFR endocytic trafficking and perhaps other as yet unknown processes, depending on treatment conditions. This puts PAP activity forward as a new suitable target against EGFR-driven malignancy.

  10. Efficient synthesis of phosphatidylserine in 2-methyltetrahydrofuran.

    PubMed

    Duan, Zhang-Qun; Hu, Fei

    2013-01-10

    2-Methyltetrahydrofuran has recently been described as a promising and green solvent. Herein, it was successfully used as the reaction medium for enzyme-mediated transphosphatidylation of phosphatidylcholine with L-serine with the aim of phosphatidylserine synthesis for the first time. Our results indicated that as high as 90% yield of phosphatidylserine could be achieved after 12 h combined with no byproduct (phosphatidic acid) forming. The present work accommodated a facilely and efficiently enzymatic strategy for preparing phosphatidylserine, which possessed obvious advantages over the reported processes in terms of high efficiency and environmental friendliness. This work is also a proof-of-concept opening the use of 2-methyltetrahydrofuran in biosynthesis as well.

  11. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  12. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  13. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  14. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  15. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  16. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  17. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  18. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  19. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  20. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  1. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  2. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  3. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  4. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  5. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  6. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  7. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.

    PubMed

    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo

    2007-09-14

    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  8. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  9. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  10. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  11. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  12. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  13. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  14. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  15. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central

    2016-01-01

    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  16. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R

    1998-01-01

    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  17. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  18. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  19. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  20. An Unconventional Diacylglycerol Kinase That Regulates Phospholipid Synthesis and Nuclear Membrane Growth*♦

    PubMed Central

    Han, Gil-Soo; O'Hara, Laura; Carman, George M.; Siniossoglou, Symeon

    2008-01-01

    Changes in nuclear size and shape during the cell cycle or during development require coordinated nuclear membrane remodeling, but the underlying molecular events are largely unknown. We have shown previously that the activity of the conserved phosphatidate phosphatase Pah1p/Smp2p regulates nuclear structure in yeast by controlling phospholipid synthesis and membrane biogenesis at the nuclear envelope. Two screens for novel regulators of phosphatidate led to the identification of DGK1. We show that Dgk1p is a unique diacylglycerol kinase that uses CTP, instead of ATP, to generate phosphatidate. DGK1 counteracts the activity of PAH1 at the nuclear envelope by controlling phosphatidate levels. Overexpression of DGK1 causes the appearance of phosphatidate-enriched membranes around the nucleus and leads to its expansion, without proliferating the cortical endoplasmic reticulum membrane. Mutations that decrease phosphatidate levels decrease nuclear membrane growth in pah1Δ cells. We propose that phosphatidate metabolism is a critical factor determining nuclear structure by regulating nuclear membrane biogenesis. PMID:18458075

  1. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.

    PubMed

    Oudot, F; Grynberg, A; Sergiel, J P

    1995-01-01

    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  2. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  3. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.

    PubMed

    Gray, W J; Midgley, J E

    1972-08-01

    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  4. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  5. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-06-28

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  6. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  7. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  8. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  9. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  10. Prolonged stimulation of protein synthesis by leucine is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leucine is unique among the amino acids in its ability to enhance protein synthesis by activating translation initiation (Kimball and Jefferson, 2005). Our laboratory has shown that raising leucine to postprandial levels, whilst keeping all other amino acids at the post absorptive, level acutely st...

  11. Pyrazinoic acid decreases the proton motive force, respiratory ATP synthesis activity, and cellular ATP levels.

    PubMed

    Lu, Ping; Haagsma, Anna C; Pham, Hoang; Maaskant, Janneke J; Mol, Selena; Lill, Holger; Bald, Dirk

    2011-11-01

    Pyrazinoic acid, the active form of the first-line antituberculosis drug pyrazinamide, decreased the proton motive force and respiratory ATP synthesis rates in subcellular mycobacterial membrane assays. Pyrazinoic acid also significantly lowered cellular ATP levels in Mycobacterium bovis BCG. These results indicate that the predominant mechanism of killing by this drug may operate by depletion of cellular ATP reserves.

  12. Facile synthesis of nucleic acid-polymer amphiphiles and their self-assembly.

    PubMed

    Jia, Fei; Lu, Xueguang; Tan, Xuyu; Zhang, Ke

    2015-05-07

    A solid-phase synthesis for nucleic acid-polymer amphiphiles is developed. Using this strategy, several DNA-b-polymer amphiphiles are synthesized, and their self-assembly in aqueous solution is investigated. This general method can in principle be extended to nearly all polymers synthesized by atom transfer radical polymerization to produce a variety of nucleic acid-polymer conjugates.

  13. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.

    1966-01-01

    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  14. Total synthesis of racemic and (R) and (S)-4-methoxyalkanoic acids and their antifungal activity.

    PubMed

    Das, Biswanath; Shinde, Digambar Balaji; Kanth, Boddu Shashi; Kamle, Avijeet; Kumar, C Ganesh

    2011-07-01

    The total synthesis of 4-methoxydecanoic acid and 4-methoxyundecanoic acid in racemic and stereoselective [(R) and (S)] forms has been accomplished. For stereoselective synthesis of the compounds (S) and (R)-BINOL complexes have been used to generate the required chiral centres. The antifungal activity of these compounds has been studied against different organisms and the results were found to be impressive. The activity of the compounds in racemic and in stereoselective forms was compared. (R)-4-Methoxydecanoic acid was found to be most potent (MIC: 0.019 mg/mL against Candida albicans MTCC 227, C. albicans MTCC 4748, Aspergillus brasiliensis (niger) MTCC 281 and Issatchenkia orientalis MTCC 3020).

  15. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  16. Formamide Synthesis through Borinic Acid Catalysed Transamidation under Mild Conditions.

    PubMed

    Dine, Tharwat Mohy El; Evans, David; Rouden, Jacques; Blanchet, Jérôme

    2016-04-18

    A highly efficient and mild transamidation of amides with amines co-catalysed by borinic acid and acetic acid has been reported. A wide range of functionalised formamides was synthesized in excellent yields, including important chiral α-amino acid derivatives, with minor racemisation being observed. Experiments suggested that the reaction rely on a cooperative catalysis involving an enhanced boron-derived Lewis acidity rather than an improved Brønsted acidity of acetic acid.

  17. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  18. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  19. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  20. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  1. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  2. Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures

    PubMed Central

    Rodas-Junco, Beatriz A; Cab-Guillen, Yahaira; Muñoz-Sanchez, J Armando; Vázquez-Flota, Felipe; Monforte-Gonzalez, Miriam; Hérnandez-Sotomayor, S M Teresa

    2013-01-01

    Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

  3. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  4. Synthesis of bile acid monosulphates by the isolated perfused rat kidney.

    PubMed Central

    Summerfield, J A; Gollan, J L; Billing, B H

    1976-01-01

    Perfusion of an isolated rat kidney with labelled bile acids, in a protein-free medium, resulted in the urinary excretion of the labelled bile acid, 3% being converted into polar metabolities in 1h. These metabolities were neither glycine nor taurine conjugates, nor bile acid glucuronides, and on solovolysis yielded the free bile acid. On t.l.c. the metabolite of [24-14C]lithocholic acid had the mobility of lithocholate 3-sulphate. The principal metabolite of [24-14C]chenodeoxycholic acid had the mobility of chenodeoxycholate 7-sulphate; trace amounts appeared as chenodeoxycholate 3-sulphate. [35S]sulphate was incorporated in chenodeoxycholic acid by the kidney, resulting in a similar pattern of sulphation. No disulphate salt of chenodeoxycholic acid was detected. These findings lend support to the hypothesis that renal synthesis may account for some of the bile acid sulphates present in urine in the cholestatic syndrome in man. PMID:942413

  5. Lewis Acid Promoted Oxonium Ion Driven Carboamination of Alkynes for the Synthesis of 4-Alkoxy Quinolines.

    PubMed

    Gharpure, Santosh J; Nanda, Santosh K; Adate, Priyanka A; Shelke, Yogesh G

    2017-02-17

    Lewis acid mediated multisegment coupling cascade is designed for the synthesis of densely substituted 4-alkoxy quinolines via an oxonium ion triggered alkyne carboamination sequence involving C-C and C-N bond formations. Cyclic ether fused-quinolines could also be accessed using this fast, operationally simple, high yielding, chemoselective and functional group tolerant method. Versatility and utility of this methodology is demonstrated by postfunctionalization of products obtained and its use in synthesis of potent drug molecules.

  6. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  7. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-04

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  8. Orthogonally Protected Furanoid Sugar Diamino Acids for Solid-Phase Synthesis of Oligosaccharide Mimetics.

    PubMed

    John, Franklin; Wittmann, Valentin

    2015-08-07

    Sugar diamino acids (SDAs), which differ from the widely used sugar amino acids in the presence of a second amino group connected to the carbohydrate core, share structural features of both amino acids and carbohydrates. They can be used for the preparation of linear and branched amide-linked oligosaccharide mimetics. Such oligomers carry free amino groups, which are positively charged at neutral pH, in a spatially defined way and, thus, represent a potential class of aminoglycoside mimetics. We report here the first examples of orthogonally protected furanoid SDAs and their use in solid-phase synthesis. Starting from d-glucose, we developed a divergent synthetic route to three derivatives of 3,5-diamino-3,5-dideoxy-d-ribofuranose. These building blocks are compatible with solid-phase peptide synthesis following the 9-fluorenylmethoxycarbonyl (Fmoc) strategy, which we demonstrate by the synthesis of an SDA tetramer.

  9. New hydroxamic acid derivatives of fluoroquinolones: synthesis and evaluation of antibacterial and anticancer properties.

    PubMed

    Rajulu, Gavara Govinda; Bhojya Naik, Halehatty Seephya; Viswanadhan, Abhilash; Thiruvengadam, Jayaraman; Rajesh, Kondodiyil; Ganesh, Sambasivam; Jagadheshan, Hiriyan; Kesavan, Poonimangadu Koppolu

    2014-01-01

    A series of new hydroxamic acid derivatives (6a-f) at C-3 position of fluoroquinolones were designed and synthesized through multistep synthesis. The design concept involved replacement of the 3-carboxylic acid in fluoquinolones with hydroxamic acid as an acid mimicking group. The synthetic work employed in this work provides a good example for the synthesis of pure hydroxamic acid based fluoroquinolones. The synthesized compounds were characterized by (1)H-NMR, electrospray ionization (ESI)-MS and IR. The new compounds were tested for their in vitro antimicrobial and anti-proliferative activity. Out of the six derivatives, compound 6e exhibited moderate antibacterial activity by inhibiting the growth of Escherichia coli and Klebsiella pneumoniae (MIC: 4.00-8.00 µg/mL). Compounds 6b and 6f displayed good growth inhibition against A549 Lung adenocarcinoma and HCT-116 Colon carcinoma cell lines.

  10. Synthesis of 5,9-hexacosadienoic acid phospholipids. 11. Phospholipid studies of marine organisms.

    PubMed

    Mena, P L; Djerassi, C

    1985-01-01

    The synthesis of phosphatidylcholines (PC), phosphatidylethanolamines (PE) and phosphatidylserines (PS) containing two acyl chains of the naturally occurring sponge fatty acid (5Z,9Z)-5,9-hexacosadienoic acid as well as its hitherto unknown geometrical isomers is described. The PCs were prepared by deacylation of natural lecithins, followed by reacylation with fatty acid anhydrides. The synthesis of mixed-acid PCs is also reported: a diacyl product was converted to the lyso-PC by treatment with phospholipase A2 and subsequent acylation of the secondary hydroxyl group to give the desired mixed-acid PCs. The PEs and the PSs were prepared from the corresponding PCs by enzymatic transphosphatidylation catalyzed by phospholipase D. Structural assignments of the compounds were confirmed by spectroscopy (1H-NMR and MS). Ammonia chemical ionization mass spectrometry provided molecular ion and significant fragment peaks for PCs and PEs.

  11. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  12. Stimulation of Ribonucleic Acid Synthesis by Chloramphenicol in a rel+ Aminoacyl-Transfer Ribonucleic Acid Synthetase Mutant of Escherichia coli

    PubMed Central

    Yegian, Charles D.; Vanderslice, Rebecca W.

    1971-01-01

    Escherichia coli strain 9D3 possesses a highly temperature-sensitive valyl-transfer ribonucleic acid (tRNA) synthetase (EC 6.1.1.9). Since 9D3 is a rel+ strain, it cannot carry out net RNA synthesis at high temperature. A 100-μg amount of chloramphenicol (CAP) per ml added in the absence of valine cannot stimulate RNA synthesis. Either 300 μg of CAP or 100 μg of CAP plus 50 μg of valine per ml, however, promotes nearly maximal RNA synthesis. These results can be understood as follows. (i) Valyl-tRNA is required for net RNA synthesis, (ii) the synthetase lesion is incomplete, (iii) the rate of mutant acylation of tRNAval at high temperature is valine-dependent, and (iv) the CAP concentration determines the rate of residual protein synthesis. Data are also presented which demonstrate that the rate of net RNA synthesis can greatly increase long after the addition of CAP, if the amount of valyl-tRNA increases. PMID:4942766

  13. Aromatic amino acids are utilized and protein synthesis is stimulated during amino acid infusion in the ovine fetus.

    PubMed

    Liechty, E A; Boyle, D W; Moorehead, H; Auble, L; Denne, S C

    1999-06-01

    The purpose of this study was to determine whether the ovine fetus is capable of increased disposal of an amino acid load; if so, would it respond by increased protein synthesis, amino acid catabolism or both? A further purpose of the study was to determine whether the pathways of aromatic amino acid catabolism are functional in the fetus. Late gestation ovine fetuses of well-nourished ewes received an infusion of Aminosyn PF alone (APF), and Aminosyn PF + glycyl-L-tyrosine (APF+GT) at rates estimated to double the intake of these amino acids. The initial study, using APF, was performed at 126 +/- 1.4 d; the APF+GT study was performed at 132 +/- 1.7 d (term = 150 d). Phenylalanine and tyrosine kinetics were determined using both stable and radioactive isotopes. Plasma concentrations of most amino acids, but not tyrosine, increased during both studies; tyrosine concentration increased only during the APF+GT study. Phenylalanine rate of appearance and phenylalanine hydroxylation increased during both studies. Tyrosine rate of appearance increased only during the APF+GT study; tyrosine oxidation did not increase during either study. Fetal protein synthesis increased significantly during both studies, producing a significant increase in fetal protein accretion. Fetal proteolysis was unchanged in response to either amino acid infusion. These results indicate that the fetus responds to an acute increase in amino acid supply primarily by increasing protein synthesis and accretion, with a smaller but significant increase in amino acid catabolism also. Both phenylalanine hydroxylation and tyrosine oxidation are active in the fetus, and the fetus is able to increase phenylalanine hydroxylation rapidly in response to increased supply.

  14. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-08

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  15. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  16. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  17. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  18. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  19. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  20. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  1. Amino Acid Starvation Has Opposite Effects on Mitochondrial and Cytosolic Protein Synthesis

    PubMed Central

    Pearce, Sarah F.; Rorbach, Joanna; He, Jiuya; Brea-Calvo, Gloria; Minczuk, Michal; Reyes, Aurelio; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    Amino acids are essential for cell growth and proliferation for they can serve as precursors of protein synthesis, be remodelled for nucleotide and fat biosynthesis, or be burnt as fuel. Mitochondria are energy producing organelles that additionally play a central role in amino acid homeostasis. One might expect mitochondrial metabolism to be geared towards the production and preservation of amino acids when cells are deprived of an exogenous supply. On the contrary, we find that human cells respond to amino acid starvation by upregulating the amino acid-consuming processes of respiration, protein synthesis, and amino acid catabolism in the mitochondria. The increased utilization of these nutrients in the organelle is not driven primarily by energy demand, as it occurs when glucose is plentiful. Instead it is proposed that the changes in the mitochondrial metabolism complement the repression of cytosolic protein synthesis to restrict cell growth and proliferation when amino acids are limiting. Therefore, stimulating mitochondrial function might offer a means of inhibiting nutrient-demanding anabolism that drives cellular proliferation. PMID:24718614

  2. Synthesis and characterization of bis-thiourea having amino acid derivatives

    NASA Astrophysics Data System (ADS)

    Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

    2016-11-01

    In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

  3. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  4. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  5. The use of ascorbate as an oxidation inhibitor in prebiotic amino acid synthesis: a cautionary note.

    PubMed

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO(2)-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO(2) was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO(2)-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO(2)-rich atmosphere under the conditions studied.

  6. Acyl Meldrum's acid derivatives: application in organic synthesis

    NASA Astrophysics Data System (ADS)

    Janikowska, K.; Rachoń, J.; Makowiec, S.

    2014-07-01

    This review is focused on an important class of Meldrum's acid derivatives commonly known as acyl Meldrum's acids. The preparation methods of these compounds are considered including the recently proposed and rather rarely used ones. The chemical properties of acyl Meldrum's acids are described in detail, including thermal stability and reactions with various nucleophiles. The possible mechanisms of these transformations are analyzed. The bibliography includes 134 references.

  7. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  8. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA.

  9. Synthesis and biological activity of glutamic acid derivatives.

    PubMed

    Receveur, J M; Guiramand, J; Récasens, M; Roumestant, M L; Viallefont, P; Martinez, J

    1998-01-20

    In order to develop new specific glutamate analogues at metabotropic glutamate receptors, Diels-Alder, 1-4 ionic and radical reactions were performed starting from (2S)-4-methyleneglutamic acid. Preliminary pharmacological evaluation by measuring IP accumulation using rat forebrain synaptoneurosomes has shown that (2S)-4-(2-phthalimidoethyl)glutamic acid (3a), (2S)-4-(4-phthalimidobutyl)glutamic acid (3b) and 1-[(S)-2-amino-2-carboxyethyl]-3,4-dimethylcyclohex-3-ene-1-carbox ylic acid (8) presented moderate antagonist activities.

  10. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  11. Indole-3-acetic Acid Synthesis in Tumorous and Nontumorous Species of Nicotiana 1

    PubMed Central

    Liu, Shih-Tung; Katz, Charles D.; Knight, C. Arthur

    1978-01-01

    The synthesis of indole-3-acetic acid (IAA) in the enzyme extracts of Nicotiana glauca, Nicotiana langsdorffii, their F1 hybrid, their amphidiploid hybrid, and the nontumorous mutant of the hybrid was investigated. Tryptamine, a possible precursor of IAA biosynthesis in Nicotiana tabacum, was not found in the callus tissue of N. glauca, N. langsdorffii, and their F1 hybrid. In petiole slices, the synthesis of IAA progressively increased during 5 hours of incubation in [14C]tryptophan. The rate of synthesis was about equal in the hybrid and N. langsdorffii but lower in N. glauca on either a cell or fresh weight basis. It was also found that tryptophan was about 25 times more efficient than tryptamine in promoting synthesis of IAA in petiole slices. It was found that indoleacetaldehyde oxidase, indoleacetaldehyde reductase, and tryptophan aminotransferase activities were present in all of the species examined; however, tryptophan decarboxylase activity was not found. The tryptophan aminotransferase activity in N. glauca, N. langsdorffii, and the nontumorous mutant required α-ketoglutaric acid and pyridoxal 5-phosphate whereas the addition of pyridoxal 5-phosphate seemed not to increase the enzyme activity in tumor plants. The tryptophan aminotransferase in the amphidiploid hybrid was partially purified by acetone precipitation. The enzyme activity had a temperature optimum at 49 C and a pH optimum at 8.9. It is suggested that there is an indolepyruvic acid pathway in the synthesis of IAA in the Nicotiana species examined. PMID:16660376

  12. Synthesis of phosphonic analogues of carnitine and gamma-amino-beta-hydroxybutyric acid.

    PubMed

    Tadeusiak, Elzbieta J

    2004-12-01

    The involvement of carnitine and gamma-amino-beta-hydroxybutyric acid in the biology of mammalian cells, the physiology of the human body, and some important aspects of medicinal treatment has induced many research groups to develop their pharmacologically potent analogues. Among them are the very important phosphonic analogues: phosphocarnitine and gamma-amino-beta-hydroxypropylphosphonic acid. This mini-review describes the various methodologies used for the synthesis of these compounds.

  13. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  14. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  15. [Genetic code: codon bases--the symbols of amino acid synthesis and catabolism pathways].

    PubMed

    Konyshev, V A

    1983-01-01

    The correlations between genetic codes of amino acids and pathways of synthesis and catabolism of carbon backbone of amino acids are considered. Codes of amino acids which are synthesized from oxoacids of glycolysis, the Krebs cycle and glyoxalic cycle via transamination without any additional chemical reactions, are initiated with guanine (alanine, glutamic and aspartic acids, glycine). Codons of amino acids which are formed on the branches of glycolysis at the level of compounds with three carbon atoms, begin with uracil (phenylalanine, serine, leucine, tyrosine, cysteine, tryptophan). Codes of amino acids formed from aspartate begin with adenine (methionine, isoleucine, threonine, asparagine, lysine, serine), while those of the amino acids formed from the compounds with five carbon atoms (glutamic acid and phosphoribosyl pyrophosphate) begin with cytosine (arginine, proline, glutamine, histidine). The second letter of codons is linked to catabolic pathways of amino acids: most of amino acids entering glycolysis and the Krebs cycle through even-numbered carbon compounds, have adenine and uracil at the second position of codes (A-U type); most of amino acids entering the glycolysis and the Krebs cycle via odd-numbered carbon compounds, have codons with guanine and cytidine at the second position (G-C type). The usage of purine and pyrimidine as the third letter of weak codones in most of amino acids is linked to the enthropy of amino acid formation. A hypothesis claiming that the linear genetic code was assembled from the purine and pyrimidine derivatives which have acted as participants of primitive control of amino acid synthesis and catabolism, is suggested.

  16. Resistance of lung fatty acid synthesis to inhibition by dietary fat in the meal-fed rat.

    PubMed

    Clarke, S D; Wilson, M D; Ibnoughazala, T

    1984-03-01

    One-half of the palmitate utilized by the lung for production of the surfactant phospholipid, dipalmitoyl phosphatidylcholine, originates from de novo palmitate synthesis in the lung. In this report the lung was examined for the influence of dietary fat on the lung de novo fatty acid synthesis pathway. Lung lipogenesis was reduced by fasting and accelerated by carbohydrate refeeding or insulin injection. However, in general lung fatty acid synthesis was unaffected by dietary fat. Supplementing one meal (high glucose diet) with as much as 36% additional fat kilocalories did not suppress lung fatty acid synthesis. An inhibition of fatty acid synthesis resulted from a fat supplement of +60 and +120% of meal kilocalories, but this inhibition was likely due to an attenuated rate of glucose absorption. Ingestion of a high carbohydrate diet supplemented with 10, 17, or 30% added kilocalories as safflower oil or palmitate had no effect on lipogenesis after 10 days. On the other hand, liver fatty acid synthesis and acetyl-CoA carboxylase were selectively suppressed by safflower oil, whereas dietary palmitate was ineffective as an inhibitor of lipogenesis. These data clearly demonstrate that the well-characterized preferential suppression of liver lipogenesis by dietary polyunsaturated fats does not extend to lung tissue, and, more importantly, the inhibition of liver lipogenesis is not secondary to an essential fatty acid deficiency. The marked resistance of lung fatty acid synthesis to inhibition by dietary fat might be a biological protective mechanism to ensure adequate palmitate for dipalmitoyl phosphatidylcholine synthesis.

  17. Synthesis and characterization of L-lactide and polylactic acid (PLA) from L-lactic acid for biomedical applications

    NASA Astrophysics Data System (ADS)

    Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri

    2017-02-01

    Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.

  18. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  19. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu

    2014-05-01

    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  20. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  1. Total synthesis of (±)-epithuriferic acid methyl ester via Diels-Alder reaction.

    PubMed

    Koprowski, Marek; Bałczewski, Piotr; Owsianik, Krzysztof; Różycka-Sokołowska, Ewa; Marciniak, Bernard

    2016-02-07

    In this paper, we have described the first total synthesis of (±)-epithuriferic acid methyl ester from non-natural sources, in four steps (20% overall yield). The key step involves the Diels-Alder reaction of isobenzofuran with methyl 3-(dimethoxyphosphoryl)acrylate which is controlled by "ortho" regio- and endo stereoselectivities due to the COOMe group.

  2. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  3. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  4. Total synthesis of (−)-dihydroprotolichesterenic acid via diastereoselective conjugate addition to chiral fumarates

    PubMed Central

    Hethcox, J. Caleb; Shanahan, Charles S.; Martin, Stephen F.

    2013-01-01

    A diastereoselective conjugate addition of a variety of monoorganocuprates, Li[RCuI], to chiral fumarates to provide funtionalized succinates has been developed. The utility of this reaction is demonstrated in a concise total synthesis of (−)-dihydroprotolichesterenic acid that required only four steps and proceeded in an overall 31% yield. PMID:23539490

  5. Diastereoselective addition of monoorganocuprates to a chiral fumarate: reaction development and synthesis of (-)-dihydroprotolichesterinic acid.

    PubMed

    Hethcox, J Caleb; Shanahan, Charles S; Martin, Stephen F

    2015-09-16

    Recent studies of diastereoselective conjugate additions of monoorganocuprates, Li[RCuI], to chiral γ-alkoxycrotonates and fumarates are disclosed. This methodology was applied to the shortest total synthesis of (-)-dihydroprotolichesterinic acid to date, but several attempts to prepare other succinate-derived natural products, such as pilocarpine and antrodin E, were unsuccessful.

  6. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  7. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  8. Methods for the synthesis of tritium-labelled fatty acids and their derivatives, oxylipins and steroids

    NASA Astrophysics Data System (ADS)

    Shevchenko, Valerii P.; Nagaev, Igor Yu; Myasoedov, Nikolai F.

    1999-10-01

    The achievements in the field of synthesis and application of tritium-labelled oxylipins, steroids, fatty acids, phospho-, sphingo- and other lipids are reviewed. The importance of these studies for the solution of current problems of biochemistry, biology and pharmacology is exemplified in the application of labelled compounds. The bibliography includes 148 references.

  9. Synthesis of mixed acid anhydrides from methane and carbon dioxide in acid solvents.

    PubMed

    Zerella, Mark; Mukhopadhyay, Sudip; Bell, Alexis T

    2003-09-04

    [reaction: see text] The reaction of CH(4) with CO(2) has been performed in anhydrous acids using VO(acac)(2) and K(2)S(2)O(8) as promoters. NMR analysis establishes that the primary product is a mixed anhydride of acetic acid and the acid solvent. In sulfuric acid, the overall reaction is CH(4) + CO(2) + SO(3) --> CH(3)C(O)-O-SO(3)H. Hydrolysis of the mixed anhydride produces acetic acid and the solvent acid. When trifluoroacetic acid is the solvent, acetic acid is primarily formed via the reaction CH(4) + CF(3)COOH --> CH(3)COOH + CHF(3).

  10. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.

    2003-10-01

    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  11. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  12. Synthesis of deuterated [D32 ]oleic acid and its phospholipid derivative [D64 ]dioleoyl-sn-glycero-3-phosphocholine.

    PubMed

    Darwish, Tamim A; Luks, Emily; Moraes, Greta; Yepuri, Nageshwar R; Holden, Peter J; James, Michael

    2013-01-01

    Oleic acid and its phospholipid derivatives are fundamental to the structure and function of cellular membranes. As a result, there has been increasing interest in the availability of their deuterated forms for many nuclear magnetic resonance, infrared, mass spectroscopy and neutron scattering studies. Here, we present for the first time a straightforward, large-scale (gram quantities) synthesis of highly deuterated [D32 ]oleic acid by using multiple, yet simple and high yielding reactions. The precursors for the synthesis of [D32 ]oleic acid are [D14 ]azelaic acid and [D17 ]nonanoic acid, which were obtained by complete deuteration (>98% D) of their (1) H forms by using metal catalysed hydrothermal H/D exchange reactions. The oleic acid was produced with ca. 94% D isotopic purity and with no contamination by the trans-isomer (elaidic acid). The subsequent synthesis of [D64 ]dioleoyl-sn-glycero-3-phosphocholine from [D32 ]oleic acid is also described.

  13. Synthesis of Site-Specifically (13)C Labeled Linoleic Acids.

    PubMed

    Offenbacher, Adam R; Zhu, Hui; Klinman, Judith P

    2016-10-12

    Soybean lipoxygenase-1 (SLO-1) catalyzes the C-H abstraction from the reactive carbon (C-11) in linoleic acid as the first and rate-determining step in the formation of alkylhydroperoxides. While previous labeling strategies have focused on deuterium labeling to ascertain the primary and secondary kinetic isotope effects for this reaction, there is an emerging interest and need for selectively enriched (13)C isotopologues. In this report, we present synthetic strategies for site-specific (13)C labeled linoleic acid substrates. We take advantage of a Corey-Fuchs formyl to terminal (13)C-labeled alkyne conversion, using (13)CBr4 as the labeling source, to reduce the number of steps from a previous fatty acid (13)C synthetic labeling approach. The labeled linoleic acid substrates are useful as nuclear tunneling markers and for extracting active site geometries of the enzyme-substrate complex in lipoxygenase.

  14. [Clarification on publications concerning the synthesis of acetylsalicylic acid].

    PubMed

    Lafont, O

    1996-01-01

    Charles Frédéric Gerhardt (1816-1856) mentioned in his Traité de chimie Organique (1854) a publication, in French (realized in 1852 but published in 1853) entitled "Researches on anhydrous organic acids" in which, was reported the reaction of sodium salicylate with acetyl chloride. He thought that the reaction product was an acid anhydride, but obtained really crude acetylsalicylic acid. Later on, but also in 1853, a publication in german, by the same author related the same experiments. Surprisingly only the second publication has been mentioned in most of the historical studies on the subject. Acetyl salicylic acid was identified and synthesised in 1859 by von Gilm by another method and the product obtained by Gerhardt was identified to it in 1869.

  15. Nalidixic Acid and Macromolecular Metabolism in Tetrahymena pyriformis: Effects on Protein Synthesis

    PubMed Central

    de Castro, J. F.; Carvalho, J. F. O.; Moussatché, N.; de Castro, F. T.

    1975-01-01

    A study on the effect of nalidixic acid on macromolecular metabolism, particularly of protein, in Tetrahymena pyriformis was performed. It was shown that the compound is a potent inhibitor of deoxyribonucleic acid, ribonucleic acid, and protein synthesis for this organism. A conspicuous breakdown of polysomes, accompanied by the accumulation of 80S ribosomes, occurred in cells incubated for 10 min with the drug; polysome formation was prevented. The accumulating 80S particles were shown to be run-off ribosomal units. The incorporation of amino acids by a cell-free system is not affected by nalidixic acid. In nonproliferating cells the incorporation was also not prevented, unless the cells were previously incubated with the drug. These results are discussed in terms of the possible mechanism of action of nalidixic acid in T. pyriformis. PMID:807153

  16. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  17. Synthesis and biological activity of alkynoic acids derivatives against mycobacteria

    PubMed Central

    Vilchèze, Catherine; Leung, Lawrence W.; Bittman, Robert; Jacobs, William R.

    2015-01-01

    2-alkynoic acids have bactericidal activity against Mycobacterium smegmatis but their activity fall sharply as the length of the carbon chain increased. In this study, derivatives of 2- alkynoic acids were synthesized and tested against fast- and slow-growing mycobacteria. Their activity was first evaluated in M. smegmatis against their parental 2-alkynoic acids, as well as isoniazid, a first-line antituberculosis drug. The introduction of additional unsaturation or heteroatoms into the carbon chain enhanced the antimycobacterial activity of longer chain alkynoic acids (more than 19 carbons long). In contrast, although the modification of the carboxylic group did not improve the antimycobacterial activity, it significantly reduced the toxicity of the compounds against eukaryotic cells. Importantly, 4-(alkylthio)but-2-ynoic acids, had better bactericidal activity than the parental 2-alkynoic acids and on a par with isoniazid against the slow-grower Mycobacterium bovis BCG. These compounds had also low toxicity against eukaryotic cells, suggesting that they could be potential therapeutic agents against other types of topical mycobacterial infections causing skin diseases including Mycobacterium abscessus, Mycobacterium ulcerans, and Mycobacterium leprae. Moreover, they provide a possible scaffold for future drug development. PMID:26256431

  18. Bioengineering of bacterial polymer inclusions catalyzing the synthesis of N-acetylneuraminic acid.

    PubMed

    Hooks, David O; Blatchford, Paul A; Rehm, Bernd H A

    2013-05-01

    N-Acetylneuraminic acid is produced by alkaline epimerization of N-acetylglucosamine to N-acetylmannosamine and then subsequent condensation with pyruvate catalyzed by free N-acetylneuraminic acid aldolase. The high-alkaline conditions of this process result in the degradation of reactants and products, while the purification of free enzymes to be used for the synthesis reaction is a costly process. The use of N-acetylglucosamine 2-epimerase has been seen as an alternative to the alkaline epimerization process. In this study, these two enzymes involved in N-acetylneuraminic acid production were immobilized to biopolyester beads in vivo in a one-step, cost-efficient process of production and isolation. Beads with epimerase-only, aldolase-only, and combined epimerase/aldolase activity were recombinantly produced in Escherichia coli. The enzymatic activities were 32 U, 590 U, and 2.2 U/420 U per gram dry bead weight, respectively. Individual beads could convert 18% and 77% of initial GlcNAc and ManNAc, respectively, at high substrate concentrations and near-neutral pH, demonstrating the application of this biobead technology to fine-chemical synthesis. Beads establishing the entire N-acetylneuraminic acid synthesis pathway were able to convert up to 22% of the initial N-acetylglucosamine after a 50-h reaction time into N-acetylneuraminic acid.

  19. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases.

  20. Synthesis and Bioactivity of (R)-Ricinoleic Acid Derivatives: A Review.

    PubMed

    Pabiś, Sylwia; Kula, Józef

    2016-01-01

    (R)-Ricinoleic acid (RA) [(12R,9Z)-hydroxyoctadecenoic acid], the main compound of castor seed oil, because of its unusual structure readily undergoes multi-directional chemical and biochemical transformations to produce derivatives with the retained carbon skeleton or with its degradation. Many of these are of high biological activity, as documented by an in vitro study, and possess therapeutic potential. This review article provides an overview of the recent developments in the area of synthesis of RA based compounds with anticancer and antimicrobial activities. Moreover, the antiinflammatory and analgesic properties of some ricinoleic acid derivatives are also highlighted.

  1. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  2. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  3. Double-helical nucleic acids with cross-linked strands: synthesis and applications in molecular biology

    NASA Astrophysics Data System (ADS)

    Antsypovitch, Sergei I.; Oretskaya, Tat'yana S.

    1998-03-01

    Data on the methods employed for cross-linking of DNA strands and for the synthesis of oligonucleotide duplexes with cross-links between strands are summarised. Existing methods are systematised; their advantages and drawbacks are discussed. The examples of applications of DNA duplexes with covalently cross-linked chains for the study of protein-nucleic acid recognition and mechanisms of action of nucleic acid-binding proteins for gaining information about the spatial structure of nucleic acids, and for the solution of other problems of molecular biology are given. The bibliography includes 131 references.

  4. Recent advances in the synthesis and application of fluorescent α-amino acids.

    PubMed

    Harkiss, Alexander H; Sutherland, Andrew

    2016-09-26

    Fluorescence spectroscopy has become a powerful technique for probing a range of complex biological processes including enzyme mechanisms and protein-protein interactions. While the application of this technique uses a number of strategies, many of these rely on the use of fluorescent α-amino acids. This review highlights the recent synthetic methods developed for the incorporation of highly conjugated chromophores into the side-chain of α-amino acids and the application of these compounds as probes for imaging in medicine and biology. In particular, the design and synthesis of α-amino acids bearing coumarin, flavone and polyaromatic derived chromophores is described.

  5. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  6. Enantiomeric deoxycholic acid: total synthesis, characterization, and preliminary toxicity toward colon cancer cell lines.

    PubMed

    Katona, Bryson W; Rath, Nigam P; Anant, Shrikant; Stenson, William F; Covey, Douglas F

    2007-11-23

    Deoxycholic acid (DCA) is an endogenous secondary bile acid implicated in numerous pathological conditions including colon cancer formation and progression and cholestatic liver disease. DCA involvement in these disease processes results partly from its ability to modulate signaling cascades within the cell, presumably through both direct receptor activation and general detergent mediated membrane changes. To further explore DCA induced changes in cell signaling, we completed a total synthesis of enantiomeric deoxycholic acid (ent-DCA) from achiral 2-methyl-1,3-cyclopentanedione. Using a modified method of the synthesis of ent-testosterone that proceeds through the (R)-(-)-Hajos-Parrish ketone, we have completed the successful synthesis of ent-DCA in 25 steps with a yield of 0.3% with all stereochemical assignments of the product confirmed by X-ray crystallography. Our studies toward this synthesis also uncovered the methodology for the development of a novel A,B-cis steroidal skeleton system containing a C3-C9 single bond as well as conditions to selectively ketalize the typically less reactive 12-carbonyl in poly-keto A,B-cis androgens. The critical micelle concentration (cmc) of ent-DCA, determined by a dye solubilization method, was identical to the cmc of natural DCA. Toxicity studies toward HT-29 and HCT-116 human colon cancer cell lines demonstrated that ent-DCA had similar effects on proliferation, yet showed a markedly decreased ability to induce apoptosis as compared to natural DCA.

  7. The promoting effects of geniposidic acid and aucubin in Eucommia ulmoides Oliver leaves on collagen synthesis.

    PubMed

    Li, Y; Sato, T; Metori, K; Koike, K; Che, Q M; Takahashi, S

    1998-12-01

    We have reported that collagen synthesis was stimulated by the administration of a hot water extract from the leaves of Eucommia ulmoides OLIVER, Eucommiaceae (Du-Zhong leaves) in false aged model rats. In this paper, we set out to examine the compounds in Du-Zhong leaves that stimulated collagen synthesis in false aged model rats. In experiment 1, a methanol extract of Du-Zhong leaves also stimulated collagen synthesis in aged model rats. An acetone fraction was derived from the methanol extract by silica gel chromatography in experiment 2. The acetone fraction mainly contained iridoides mono-glycosides such as geniposidic acid and aucubin. The administration of geniposidic acid or aucubin stimulated collagen synthesis in aged model rats in experiments 3 and 4 (significance (p<0.05)). The reported pharmacological effects of Du-Zhong leaves, including healing organs and strengthening bone and muscle, are closely related to collagen metabolism. It appears that geniposidic acid and aucubin are the actual compounds in Du-Zhong which caused the effect in our experiments.

  8. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  9. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  10. Novel chemical synthesis of ginkgolic acid (13:0) and evaluation of its tyrosinase inhibitory activity.

    PubMed

    Fu, Yuanqing; Hong, Shan; Li, Duo; Liu, Songbai

    2013-06-05

    A novel efficient synthesis of ginkgolic acid (13:0) from abundant 2,6-dihydroxybenzoic acid was successfully developed through a state-of-the-art palladium-catalyzed cross-coupling reaction and catalytic hydrogenation with an overall yield of 34% in five steps. The identity of the synthesized ginkgolic acid (13:0) was confirmed by nuclear magnetic resonance, mass spectrometry, infrared, and high-performance liquid chromatography. The reaction sequence of this method can be readily extended to the synthesis of other ginkgolic acids. The synthesized ginkgolic acid (13:0) exhibited promising anti-tyrosinase activity (IC₅₀ = 2.8 mg/mL) that was not correlated to antioxidant activity as probed by 1,1-diphenyl-2-picrylhydrazyl, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), ferric reducing ability of plasma, and oxygen radical absorbance capacity assays. The synthetic strategy developed in this work will significantly facilitate biological studies of ginkgolic acids that have great potential applications in food and pharmaceuticals.

  11. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  12. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  13. The use of supported acidic ionic liquids in organic synthesis.

    PubMed

    Skoda-Földes, Rita

    2014-06-26

    Catalysts obtained by the immobilisation of acidic ionic liquids (ILs) on solid supports offer several advantages compared to the use of catalytically active ILs themselves. Immobilisation may result in an increase in the number of accessible active sites of the catalyst and a reduction of the amount of the IL required. The ionic liquid films on the carrier surfaces provide a homogeneous environment for catalytic reactions but the catalyst appears macroscopically as a dry solid, so it can simply be separated from the reaction mixture. As another advantage, it can easily be applied in a continuous fixed bed reactor. In the present review the main synthetic strategies towards the preparation of supported Lewis acidic and Brønsted acidic ILs are summarised. The most important characterisation methods and structural features of the supported ionic liquids are presented. Their efficiency in catalytic reactions is discussed with special emphasis on their recyclability.

  14. Survival, Deoxyribonucleic Acid Breakdown, and Synthesis in Salmonella typhimurium as Compared with Escherichia coli B Strains

    PubMed Central

    Hudnik-Plevnik, Tamara A.; Djordjević, Nadežda

    1970-01-01

    Salmonella typhimurium LT-2 was compared with radioresistant (B/r) and radiosensitive (Bs−2) strains of Escherichia coli in respect to the survival, deoxyribonucleic acid (DNA) breakdown, and DNA synthesis after X irradiation. It is shown that S. typhimurium LT-2 is about four times more sensitive than E. coli B/r but less sensitive than Bs−2. The DNA breakdown is in S. typhimurium LT-2 lower than the postirradiation breakdown of DNA in both E. coli strains and DNA synthesis proceeds in this bacterium in spite of a much lower survival, as in the radioresistant E. coli B/r. PMID:4916313

  15. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  16. Hydrothermal synthesis of hollow silica spheres under acidic conditions.

    PubMed

    Yu, Qiyu; Wang, Pengpeng; Hu, Shi; Hui, Junfeng; Zhuang, Jing; Wang, Xun

    2011-06-07

    It is well-known that silica can be etched in alkaline media or in a unique hydrofluoric acid (HF) solution, which is widely used to prepare various kinds of hollow nanostructures (including silica hollow structures) via silica-templating methods. In our experiments, we found that stöber silica spheres could be etched in generic acidic media in a well-controlled way under hydrothermal conditions, forming well-defined hollow/rattle-type silica spheres. Furthermore, some salts such as NaCl and Na(2)SO(4) were found to be favorable for the formation of hollow/rattle-type silica spheres.

  17. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  18. The Synthesis and Evaluation of Arctigenin Amino Acid Ester Derivatives.

    PubMed

    Cai, En-Bo; Yang, Li-Min; Jia, Cai-Xia; Zhang, Wei-Yuan; Zhao, Yan; Li, Wei; Song, Xing-Zhuo; Zheng, Man-Ling

    2016-10-01

    The use of arctigenin (ARG), a traditional medicine with many pharmacological activities, has been restricted due to its poor solubility in water. Five amino acid derivatives of ARG have been synthesized using glycine, o-alanine, valine, leucine, and isoleucine, which have t-butyloxy carbonyl (BOC) as a protective group. In this study, we examined the effects of removing these protective groups. The results showed that the amino acid derivatives have better solubility and nitrite-clearing ability than ARG. Among the compounds tested, the amino acid derivatives without protective group were the best. Based on these results, ARG and its two amino acid derivatives without protective group (ARG8, ARG10) were selected to evaluate their anti-tumor activity in vivo at a dosage of 40 mg/kg. The results indicated that ARG8 and ARG10 both exhibit more anti-tumor activity than ARG in H22 tumor-bearing mice. The tumor inhibition rates of ARG8 and ARG10 were 69.27 and 43.58%, which was much higher than ARG. Furthermore, the mice treated with these compounds exhibited less damage to the liver, kidney and immune organs compared with the positive group. Furthermore, ARG8 and ARG10 improved the serum cytokine levels significantly compared to ARG. In brief, this study provides a method to improve the water solubility of drugs, and we also provide a reference basis for new drug development.

  19. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  20. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  1. Synthesis of copper sulphide nanoparticles in carboxylic acids as solvent.

    PubMed

    Armelao, Lidia; Camozzo, Daniele; Gross, Silvia; Tondello, Eugenio

    2006-02-01

    A novel method for the preparation of CuS nanoparticles based on the fast nucleation of the sulphide has been developed. The particles have been synthesized by reaction of thioacetic acid with water and copper carboxylates (acetate, propionate) in the corresponding carboxylic acid (acetic, propionic) as a solvent. The use of carboxylic acids presents several advantages: (i) the hydrolysis of the C-S bond is favoured thus producing a fast CuS supersaturation and a high nucleation rate; (ii) the mobility of the precursor molecules is limited so that nucleation events are favoured with respect to particle growth; (iii) the low dielectric constant of the medium stabilises the nanoparticles dispersion by reducing the critical coagulation concentration. The prepared nanoparticles were investigated by UV-Vis spectroscopy, X-ray photoelectron spectroscopy, atomic force microscopy and dynamic light scattering. The nanoparticle suspensions are clear and characterized by a blue-shifted adsorption edge with respect to bulk CuS. Light scattering measurements performed on acetic acid suspensions evidence the formation of monodispersed nanoparticles with an average diameter of about 5 nm.

  2. First Synthesis of 1,4-Dimethoxy-2-Naphthoxyacetic acid.

    PubMed

    Chinea, Kimberly; Banerjee, Ajoy K

    2015-07-01

    2-Acetyl-1-hydroxynaphthalene was converted into 1,4-dimethoxy-2-naphthoxyacetic acid in seven steps (methylation, Bayer-Villiger oxidation, hydrolysis, bromination, methylation, alkylation and hydrolysis). 2-Hydroxy-1,4-naphthoquinone on acetylation, aromatization, methylation and hydrolysis, respectively, also yielded the title compound.

  3. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  4. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  5. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  6. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  7. Progressive familial intrahepatic cholestasis and inborn errors of bile acid synthesis.

    PubMed

    Jankowska, Irena; Socha, Piotr

    2012-06-01

    Progressive familial intrahepatic cholestasis (PFIC), types 1, 2 and 3, are due to defects in genes involved in bile secretion (FIC1, BSEP, MDR3). PFIC and inborn errors of bile acid synthesis (IEBAS) often present in infancy with cholestasis. The distinctive feature of PFIC 1 and 2 and IEBAS is a normal level of GGT, while IEBAS are suspected in patients with low plasma bile acids concentration. Molecular testing, urinary bile acid analysis (IEBAS), liver biopsy and immuno-staining are used for the diagnosis. Some patients with PFIC can be successfully treated with ursodeoxycholic acid or partial external biliary diversion. IEBAS is treated with cholic acid. Liver transplantation is required for cirrhosis with liver failure. Hepatocarcinoma has been reported in PFIC2.

  8. Synthesis of medronic acid monoesters and their purification by high-performance countercurrent chromatography or by hydroxyapatite

    PubMed Central

    Vepsäläinen, Jouko; Turhanen, Petri A

    2016-01-01

    Summary We achieved the synthesis of important medronic acid monoalkyl esters via the dealkylation of mixed trimethyl monoalkyl esters of medronic acid. Two methods were developed for the purification of medronic acid monoesters: 1) small scale (10–20 mg) purification by using hydroxyapatite and 2) large scale (tested up to 140 mg) purification by high-performance countercurrent chromatography (HPCCC). PMID:27829921

  9. Fmoc/Trt-amino acids: comparison to Fmoc/tBu-amino acids in peptide synthesis.

    PubMed

    Barlos, K; Gatos, D; Koutsogianni, S

    1998-03-01

    Model peptides containing the nucleophilic amino acids Trp and Met have been synthesized with the application of Fmoc/Trt- and Fmoc/tBu-amino acids, for comparison. The deprotection of the peptides synthesized using Fmoc/Trt-amino acids in all cases leads to crude peptides of higher purity than that of the same peptides synthesized using Fmoc/tBu-amino acids.

  10. Developmental aspects and factors influencing the synthesis and status of ascorbic Acid in the pig.

    PubMed

    Mahan, D C; Ching, S; Dabrowski, K

    2004-01-01

    Ascorbic acid synthesis in the pig occurs at mid-pregnancy, but activity of the enzyme l-gulono-gamma-lactone oxidase (GLO) declines thereafter during gestation and remains low when the pig nurses the sow. During late gestation the ascorbic acid concentration in the fetus increases, but serum and liver ascorbic acid concentration in the sow declines without affecting the dam's liver GLO activity. It is presumed that as gestation progresses an increased amount of maternal ascorbic acid is transferred to the fetus and to the mammary gland. Colostrum and milk are rich sources of the vitamin and supply the nursing pig with ascorbic acid. The available data suggest that high amounts of ascorbic acid appear to suppress liver GLO activity in the pig. Upon weaning, when exogenous vitamin C is generally not provided, liver GLO activity and serum ascorbic acid increases. During the initial periods postweaning, some reports have indicated growth benefits of supplemental vitamin C. Body tissues differ in their concentrations of ascorbic acid, but tissues of high metabolic need generally have greater concentrations. The corpus luteum in the female, the testis in the male, and the adrenal glands in all pigs contain greater concentrations of the vitamin. Knockout genes preventing ascorbic acid synthesis in pigs have demonstrated poor skeletal and collagen formation and poor antioxidant protection. Under periods of stress ascorbic acid declines in the adrenal, but the pig rapidly recovers to its resting state once the stressor agent is removed. Although there are periods when supplemental vitamin C has been shown to promote pig performance (e.g., during high environmental stress and early postweaning), supplemental vitamin C has not been shown to routinely enhance pig performance.

  11. Fatty Acid Synthesis Intermediates Represent Novel Noninvasive Biomarkers of Prostate Cancer Chemoprevention by Phenethyl Isothiocyanate.

    PubMed

    Singh, Krishna B; Singh, Shivendra V

    2017-03-14

    Increased de novo synthesis of fatty acids is a distinctive feature of prostate cancer, which continues to be a leading cause of cancer-related deaths among American men. Therefore, inhibition of de novo fatty acid synthesis represents an attractive strategy for chemoprevention of prostate cancer. We have shown previously that dietary feeding of phenethyl isothiocyanate (PEITC), a phytochemical derived from edible cruciferous vegetables such as watercress, inhibits incidence and burden of poorly-differentiated prostate cancer in Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. The present study was designed to test the hypothesis of whether fatty acid intermediate(s) can serve as noninvasive biomarker(s) of prostate cancer chemoprevention by PEITC using archived plasma and tumor specimens from the TRAMP study as well as cellular models of prostate cancer. Exposure of prostate cancer cells (LNCaP and 22Rv1) to pharmacological concentrations of PEITC resulted in downregulation of key fatty acid metabolism proteins, including acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FASN), and carnitine palmitoyltransferase 1A (CPT1A). The mRNA expression of FASN and CPT1A as well as acetyl-CoA levels were decreased by PEITC treatment in both cell lines. PEITC administration to TRAMP mice also resulted in a significant decrease in tumor expression of FASN protein. Consistent with these findings, the levels of total free fatty acids, total phospholipids, triglyceride, and ATP were significantly lower in the plasma and/or prostate tumors of PEITC-treated TRAMP mice compared with controls. The present study is the first to implicate inhibition of fatty acid synthesis in prostate cancer chemoprevention by PEITC.

  12. Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

    PubMed

    Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

    2012-03-27

    In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages.

  13. Lipin-1 regulation of phospholipid synthesis maintains endoplasmic reticulum homeostasis and is critical for triple-negative breast cancer cell survival.

    PubMed

    He, Jingquan; Zhang, Feng; Tay, Li Wei Rachel; Boroda, Salome; Nian, Weiqi; Levental, Kandice R; Levental, Ilya; Harris, Thurl E; Chang, Jeffrey T; Du, Guangwei

    2017-03-27

    Cancer cells reprogram their metabolism to increase the synthesis of macromolecules for rapid proliferation. Compared to fatty acids, much less is known about the synthesis of phospholipids, which is essential for membrane biogenesis in cancer cells. We found that LPIN1, which encodes lipin-1, a phosphatidic acid phosphatase (PAP) controlling the rate-limiting step in the phospholipid synthesis pathway, is highly up-regulated in basal-like triple-negative breast cancer (TNBC). Moreover, high LPIN1 expression correlates with the poor prognosis of these patients. Knockdown of LPIN1 increases apoptosis in basal-like TNBC cell lines, whereas it has minimal or less effect on normal human mammary gland epithelial cells (HMECs) and estrogen receptor-positive breast cancer cell lines. Fatty acid incorporation and lipidomics analyses showed that LPIN1 knockdown blocks phospholipid synthesis and changes membrane lipid compositions that ultimately induce the activation of 1 of the 3 branches of unfolded protein responses, the inositol-requiring enzyme-1α pathway. We also show for the first time, to our knowledge, that lipin-1 knockdown significantly inhibits tumor growth in vivo using an orthotopic xenograft breast mouse model. Our results suggest that lipin-1 is a potential target for cancer therapy.-He, J., Zhang, F., Tay, L. W. R., Boroda, S., Nian, W., Levental, K. R., Levental, I., Harris, T. E., Chang, J. T., Du, G. Lipin-1 regulation of phospholipid synthesis maintains endoplasmic reticulum homeostasis and is critical for triple-negative breast cancer cell survival.

  14. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  15. Synthesis of repressible acid phosphatase in Saccharomyces cerevisiae under conditions of enzyme instability.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1982-01-01

    The synthesis of repressible acid phosphatase in Saccharomyces cerevisiae was examined under conditions of blocked derepression as described by Toh-e et al. (Mol. Gen. Genet. 162:139-149, 1978). Based on a genetic and biochemical analysis of the phenomenon these authors proposed a new regulatory model for acid phosphatase expression involving a simultaneous interaction of regulatory factors in the control of structural gene transcription. We demonstrate here that under growth conditions that fail to produce acid phosphatase the enzyme is readily inactivated. Furthermore, we demonstrate under these conditions the production of acid phosphatase mRNA which is active both in vitro and in vivo in the synthesis of enzyme. This eliminates any step prior to translation of acid phosphatase polypeptide as an explanation for the phenomenon. We interpret our results for the block in appearance of acid phosphatase as a result of both deaccelerated growth and cellular biosynthesis during derepression, accompanied by an enhanced instability of the enzyme. Images PMID:7050664

  16. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  17. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  18. Protein and Ribonucleic Acid Synthesis During the Diploid Life Cycle of Allomyces arbuscula

    PubMed Central

    Burke, Daniel J.; Seale, Thomas W.; McCarthy, Brian J.

    1972-01-01

    The diploid life cycle of Allomyces arbuscula may be divided into four parts: spore induction, germination, vegetative growth, and mitosporangium formation. Spore induction, germination, and mitosporangium formation are insensitive to inhibition of actinomycin D, probably indicating that stable, pre-existing messenger ribonucleic acid (RNA) is responsible for these developmental events. Protein synthesis is necessary during the entire life cycle except for cyst formation. A system for obtaining synchronous germination of mitospores is described. During germination there is a characteristic increase in the rate of synthesis of RNA and protein although none of the other morphogenetic changes occurring during the life cycle are necessarily accompanied by an appreciable change in the rate of macromolecular synthesis. PMID:4113121

  19. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  20. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  1. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  2. Synthesis and verification of biobased terephthalic acid from furfural.

    PubMed

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-02-04

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  3. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives.

  4. Enzymatic synthesis of palm olein-based fatty thiohydroxamic acids.

    PubMed

    Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor Azowa Bt; Rahman, Mohd Zaki Ab

    2010-01-01

    Fatty thiohydroxamic acids (FTAs) have been successfully synthesized from palm olein and thiohydroxamic acid by a one-step lipase catalyzed reaction. The use of immobilized lipase (Lipozyme RMIM) as the catalyst for the preparation reaction provides an easy isolation of the enzyme from the products and other components in the reaction mixture. The FTAs were characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The highest conversion percentage (95 %) was obtained when the process was carried out for 30 hours using urea to palm oil ratio of 6.0: 1.0 at 40 °C. The method employed offers several advantages such as renewable and abundant of the raw material, simple reaction procedure, environmentally friendly process and high yield of the product.

  5. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  6. An approach for the synthesis of nakamuric acid

    PubMed Central

    Wang, Xiaolei; Chen, Chuo

    2014-01-01

    The biosynthesis of dimeric pyrrole–imidazole alkaloids is likely mediated by enzyme-catalyzed reversible single-electron transfer (SET) cycloaddition. We now show that Ir(ppy)3 can promote SET-mediated formal [2+2] and [4+2] cycloaddition reactions of pyrrole–imidazole alkaloids-related substrates under photolytic conditions. This biomimetic approach is useful for the construction of the core skeleton of nakamuric acid and sceptrin. PMID:25983349

  7. Synthesis and characterization of fatty hydroxamic acids from triacylglycerides.

    PubMed

    Hoidy, Wisam H; Ahmad, Mansor B; Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor azowa Bt

    2010-01-01

    In this study, fatty haydroxamic acids (FHAs), which have biological activities as antibiotics and antifungal, have been synthesized via refluxing of triacylglycrides, palm olein, palm stearin or corn oil with hydroxylamine hydrochloride. The products were characterized using the complex formation test of hydroxamic acid group with zinc(I), copper(II) and iron(III), various technique methods including nuclear magnetic resonance ((1)H NMR) spectroscopy, Fourier transform infrared (FTIR) spectroscopy and elemental analysis. Parameters that may affect the conversion of oils to FHAs including the effect of reaction time, effect of organic solvent and effect of hydro/oil molar issue were also investigated in this study. Results of characterization indicate that FHAs were successfully produced from triacylglycrides. The conversion percentages of palm stearin, palm olein and corn oil into their fatty hydroxamic acids are 82, 81 and 78, respectively. Results also showed that hexane is the best organic solvent to produce the FHAs from the three oils used in this study. The optimum reaction time to achieve the maximum conversion percentage of the oils to FHAs was found to be 10 hours for all the three oils, while the optimum molar ration of hydro/to oil was found to be 7:1 for all the different three oils.

  8. Synthesis, crystal structure and computational studies of 4-nitrobenzylphosphonic acid

    NASA Astrophysics Data System (ADS)

    Wilk, Magdalena; Jarzembska, Katarzyna N.; Janczak, Jan; Hoffmann, Józef; Videnova-Adrabinska, Veneta

    2014-09-01

    4-Nitrobenzylphosphonic acid (1a) has been synthesized and structurally characterized by vibrational spectroscopy (IR and Raman) and single-crystal X-ray diffraction. Additionally, Hirshfeld surface analysis and computational methods have been used to compare the intermolecular interactions in the crystal structures of 1a and its carboxylic analogue, 4-nitrobenzylcarboxylic acid (4-NBCA). The crystal structure analysis of 1a has revealed that the acid molecules are extended into helical chains along the b axis using one of the hydrogen bonds established between phosphonic groups. The second (P)Osbnd H⋯O(P) hydrogen bond cross-links the inversion-related chains to form a thick monolayer with phosphonic groups arranged inwards and aromatic rings outwards. The nitro groups serve to link the neighbouring monolayers by weak Csbnd H⋯O(N) hydrogen bonds. Computations have confirmed the great contribution of electrostatic interactions for the crystal lattice stability. The cohesive energy, computed for the crystal structure of 1a exceeds 200 kJ mol-1 in magnitude and is nearly twice as large as that of 4-NBCA. The calculated cohesive energy values have been further related to the results of thermal analyses.

  9. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  10. Responsibility of regulatory gene expression and repressed protein synthesis for triacylglycerol accumulation on sulfur-starvation in Chlamydomonas reinhardtii.

    PubMed

    Sato, Atsushi; Matsumura, Rie; Hoshino, Naomi; Tsuzuki, Mikio; Sato, Norihiro

    2014-01-01

    Triacylglycerol (TG) synthesis is induced for energy and carbon storage in algal cells under nitrogen(N)-starved conditions, and helps prevent reactive oxygen species (ROS) production through fatty acid synthesis that consumes excessive reducing power. Here, the regulatory mechanism for the TG content in sulfur(S)-starved cells of Chlamydomonas reinhardtii was examined, in comparison to that in N- or phosphorus(P)-starved cells. S- and N- starved cells exhibited markedly increased TG contents with up-regulation of mRNA levels of diacylglycerol acyltransferase (DGAT) genes. S-Starvation also induced expression of the genes for phosphatidate synthesis. In contrast, P-starved cells exhibited little alteration of the TG content with almost no induction of these genes. The results implied deficient nutrient-specific regulation of the TG content. An arg9 disruptant defective in arginine synthesis, even without nutritional deficiencies, exhibited an increased TG content upon removal of supplemented arginine, which repressed protein synthesis. Repression of protein synthesis thus seemed crucial for TG accumulation in S- or N- starved cells. Meanwhile, the results of inhibitor experiments involving cells inferred that TG accumulation during S-starvation is supported by photosynthesis and de novo fatty acid synthesis. During S-starvation, sac1 and snrk2.2 disruptants, which are defective in the response to the ambient S-status, accumulated TG at lower and higher levels, respectively, than the wild type. The sac1 and snrk2.2 disruptants showed no or much greater up-regulation of DGAT genes, respectively. In conclusion, TG synthesis would be activated in S-starved cells, through the diversion of metabolic carbon-flow from protein to TG synthesis, and simultaneously through up-regulation of the expression of a particular set of genes for TG synthesis at proper levels through the actions of SAC1 and SNRK2.2.

  11. Acid Gradient across Plasma Membrane Can Drive Phosphate Bond Synthesis in Cancer Cells: Acidic Tumor Milieu as a Potential Energy Source

    PubMed Central

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

  12. Loss of Nuclear Receptor SHP Impairs but Does Not Eliminate Negative Feedback Regulation of Bile Acid Synthesis

    PubMed Central

    Kerr, Thomas A.; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W.; Schwarz, Margrit

    2014-01-01

    Summary The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  13. Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

  14. Synthesis of a Homologous Series of Side Chain Extended Orthogonally-Protected Aminooxy-Containing Amino Acids

    PubMed Central

    Liu, Fa; Thomas, Joshua; Burke, Terrence R.

    2008-01-01

    Practical methodology is reported for the synthesis of a homologous series of side chain extended amino acids containing aminooxy functionality bearing orthogonal protection suitable for Fmoc peptide synthesis. These reagents may be useful for the preparation of libraries containing fragments joined by peptide linkers. PMID:19122755

  15. Choroidal retinoic acid synthesis: a possible mediator between refractive error and compensatory eye growth.

    PubMed

    Mertz, J R; Wallman, J

    2000-04-01

    Research over the past two decades has shown that the growth of young eyes is guided by vision. If near- or far-sightedness is artificially imposed by spectacle lenses, eyes of primates and chicks compensate by changing their rate of elongation, thereby growing back to the pre-lens optical condition. Little is known about what chemical signals might mediate between visual effects on the retina and alterations of eye growth. We present five findings that point to choroidal retinoic acid possibly being such a mediator. First, the chick choroid can convert retinol into all-trans-retinoic acid at the rate of 11 +/- 3 pmoles mg protein(-1) hr(-1), compared to 1.3 +/- 0.3 for retina/RPE and no conversion for sclera. Second, those visual conditions that cause increased rates of ocular elongation (diffusers or negative lens wear) produce a sharp decrease in all-trans-retinoic acid synthesis to levels barely detectable with our assay. In contrast, visual conditions which result in decreased rates of ocular elongation (recovery from diffusers or positive lens wear) produce a four- to five-fold increase in the formation of all-trans-retinoic acid. Third, the choroidal retinoic acid is found bound to a 28-32 kD protein. Fourth, a large fraction of the choroidal retinoic acid synthesized in culture is found in a nucleus-enriched fraction of sclera. Finally, application of retinoic acid to cultured sclera at physiological concentrations produced an inhibition of proteoglycan production (as assessed by measuring sulfate incorporation) with a EC50 of 8 x 10(-7) M. These results show that the synthesis of choroidal retinoic acid is modulated by those visual manipulations that influence ocular elongation and that this retinoic acid may reach the sclera in concentrations adequate to modulate scleral proteoglycan formation.

  16. Inhibition of fatty acid and cholesterol synthesis by stimulation of AMP-activated protein kinase.

    PubMed

    Henin, N; Vincent, M F; Gruber, H E; Van den Berghe, G

    1995-04-01

    AMP-activated protein kinase is a multisubstrate protein kinase that, in liver, inactivates both acetyl-CoA carboxylase, the rate-limiting enzyme of fatty acid synthesis, and 3-hydroxy-3-methyl-glutaryl-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. AICAR (5-amino 4-imidazolecarboxamide ribotide, ZMP) was found to stimulate up to 10-fold rat liver AMP-activated protein kinase, with a half-maximal effect at approximately 5 mM. In accordance with previous observations, addition to suspensions of isolated rat hepatocytes of 50-500 microM AICAriboside, the nucleoside corresponding to ZMP, resulted in the accumulation of millimolar concentrations of the latter. This was accompanied by a dose-dependent inactivation of both acetyl-CoA carboxylase and 3-hydroxy-3-methylglutaryl-CoA reductase. Addition of 50-500 microM AICAriboside to hepatocyte suspensions incubated in the presence of various substrates, including glucose and lactate/pyruvate, caused a parallel inhibition of both fatty acid and cholesterol synthesis. With lactate/pyruvate (10/1 mM), half-maximal inhibition was obtained at approximately 100 microM, and near-complete inhibition at 500 microM AICAriboside. These findings open new perspectives for the simultaneous control of triglyceride and cholesterol synthesis by pharmacological stimulators of AMP-activated protein kinase.

  17. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  18. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  19. Fatty Acid Synthesis and Control of Caspase 2 in Prostate Cancer

    DTIC Science & Technology

    2013-05-01

    July 2011- 30 June 2012 4 . TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fatty Acid Synthesis and control of Caspase 2 in Prostate Cancer 5b. GRANT...Introduction…………………………………………………………….………..….. 4 Body………………………………………………………………………………….. 4 -6 Key Research Accomplishments...combination  with  inhibitors  of  NADPH  production   ( DHEA ),  fatty  acid  synthesis,  (C75,  C93,  cerulenin)  and  CaMKII

  20. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  1. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  2. Ribonucleic Acid and Protein Synthesis During Germination of Myxococcus xanthus Myxospores

    PubMed Central

    Juengst, Fredrick W.; Dworkin, Martin

    1973-01-01

    Ribonucleic acid (RNA) and protein synthesis during myxospore germination were examined. When RNA synthesis was inhibited more than 90% by either actinomycin D (Act D) or rifampin, germination was prevented. The data were consistent with the interpretation that rifampin did not interfere with protein synthesis in any way other than by inhibition of messenger RNA formation. Act D concentrations as high as 20 μg/ml did not totally inhibit RNA synthesis. In the presence of 8 μg of Act D/ml, germinating myxospores synthesized transfer RNA, 16S RNA, and 23S RNA. Evidence was presented which indicated that messenger RNA was also synthesized early in the germination period both in the presence and absence of 8 μg of Act D/ml. One explanation for the escape synthesis of RNA in germinating myxospores is that Act D exerts a differential effect on the transcription of larger versus smaller cistrons, the latter having a lower probability of binding Act D. We have found that in the presence of 8 μg of Act D/ml, escape RNA synthesis in myxospores was 25% for 23S RNA, 55% for 16S RNA, and more than 90% for 4S RNA. We have shown that germination of myxospores requires both RNA and protein synthesis during the first 25 to 35 min in germination medium. This finding does not support the earlier suggestion by Ramsey and Dworkin that a stable germination messenger RNA is required for germination of the myxospores of Myxococcus xanthus. PMID:4690965

  3. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  4. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  5. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  6. Selective synthesis of thioethers in the presence of a transition-metal-free solid Lewis acid.

    PubMed

    Santoro, Federica; Mariani, Matteo; Zaccheria, Federica; Psaro, Rinaldo; Ravasio, Nicoletta

    2016-01-01

    The synthesis of thioethers starting from alcohols and thiols in the presence of amorphous solid acid catalysts is reported. A silica alumina catalyst with a very low content in alumina gave excellent results in terms of both activity and selectivity also under solvent-free conditions. The reaction rate follows the electron density of the carbinol atom in the substrate alcohol and yields up to 99% and can be obtained for a wide range of substrates under mild reaction conditions.

  7. Aminochlorination in water: first Brønsted acid-promoted synthesis of vicinal chloramines.

    PubMed

    Wu, Xue-Liang; Wang, Guan-Wu

    2007-11-23

    A practical and scaleable route for the regio- and diastereoselective synthesis of vicinal chloramines from electron-deficient olefins and Chloramine-T promoted by Brønsted acids in water has been realized for the first time. This novel protocol is efficient, mild, ecofriendly, and broadly applicable for the aminochlorination of various electron-deficient olefins including alpha,beta-unsaturated ketones, cinnamate, and cinnamide. Water represents as a privileged solvent for the aminochlorination reaction in our system.

  8. Synthesis of 2-(hetero)aryl-5-(trimethylsilylethynyl)oxazoles from (hetero)arylacrylic acids.

    PubMed

    Pankova, Alena S; Stukalov, Alexander Yu; Kuznetsov, Mikhail A

    2015-04-17

    A three-step method for the synthesis of 2-(hetero)aryl-5-(trimethylsilylethynyl)oxazoles is described. Easily accessible bis(trimethylsilyl)acetylene and acrylic acid derivatives are used as starting materials for the preparation of mono- and disubstituted 5-(trimethylsilyl)pent-1-en-4-yn-3-ones. Oxidative phthalimidoaziridination of these enynones provides the key 2-acyl-1-phthalimidoaziridines that are further utilized in the thermal expansion of the three-membered ring to furnish the target functionalizable oxazoles.

  9. Synthesis and biological evaluation of new salvinorin A analogues incorporating natural amino acids.

    PubMed

    Fichna, Jakub; Lewellyn, Kevin; Yan, Feng; Roth, Bryan L; Zjawiony, Jordan K

    2011-01-01

    The synthesis and in vitro evaluation of a new series of salvinorin A analogues substituted at the C(2) position with natural amino acids is reported. Compound 12, containing Val, displayed high affinity and full agonist activity at the kappa-opioid receptor. Analogues with bulky and/or aromatic residues were inactive, showing the importance of size and electronegativity of C(2)-substituents for binding affinity of salvinorin A derivatives.

  10. One-step synthesis of 1-chloro-3-arylacetone derivatives from arylacetic acids.

    PubMed

    Zacuto, Michael J; Dunn, Robert F; Figus, Margaret

    2014-09-19

    A practical one-step method has been developed to prepare α-chloroketones from readily available, inexpensive phenylacetic acid derivatives. The method utilizes the unique reactivity of an intermediate Mg-enolate dianion, which displays selectivity for the carbonyl carbon of chloromethyl carbonyl electrophiles. Decarboxylation of the intermediate occurs spontaneously during the reaction quench. The utility of the reaction products has been demonstrated through the total synthesis of the natural product cimiracemate B.

  11. Selective synthesis of thioethers in the presence of a transition-metal-free solid Lewis acid

    PubMed Central

    Santoro, Federica; Mariani, Matteo; Zaccheria, Federica; Psaro, Rinaldo

    2016-01-01

    The synthesis of thioethers starting from alcohols and thiols in the presence of amorphous solid acid catalysts is reported. A silica alumina catalyst with a very low content in alumina gave excellent results in terms of both activity and selectivity also under solvent-free conditions. The reaction rate follows the electron density of the carbinol atom in the substrate alcohol and yields up to 99% and can be obtained for a wide range of substrates under mild reaction conditions. PMID:28144333

  12. Stimulation of phosphatidylglycerolphosphate phosphatase activity by unsaturated fatty acids in rat heart.

    PubMed

    Cao, S G; Hatch, G M

    1994-07-01

    Phosphatidylglycerolphosphate (PGP) synthase and PGP phosphatase catalyze the sequential synthesis of phosphatidylglycerol from cytidine-5'-diphosphate 1,2-diacyl-sn-glycerol (CDP-DG) and glycerol-3-phosphate. PGP synthase and PGP phosphatase activities were characterized in rat heart mitochondrial fractions, and the effect of fatty acids on the activity of these enzymes was determined. PGP synthase was observed to be a heat labile enzyme that exhibited apparent Km values for CDP-PG and glycerol-3-phosphate of 46 and 20 microM, respectively. The addition of exogenous oleic acid to the assay mixture did not affect PGP synthase activity. PGP phosphatase was observed to be a heat labile enzyme, and addition of oleic acid to the assay mixture caused a concentration-dependent stimulation of PGP phosphatase activity. Maximum stimulation (1.9-fold) of enzyme activity was observed in the presence of 0.5 mM oleic acid, but the stimulation was slightly attenuated by the presence of albumin in the assay. The presence of oleic acid in the assay mixture caused the inactivation of PGP phosphatase activity to be retarded at 55 degrees C. Stimulation of PGP phosphatase activity was also observed with arachidonic acid, whereas taurocholic, stearic and palmitic acids did not significantly affect PGP phosphatase activity. The activity of mitochondrial phosphatidic acid phosphohydrolase was not affected by inclusion of oleic acid in the incubation mixture. We postulate that unsaturated fatty acids stimulate PGP phosphatase activity in rat heart.

  13. Synthesis and cytotoxicity of A-homo-lactam derivatives of cholic acid and 7-deoxycholic acid.

    PubMed

    Huang, Yanmin; Chen, Sijing; Cui, Jianguo; Gan, Chunfang; Liu, Zhiping; Wei, Yingliang; Song, Huachan

    2011-06-01

    Using cholic acid and deoxycholic acid as starting materials, a series of 3-aza-A-homo-4-one bile acid and 7-deoxycholic acid derivatives were synthesized by the esterification, oxidation, reduction, oximation and Beckman rearrangement etc. The cytotoxicity of the synthesized compounds against MGC 7901 (human ventriculi carcinoma cell line), hela (human cervical carcinoma cell line), SMMC 7404 (human liver carcinoma cell line) were investigated. The results showed that bile acid and 7-deoxycholic-acid derivatives with 3-aza-A-homo-4-one configuration bearing a 6-hydroximino or 12-hydroximino group displayed a distinct cytotoxicity to Hela tumor cell line. In particular, the IC(50) values of the compounds 6 and 13 were 14.3 and 24.3 μmol/L against Hela human tumor cell line respectively. The information obtained from the studies may be useful for the design of novel chemotherapeutic drugs.

  14. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  15. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  16. Integrated process of distillation with side reactors for synthesis of organic acid esters

    DOEpatents

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  17. Oxidation-resistant acidic resins prepared by partial carbonization as cocatalysts in synthesis of adipic acid.

    PubMed

    Wei, Huijuan; Li, Hongbian; Liu, Yangqing; Jin, Peng; Wang, Xiangyu; Li, Baojun

    2012-08-01

    The oxidation-resistant acidic resins are of great importance for the catalytic oxidation systems. In this paper, the oxidatively stable acidic resins are obtained from the cation ion exchange resins (CIERs) through the thermal treatment in N(2) atmosphere. The structure and properties of the thermally treated CIERs were characterized by chemical analysis, Fourier transform infrared (FT-IR) spectra, acid capacity measurement and scanning electron microscope (SEM). The thermally treated CIERs possess high acid capacity up to 4.09 mmol g(-1). A partial carbonization is observed in the thermal treatment process of CIERs, but the morphology of resin spheres maintains well. The as-prepared CIERs are used as solid acids to assist the hydrogen peroxide oxidation of cyclohexene to adipic acid (ADA) with tungstic acid as the catalyst precursor. The improved yields of ADA in the recycling reaction are obtained in the presence of acidic CIERs. Meanwhile, the unproductive decomposition of H(2)O(2) is effectively suppressed. The high yields of ADA (about 81%) are kept by the thermally treated CIERs even after the fifth cycle. The thermally treated CIERs exhibit excellent acid-catalytic performance and possess remarkable oxidation-resistant capability.

  18. A novel and highly regioselective synthesis of new carbamoylcarboxylic acids from dianhydrides.

    PubMed

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N'-disubstituted 4,4'-carbonylbis(carbamoylbenzoic) acids and N,N'-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3',4,4'-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS.

  19. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  20. Systems-level metabolic flux profiling identifies fatty acid synthesis as a target for antiviral therapy

    PubMed Central

    Munger, Joshua; Bennett, Bryson D; Parikh, Anuraag; Feng, Xiao-Jiang; McArdle, Jessica; Rabitz, Herschel A; Shenk, Thomas; Rabinowitz, Joshua D

    2010-01-01

    Viruses rely on the metabolic network of their cellular hosts to provide energy and building blocks for viral replication. We developed a flux measurement approach based on liquid chromatography–tandem mass spectrometry to quantify changes in metabolic activity induced by human cytomegalovirus (HCMV). This approach reliably elucidated fluxes in cultured mammalian cells by monitoring metabolome labeling kinetics after feeding cells 13C-labeled forms of glucose and glutamine. Infection with HCMV markedly upregulated flux through much of the central carbon metabolism, including glycolysis. Particularly notable increases occurred in flux through the tricarboxylic acid cycle and its efflux to the fatty acid biosynthesis pathway. Pharmacological inhibition of fatty acid biosynthesis suppressed the replication of both HCMV and influenza A, another enveloped virus. These results show that fatty acid synthesis is essential for the replication of two divergent enveloped viruses and that systems-level metabolic flux profiling can identify metabolic targets for antiviral therapy. PMID:18820684

  1. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

  2. Acid synthesis of luminescent amine-functionalized or erbium-doped silica spheres for biological applications.

    PubMed

    Enrichi, Francesco; Trave, Enrico; Bersani, Marco

    2008-03-01

    In this work we discuss and investigate the morphological and optical properties of luminescent silica spheres which can have interesting applications in bioimaging and biosensing. The spheres are synthesized following an acid route by the hydrolysis and condensation of tetraethylortosilicate (TEOS) and can be functionalized by incorporation of aminopropyl-triethoxysilane (APTES) during the synthesis, inducing a significant luminescence that can be attributed to a recombination mechanism from localized organic defects related to -NH(2) groups. It is shown that the acid synthesis route produces very regular spherical particles, but their diameter vary in the range of 200-4,000 nm. The luminescence properties have been investigated and optimized by variation of the annealing temperature for the functionalized spheres, obtaining the most efficient PL emission after a thermal treatment of 1 h at 600 degrees C in air. Moreover, the possibility to introduce rare earths like erbium in the spheres was also studied and the corresponding Er(3) luminescence emission at 1.53 microm is reported in terms of intensity and lifetime, pointing out that erbium can be easily and efficiently incorporated during the acid synthesis giving high PL intensity with a good lifetime of 3.9 ms.

  3. In vitro synthesis of the unit that links teichoic acid to peptidoglycan.

    PubMed

    Hancock, I; Baddiley, J

    1976-03-01

    The role of cytidine diphosphate (CDP)-glycerol in gram-positive bacteria whose walls lack poly(glycerol phosphate) was investigated. Membrane preparations from Staphylococcus aureus H, Bacillus subtilis W23, and Micrococcus sp. 2102 catalyzed the incorporation of glycerol phosphate residues from radioactive CDP-glycerol into a water-soluble polymer. In toluenized cells of Micrococcus sp. 2102, some of this product became linked to the wall. In each case, maximum incorporation of glycerol phosphate residues required the presence of the nucleotide precursors of wall teichoic acid and of uridine diphosphate-N-acetylglucosamine. In membrane preparations capable of synthesizing peptidoglycan, vancomycin caused a decrease in the incorporation of isotope from CDP-glycerol into polymer. Synthesis of the poly (glycerol phosphate) unit thus depended at an early stage on the concomitant synthesis of wall teichoic acid and later on the synthesis of peptidoglycan. It is concluded that CDP-glycerol is the biosynthetic precursor of the tri(glycerol phosphate) linkage unit between teichoic acid and peptidoglycan that has recently been characterized in S. aureus H.

  4. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale.

  5. Novel sol-gel synthesis of acidic MgF(2-x)(OH)(x) materials.

    PubMed

    Wuttke, Stefan; Coman, Simona M; Scholz, Gudrun; Kirmse, Holm; Vimont, Alexandré; Daturi, Maro; Schroeder, Sven L M; Kemnitz, Erhard

    2008-01-01

    Novel magnesium fluorides have been prepared by a new fluorolytic sol-gel synthesis for fluoride materials based on aqueous HF. By changing the amount of water at constant stoichiometric amount of HF, it is possible to tune the surface acidity of the resulting partly hydroxylated magnesium fluorides. These materials possess medium-strength Lewis acid sites and, by increasing the amount of water, Brønsted acid sites as well. Magnesium hydroxyl groups normally have a basic nature and only with this new synthetic route is it possible to create Brønsted acidic magnesium hydroxyl groups. XRD, MAS NMR, TEM, thermal analysis, and elemental analysis have been applied to study the structure, composition, and thermal behaviour of the bulk materials. XPS measurements, FTIR with probe molecules, and the determination of N(2)/Ar adsorption-desorption isotherms have been carried out to investigate the surface properties. Furthermore, activity data have indicated that the tuning of the acidic properties makes these materials versatile catalysts for different classes of reactions, such as the synthesis of (all-rac)-[alpha]-tocopherol through the condensation of 2,3,6-trimethylhydroquinone (TMHQ) with isophytol (IP).

  6. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  7. Relationships between pyruvate decarboxylation and branched-chain volatile acid synthesis in Ascaris mitochondria.

    PubMed

    Komuniecki, R; Komuniecki, P R; Saz, H J

    1981-10-01

    The rate of 14CO2 evolution from 1-[14C]pyruvate by intact Ascaris mitochondria was very slow, but increased with increasing concentrations of pyruvate. At all concentrations of pyruvate, in an aerobic environment, pyruvate decarboxylation was stimulated greatly by the addition of fumarate, malate, or succinate. However, under anaerobic conditions, only malate and fumarate stimulated pyruvate decarboxylation; succinate had no effect. This implies that the aerobic metabolism of succinate, presumably to other dicarboxylic acids, may be required for the stimulation. Incubation of sonicated mitochondria with pyruvate plus fumarate, under rate-limiting concentrations of NAD+, resulted in approximately equal quantities of pyruvate utilized and succinate formed, suggesting that pyruvate oxidation and fumarate reduction may be linked. Branched-chain, volatile fatty acids were not formed during incubations with either malate or succinate, or succinate plus acetate. However, incubations of intact Ascaris mitochondria with pyruvate plus succinate yielded 2-methylbutyrate and 2-methylvalerate, whereas incubations with pyruvate plus propionate yielded almost exclusively 2-methylvalerate. Oxygen dramatically inhibited the synthesis of the branched-chain acids from succinate plus pyruvate, attesting to the apparent anaerobic nature of Ascaris mitochondrial metabolism. Significantly, the addition of glucose plus ADP stimulated the formation of all volatile fatty acids. Therefore, the synthesis of branched-chain acids may be related directly to increased energy generation. Alternatively, they may function in the regulatory role of maintaining the mitochondrial redox balance.

  8. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  9. Synthesis of side chain N,N'-diaminoalkylated derivatives of basic amino acids for application in solid-phase peptide synthesis.

    PubMed

    Pitteloud, Jean-Philippe; Bionda, Nina; Cudic, Predrag

    2013-01-01

    Despite the enormous therapeutic potential, the clinical use of peptides has been limited by their poor bioavailability and low stability under physiological conditions. Hence, efforts have been undertaken to alter peptide structure in ways to improve their pharmacological properties. Inspired by the importance of basic amino acids in biological systems and the remarkable versatility displayed by lysine during the synthesis of complex peptide scaffolds, this chapter describes a simple procedure that enables rapid access to protected N,N'-diaminoalkylated basic amino acid building blocks suitable for standard solid-phase peptide synthesis. This procedure allows preparation of symmetrical, as well as unsymmetrical, dialkylated amino acid derivatives that can be further modified, enhancing their synthetic utility. The suitability of the synthesized branched basic amino acid building blocks for use in standard solid-phase peptide synthesis has been demonstrated by synthesis of an indolicidin analog in which the lysine residue was substituted with its synthetic polyamino derivate. The substitution provided indolicidin analog with increase net positive charge, more ordered secondary structure in biological membranes mimicking conditions, and enhanced antibacterial activity without altering hemolytic activity. Taking into consideration the increasing interest for peptides with unusual structural features due to their improved biological properties, the described synthesis of polyfunctional amino acid building blocks is of particular practical value.

  10. The effects of borate minerals on the synthesis of nucleic acid bases, amino acids and biogenic carboxylic acids from formamide.

    PubMed

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; Di Mauro, Ernesto; Crestini, Claudia

    2011-08-01

    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  11. Synthesis and characterization of agricultural controllable humic acid superabsorbent.

    PubMed

    Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

    2013-12-01

    Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent.

  12. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  13. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  14. Differential modulation of citrate synthesis and release by fatty acids in perfused working rat hearts.

    PubMed

    Vincent, Genevieve; Bouchard, Bertrand; Khairallah, Maya; Des Rosiers, Christine

    2004-01-01

    The objective of this study was to test the effect of increasing fatty acid concentrations on substrate fluxes through pathways leading to citrate synthesis and release in the heart. This was accomplished using semirecirculating work-performing rat hearts perfused with substrate mixtures mimicking the in situ milieu (5.5 mM glucose, 8 nM insulin, 1 mM lactate, 0.2 mM pyruvate, and 0.4 mM oleate-albumin) and 13C methods. Raising the fatty acid concentration from 0.4 to 1 mM with long-chain oleate or medium-chain octanoate resulted in a lowering ( approximately 20%) of cardiac output and efficiency with unaltered O2 consumption. At the metabolic level, beyond the expected effects of high fatty acid levels on the contribution of pyruvate decarboxylation (reduced >3-fold) and beta-oxidation (enhanced approximately 3-fold) to citrate synthesis, there was also a 2.4-fold lowering of anaplerotic pyruvate carboxylation. Despite the dual inhibitory effect of high fatty acids on pyruvate decarboxylation and carboxylation, tissue citrate levels were twofold higher, but citrate release rates remained unchanged at 11-14 nmol/min, representing <0.5% of citric acid cycle flux. A similar trend was observed for most metabolic parameters after oleate or octanoate addition. Together, these results emphasize a differential modulation of anaplerotic pyruvate carboxylation and citrate release in the heart by fatty acids. We interpret the lack of effects of high fatty acid concentrations on citrate release rates as suggesting that, under physiological conditions, this process is maximal, probably limited by the activity of its mitochondrial or plasma membrane transporter. Limited citrate release at high fatty acid concentrations may have important consequences for the heart's fuel metabolism and function.

  15. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  16. Synthesis and biological activity of hydroxylated derivatives of linoleic acid and conjugated linoleic acids.

    PubMed

    Li, Zhen; Tran, Van H; Duke, Rujee K; Ng, Michelle C H; Yang, Depo; Duke, Colin C

    2009-03-01

    Allylic hydroxylated derivatives of the C18 unsaturated fatty acids were prepared from linoleic acid (LA) and conjugated linoleic acids (CLAs). The reaction of LA methyl ester with selenium dioxide (SeO(2)) gave mono-hydroxylated derivatives, 13-hydroxy-9Z,11E-octadecadienoic acid, 13-hydroxy-9E,11E-octadecadienoic acid, 9-hydroxy-10E,12Z-octadecadienoic acid and 9-hydroxy-10E,12E-octadecadienoic acid methyl esters. In contrast, the reaction of CLA methyl ester with SeO(2) gave di-hydroxylated derivatives as novel products including, erythro-12,13-dihydroxy-10E-octadecenoic acid, erythro-11,12-dihydroxy-9E-octadecenoic acid, erythro-10,11-dihydroxy-12E-octadecenoic acid and erythro-9,10-dihydroxy-11E-octadecenoic acid methyl esters. These products were purified by normal-phase short column vacuum chromatography followed by high-performance liquid chromatography (HPLC). Their chemical structures were characterized by liquid chromatography-mass spectrometry (LC-MS) and nuclear magnetic resonance spectroscopy (NMR). The allylic hydroxylated derivatives of LA and CLA exhibited moderate in vitro cytotoxicity against a panel of human cancer cell lines including chronic myelogenous leukemia K562, myeloma RPMI8226, hepatocellular carcinoma HepG2 and breast adenocarcinoma MCF-7 cells (IC(50) 10-75 microM). The allylic hydroxylated derivatives of LA and CLA also showed toxicity to brine shrimp with LD(50) values in the range of 2.30-13.8 microM. However these compounds showed insignificant toxicity to honeybee at doses up to 100 microg/bee.

  17. Synthesis of 11-Thialinoleic Acid and 14-Thialinoleic Acid, Inhibitors of Soybean and Human Lipoxygenases

    PubMed Central

    Jacquot, Cyril; McGinley, Chris M.; Plata, Erik; Holman, Theodore R.

    2010-01-01

    Lipoxygenases catalyse the oxidation of polyunsaturated fatty acids and have been invoked in many diseases including cancer, atherosclerosis and Alzheimer’s disease. Currently, no X-ray structures are available with substrate or substrate analogues bound in a productive conformation. Such structures would be very useful for examining interactions between substrate and active site residues. Reported here are the syntheses of linoleic acid analogues containing a sulphur atom at the 11 or 14 positions. The key steps in the syntheses were the incorporation of sulphur using nucleophilic attack of metallated alkynes on electrophilic sulphur compounds and the subsequent stereospecific tantalum-mediated reduction of the alkynylsulphide to the cis-alkenylsulphide. Kinetic assays performed with soybean lipoxygenase-1 showed that both 11-thialinoleic acid and 14-thialinoleic acid were competitive inhibitors with respect to linoleic acid with Ki values of 22 and 35 µM, respectively. On the other hand, 11-thialinoleic acid was a noncompetitive inhibitor with respect to arachidonic acid with Kis and Kii values of 48 and 36 µM, respectively. 11-Thialinoleic acid was also a noncompetitive inhibitor of human 15-lipoxygenase-1 with arachidonic acid (Kis = 11.4 µM, Kii = 18.1 µM) or linoleic acid as substrate (Kis = 20.1 µM, Kii = 20.0 µM), and a competitive inhibitor of human 12-lipoxygenase with arachidonic acid as substrate (Ki = 2.5 µM). The presence of inhibitor did not change the regioselectivity of soybean lipoxygenase-1, human 12- or 15-lipoxygenase-1. PMID:18972057

  18. Control of the Synthesis of Macromolecules During Amino Acid and Thymine Starvation in Bacillus subtilis

    PubMed Central

    Anraku, Naoyo; Landman, Otto E.

    1968-01-01

    Studies of Maaløe, Lark, and others with amino acid- and thymine-starved cultures revealed successive steps in the biosynthesis of Escherichia coli chromosomes. In this study, the corresponding mechanisms in Bacillus subtilis 168 were examined. Using a strain requiring both thymine and tryptophan, we found that, 3 hr after the start of amino acid starvation, when the deoxyribonucleic acid (DNA) content of the culture had increased 40 to 50%, DNA synthesis ceased. After 4 to 5 hr, 100% of the cells were immune to thymineless death; their chromosomes had presumably been completed. Immune cultures slowly incorporated 3H-thymine. Thymine incorporation increased 20-fold 30 min after readdition of amino acids, indicating reinitiation of chromosome synthesis. Simultaneous presence of amino acids and thymine was required for reinitiation. If 5-bromouracil (5-BU) was added instead of thymine, newly replicated DNA segments could be separated by centrifugation in CsCl. Analysis of the CsCl fractions by a transformation assay showed that the order in which the markers were synthesized was ade-16, thr-5, leu-8, metB5. Less than half the chromosomes started resynthesis synchronously in 5-BU. Nevertheless, chromosome alignment in the amino acid-starved culture is probably very good: marker frequency analysis of its DNA gives the same normalized frequencies as DNA from “perfectly” aligned spores. Full viability is maintained in the chromosome-arrested culture for 10 hr in thymine-free medium in the absence or presence of amino acids. In the latter condition, protein synthesis proceeds, and the cells filament and become more lysozyme-sensitive. Such cells must be incubated and plated on hypertonic or on slow-growth media; otherwise, they undergo “quasiosmotic” thymineless death. This death is thus apparently not directly attributable to any damage of chromosomal DNA. Further, weakening of the teichoic acid portion of the cell wall is not involved, since 32P incorporation

  19. Synthesis and cytotoxic evaluation of novel paraconic acid analogs.

    PubMed

    Le Floch, Camille; Le Gall, Erwan; Léonel, Eric; Martens, Thierry; Cresteil, Thierry

    2011-12-01

    A novel class of 2,3-tri- and tetrasubstituted γ-butyrolactones analogous to paraconic acids has been synthesized in one step using a straightforward three-component reaction among aryl bromides, dimethyl itaconate and carbonyl compounds. The in vitro cytotoxic activity of representative compounds has been evaluated against a panel of human cancer cell lines (KB, HCT116, MCF7, HL60). While most molecules exhibit a low to moderate background activity on both KB and HL60 cancer cell lines, one compound shows increased antiproliferative activities against both cell lines with IC(50) values in the 10(-7)-10(-6)mol/L range. An extended evaluation indicated that this compound also inhibits PC3, SK-OV3, MCF7R and HL60R cell growth in the same fashion.

  20. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  1. Synthesis and cholinesterase inhibition of cativic acid derivatives.

    PubMed

    Alza, Natalia P; Richmond, Victoria; Baier, Carlos J; Freire, Eleonora; Baggio, Ricardo; Murray, Ana Paula

    2014-08-01

    Alzheimer's disease (AD) is a neurodegenerative disorder associated with memory impairment and cognitive deficit. Most of the drugs currently available for the treatment of AD are acetylcholinesterase (AChE) inhibitors. In a preliminary study, significant AChE inhibition was observed for the ethanolic extract of Grindelia ventanensis (IC₅₀=0.79 mg/mL). This result prompted us to isolate the active constituent, a normal labdane diterpenoid identified as 17-hydroxycativic acid (1), through a bioassay guided fractionation. Taking into account that 1 showed moderate inhibition of AChE (IC₅₀=21.1 μM), selectivity over butyrylcholinesterase (BChE) (IC₅₀=171.1 μM) and that it was easily obtained from the plant extract in a very good yield (0.15% w/w), we decided to prepare semisynthetic derivatives of this natural diterpenoid through simple structural modifications. A set of twenty new cativic acid derivatives (3-6) was prepared from 1 through transformations on the carboxylic group at C-15, introducing a C2-C6 linker and a tertiary amine group. They were tested for their inhibitory activity against AChE and BChE and some structure-activity relationships were outlined. The most active derivative was compound 3c, with an IC₅₀ value of 3.2 μM for AChE. Enzyme kinetic studies and docking modeling revealed that this inhibitor targeted both the catalytic active site and the peripheral anionic site of this enzyme. Furthermore, 3c showed significant inhibition of AChE activity in SH-SY5Y human neuroblastoma cells, and was non-cytotoxic.

  2. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  3. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  4. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  5. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  6. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  7. Synthesis and Physical Properties of Estolide Ester Using Saturated Fatty Acid and Ricinoleic Acid

    PubMed Central

    Salimon, Jumat; Nallathamby, Neeranjini; Salih, Nadia; Abdullah, Bashar Mudhaffar

    2011-01-01

    A study was conveyed to produce estolide ester using ricinoleic acid as the backbone. The ricinoleic acid reacted with saturated fatty acid from C8–C18. These reactions were conducted under vacuum at 60°C for 24 h without solvent. The reaction used acid catalyst, sulphuric acid. The new saturate ricinoleic estolide esters show superior low-temperature properties (−52 ± 0.08°C) and high flash point (>300°C). The yield of the neat estolide esters ranged from 52% to 96%. The viscosity range was 51 ± 0.08 to 86 ± 0.01 cp. These new saturated estolide esters were also compared with saturated branched estolide esters. PMID:22007150

  8. Enantiopure synthesis of dihydrobenzo[1,4]-oxazine-3-carboxylic acids and a route to benzoxazinyl oxazolidinones.

    PubMed

    Malhotra, Rajesh; Dey, Tushar K; Basu, Sourav; Hajra, Saumen

    2015-03-21

    A two step protocol is developed for the efficient synthesis of enantiopure N-Boc-dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 from serine derived cyclic sulfamidate via intramolecular arylamination. The RuPhos Palladacycle along with additional RuPhos ligand is found to be an efficient catalyst for the arylamination of β-(2-bromoaryloxy)amino acids 3 to provide easy and direct access to a variety of dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 with complete retention of enantiopurity in moderate to high yields. Dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids are not only important unnatural amino acids, but are key precursors for the synthesis of important compounds such as benzoxazinyl oxazolidinones. A general approach for the synthesis of benzoxazinyl oxazolidinone is presented.

  9. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  10. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-01-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  11. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  12. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |

    1996-05-01

    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  13. Revisiting the cell biology of the acyl-ACP:phosphate transacylase PlsX suggests that the phospholipid synthesis and cell division machineries are not coupled in Bacillus subtilis.

    PubMed

    Sastre, Diego Emiliano; Bisson-Filho, Alexandre; de Mendoza, Diego; Gueiros-Filho, Frederico J

    2016-05-01

    PlsX is a central enzyme of phospholipid synthesis in bacteria, converting acyl-ACP to acyl-phosphate on the pathway to phosphatidic acid formation. PlsX has received attention because it plays a key role in the coordination of fatty acid and phospholipid synthesis. Recently, PlsX was also suggested to coordinate membrane synthesis with cell division in Bacillus subtilis. Here, we have re-investigated the cell biology of PlsX and determined that the enzyme is uniformly distributed on the membrane of most cells, but occasionally appears as membrane foci as well. Foci and homogenous patterns seem freely interconvertible but the prevalence of the uniform staining suggests that PlsX does not need to localize to specific sites to function correctly. We also investigated the relationship between PlsX and the divisome. In contrast to previous observations, PlsX's foci showed no obvious periodicity of localization and did not colocalize with the divisome. Furthermore, depletion of PlsX did not affect cell division if phospholipid synthesis is maintained by an alternative enzyme. These results suggest that coordination between division and membrane synthesis may not require physical or functional interactions between the divisome and phospholipid synthesis enzymes.

  14. Synthesis of tricyclic indole-2-carboxylic [correction of caboxylic] acids as potent NMDA-glycine antagonists.

    PubMed

    Katayama, S; Ae, N; Nagata, R

    2001-05-18

    The practical synthesis of a series of tricyclic indole-2-carboxylic acids, 7-chloro-3-arylaminocarbonylmethyl-1,3,4,5-tetrahydrobenz[cd]indole-2-carboxylic acids, as a new class of potent NMDA-glycine antagonists is described. The synthetic route to the key intermediate 12a comprises a regioselective iodination of 4-chloro-2-nitrotoluene, modified Reissert indole synthesis, Jeffery's Heck-type reaction with allyl alcohol, Wittig-Horner-Emmons reaction, and iodination at the indole C-3 position. The key step in the route is an intramolecular cyclization of 12a to give the tricyclic indole structure. Two methods of cyclization, (1) an intramolecular radical cyclization of 12a and (2) a sequence of intramolecular Heck reaction of 12a followed by a 1,4-reduction, were performed. The resulting tricyclic indole diester 13a was selectively hydrolyzed to afford the desired tricyclic indole monocarboxylic acid 16 on a multihundred gram scale without any chromatographic purifications. Optical resolution of 16 to (-)-isomer 17 and (+)-isomer 18 was carried out, and the resulting isomers were derivatized, respectively. Evaluation of the optically active derivatives for affinity to the NMDA-glycine binding site using the radio ligand binding assay with [(3)H]-5,7-dichlorokynurenic acid revealed that the derivatives of (-)-isomer 17 were more potent than the others and that especially substituted anilide (-)-isomer 24 (K(i) = 0.8 nM) showed high affinity.

  15. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women.

    PubMed

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-12-16

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m², n = 35) and moderately obese women (BMI 30-38 kg/m², n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity.

  16. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  17. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  18. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  19. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  20. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.

    PubMed

    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta

    2016-05-23

    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation.

  1. Engineering fungal de novo fatty acid synthesis for short chain fatty acid production

    PubMed Central

    Gajewski, Jan; Pavlovic, Renata; Fischer, Manuel; Boles, Eckhard; Grininger, Martin

    2017-01-01

    Fatty acids (FAs) are considered strategically important platform compounds that can be accessed by sustainable microbial approaches. Here we report the reprogramming of chain-length control of Saccharomyces cerevisiae fatty acid synthase (FAS). Aiming for short-chain FAs (SCFAs) producing baker's yeast, we perform a highly rational and minimally invasive protein engineering approach that leaves the molecular mechanisms of FASs unchanged. Finally, we identify five mutations that can turn baker's yeast into a SCFA producing system. Without any further pathway engineering, we achieve yields in extracellular concentrations of SCFAs, mainly hexanoic acid (C6-FA) and octanoic acid (C8-FA), of 464 mg l−1 in total. Furthermore, we succeed in the specific production of C6- or C8-FA in extracellular concentrations of 72 and 245 mg l−1, respectively. The presented technology is applicable far beyond baker's yeast, and can be plugged into essentially all currently available FA overproducing microorganisms. PMID:28281527

  2. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  3. Effect of nitric acid concentrations on synthesis and stability of maghemite nanoparticles suspension.

    PubMed

    Nurdin, Irwan; Johan, Mohd Rafie; Yaacob, Iskandar Idris; Ang, Bee Chin

    2014-01-01

    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension.

  4. Chemical synthesis and biological evaluation of ω-hydroxy polyunsaturated fatty acids.

    PubMed

    Hwang, Sung Hee; Wagner, Karen; Xu, Jian; Yang, Jun; Li, Xichun; Cao, Zhengyu; Morisseau, Christophe; Lee, Kin Sing Stephen; Hammock, Bruce D

    2017-02-01

    ω-Hydroxy polyunsaturated fatty acids (PUFAs), natural metabolites from arachidonic acid (ARA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) were prepared via convergent synthesis approach using two key steps: Cu-mediated CC bond formation to construct methylene skipped poly-ynes and a partial alkyne hydrogenation where the presence of excess 2-methyl-2-butene as an additive that is proven to be critical for the success of partial reduction of the poly-ynes to the corresponding cis-alkenes without over-hydrogenation. The potential biological function of ω-hydroxy PUFAs in pain was evaluated in naive rats. Following intraplantar injection, 20-hydroxyeicosatetraenoic acid (20-HETE, ω-hydroxy ARA) generated an acute decrease in paw withdrawal thresholds in a mechanical nociceptive assay indicating pain, but no change was observed from rats which received either 20-hydroxyeicosapentaenoic acid (20-HEPE, ω-hydroxy EPA) or 22-hydroxydocosahexaenoic acid (22-HDoHE, ω-hydroxy DHA). We also found that both 20-HEPE and 22-HDoHE are more potent than 20-HETE to activate murine transient receptor potential vanilloid receptor1 (mTRPV1).

  5. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  6. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.

    2015-01-01

    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  7. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  8. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed Central

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells. PMID:6965093

  9. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells.

  10. Synthesis and anticoagulant activity of bioisosteric sulfonic-Acid analogues of the antithrombin-binding pentasaccharide domain of heparin.

    PubMed

    Herczeg, Mihály; Lázár, László; Bereczky, Zsuzsanna; Kövér, Katalin E; Timári, István; Kappelmayer, János; Lipták, András; Antus, Sándor; Borbás, Anikó

    2012-08-20

    Two pentasaccharide sulfonic acids that were related to the antithrombin-binding domain of heparin were prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic-acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic-acid esters were found to be excellent donors and acceptors in the glycosylation reactions. Throughout the synthesis, the hydroxy groups to be methylated were masked in the form of acetates and the hydroxy groups to be sulfated were masked with benzyl groups. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of these new sulfonic-acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic-acid moiety resulted in a notable decrease in the anti-Xa activity. The difference in the biological activity of the disulfonic- and trisulfonic-acid counterparts could be explained by the different conformation of their L-iduronic-acid residues.

  11. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  12. Amino acid metabolism and protein synthesis in lactating rats fed on a liquid diet.

    PubMed Central

    Barber, T; García de la Asunción, J; Puertes, I R; Viña, J R

    1990-01-01

    1. Amino acid metabolism was studied in control virgin rats, lactating rats and virgin rats protein-pair-fed with the lactating rats (high-protein virgin rats). 2. Urinary excretion of nitrogen and urea was higher in lactating than in control virgin rats, and in high-protein virgin rats it was higher than in lactating rats. 3. The activities of urea-cycle enzymes (units/g) were higher in high-protein virgin than in lactating rats, except for arginase. In lactating rats the activities of carbamoyl-phosphate synthase, ornithine carbamoyltransferase and argininosuccinate synthase were lower than in control virgin rats. When the liver size is considered, the activities in lactating rats were similar to those in high-protein virgin rats, except for arginase. 4. N-Acetylglutamate content was higher in high-protein virgin rats than in the other two groups. 5. The rate of urea synthesis from precursors by isolated hepatocytes was higher in high-protein virgin rats than in the other two groups. 6. The flooding-dose method (L-[4-3H]phenylalanine) for measuring protein synthesis was used. The absolute synthesis rates of mammary gland, liver and small-intestinal mucosa were higher in lactating rats than in the other two groups, and in high-protein virgin rats than in control virgin rats 7. These results show that the increased needs for amino acids during lactation are met by hyperphagia and by a nitrogen-sparing mechanism. PMID:2396994

  13. Synthesis of goethite in solutions of artificial seawater and amino acids: a prebiotic chemistry study

    NASA Astrophysics Data System (ADS)

    Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.

    2013-04-01

    This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was

  14. A strategy for the solution-phase parallel synthesis of N-(pyrrolidinylmethyl)hydroxamic acids.

    PubMed

    Takayanagi, M; Flessner, T; Wong, C H

    2000-06-16

    Both five- and six-membered iminocyclitols have proven to be useful transition-state analogue inhibitors of glycosidases. They also mimic the transition-state sugar moiety of the nucleoside phosphate sugar in glycosyltransferase-catalyzed reactions. Described here is the development of a general strategy toward the parallel synthesis of a five-membered iminocyclitol linked to a hydroxamic acid group designed to mimic the transition state of GDP-fucose complexed with Mn(II) in fucosyltransferase reactions. The iminocyclitol 8 containing a protected hydroxylamine unit was prepared from D-mannitol. The hydroxamic acid moiety was introduced via the reaction of 8 with various acid chlorides. The strategy is generally applicable to the construction of libraries for identification of glycosyltransferase inhibitors.

  15. Facile synthesis of PtAu alloy nanoparticles with high activity for formic acid oxidation

    SciTech Connect

    Zhang, Sheng; Shao, Yuyan; Yin, Geping; Lin, Yuehe

    2010-02-15

    We report the facile synthesis of carbon supported PtAu alloy nanoparticles with high electrocatalytic activity as the anode catalyst for direct formic acid fuel cells (DFAFCs). PtAu alloy nanopaticles are synthesized by co-reducing HAuCl4 and H2PtCl6 with NaBH4 in the presence of sodium citrate and then the nanoparticles are deposited on Vulcan XC-72R carbon support (PtAu/C). The obtained catalysts are characterized with X-ray diffraction (XRD) and transmission electron microscope (TEM), which reveal PtAu alloy formation with an average diameter of 4.6 nm. PtAu/C exhibits 8 times higher catalytic activity toward formic acid oxidation than Pt/C. The enhanced activity of PtAu/C catalyst is attributed to noncontinuous Pt sites formed in the presence of the neighbored Au sites, which promotes direct oxidation of formic acid by avoiding poison CO.

  16. A plausible simultaneous synthesis of amino acids and simple peptides on the primordial Earth.

    PubMed

    Parker, Eric T; Zhou, Manshui; Burton, Aaron S; Glavin, Daniel P; Dworkin, Jason P; Krishnamurthy, Ramanarayanan; Fernández, Facundo M; Bada, Jeffrey L

    2014-07-28

    Following his seminal work in 1953, Stanley Miller conducted an experiment in 1958 to study the polymerization of amino acids under simulated early Earth conditions. In the experiment, Miller sparked a gas mixture of CH4, NH3, and H2O, while intermittently adding the plausible prebiotic condensing reagent cyanamide. For unknown reasons, an analysis of the samples was not reported. We analyzed the archived samples for amino acids, dipeptides, and diketopiperazines by liquid chromatography, ion mobility spectrometry, and mass spectrometry. A dozen amino acids, 10 glycine-containing dipeptides, and 3 glycine-containing diketopiperazines were detected. Miller's experiment was repeated and similar polymerization products were observed. Aqueous heating experiments indicate that Strecker synthesis intermediates play a key role in facilitating polymerization. These results highlight the potential importance of condensing reagents in generating diversity within the prebiotic chemical inventory.

  17. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.

  18. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.

    PubMed

    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P

    2016-03-01

    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA.

  19. Docosahexaenoic acid synthesis from alpha-linolenic acid is inhibited by diets high in polyunsaturated fatty acids.

    PubMed

    Gibson, R A; Neumann, M A; Lien, E L; Boyd, K A; Tu, W C

    2013-01-01

    The conversion of the plant-derived omega-3 (n-3) α-linolenic acid (ALA, 18:3n-3) to the long-chain eicosapentaenoic acid (EPA, 20:5n-3) and docosahexaenoic acid (DHA, 22:6n-3) can be increased by ALA sufficient diets compared to ALA deficient diets. Diets containing ALA above an optimal level result in no further increase in DHA levels in animals and humans. The present study evaluates means of maximizing plasma DHA accumulation by systematically varying both linoleic acid (LA, 18:2n-6) and ALA dietary level. Weanling rats were fed one of 54 diets for three weeks. The diets varied in the percentage of energy (en%) of LA (0.07-17.1 en%) and ALA (0.02-12.1 en%) by manipulating both the fat content and the balance of vegetable oils. The peak of plasma phospholipid DHA (>8% total fatty acids) was attained as a result of feeding a narrow dietary range of 1-3 en% ALA and 1-2 en% LA but was suppressed to basal levels (∼2% total fatty acids) at dietary intakes of total polyunsaturated fatty acids (PUFA) above 3 en%. We conclude it is possible to enhance the DHA status of rats fed diets containing ALA as the only source of n-3 fatty acids but only when the level of dietary PUFA is low (<3 en%).

  20. Synthesis and characterization of m- and p-methylbenzyl-mercapturic acids derived from m- and p-xylenes.

    PubMed

    Tanaka, M; Noda, T; Moriwaki, H; Tsujimoto, Y

    1997-06-01

    Chemical synthesis and physical properties of two mercapturic acids suggested as urinary metabolites of m- and p-xylenes are described. These compounds may be used for the identification and quantitative determination by high-performance liquid chromatography of the corresponding mercapturic acids in urine.