Science.gov

Sample records for phosphoprotein phosphatases

  1. Molecular Evolution of Phosphoprotein Phosphatases in Drosophila

    PubMed Central

    Miskei, Márton; Ádám, Csaba; Kovács, László; Karányi, Zsolt; Dombrádi, Viktor

    2011-01-01

    Phosphoprotein phosphatases (PPP), these ancient and important regulatory enzymes are present in all eukaryotic organisms. Based on the genome sequences of 12 Drosophila species we traced the evolution of the PPP catalytic subunits and noted a substantial expansion of the gene family. We concluded that the 18–22 PPP genes of Drosophilidae were generated from a core set of 8 indispensable phosphatases that are present in most of the insects. Retropositons followed by tandem gene duplications extended the phosphatase repertoire, and sporadic gene losses contributed to the species specific variations in the PPP complement. During the course of these studies we identified 5, up till now uncharacterized phosphatase retrogenes: PpY+, PpD5+, PpD6+, Pp4+, and Pp6+ which are found only in some ancient Drosophila. We demonstrated that all of these new PPP genes exhibit a distinct male specific expression. In addition to the changes in gene numbers, the intron-exon structure and the chromosomal localization of several PPP genes was also altered during evolution. The G−C content of the coding regions decreased when a gene moved into the heterochromatic region of chromosome Y. Thus the PPP enzymes exemplify the various types of dynamic rearrangements that accompany the molecular evolution of a gene family in Drosophilidae. PMID:21789237

  2. Leishmanial phosphatase hydrolyzes phosphoproteins and inositol phosphates

    SciTech Connect

    Saha, A.K.; Das, S.; Glew, R.H.

    1986-05-01

    An extensively purified preparation of the predominant, tartrate-resistant acid phosphatase (ACP) from the external surface of Leishmania donovani promastigotes form catalyzes the dephosphorylation of several phosphoproteins; these include: pyruvate kinase, phosphorylase kinase and histones. However, the protein phosphatase activity of ACP is very low compared with that of other protein phosphates known to be involved in regulating various metabolic pathways. /sup 32/P-labelled inositoltriphosphate (IP3), a well-established second messenger derived from phosphatidylinositol-4,5-diphosphate (PIP2), was a substrate for the leishmanial acid phosphatase; incubation of the IP3 preparation with 13.2 milliunits (1 unit equals 1 ..mu..mol 4-methylumbelliferyl phosphate (MUP) cleaved per min at pH 5.5) of ACP at pH 5.5 for 4 hr resulted in hydrolysis of 75% of the radiolabelled substrate resulting in a mixture of inositoldiphosphate and inositolmonophosphate. In addition PIP2 was hydrolyzed rapidly by ACP at pH 5.5 (V/sub max/, 71 units/mg protein; k/sub m/, 4.16 ..mu..M). In contrast, to MUP which is hydrolzyed most rapidly at pH 5.5, PIP2 hydrolysis was optimal at pH 6.8. These observations raise the possibility that ACP could play a role in the host-phagocyte interaction by degrading the precursor of the second messenger, PIP2 or the second messenger itself, IP3.

  3. The relationship between the MMP system, adrenoceptors and phosphoprotein phosphatases

    PubMed Central

    Rietz, A; Spiers, JP

    2012-01-01

    The MMPs and their inhibitors [tissue inhibitor of MMPs (TIMPs) ] form the mainstay of extracellular matrix homeostasis. They are expressed in response to numerous stimuli including cytokines and GPCR activation. This review highlights the importance of adrenoceptors and phosphoprotein phosphatases (PPP) in regulating MMPs in the cardiovascular system, which may help explain some of the beneficial effects of targeting the adrenoceptor system in tissue remodelling and will establish emerging crosstalk between these three systems. Although α- and β-adrenoceptor activation increases MMP but decreases TIMP expression, MMPs are implicated in the growth stimulatory effects of adrenoceptor activation through transactivation of epidermal growth factor receptor. Furthermore, they have recently been found to catalyse the proteolysis of β-adrenoceptors and modulate vascular tone. While the mechanisms underpinning these effects are not well defined, reversible protein phosphorylation by kinases and phosphatases may be key. In particular, PPP (Ser/Thr phosphatases) are not only critical in resensitization and internalization of adrenoceptors but also modulate MMP expression. The interrelationship is complex as isoprenaline (ISO) inhibits okadaic acid [phosphoprotein phosphatase type 1/phosphoprotein phosphatase type 2A (PP2A) inhibitor]-mediated MMP expression. While this may be simply due to its ability to transiently increase PP2A activity, there is evidence for MMP-9 that ISO prevents okadaic acid-mediated expression of MMP-9 through a β-arrestin, NF-κB-dependent pathway, which is abolished by knock-down of PP2A. It is essential that crosstalk between MMPs, adrenoceptors and PPP are investigated further as it will provide important insight into how adrenoceptors modulate cardiovascular remodelling, and may identify new targets for pharmacological manipulation of the MMP system. PMID:22364165

  4. Phosphoprotein phosphatase of bovine spleen cell nuclei: physicochemical properties

    SciTech Connect

    Rezyapkin, V.I.; Leonova, L.E.; Komkova, A.I.

    1986-01-10

    The physicochemical properties of phosphoprotein phosphatase (EC 1.3.1.16) from bovine spleen cell nuclei were studied. The enzyme possesses broad substrate specificity and catalyzes the dephosphorylation of phosphocasein, ATP, ADP, and p-nitrophenyl phosphate (pNPP). K/sub m/ for ATP, ADP, and pNPP are equal to 0.44, 0.43, and 1.25 mM, respectively. M/sub r/ of the enzyme, according to the data of gel filtraction of Sephadex G-75 and electrophoresis in polyacrylamide gel of various concentrations is approx. 33,000. In electrophoresis in the presence of SDS, two protein bands with M/sub r/ 12,000 and 18,000 are detected. In the enzyme molecule, acid amino acid residues predominate; two free SH groups and two disulfide bridges are detected. Phosphoprotein phosphatase is a glycoprotein, containing approx. 22% carbonhydrates. The protein possesses a supplementary absorption maximum at 560 nm. Ammonium molybdate is a competitive inhibitor with K/sub i/ 0.37 ..mu..M, while sodium fluoride is a noncompetitive inhibitor with K/sub i/ 1.3 mM. Incubation in the presence of 2 mM phenylmethylsulfonyl fluoride for 25 h leads to a loss of approx. 46% of the enzymatic activity. Ammonium molybdate, sodium fluoride, and PMSF are reversible inhibitors. Modifications of the SH groups, NH/sub 2/ groups, and histidine leads to a decrease in the enzymatic activity. Incubation of phosphoprotein phosphatase with (..gamma..-/sup 32/P)ATP leads to the incorporation of 0.33 mole /sup 33/P per mole of the enzyme. The mechanism of hydrolysis of the phosphodiester bond, catalyzed by the enzyme, is discussed.

  5. Hyperphosphatemia, Phosphoprotein Phosphatases, and Microparticle Release in Vascular Endothelial Cells

    PubMed Central

    Abbasian, Nima; Burton, James O.; Herbert, Karl E.; Tregunna, Barbara-Emily; Brown, Jeremy R.; Ghaderi-Najafabadi, Maryam; Brunskill, Nigel J.; Goodall, Alison H.

    2015-01-01

    Hyperphosphatemia in patients with advanced CKD is thought to be an important contributor to cardiovascular risk, in part because of endothelial cell (EC) dysfunction induced by inorganic phosphate (Pi). Such patients also have an elevated circulating concentration of procoagulant endothelial microparticles (MPs), leading to a prothrombotic state, which may contribute to acute occlusive events. We hypothesized that hyperphosphatemia leads to MP formation from ECs through an elevation of intracellular Pi concentration, which directly inhibits phosphoprotein phosphatases, triggering a global increase in phosphorylation and cytoskeletal changes. In cultured human ECs (EAhy926), incubation with elevated extracellular Pi (2.5 mM) led to a rise in intracellular Pi concentration within 90 minutes. This was mediated by PiT1/slc20a1 Pi transporters and led to global accumulation of tyrosine- and serine/threonine-phosphorylated proteins, a marked increase in cellular Tropomyosin-3, plasma membrane blebbing, and release of 0.1- to 1-μm-diameter MPs. The effect of Pi was independent of oxidative stress or apoptosis. Similarly, global inhibition of phosphoprotein phosphatases with orthovanadate or fluoride yielded a global protein phosphorylation response and rapid release of MPs. The Pi-induced MPs expressed VE-cadherin and superficial phosphatidylserine, and in a thrombin generation assay, they displayed significantly more procoagulant activity than particles derived from cells incubated in medium with a physiologic level of Pi (1 mM). These data show a mechanism of Pi-induced cellular stress and signaling, which may be widely applicable in mammalian cells, and in ECs, it provides a novel pathologic link between hyperphosphatemia, generation of MPs, and thrombotic risk. PMID:25745026

  6. Acidic-phosphoprotein phosphatase activity of rat ventral prostate nuclei: apparent lack of effect of androgens.

    PubMed

    Wilson, M J; Ahmed, K; Fischbach, T J

    1978-08-03

    A protein phosphatase activity has been demonstrated in nuclei of rat ventral prostate utilizing 32P-labelled phosvitin as a model acidic phosphoprotein substrate. This phosphoprotein phosphatase has a pH optimum of 6.7, is unaffected by the sulphydryl protecting agent 2-mercaptoethanol, and requires a divalent cation for maximal activity. Of the various divalent cations tested, Mg2+ is the most effective in reactivating the EDTA-inhibited enzyme. The phosphatase is inhibited by sodium flouride, sodium oxalate, N-ethylmaleimide, ATP and ADP but is relatively insensitive to ammonium molybdate. Increased ionic strength of the reaction medium also causes a reduction in the enzyme activity, e.g., by 48% at 200 mM sodium chloride. The activity of the acidic phosphoprotein phosphatase did not change significantly at 48 h or 96 h post-orchiectomy when expressed per unit of nuclear protein. However, it is reduced by approx. 30% at these times after castration if based on DNA content. The decline in activity per nucleus reflects the decrease in the realtive nuclear protein content observed at 48 h or 96 h post-orchiectomy. This suggests that the decline in the phosphorylation of prostatic nuclear acidic proteins which occurs upon androgen withdrawal is not due to increased nuclear phosphatase activity.

  7. Phosphoproteins with Stability Against All Urinary Phosphatases as Potential Biomarkers in Urine.

    PubMed

    Zhao, Mindi; Liu, Kehui; Gao, Youhe

    2015-01-01

    Urine, by accumulating all kinds of changes, was proposed to be a better source for biomarker discovery. As one of the most common post-translational modifications, phosphorylation plays a vital role in many biological activities. However, the urine phosphoproteome has been largely neglected due to the low abundance of phosphoproteins and the presence of various phosphatases in urine. The low level of background phosphorylation in urine is actually advantageous, as urinary phosphopeptides/proteins that are stable to the phosphatases present in urine have the potential to serve as valuable disease biomarkers. Using a TiO2 enrichment strategy, this study aimed to create a comprehensive proteomic profile of human urinary phosphoproteins and to characterize the changes in the urine phosphoproteome after incubation of urine with renal carcinoma cell lysates. In total, 106 urine phosphorylation sites corresponding to 64 proteins, including 80 previously unidentified human urine protein phosphorylation sites, were identified by mass spectrometry. Fifteen phosphopeptides, together averaging 47% of the total phosphopeptides, were found in samples from three individuals. Cellular proteins are potential source of biomarker in urine phosphorylated proteins. Addition of renal carcinoma cellular proteins to urine did not significantly change the phosphorylation level of urine proteins. But there were still a few phosphopeptides from cell lysates survived urinary phosphatases; such phosphopeptides represent potential biomarkers in urine.

  8. Use of intein-mediated phosphoprotein arrays to study substrate specificity of protein phosphatases.

    PubMed

    Kochinyan, Samvel; Sun, Luo; Ghosh, Inca; Barshevsky, Tanya; Xu, Jie; Xu, Ming-Qun

    2007-01-01

    Synthetic peptides incorporating various chemical moieties, for example, phosphate groups, are convenient tools for investigating protein modification enzymes, such as protein phosphatases (PPs). However, short peptides are sometimes poor substrates, and their binding to commonly used matrices is unpredictable and variable. In general, protein substrates for PPs are superior for enzymatic assays, binding to various matrices, and Western blot analysis. The preparation and characterization of phosphoproteins, however can be difficult and technically demanding. In this study, the intein-mediated protein ligation (IPL) technique was used to readily generate phosphorylated protein substrates by ligating a synthetic phosphopeptide to an intein-generated carrier protein (CP) possessing a carboxyl-terminal thioester with a one-to-one stoichiometry. The ligated phosphoprotein (LPP) substrate was treated with a PP and subsequently subjected to array or Western blot analysis with a phospho-specific antibody. This approach is highly effective in producing arrays of protein substrates containing phosphorylated amino acid residues and has been applied for screening of PPs with specificity toward phosphorylated tyrosine, serine, or threonine residues, resulting in an approximately 240-fold increase in sensitivity in dot blot analysis compared with the use of synthetic peptides. The IPL technique overcomes the disadvantages of current methods and is a versatile system for the facile production of protein substrates containing well-defined structural motifs for the study of protein modification enzymes.

  9. Ser/Thr-phosphoprotein phosphatases in chondrogenesis: neglected components of a two-player game.

    PubMed

    Matta, Csaba; Mobasheri, Ali; Gergely, Pál; Zákány, Róza

    2014-10-01

    Protein phosphorylation plays a determining role in the regulation of chondrogenesis in vitro. While signalling pathways governed by protein kinases including PKA, PKC, and mitogen-activated protein kinases (MAPK) have been mapped in great details, published data relating to the specific role of phosphoprotein phosphatases (PPs) in differentiating chondroprogenitor cells or in mature chondrocytes is relatively sparse. This review discusses the known functions of Ser/Thr-specific PPs in the molecular signalling pathways of chondrogenesis. PPs are clearly equally important as protein kinases to counterbalance the effect of reversible protein phosphorylation. Of the main Ser/Thr PPs, some of the functions of PP1, PP2A and PP2B have been characterised in the context of chondrogenesis. While PP1 and PP2A appear to negatively regulate chondrogenic differentiation and maintenance of chondrocyte phenotype, calcineurin is an important stimulatory mediator during chondrogenesis but becomes inhibitory in mature chondrocytes. Furthermore, PPs are implicated to be mediators during the pathogenesis of osteoarthritis that makes them potential therapeutic targets to be exploited in the close future. Among the many yet unexplored targets of PPs, modulation of plasma membrane ion channel function and participation in mechanotransduction pathways are emerging novel aspects of signalling during chondrogenesis that should be further elucidated. Besides the regulation of cellular ion homeostasis, other potentially significant novel roles for PPs during the regulation of in vitro chondrogenesis are discussed. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Theoretical studies on the mechanism of activation of phosphoprotein phosphatases and purple acid phosphatases suggest an evolutionary strategy to survive in acidic environments.

    PubMed

    Zhang, Hao; Ma, Yingying; Yu, Jian-Guo

    2013-12-01

    Dephosphorylation reactions of phosphoprotein phosphatases (PPPs) share a common catalytic cycle. In one stage of the cycle, the active site is regenerated through formation of a new nucleophilic μ-hydroxy moiety and reprotonation of the proton donor, His125 (numbered according to the protein phosphatase 1 sequence). To date the exact details of the mechanism of this step remain uncertain. On the basis of recurring observations in several crystal structures, we propose an activation mechanism in which dephosphorylation of PPPs proceeds mainly through proton transfer from the water molecule that bridges the metal ions to His125, which is mediated by another water molecule. Our calculations using hybrid density functional theory and B3LYP functionals support this activation mechanism. We also propose that Asp95 facilitates proton transfer by eliminating the energy barrier and the backbone carbonyl oxygen atom of His248 acts mainly to orient and stabilize the μ-hydroxo (or water molecule) through hydrogen bonding. Furthermore, on the basis of the structural similarities of the active sites of purple acid phosphatases (PAPs) and PPPs, we speculate that PAPs are activated by a dual proton transfer mediated by one water molecule. Our calculations support this hypothesis and indicate that the active site of PAPs can still be active in an acidic environment (in agreement with the acid phosphatase activity of PAPs). Therefore, the variant of the activation mechanism from PPPs to PAPs implies an evolutionary adaptation to acidic environments.

  11. A Porphyromonas gingivalis haloacid dehalogenase family phosphatase interacts with human phosphoproteins and is important for invasion.

    PubMed

    Tribble, Gena D; Mao, Song; James, Chloe E; Lamont, Richard J

    2006-07-18

    Haloacid dehalogenase (HAD) family phosphatases are widespread in prokaryotes and are generally involved in metabolic processes. Porphyromonas gingivalis, an invasive periodontal pathogen, secretes the HAD family phosphoserine phosphatase SerB653 when in contact with gingival epithelial cells. Here we characterize the structure and enzymatic activity of SerB653 and show that a SerB653 allelic replacement mutant of P. gingivalis is deficient in internalization and persistence in gingival epithelial cells. In contrast, mutation of a second HAD family serine phosphatase of P. gingivalis (SerB1170), or of a serine transporter, did not affect invasion. A pull-down assay identified GAPDH and heat-shock protein 90 as potential substrates for SerB653. Furthermore, exogenous phosphatase regulated microtubule dynamics in host cells. These data indicate that P. gingivalis has adapted a formerly metabolic enzyme to facilitate entry into host cells by modulating host cytoskeletal architecture. Our findings define a virulence-related role of a HAD family phosphatase and reveal an invasin of an important periodontal pathogen.

  12. Intracellular receptor for somatostatin in gastric mucosal cells: decomposition and reconstitution of somatostatin-stimulated phosphoprotein phosphatases.

    PubMed

    Reyl, F J; Lewin, M J

    1982-02-01

    Using 32P-labeled histone as exogenous substrate, we showed a potent stimulatory effect of somatostatin on cytosolic phosphoprotein phosphatases (PPPases; phosphoprotein phosphohydrolase, EC 3.1.3.16) in rat gastric mucosal cells. Partial purification of cytosolic fraction in DEAE-Sephadex ion-exchange chromatography and further gel filtration on Sephadex C-75 and Sephadex G-100 separated somatostatin-dependent PPPases into three distinct molecular species. One corresponding to Mr 130,000 was devoid of any PPPase activity but specifically bound [Tyr1]somatostatin 125I-labeled on the Tyr ([125I-Tyr1]somatostatin) with an apparent equilibrium dissociation constant of 3 x 10(-10) M. The two other molecular species corresponded to Mrs 64,000 and 13,000. They produced catalytic dephosphorylation of 32P-labeled histone, but they were not sensitive to somatostatin and did not show any specific binding to radiolabeled hormone. Mixing of the larger with either of the two smaller molecular species resulted in concentration -dependent inhibition of PPPase activity. However this inhibition was reversed by increased concentrations of somatostatin, with the concentration for half-maximal reactivation on being close to 0.1 nM. Furthermore somatostatin stimulation in reconstituted materials developed according to a rapid time course (t1/2, less than 5 sec), consistent with that observed for binding of [125I-Tyr1]somatostatin. These results strongly argue for the presence of an intracellular somatostatin receptor in gastric mucosal cells and characterize this receptor as a PPPase regulatory subunit. Thus, substrate dephosphorylation could be the primary event triggering physiological effects of somatostatin in stomach and perhaps other organs of the digestive tract [Reyl, F. & Lewin, M. J.l M. (1981) Biochim. Biophys. Acta 675, 297-300].

  13. Effects of phosphoprotein phosphatase inhibitors (phenylarsine oxide and cantharidin) on Tetrahymena.

    PubMed

    Kovács, P; Pintér, M

    2001-09-01

    The effects of phenylarsine oxide (PAO) (phosphotyrosine phosphatase inhibitor) and cantharidin (serine/threonine phosphatase [PP2A] inhibitor) treatments were analysed on the synthesis of phospholipids and glycolipids, and on the cytoskeletal elements (F-actin and tubulin containing structures) of Tetrahymena pyriformis. Both phosphatase inhibitors reduced the amount of incorporated 32P of the whole phospholipid content, but the ratio of phosphatidylserine (PS) and phosphatidylcholine (PC) to the total phospholipid content increased. Both treatments influenced the phosphatidylinositol (PI) system. These inhibitors also influenced the incorporation of palmitic acid into the phospholipids: in general PAO decreased, whereas cantharidin increased the amount of incorporated palmitic acid; 1 microM cantharidin significantly increased the labelling of PE and PA. The incorporation of mannose and glucosamine was influenced differently by PAO and cantharidin treatments: the latter elevated, while PAO decreased the labelling of glycolipids with these sugars. The effects of these treatments were visible also in the case of confocal scanning laser microscopic (CSLM) images: after treatments with both inhibitors, the F-actin containing cortical elements were destroyed, but the tubulin containing ones (longitudinal and transversal microtubules, oral apparatus and deep fibres) did not display significant alterations. The different effects of phosphatase inhibitors were visible also on the scanning electron microscopic (sEM) images: cantharidin treatments (1 microM) decreased the amount of dissolved membrane lipids after chemical dehydration of the cells with 2, 2-dimethoxy propane (DMP), but in the case of treatments with 10 microM, the surface pattern of cells was similar to the controls. On the other hand, after PAO treatments the surface pattern of Tetrahymena showed significant alterations. Both phosphatase inhibitors inhibited the phagocytotic activity of the cells. On the

  14. Rhizobiales-like Phosphatase 2 from Arabidopsis thaliana Is a Novel Phospho-tyrosine-specific Phospho-protein Phosphatase (PPP) Family Protein Phosphatase*

    PubMed Central

    Uhrig, R. Glen; Labandera, Anne-Marie; Muhammad, Jamshed; Samuel, Marcus; Moorhead, Greg B.

    2016-01-01

    Cellular signaling through protein tyrosine phosphorylation is well established in mammalian cells. Although lacking the classic tyrosine kinases present in humans, plants have a tyrosine phospho-proteome that rivals human cells. Here we report a novel plant tyrosine phosphatase from Arabidopsis thaliana (AtRLPH2) that, surprisingly, has the sequence hallmarks of a phospho-serine/threonine phosphatase belonging to the PPP family. Rhizobiales/Rhodobacterales/Rhodospirillaceae-like phosphatases (RLPHs) are conserved in plants and several other eukaryotes, but not in animals. We demonstrate that AtRLPH2 is localized to the plant cell cytosol, is resistant to the classic serine/threonine phosphatase inhibitors okadaic acid and microcystin, but is inhibited by the tyrosine phosphatase inhibitor orthovanadate and is particularly sensitive to inhibition by the adenylates, ATP and ADP. AtRLPH2 displays remarkable selectivity toward tyrosine-phosphorylated peptides versus serine/threonine phospho-peptides and readily dephosphorylates a classic tyrosine phosphatase protein substrate, suggesting that in vivo it is a tyrosine phosphatase. To date, only one other tyrosine phosphatase is known in plants; thus AtRLPH2 represents one of the missing pieces in the plant tyrosine phosphatase repertoire and supports the concept of protein tyrosine phosphorylation as a key regulatory event in plants. PMID:26742850

  15. Identical phosphatase mechanisms achieved through distinct modes of binding phosphoprotein substrate

    PubMed Central

    Pazy, Y.; Motaleb, M. A.; Guarnieri, M. T.; Charon, N. W.; Zhao, R.; Silversmith, R. E.

    2010-01-01

    Two-component signal transduction systems are widespread in prokaryotes and control numerous cellular processes. Extensive investigation of sensor kinase and response regulator proteins from many two-component systems has established conserved sequence, structural, and mechanistic features within each family. In contrast, the phosphatases which catalyze hydrolysis of the response regulator phosphoryl group to terminate signal transduction are poorly understood. Here we present structural and functional characterization of a representative of the CheC/CheX/FliY phosphatase family. The X-ray crystal structure of Borrelia burgdorferi CheX complexed with its CheY3 substrate and the phosphoryl analogue reveals a binding orientation between a response regulator and an auxiliary protein different from that shared by every previously characterized example. The surface of CheY3 containing the phosphoryl group interacts directly with a long helix of CheX which bears the conserved (E - X2 - N) motif. Conserved CheX residues Glu96 and Asn99, separated by a single helical turn, insert into the CheY3 active site. Structural and functional data indicate that CheX Asn99 and CheY3 Thr81 orient a water molecule for hydrolytic attack. The catalytic residues of the CheX·CheY3 complex are virtually superimposable on those of the Escherichia coli CheZ phosphatase complexed with CheY, even though the active site helices of CheX and CheZ are oriented nearly perpendicular to one other. Thus, evolution has found two structural solutions to achieve the same catalytic mechanism through different helical spacing and side chain lengths of the conserved acid/amide residues in CheX and CheZ. PMID:20080618

  16. Identical phosphatase mechanisms achieved through distinct modes of binding phosphoprotein substrate

    SciTech Connect

    Pazy, Y.; Motaleb, M.A.; Guarnieri, M.T.; Charon, N.W.; Zhao, R.; Silversmith, R.E.

    2010-04-05

    Two-component signal transduction systems are widespread in prokaryotes and control numerous cellular processes. Extensive investigation of sensor kinase and response regulator proteins from many two-component systems has established conserved sequence, structural, and mechanistic features within each family. In contrast, the phosphatases which catalyze hydrolysis of the response regulator phosphoryl group to terminate signal transduction are poorly understood. Here we present structural and functional characterization of a representative of the CheC/CheX/FliY phosphatase family. The X-ray crystal structure of Borrelia burgdorferi CheX complexed with its CheY3 substrate and the phosphoryl analogue BeF{sub 3}{sup -} reveals a binding orientation between a response regulator and an auxiliary protein different from that shared by every previously characterized example. The surface of CheY3 containing the phosphoryl group interacts directly with a long helix of CheX which bears the conserved (E - X{sub 2} - N) motif. Conserved CheX residues Glu96 and Asn99, separated by a single helical turn, insert into the CheY3 active site. Structural and functional data indicate that CheX Asn99 and CheY3 Thr81 orient a water molecule for hydrolytic attack. The catalytic residues of the CheX-CheY3 complex are virtually superimposable on those of the Escherichia coli CheZ phosphatase complexed with CheY, even though the active site helices of CheX and CheZ are oriented nearly perpendicular to one other. Thus, evolution has found two structural solutions to achieve the same catalytic mechanism through different helical spacing and side chain lengths of the conserved acid/amide residues in CheX and CheZ.

  17. Phosphoprotein phosphatase 1CB (PPP1CB), a novel adipogenic activator, promotes 3T3-L1 adipogenesis.

    PubMed

    Cho, Young-Lai; Min, Jeong-Ki; Roh, Kyung Min; Kim, Won Kon; Han, Baek Soo; Bae, Kwang-Hee; Lee, Sang Chul; Chung, Sang J; Kang, Hyo Jin

    2015-11-13

    Understanding the molecular networks that regulate adipogenesis is crucial for gaining insight into obesity and identifying medicinal targets thereof is necessary for pharmacological interventions. However, the identity and molecular actions of activators that promote the early development of adipocytes are still largely unknown. Here, we demonstrate a novel role for phosphoprotein phosphatase 1CB (PPP1CB) as a potent adipogenic activator that promotes adipocyte differentiation. PPP1CB expression increased in vitro during the early phase of 3T3-L1 adipogenesis and in the murine model of high-fat diet-induced obesity. Depletion of PPP1CB dramatically suppressed the differentiation of 3T3-L1 cells into mature adipocytes, with a concomitant change in adipocyte marker genes and significantly inhibited clonal expansion. We also showed that knockdown of PPP1CB caused a significant decrease in C/EBPδ expression, which in turn resulted in attenuation of PPARγ, C/EBPα, adiponectin, and aP2. In addition, we elucidated the functional significance of PPP1CB by linking p38 activation to C/EBPδ expression in early adipogenesis. Overall, our findings demonstrate a novel function of PPP1CB in promoting adipogenesis and suggest that PPP1CB may be a promising therapeutic target for treatment of obesity and obesity-related diseases.

  18. A kinetic analysis of the dephosphorylation, by bovine spleen phosphoprotein phosphatase (EC 3.1.3.16) of a phosphopeptide derived from beta-casein.

    PubMed

    West, D W; Dalgleish, D G

    1976-06-07

    A peptide containing the four closely grouped phosphoseryl residues present in beta-casein has been enzymatically dephosphorylated with bovine spleen phosphoprotein phosphatase (EC 3.1.3.16). The course of the dephosphorylation reaction has been followed by cellulose acetate electrophoresis and the amount of partially phosphorylated peptides present at each stage quantified by the same method. The phosphate groups are shown to be removed in a sequential manner and the rate constants for each stage of the dephosphorylation have been computed from the data obtained. The rate constants indicate that interaction in the intact peptide results in an enhancement of the activity of the phosphoseryl cluster.

  19. Evolution of Bacterial-Like Phosphoprotein Phosphatases in Photosynthetic Eukaryotes Features Ancestral Mitochondrial or Archaeal Origin and Possible Lateral Gene Transfer1[C][W][OPEN

    PubMed Central

    Uhrig, R. Glen; Kerk, David; Moorhead, Greg B.

    2013-01-01

    Protein phosphorylation is a reversible regulatory process catalyzed by the opposing reactions of protein kinases and phosphatases, which are central to the proper functioning of the cell. Dysfunction of members in either the protein kinase or phosphatase family can have wide-ranging deleterious effects in both metazoans and plants alike. Previously, three bacterial-like phosphoprotein phosphatase classes were uncovered in eukaryotes and named according to the bacterial sequences with which they have the greatest similarity: Shewanella-like (SLP), Rhizobiales-like (RLPH), and ApaH-like (ALPH) phosphatases. Utilizing the wealth of data resulting from recently sequenced complete eukaryotic genomes, we conducted database searching by hidden Markov models, multiple sequence alignment, and phylogenetic tree inference with Bayesian and maximum likelihood methods to elucidate the pattern of evolution of eukaryotic bacterial-like phosphoprotein phosphatase sequences, which are predominantly distributed in photosynthetic eukaryotes. We uncovered a pattern of ancestral mitochondrial (SLP and RLPH) or archaeal (ALPH) gene entry into eukaryotes, supplemented by possible instances of lateral gene transfer between bacteria and eukaryotes. In addition to the previously known green algal and plant SLP1 and SLP2 protein forms, a more ancestral third form (SLP3) was found in green algae. Data from in silico subcellular localization predictions revealed class-specific differences in plants likely to result in distinct functions, and for SLP sequences, distinctive and possibly functionally significant differences between plants and nonphotosynthetic eukaryotes. Conserved carboxyl-terminal sequence motifs with class-specific patterns of residue substitutions, most prominent in photosynthetic organisms, raise the possibility of complex interactions with regulatory proteins. PMID:24108212

  20. Evolution of bacterial-like phosphoprotein phosphatases in photosynthetic eukaryotes features ancestral mitochondrial or archaeal origin and possible lateral gene transfer.

    PubMed

    Uhrig, R Glen; Kerk, David; Moorhead, Greg B

    2013-12-01

    Protein phosphorylation is a reversible regulatory process catalyzed by the opposing reactions of protein kinases and phosphatases, which are central to the proper functioning of the cell. Dysfunction of members in either the protein kinase or phosphatase family can have wide-ranging deleterious effects in both metazoans and plants alike. Previously, three bacterial-like phosphoprotein phosphatase classes were uncovered in eukaryotes and named according to the bacterial sequences with which they have the greatest similarity: Shewanella-like (SLP), Rhizobiales-like (RLPH), and ApaH-like (ALPH) phosphatases. Utilizing the wealth of data resulting from recently sequenced complete eukaryotic genomes, we conducted database searching by hidden Markov models, multiple sequence alignment, and phylogenetic tree inference with Bayesian and maximum likelihood methods to elucidate the pattern of evolution of eukaryotic bacterial-like phosphoprotein phosphatase sequences, which are predominantly distributed in photosynthetic eukaryotes. We uncovered a pattern of ancestral mitochondrial (SLP and RLPH) or archaeal (ALPH) gene entry into eukaryotes, supplemented by possible instances of lateral gene transfer between bacteria and eukaryotes. In addition to the previously known green algal and plant SLP1 and SLP2 protein forms, a more ancestral third form (SLP3) was found in green algae. Data from in silico subcellular localization predictions revealed class-specific differences in plants likely to result in distinct functions, and for SLP sequences, distinctive and possibly functionally significant differences between plants and nonphotosynthetic eukaryotes. Conserved carboxyl-terminal sequence motifs with class-specific patterns of residue substitutions, most prominent in photosynthetic organisms, raise the possibility of complex interactions with regulatory proteins.

  1. Design, preparation and use of ligated phosphoproteins: a novel approach to study protein phosphatases by dot blot array, ELISA and Western blot assays.

    PubMed

    Sun, Luo; Ghosh, Inca; Barshevsky, Tanya; Kochinyan, Samvel; Xu, Ming-Qun

    2007-07-01

    The study of substrate specificity of protein phosphatases (PPs) is very challenging since it is difficult to prepare a suitable phosphorylated substrate. Phosphoproteins, phosphorylated by a protein kinase, or chemically synthesized phosphopeptides are commonly used substrates for PPs. Both types of these substrates have their advantages and limitations. Phosphoproteins mimic more closely the physiologically relevant PP substrates, but their preparation is technically demanding. Synthetic phosphopeptides present advantages over proteins because they can be easily produced in large quantity and their amino acid sequence can be designed to contain potential determinants of substrate specificity. However, short peptides are less optimal compared to in vivo PP substrates and often display poor and variable binding to different matrices, resulting in low sensitivity in analysis of PP activity on solid support. In this work we utilize the intein-mediated protein ligation (IPL) technique to generate substrates for PPs, combining the advantages of proteins and synthetic peptides in one molecule. The ligation of a synthetic phosphopeptide to an intein-generated carrier protein (CP) with a one-to-one stoichiometry results in the formation of a ligated phosphoprotein (LPP). Three widely used assays, dot blot array, Western blot and ELISA were employed to study the PP activity on LPP substrates. Dephosphorylation was measured by detection of the remaining phosphorylation, or lack of it, with a phospho-specific antibody. The data show the advantage of LPPs over free peptides in assays on solid supports. LPPs exhibited enhanced binding to the matrices used in the study, which significantly improved sensitivity and consistency of the assays. In addition, saturation of the signal was circumvented by serial dilution of the assay samples. This report describes detailed experimental procedures for preparation of LPP substrates and their use in PP assays based on immobilization on

  2. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    PubMed Central

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  3. Regulation of the Src kinase-associated phosphoprotein 55 homologue by the protein tyrosine phosphatase PTP-PEST in the control of cell motility.

    PubMed

    Ayoub, Emily; Hall, Anita; Scott, Adam M; Chagnon, Mélanie J; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L

    2013-09-06

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis.

  4. Thylakoid phosphoproteins

    SciTech Connect

    Coughlan, S.J.; Hind, G.

    1986-01-01

    Thylakoid phosphoproteins were successively fractionated by (1) treatment of /sup 32/P-labeled membranes with 1 M NaBr to remove superficial proteins; (2) extraction with octyl glucoside/cholate; (3) precipitation with ammonium sulfate; (4) size exclusion chromatography on BioGel P300, and (5) sucrose density gradient centrifugation. The detergent extract contained <10% of the original membrane-bound /sup 32/P; it was enriched in cytochrome b/f complex and 64-kDa protein kinase. A 20-kDa protein which copurified with the cytochrome complex and was assumed to be the Rieske protein, was partially phosphorylated. The protein kinase, which phosphorylates itself in vitro, appeared on the sucrose gradient as a phosphoprotein, signalling that it had become labeled in the intact thylakoid. A phosphoprotein of approx.10 kDa which is seen as a product of directly radiolabeling the BioGel P300 extract, was found to differ from the well documented phosphoprotein of this approximate mass that appears in labeled thylakoids. 30 refs., 3 figs., 2 tabs.

  5. Mineral induction by immobilized phosphoproteins

    NASA Technical Reports Server (NTRS)

    Saito, T.; Arsenault, A. L.; Yamauchi, M.; Kuboki, Y.; Crenshaw, M. A.

    1997-01-01

    Dentin phosphoproteins are thought to have a primary role in the deposition of mineral on the collagen of dentin. In this study we determined the type of binding between collagen and phosphoproteins necessary for mineral formation onto collagen fibrils and whether the phosphate esters are required. Bovine dentin phosphophoryn or phosvitin from egg yolk were immobilized on reconstituted skin type I collagen fibrils by adsorption or by covalent cross-linking. In some samples the ester phosphate was removed from the covalently cross-linked phosphoproteins by treatment with acid phosphatase. All samples were incubated at 37 degrees C in metastable solutions that do not spontaneously precipitate. Reconstituted collagen fibrils alone did not induce mineral formation. The phosphoproteins adsorbed to the collagen fibrils desorbed when the mineralization medium was added, and mineral was not induced. The mineral induced by the cross-linked phosphoproteins was apatite, and the crystals were confined to the surface of the collagen fibrils. With decreasing medium saturation the time required for mineral induction increased. The interfacial tensions calculated for apatite formation by either phosphoprotein cross-linked to collagen were about the same as that for phosphatidic acid liposomes and hydroxyapatite. This similarity in values indicates that the nucleation potential of these highly phosphorylated surfaces is about the same. It is concluded that phosphoproteins must be irreversibly bound to collagen fibrils for the mineralization of the collagen network in solutions that do not spontaneously precipitate. The phosphate esters of phosphoproteins are required for mineral induction, and the carboxylate groups are not sufficient.

  6. Mineral induction by immobilized phosphoproteins

    NASA Technical Reports Server (NTRS)

    Saito, T.; Arsenault, A. L.; Yamauchi, M.; Kuboki, Y.; Crenshaw, M. A.

    1997-01-01

    Dentin phosphoproteins are thought to have a primary role in the deposition of mineral on the collagen of dentin. In this study we determined the type of binding between collagen and phosphoproteins necessary for mineral formation onto collagen fibrils and whether the phosphate esters are required. Bovine dentin phosphophoryn or phosvitin from egg yolk were immobilized on reconstituted skin type I collagen fibrils by adsorption or by covalent cross-linking. In some samples the ester phosphate was removed from the covalently cross-linked phosphoproteins by treatment with acid phosphatase. All samples were incubated at 37 degrees C in metastable solutions that do not spontaneously precipitate. Reconstituted collagen fibrils alone did not induce mineral formation. The phosphoproteins adsorbed to the collagen fibrils desorbed when the mineralization medium was added, and mineral was not induced. The mineral induced by the cross-linked phosphoproteins was apatite, and the crystals were confined to the surface of the collagen fibrils. With decreasing medium saturation the time required for mineral induction increased. The interfacial tensions calculated for apatite formation by either phosphoprotein cross-linked to collagen were about the same as that for phosphatidic acid liposomes and hydroxyapatite. This similarity in values indicates that the nucleation potential of these highly phosphorylated surfaces is about the same. It is concluded that phosphoproteins must be irreversibly bound to collagen fibrils for the mineralization of the collagen network in solutions that do not spontaneously precipitate. The phosphate esters of phosphoproteins are required for mineral induction, and the carboxylate groups are not sufficient.

  7. Dephosphorylation of phosphoproteins and synthetic phosphopeptides. Study of the specificity of the polycation-stimulated and MgATP-dependent phosphorylase phosphatases.

    PubMed

    Agostinis, P; Goris, J; Waelkens, E; Pinna, L A; Marchiori, F; Merlevede, W

    1987-01-25

    The substrate specificity of different forms of polycation-stimulated (PCSH, PCSL, and PCSC) phosphorylase phosphatases and of the catalytic subunit of the MgATP-dependent protein phosphatase from rabbit skeletal muscle was investigated. This was done, with phosphorylase a as the reference substrate, using the synthetic phosphopeptides patterned after the phosphorylated sites of pyruvate kinase (type L) (Arg2-Ala-Ser(32P)-Val-Ala (S2), and its Thr(32P) substitute (T4)), inhibitor-1 (Arg4-Pro-Thr(32P)-Pro-Ala (T5), Arg2-Pro-Thr(32P)-Pro-Ala (T1), and its Ser(32P) substitute (S1)), and some modified phosphopeptides (Arg2-Ala-Thr(32P)-Pro-Ala (T2) and Arg2-Pro-Thr(32P)-Val-Ala (T3)), all phosphorylated by cyclic AMP-dependent protein kinase. In addition, casein(Thr-32P), phosphorylated by casein kinase-2, was also tested. The PCS phosphatases show a striking preference for the T4 configuration, PCSC being the least efficient. The catalytic subunit of the MgATP-dependent phosphatase was almost completely inactive toward all these substrates. As shown for the PCSH phosphatase, and comparing with T4, the two proline residues flanking the Thr(P) in T1 and T5, just as in inhibitor-1, drastically imparied the dephosphorylation by lowering the Vmax and not by affecting the apparent Km. The C-terminal proline (as in T2) by itself represents a highly unfavorable factor in the dephosphorylation. The critical effect of the sequence X-Thr(P)-Pro or Pro-Thr(P)-Pro (T1, T2, T5, and inhibitor-1) can be overcome by manganese ions. The additional finding that this is not the case with the Pro-Ser(P)-Pro sequence (S1) suggests that the effect of Mn2+ is highly substrate specific. These observations show the considerable importance of the primary structure of the substrate in determining the specificity of the protein phosphatases.

  8. The effect of complexing phosphoproteins to decalcified collagen on in vitro calcification.

    PubMed

    Endo, A; Glimcher, M J

    1989-01-01

    Decalcified samples of chicken bone containing phosphoproteins of varying concentrations were used to assess the effect of phosphoproteins and of protein-bound Ser(P) and Thr(P) in the in vitro nucleation of a Ca-P solid phase from metastable solutions of Ca and P. Phosphoproteins of bone as well as the phosphoproteins from egg yolk (phosvitin) were used. Increasing concentrations of phosphoprotein [as measured by the amount of protein bound Ser(P) and Thr(P)] in the decalcified bone particles significantly reduced the time required for nucleation to occur after exposure to metastable solutions of Ca and P (decreased operational lag times). Treatment with wheat germ acid phosphatase markedly reduced the concentration of Ser(P) and Thr(P) in the decalcified bone samples and in the decalcified bone collagen samples complexed with phosphoproteins (almost to zero). The loss of the organic phosphate groups significantly increased the operational lag time, but did not abolish nucleation of apatite crystals by the bone collagen fibrils essentially devoid of Ser(P) and Thr(P). Bone phosphoproteins were not specific; substitution of phosvitin for bone phosphoproteins as complexes with bone collagen also proved to be effective facilitators of nucleation, which was interesting since both types of phosphoproteins have certain common chemical and structural characteristics. Noncollagenous components other than phosphoproteins were present in the decalcified bone samples. However, the marked dependence of the lag time on the Ser(P) and Thr(P) concentrations and the very marked diminution in the efficacy of the nucleation phenomenon as a result of treatment with wheat germ acid phosphatase, clearly suggests that the organic phosphate residues of the phosphoproteins play a direct and significant role in the process of in vitro nucleation of a solid phase of Ca and P (apatite) by bone collagen, and by implication, possibly in in vivo mineralization as well.

  9. Sprouty-related Ena/Vasodilator-stimulated Phosphoprotein Homology 1-Domain-containing Protein (SPRED1), a Tyrosine-Protein Phosphatase Non-receptor Type 11 (SHP2) Substrate in the Ras/Extracellular Signal-regulated Kinase (ERK) Pathway*

    PubMed Central

    Quintanar-Audelo, Martina; Yusoff, Permeen; Sinniah, Saravanan; Chandramouli, Sumana; Guy, Graeme R.

    2011-01-01

    SHP2 is a tyrosine phosphatase involved in the activation of the Ras/ERK signaling pathway downstream of a number of receptor tyrosine kinases. One of the proposed mechanisms involving SHP2 in this context is to dephosphorylate and inactivate inhibitors of the Ras/ERK pathway. Two protein families bearing a unique, common domain, Sprouty and SPRED proteins, are possible candidates because they have been reported to inhibit the Ras/ERK pathway upon FGF activation. We tested whether any of these proteins are likely substrates of SHP2. Our findings indicate that Sprouty2 binds to the C-terminal tail of SHP2, which is an unlikely substrate binding site, whereas SPRED proteins bind to the tyrosine phosphatase domain that is known to be the binding site for its substrates. Overexpressed SHP2 was able to dephosphorylate SPREDs but not Sprouty2. Finally, we found two tyrosine residues on SPRED1 that are required, when phosphorylated, to inhibit Ras/ERK activation and identified Tyr-420 as a specific dephosphorylation target of SHP2. The evidence obtained indicates that SPRED1 is a likely substrate of SHP2, whose tyrosine dephosphorylation is required to attenuate the inhibitory action of SPRED1 in the Ras/ERK pathway. PMID:21531714

  10. Proteomic Analysis of Phosphoproteins in the Rice Nucleus During the Early Stage of Seed Germination.

    PubMed

    Li, Ming; Yin, Xiaojian; Sakata, Katsumi; Yang, Pingfang; Komatsu, Setsuko

    2015-07-02

    The early stage of seed germination is the first step in the plant life cycle without visible morphological change. To investigate the mechanism controlling the early stage of rice seed germination, we performed gel-and label-free nuclear phosphoproteomics. A total of 3467 phosphopeptides belonging to 102 nuclear phosphoproteins from rice embryos were identified. Protein-synthesis-related proteins were mainly phosphorylated. During the first 24 h following imbibition, 115 nuclear phosphoproteins were identified, and significant changes in the phosphorylation level over time were observed in 29 phosphoproteins. Cluster analysis indicated that nucleotide-binding proteins and zinc finger CCCH- and BED-type proteins increased in abundance during the first 12 h of imbibition and then decreased. The in silico protein-protein interactions for 29 nuclear phosphoproteins indicated that the Sas10/Utp3 protein, which functions in snoRNA binding and gene silencing, was the center of the phosphoprotein network in nuclei. The germination rate of seeds was significantly slowed with phosphatase inhibitor treatment. The mRNA expression of the zinc finger CCCH-type protein did not change, and the zinc finger BED-type protein was upregulated in rice embryos during the early stage of germination with phosphatase inhibitor treatment. These results suggest that the phosphorylation and dephosphorylation of nuclear proteins are involved in rice seed germination. Furthermore, transcription factors such as zinc finger CCCH- and BED-type proteins might play a key role through nuclear phosphoproteins, and Sas10/Utp3 protein might interact with nuclear phosphoproteins in rice embryos to mediate the early stage of seed germination.

  11. Analysis of flagellar phosphoproteins from Chlamydomonas reinhardtii.

    PubMed

    Boesger, Jens; Wagner, Volker; Weisheit, Wolfram; Mittag, Maria

    2009-07-01

    Cilia and flagella are cell organelles that are highly conserved throughout evolution. For many years, the green biflagellate alga Chlamydomonas reinhardtii has served as a model for examination of the structure and function of its flagella, which are similar to certain mammalian cilia. Proteome analysis revealed the presence of several kinases and protein phosphatases in these organelles. Reversible protein phosphorylation can control ciliary beating, motility, signaling, length, and assembly. Despite the importance of this posttranslational modification, the identities of many ciliary phosphoproteins and knowledge about their in vivo phosphorylation sites are still missing. Here we used immobilized metal affinity chromatography to enrich phosphopeptides from purified flagella and analyzed them by mass spectrometry. One hundred forty-one phosphorylated peptides were identified, belonging to 32 flagellar proteins. Thereby, 126 in vivo phosphorylation sites were determined. The flagellar phosphoproteome includes different structural and motor proteins, kinases, proteins with protein interaction domains, and many proteins whose functions are still unknown. In several cases, a dynamic phosphorylation pattern and clustering of phosphorylation sites were found, indicating a complex physiological status and specific control by reversible protein phosphorylation in the flagellum.

  12. Structure of Acid phosphatases.

    PubMed

    Araujo, César L; Vihko, Pirkko T

    2013-01-01

    Acid phosphatases are enzymes that have been studied extensively due to the fact that their dysregulation is associated with pathophysiological conditions. This characteristic has been exploited for the development of diagnostic and therapeutic methods. As an example, prostatic acid phosphatase was the first marker for metastatic prostate cancer diagnosis and the dysregulation of tartrate resistant acid phosphatase is associated with abnormal bone resorption linked to osteoporosis. The pioneering crystallization studies on prostatic acid phosphatase and mammalian tartrate-resistant acid phosphatase conformed significant milestones towards the elucidation of the mechanisms followed by these enzymes (Schneider et al., EMBO J 12:2609-2615, 1993). Acid phosphatases are also found in nonmammalian species such as bacteria, fungi, parasites, and plants, and most of them share structural similarities with mammalian acid phosphatase enzymes. Acid phosphatase (EC 3.1.3.2) enzymes catalyze the hydrolysis of phosphate monoesters following the general equation. Phosphate monoester + H2O -->/<-- alcohol + phosphate. The general classification "acid phosphatase" relies only on the optimum acidic pH for the enzymatic activity in assay conditions using non-physiological substrates. These enzymes accept a wide range of substrates in vitro, ranging from small organic molecules to phosphoproteins, constituting a heterogeneous group of enzymes from the structural point of view. These structural differences account for the divergence in cofactor dependences and behavior against substrates, inhibitors, and activators. In this group only the tartrate-resistant acid phosphatase is a metallo-enzyme whereas the other members do not require metal-ion binding for their catalytic activity. In addition, tartrate-resistant acid phosphatase and erythrocytic acid phosphatase are not inhibited by L-(+)-tartrate ion while the prostatic acid phosphatase is tartrate-sensitive. This is an important

  13. Differential Phosphoprotein Profiling of Tamoxifen Response

    DTIC Science & Technology

    2009-08-01

    need for global phosphoproteome analysis. I have developed a method for comparison of global phosphoprotein profiles involving stable isotope...growth and survival, highlighting the need for global phosphoproteome analysis. Although many biomarkers for breast cancer prognosis and therapy...goal of this project is obtain global phosphoprotein profiles of tamoxifen response and to compare responses in tamoxifen sensitive and resistant cell

  14. A portrait of tissue phosphoprotein stability in the clinical tissue procurement process.

    PubMed

    Espina, Virginia; Edmiston, Kirsten H; Heiby, Michael; Pierobon, Mariaelena; Sciro, Manuela; Merritt, Barbara; Banks, Stacey; Deng, Jianghong; VanMeter, Amy J; Geho, David H; Pastore, Lucia; Sennesh, Joel; Petricoin, Emanuel F; Liotta, Lance A

    2008-10-01

    Little is known about the preanalytical fluctuations of phosphoproteins during tissue procurement for molecular profiling. This information is crucial to establish guidelines for the reliable measurement of these analytes. To develop phosphoprotein profiles of tissue subjected to the trauma of excision, we measured the fidelity of 53 signal pathway phosphoproteins over time in tissue specimens procured in a community clinical practice. This information provides strategies for potential surrogate markers of stability and the design of phosphoprotein preservative/fixation solutions. Eleven different specimen collection time course experiments revealed augmentation (+/-20% from the time 0 sample) of signal pathway phosphoprotein levels as well as decreases over time independent of tissue type, post-translational modification, and protein subcellular location (tissues included breast, colon, lung, ovary, and uterus (endometrium/myometrium) and metastatic melanoma). Comparison across tissue specimens showed an >20% decrease of protein kinase B (AKT) Ser-473 (p < 0.002) and myristoylated alanine-rich C-kinase substrate protein Ser-152/156 (p < 0.0001) within the first 90-min postexcision. Proteins in apoptotic (cleaved caspase-3 Asp-175 (p < 0.001)), proliferation/survival/hypoxia (IRS-1 Ser-612 (p < 0.0003), AMP-activated protein kinase beta Ser-108 (p < 0.005), ERK Thr-202/Tyr-204 (p < 0.003), and GSK3alphabeta Ser-21/9 (p < 0.01)), and transcription factor pathways (STAT1 Tyr-701 (p < 0.005) and cAMP response element-binding protein Ser-133 (p < 0.01)) showed >20% increases within 90-min postprocurement. Endothelial nitric-oxide synthase Ser-1177 did not change over the time period evaluated with breast or leiomyoma tissue. Treatment with phosphatase or kinase inhibitors alone revealed that tissue kinase pathways are active ex vivo. Combinations of kinase and phosphatase inhibitors appeared to stabilize proteins that exhibited increases in the presence of phosphatase

  15. Queuine mediated inhibition in phosphorylation of tyrosine phosphoproteins in cancer.

    PubMed

    Pathak, Chandramani; Jaiswal, Yogesh K; Vinayak, Manjula

    2008-09-01

    Protein phosphorylation or dephosphorylation is the most important regulatory switch of signal transduction contributing to control of cell proliferation. The reversibility of phosphorylation and dephosphorylation is due to the activities of kinases and phosphatase, which determine protein phosphorylation level of cell under different physiological and pathological conditions. Receptor tyrosine kinase (RTK) mediated cellular signaling is precisely coordinated and tightly controlled in normal cells which ensures regulated mitosis. Deregulation of RTK signaling resulting in aberrant activation in RTKs leads to malignant transformation. Queuine is one of the modified base of tRNA which participates in down regulation of tyrosine kinase activity. The guanine analogue queuine is a nutrient factor to eukaryotes and occurs as free base or modified nucleoside queuosine into the first anticodon position of specific tRNAs. The tRNAs are often queuine deficient in cancer and fast proliferating tissues. The present study is aimed to investigate queuine mediated inhibition in phosphorylation of tyrosine phosphorylated proteins in lymphoma bearing mouse. The result shows high level of cytosolic and membrane associated tyrosine phosphoprotein in DLAT cancerous mouse liver compared to normal. Queuine treatments down regulate the level of tyrosine phosphoproteins, which suggests that queuine is involved in regulation of mitotic signaling pathways.

  16. Adsorption and interactions of dentine phosphoprotein with hydroxyapatite and collagen.

    PubMed

    Milan, Anna M; Sugars, Rachael V; Embery, Graham; Waddington, Rachel J

    2006-06-01

    Dentine phosphoprotein (DPP) has been proposed to both promote and inhibit mineral deposition during dentinogenesis. The present study aimed to investigate the molecular interactions of DPP and dephosphorylated DPP (DPP-p) with hydroxyapatite (HAP). Bovine DPP was purified and dephosphorylated by alkaline phosphatase to obtain DPP-p. DPP and DPP-p adsorption to HAP was determined along with their ability, when free in solution or bound to collagen, to influence HAP-induced crystal growth. Absorption isotherms suggested that lower DPP concentrations (1.5-6.25 microg ml(-1)) demonstrated a reduced affinity for HAP compared with higher protein concentrations (12.5-50.0 microg ml(-1)). Dephosphorylated DPP had a much reduced affinity for HAP compared with DPP. Dentine phosphoprotein inhibited seeded HAP crystal growth, in a dose-dependent manner, whilst removal of the phosphate groups reduced this inhibition. When bound to collagen fibrils, DPP significantly promoted the rate of HAP crystal growth over 0-8 min. Conversely, DPP-p and collagen significantly decreased the rate of crystal growth over 0-18 min. These results indicate a major role for the phosphate groups present on DPP in HAP crystal growth. In addition, concentration-dependent conformational changes to DPP, and the interaction with other matrix components, such as collagen, are important in predicting its dual role in the mineralization of dentine.

  17. Differential Phosphoprotein Profiling of Tamoxifen Response

    DTIC Science & Technology

    2008-08-01

    cataloging global phosphorylation events in response to tamoxifen treatment in tamoxifen sensitive and resistant cells we will provide better... global phosphoprotein profiles. Our methodology involves stable isotope labeling 2, a phosphoprotein affinity step, 1-D SDS-PAGE and LC-MS/MS 3. I...with Xpress ratio less than 0.6 and about 28 proteins with ratio larger than 1.66. Manual analysis is underway to confirm the protein abundance

  18. Oligomerization of Mumps Virus Phosphoprotein

    PubMed Central

    Pickar, Adrian; Elson, Andrew; Yang, Yang; Xu, Pei; Luo, Ming

    2015-01-01

    ABSTRACT The mumps virus (MuV) genome encodes a phosphoprotein (P) that is important for viral RNA synthesis. P forms the viral RNA-dependent RNA polymerase with the large protein (L). P also interacts with the viral nucleoprotein (NP) and self-associates to form a homotetramer. The P protein consists of three domains, the N-terminal domain (PN), the oligomerization domain (PO), and the C-terminal domain (PC). While PN is known to relax the NP-bound RNA genome, the roles of PO and PC are not clear. In this study, we investigated the roles of PO and PC in viral RNA synthesis using mutational analysis and a minigenome system. We found that PN and PC functions can be trans-complemented. However, this complementation requires PO, indicating that PO is essential for P function. Using this trans-complementation system, we found that P forms parallel dimers (PN to PN and PC to PC). Furthermore, we found that residues R231, K238, K253, and K260 in PO are critical for P's functions. We identified PC to be the domain that interacts with L. These results provide structure-function insights into the role of MuV P. IMPORTANCE MuV, a paramyxovirus, is an important human pathogen. The P protein of MuV is critical for viral RNA synthesis. In this work, we established a novel minigenome system that allows the domains of P to be complemented in trans. Using this system, we confirmed that MuV P forms parallel dimers. An understanding of viral RNA synthesis will allow the design of better vaccines and the development of antivirals. PMID:26311887

  19. Analysis of Flagellar Phosphoproteins from Chlamydomonas reinhardtii▿ †

    PubMed Central

    Boesger, Jens; Wagner, Volker; Weisheit, Wolfram; Mittag, Maria

    2009-01-01

    Cilia and flagella are cell organelles that are highly conserved throughout evolution. For many years, the green biflagellate alga Chlamydomonas reinhardtii has served as a model for examination of the structure and function of its flagella, which are similar to certain mammalian cilia. Proteome analysis revealed the presence of several kinases and protein phosphatases in these organelles. Reversible protein phosphorylation can control ciliary beating, motility, signaling, length, and assembly. Despite the importance of this posttranslational modification, the identities of many ciliary phosphoproteins and knowledge about their in vivo phosphorylation sites are still missing. Here we used immobilized metal affinity chromatography to enrich phosphopeptides from purified flagella and analyzed them by mass spectrometry. One hundred forty-one phosphorylated peptides were identified, belonging to 32 flagellar proteins. Thereby, 126 in vivo phosphorylation sites were determined. The flagellar phosphoproteome includes different structural and motor proteins, kinases, proteins with protein interaction domains, and many proteins whose functions are still unknown. In several cases, a dynamic phosphorylation pattern and clustering of phosphorylation sites were found, indicating a complex physiological status and specific control by reversible protein phosphorylation in the flagellum. PMID:19429781

  20. The Role of Acidic Phosphoproteins in Biomineralization

    PubMed Central

    Alvares, Keith

    2014-01-01

    Biomineralization is the process by which living organisms deposit mineral in the extracellular matrix. In nature, almost 50% of biominerals are calcium-bearing minerals. In addition to calcium, we also find biominerals formed from silica and magnetite. Calcium containing biominerals could be either calcium phosphate as in apatite found in vertebrates or calcium carbonate as in calcite and aragonite found in many invertebrates. Since all biomineralization is matrix mediated, an understanding of the nature of the proteins involved is essential in elucidating its mechanism. This review will discuss some of the proteins involved in the process of biomineralization involving calcium. Two proteins, dentin matrix protein 1 and dentin phosphoprotein (Phosphophoryn) will serve as models for the vertebrate system, and two others - P16 and phosphodontin will serve as models for the invertebrate system. PMID:24437603

  1. The role of acidic phosphoproteins in biomineralization.

    PubMed

    Alvares, Keith

    2014-01-01

    Biomineralization is the process by which living organisms deposit mineral in the extracellular matrix. In nature, almost 50% of biominerals are calcium-bearing minerals. In addition to calcium, we find biominerals formed from silica and magnetite. Calcium-containing biominerals could be either calcium phosphate as in apatite found in vertebrates or calcium carbonate as in calcite and aragonite found in many invertebrates. Since all biomineralization is matrix mediated, an understanding of the nature of the proteins involved is essential in elucidating its mechanism. This review will discuss some of the proteins involved in the process of biomineralization involving calcium. Two proteins, dentin matrix protein 1 and dentin phosphoprotein (Phosphophoryn) will serve as models for the vertebrate system, and two others - P16 and phosphodontin will serve as models for the invertebrate system.

  2. Multiple forms of phosphatase from human brain: isolation and partial characterization of affi-gel blue nonbinding phosphatase activities.

    PubMed

    Cheng, L Y; Wang, J Z; Gong, C X; Pei, J J; Zaidi, T; Grundke-Iqbal, I; Iqbal, K

    2001-04-01

    Phosphatases extracted from a human brain were resolved into two main groups, namely affi-gel blue-binding phosphatases and affi-gel blue-nonbinding phosphatases. Affi-gel blue binding phosphatases were further separated into four different phosphatase activities, designated P1-P4, and described previously. In the present study we describe the affi-gel blue-nonbinding phosphatases which were separated into seven different phosphatase activities, designated P5-P11 by poly-(L-lysine)-agarose and aminohexyl Sepharose 4B chromatographies. These seven phosphatase activities were active toward nonprotein phosphoester. P7-P11 and to some extent P5 could also dephosphorylate a phosphoprotein. They displayed different enzyme kinetics. On the basis of activity peak, the apparent molecular mass as estimated by Sephadex G-200 column chromatography for P5 was 49 kDa; P6, 32 kDa; P7, 150 kDa; P8, 250 kDa; P9, 165 kDa; P10, 90 kDa and P11, 165 kDa. Immunoblot analysis indicated that P8-P11 may belong to PP2B family, whereas P7 may associate with PP2A. The phosphatases P7-P11 were found to be effective in the dephosphorylation of Alzheimer's disease abnormally hyperphosphorylated tau. The resulting dephosphorylated tau regained its activity in promoting the microtubule assembly, suggesting that P7-P11 might regulate the phosphorylation of tau protein in the brain.

  3. Protein Phosphatases Involved in Regulating Mitosis: Facts and Hypotheses.

    PubMed

    Kim, Hyun-Soo; Fernandes, Gary; Lee, Chang-Woo

    2016-09-01

    Almost all eukaryotic proteins are subject to post-translational modifications during mitosis and cell cycle, and in particular, reversible phosphorylation being a key event. The recent use of high-throughput experimental analyses has revealed that more than 70% of all eukaryotic proteins are regulated by phosphorylation; however, the mechanism of dephosphorylation, counteracting phosphorylation, is relatively unknown. Recent discoveries have shown that many of the protein phosphatases are involved in the temporal and spatial control of mitotic events, such as mitotic entry, mitotic spindle assembly, chromosome architecture changes and cohesion, and mitotic exit. This implies that certain phosphatases are tightly regulated for timely dephosphorylation of key mitotic phosphoproteins and are essential for control of various mitotic processes. This review describes the physiological and pathological roles of mitotic phosphatases, as well as the versatile role of various protein phosphatases in several mitotic events.

  4. Revealing phosphoproteins playing role in tobacco pollen activated in vitro.

    PubMed

    Fíla, Jan; Matros, Andrea; Radau, Sonja; Zahedi, René Peiman; Capková, Věra; Mock, Hans-Peter; Honys, David

    2012-11-01

    The transition between the quiescent mature and the metabolically active germinating pollen grain most probably involves changes in protein phosphorylation status, since phosphorylation has been implicated in the regulation of many cellular processes. Given that, only a minor proportion of cellular proteins are phosphorylated at any one time, and that phosphorylated and nonphosphorylated forms of many proteins can co-exist within a cell, the identification of phosphoproteins requires some prior enrichment from a crude protein extract. Here, we have used metal oxide/hydroxide affinity chromatography (MOAC) based on an aluminum hydroxide matrix for this purpose, and have generated a population of phosphoprotein candidates from both mature and in vitro activated tobacco pollen grains. Both electrophoretic and nonelectrophoretic methods, allied to MS, were applied to these extracts to identify a set of 139 phosphoprotein candidates. In vitro phosphorylation was also used to validate the spectrum of phosphoprotein candidates obtained by the MOAC phosphoprotein enrichment. Since only one phosphorylation site was detected by the above approach, titanium dioxide phosphopeptide enrichment of trypsinized mature pollen crude extract was performed as well. It resulted in a detection of additional 51 phosphorylation sites giving a total of 52 identified phosphosites in this set of 139 phosphoprotein candidates.

  5. Post-translational processing of chicken bone phosphoproteins. Identification of bone (phospho)protein kinase.

    PubMed Central

    Mikuni-Takagaki, Y; Glimcher, M J

    1990-01-01

    We have detected a protein kinase which phosphorylates bone phosphoproteins (BPPs) in the detergent extract of the membranous fractions in the periosteal bone strips of 12-day-embryonic-chick tibia. This enzyme, tentatively named BPP kinase, has a catalytic subunit of Mr approximately 39,000, utilizes GTP as well as ATP as a phospho-group donor, is inhibited by 2,3-bisphosphoglycerate and heparin, and is therefore similar to casein kinase II. The enzyme can phosphorylate dephosphorylated proteins such as casein, phosvitin and chicken BPPs, but the last-named are preferred substrates. The in vitro-phosphorylation-assay products of this enzyme in the extract were indistinguishable on an SDS/polyacrylamide gel from the major [32P]phosphoproteins metabolically labelled in the embryonic-chick bone tissue. The regulatory mechanisms of the phosphorylation process of BPPs by BPP kinase as well as the potential role of this enzyme in mineralization are discussed. Images Fig. 1. Fig. 4. PMID:2363697

  6. Methods to distinguish various types of protein phosphatase activity

    SciTech Connect

    Brautigan, D.L.; Shriner, C.L.

    1988-01-01

    To distinguish the action of protein Tyr(P) and protein Ser(P)/Thr(P) phosphatases on /sup 32/P-labeled phosphoproteins in subcellular fractions different inhibitors and activators are utilized. Comparison of the effects of added compounds provides a convenient, indirect method to characterize dephosphorylation reactions. Protein Tyr(P) phosphatases are specifically inhibited by micromolar Zn2+ or vanadate, and show maximal activity in the presence of EDTA. The other class of cellular phosphatases, specific for protein Ser(P) and Thr(P) residues, are inhibited by fluoride and EDTA. In this class of enzymes two major functional types can be distinguished: those sensitive to inhibition by the heat-stable protein inhibitor-2 and not stimulated by polycations, and those not sensitive to inhibition and stimulated by polycations. Preparation of /sup 32/P-labeled Tyr(P) and Ser(P) phosphoproteins also is presented for the direct measurement of phosphatase activities in preparations by the release of acid-soluble (/sup 32/P)phosphate.

  7. Phosphoproteins and protein kinases of the Golgi apparatus membrane

    SciTech Connect

    Capasso, J.M.; Abeijon, C.; Hirschberg, C.B.

    1985-11-25

    Incubation of a highly purified fraction derived from rat liver Golgi apparatus with (gamma-TSP)ATP results in phosphorylation of several endogenous phosphoproteins. One phosphoprotein with an apparent Mr of 48,300 is radiolabeled to an apparent extent at least 5-fold higher than any other phosphoprotein as part of either the Golgi apparatus or highly purified rat liver fractions derived from the rough endoplasmic reticulum, mitochondria, plasma membrane, coated vesicles, cytosol, and total homogenate. Approximately 70% of the 48.3-kDa phosphoprotein appears to be a specific extrinsic Golgi membrane protein with the phosphorylated amino acid being threonine. The protein kinase which phosphorylates the 48.3-kDa protein is an intrinsic Golgi membrane protein and is dependent on MgS , independent of CaS , calmodulin, and cAMP, and is inhibited by N-ethylmaleimide. Preliminary evidence suggests that there are also intrinsic membrane protein kinases in the Golgi apparatus which are dependent on CaS and cAMP. The physiological role of the above phosphoproteins and protein kinases is not known.

  8. Rapid, Multiplexed Phosphoprotein Profiling Using Silicon Photonic Sensor Arrays

    PubMed Central

    2015-01-01

    Extracellular signaling is commonly mediated through post-translational protein modifications that propagate messages from membrane-bound receptors to ultimately regulate gene expression. Signaling cascades are ubiquitously intertwined, and a full understanding of function can only be gleaned by observing dynamics across multiple key signaling nodes. Importantly, targets within signaling cascades often represent opportunities for therapeutic development or can serve as diagnostic biomarkers. Protein phosphorylation is a particularly important post-translational modification that controls many essential cellular signaling pathways. Not surprisingly, aberrant phosphorylation is found in many human diseases, including cancer, and phosphoprotein-based biomarker signatures hold unrealized promise for disease monitoring. Moreover, phosphoprotein analysis has wide-ranging applications across fundamental chemical biology, as many drug discovery efforts seek to target nodes within kinase signaling pathways. For both fundamental and translational applications, the analysis of phosphoprotein biomarker targets is limited by a reliance on labor-intensive and/or technically challenging methods, particularly when considering the simultaneous monitoring of multiplexed panels of phosphoprotein biomarkers. We have developed a technology based upon arrays of silicon photonic microring resonator sensors that fills this void, facilitating the rapid and automated analysis of multiple phosphoprotein levels from both cell lines and primary human tumor samples requiring only minimal sample preparation. PMID:26539563

  9. Signaling in striatal neurons: the phosphoproteins of reward, addiction, and dyskinesia.

    PubMed

    Girault, Jean-Antoine

    2012-01-01

    The striatum is a deep region of the forebrain involved in action selection, control of movement, and motivation. It receives a convergent excitatory glutamate input from the cerebral cortex and the thalamus, controlled by dopamine (DA) released in response to unexpected rewards and other salient stimuli. Striatal function and its dysfunction in drug addiction or Parkinson's disease depend on the interplay between these neurotransmitters. Signaling cascades in striatal medium-sized spiny neurons (MSNs) involve multiple kinases, phosphatases, and phosphoproteins, some of which are highly enriched in these neurons. They control the properties of ion channels and the plasticity of MSNs, in part through their effects on gene transcription. This chapter summarizes signaling in MSNs and focuses on the regulation of multiple protein phosphatases through DA and glutamate receptors and the role of ERK. It is hypothesized that these pathways are particularly adapted to the specific computing properties of MSNs and the function of the basal ganglia circuits in which they participate. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Localization of Phosphoproteins within the Barnacle Adhesive Interface.

    PubMed

    Dickinson, Gary H; Yang, Xu; Wu, Fanghui; Orihuela, Beatriz; Rittschof, Dan; Beniash, Elia

    2016-06-01

    Barnacles permanently adhere to nearly any inert substrate using proteinaceous glue. The glue consists of at least ten major proteins, some of which have been isolated and sequenced. Questions still remain about the chemical mechanisms involved in adhesion and the potential of the glue to serve as a platform for mineralization of the calcified base plate. We tested the hypothesis that barnacle glue contains phosphoproteins, which have the potential to play a role in both adhesion and mineralization. Using a combination of phosphoprotein-specific gel staining and Western blotting with anti-phosphoserine antibody, we identified multiple phosphorylated proteins in uncured glue secretions from the barnacle Amphibalanus amphitrite The protein composition of the glue and the quantity and abundance of phosphoproteins varied distinctly among individual barnacles, possibly due to cyclical changes in the glue secretion over time. We assessed the location of the phosphoproteins within the barnacle glue layer using decalcified barnacle base plates and residual glue deposited by reattached barnacles. Phosphoproteins were found throughout the organic matrix of the base plate and within the residual glue. Staining within the residual glue appeared most intensely in regions where capillary glue ducts, which are involved in cyclical release of glue, had been laid down. Lastly, mineralization studies of glue proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) indicated that proteins identified as phosphorylated possibly induce mineralization of calcium carbonate (CaCO3). These results contribute to our understanding of the protein composition of barnacle glue, and provide new insights into the potential roles of phosphoproteins in underwater bioadhesives.

  11. Plasmodium falciparum Serine/Threonine Phosphoprotein Phosphatases (PPP): From Housekeeper to 'Holy Grail'

    USDA-ARS?s Scientific Manuscript database

    Availability of complete genome sequence for Plasmodium falciparum has been useful in drawing a comprehensive metabolic map of the parasite. Distinct and unique metabolic characteristics of the parasite may be exploited as potential targets for new antimalarial drug discovery research. Reversible ph...

  12. Adenovirus DNA polymerase is a phosphoprotein.

    PubMed

    Ramachandra, M; Nakano, R; Mohan, P M; Rawitch, A B; Padmanabhan, R

    1993-01-05

    Biological activities of many of the eukaryotic DNA replication proteins are modulated by protein phosphorylation. Investigations of the phosphorylation of adenovirus DNA polymerase (AdPol) have been difficult mainly because of its low level of synthesis in adenovirus-infected HeLa cells. However, when AdPol was overproduced using the recombinant vaccinia virus (RV-AdPol) and the baculovirus expression systems, or by a large scale metabolic labeling of adenovirus 2-infected HeLa cells (native AdPol), in vivo phosphorylation of AdPol could be demonstrated. Phosphoamino acid analysis of [32P]AdPol indicated the presence of phosphoserine independent of the source of AdPol. Comparison of tryptic peptide maps of native AdPol and RV-AdPol revealed that the majority of phosphopeptides were common. Fractionation by high performance liquid chromatography and sequencing of one of the major phosphopeptides revealed serine 67 as a site of phosphorylation. Interestingly, this site is located close to the nuclear localization signal of AdPol and has a consensus substrate recognition sequence for histone H1 (cdc2-related) kinases and mitogen-activated protein kinases. Dephosphorylation of AdPol with calf intestinal alkaline phosphatase resulted in significant decrease in its activity in the in vitro DNA replication initiation assay, suggesting that phosphorylation is important for its biological activity.

  13. Protein phosphatase-1 modulates the function of Pax-6, a transcription factor controlling brain and eye development.

    PubMed

    Yan, Qin; Liu, Wen-Bin; Qin, Jichao; Liu, Jinping; Chen, He-Ge; Huang, Xiaoqin; Chen, Lili; Sun, Shuming; Deng, Mi; Gong, Lili; Li, Yong; Zhang, Lan; Liu, Yan; Feng, Hao; Xiao, Yamei; Liu, Yun; Li, David W-C

    2007-05-11

    Pax-6 is an evolutionarily conserved transcription factor and acts high up in the regulatory hierarchy controlling eye and brain development in humans, mice, zebrafish, and Drosophila. Previous studies have shown that Pax-6 is a phosphoprotein, and its phosphorylation by ERK, p38, and homeodomain-interacting protein kinase 2 greatly enhances its transactivation activity. However, the protein phosphatases responsible for the dephosphorylation of Pax-6 remain unknown. Here, we present both in vitro and in vivo evidence to show that protein serine/threonine phosphatase-1 is a major phosphatase that directly dephosphorylates Pax-6. First, purified protein phosphatase-1 directly dephosphorylates Pax-6 in vitro. Second, immunoprecipitation-linked Western blot revealed that both protein phosphatase-1alpha and protein phosphatase-1beta interact with Pax-6. Third, overexpression of protein phosphatase-1 in human lens epithelial cells leads to dephosphorylation of Pax-6. Finally, inhibition of protein phosphatase-1 activity by calyculin A or knockdown of protein phosphatase-1alpha and protein phosphatase-1beta by RNA interference leads to enhanced phosphorylation of Pax-6. Moreover, our results also demonstrate that dephosphorylation of Pax-6 by protein phosphatase-1 significantly modulates its function in regulating expression of both exogenous and endogenous genes. These results demonstrate that protein phosphatase 1 acts as a major phosphatase to dephosphorylate Pax-6 and modulate its function.

  14. Sac phosphatase domain proteins.

    PubMed Central

    Hughes, W E; Cooke, F T; Parker, P J

    2000-01-01

    Advances in our understanding of the roles of phosphatidylinositol phosphates in controlling cellular functions such as endocytosis, exocytosis and the actin cytoskeleton have included new insights into the phosphatases that are responsible for the interconversion of these lipids. One of these is an entirely novel class of phosphatase domain found in a number of well characterized proteins. Proteins containing this Sac phosphatase domain include the yeast Saccharomyces cerevisiae proteins Sac1p and Fig4p. The Sac phosphatase domain is also found within the mammalian phosphoinositide 5-phosphatase synaptojanin and the yeast synaptojanin homologues Inp51p, Inp52p and Inp53p. These proteins therefore contain both Sac phosphatase and 5-phosphatase domains. This review describes the Sac phosphatase domain-containing proteins and their actions, with particular reference to the genetic and biochemical insights provided by study of the yeast Saccharomyces cerevisiae. PMID:10947947

  15. Enrichment and Analysis of Intact Phosphoproteins in Arabidopsis Seedlings.

    PubMed

    Aryal, Uma K; Ross, Andrew R S; Krochko, Joan E

    2015-01-01

    Protein phosphorylation regulates diverse cellular functions and plays a key role in the early development of plants. To complement and expand upon previous investigations of protein phosphorylation in Arabidopsis seedlings we used an alternative approach that combines protein extraction under non-denaturing conditions with immobilized metal-ion affinity chromatography (IMAC) enrichment of intact phosphoproteins in Rubisco-depleted extracts, followed by identification using two-dimensional gel electrophoresis (2-DE) and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In-gel trypsin digestion and analysis of selected gel spots identified 144 phosphorylated peptides and residues, of which only 18 phosphopeptides and 8 phosphosites were found in the PhosPhAt 4.0 and P3DB Arabidopsis thaliana phosphorylation site databases. More than half of the 82 identified phosphoproteins were involved in carbohydrate metabolism, photosynthesis/respiration or oxidative stress response mechanisms. Enrichment of intact phosphoproteins prior to 2-DE and LC-MS/MS appears to enhance detection of phosphorylated threonine and tyrosine residues compared with methods that utilize peptide-level enrichment, suggesting that the two approaches are somewhat complementary in terms of phosphorylation site coverage. Comparing results for young seedlings with those obtained previously for mature Arabidopsis leaves identified five proteins that are differentially phosphorylated in these tissues, demonstrating the potential of this technique for investigating the dynamics of protein phosphorylation during plant development.

  16. Structure of an Enzyme-Derived Phosphoprotein Recognition Domain

    PubMed Central

    Johnston, Christopher A.; Doe, Chris Q.; Prehoda, Kenneth E.

    2012-01-01

    Membrane Associated Guanylate Kinases (MAGUKs) contain a protein interaction domain (GKdom) derived from the enzyme Guanylate Kinase (GKenz). Here we show that GKdom from the MAGUK Discs large (Dlg) is a phosphoprotein recognition domain, specifically recognizing the phosphorylated form of the mitotic spindle orientation protein Partner of Inscuteable (Pins). We determined the structure of the Dlg-Pins complex to understand the dramatic transition from nucleotide kinase to phosphoprotein recognition domain. The structure reveals that the region of the GKdom that once served as the GMP binding domain (GBD) has been co-opted for protein interaction. Pins makes significantly more contact with the GBD than does GMP, but primarily with residues that are conserved between enzyme and domain revealing the versatility of the GBD as a platform for nucleotide and protein interactions. Mutational analysis reveals that the GBD is also used to bind the GK ligand MAP1a, suggesting that this is a common mode of MAGUK complex assembly. The GKenz undergoes a dramatic closing reaction upon GMP binding but the protein-bound GKdom remains in the ‘open’ conformation indicating that the dramatic conformational change has been lost in the conversion from nucleotide kinase to phosphoprotein recognition domain. PMID:22545154

  17. Specific dephosphorylation of phosphoproteins by protein-serine and -tyrosine kinases.

    PubMed

    Kole, H K; Abdel-Ghany, M; Racker, E

    1988-08-01

    Five protein kinases are shown to serve as specific phosphatases in the absence of ADP. Although the rates of hydrolysis are very slow compared to the forward phosphorylation rates under optimal conditions, they are of the same order as the reverse reaction in the presence of ADP. Because cells contain approximately equal to 3 mM ATP, neither the reverse reaction nor the phosphatase is likely to play a physiological role. beta-casein B phosphorylated by the catalytic subunit of cAMP-dependent protein kinase (protein kinase A) is specifically dephosphorylated by protein kinase A but not by polypeptide-dependent protein kinase (protein kinase P). beta-casein B phosphorylated by protein kinase P is specifically dephosphorylated by protein kinase P but not by protein kinase A. Histone H1 phosphorylated by protein kinase C is dephosphorylated by the same enzyme in the absence of ADP. In all cases tested addition of ADP and F1-ATPase accelerates moderately the rate of dephosphorylation. Native H+-ATPase from yeast plasma membranes is isolated mainly in the phosphorylated form. It is dephosphorylated and rephosphorylated by protein kinase P but not by protein kinase A. Protein-tyrosine kinase of the epidermal growth factor receptor phosphorylates the random synthetic polypeptide poly(Glu80Tyr20). The phosphorylated polymer is specifically dephosphorylated in the absence of ADP by epidermal growth factor receptor preparations but not by insulin receptor preparations. The same polymer phosphorylated by insulin receptor is dephosphorylated by insulin receptor but not by epidermal growth factor receptor preparations. By using a cycle of dephosphorylation-rephosphorylation, it is possible to identify proteins that are phosphorylated by these protein kinases in vivo. Should this method be applicable to additional protein kinases, it should be possible to estimate the quantitative contribution of each protein kinase to a single phosphoprotein.

  18. Specific dephosphorylation of phosphoproteins by protein-serine and -tyrosine kinases.

    PubMed Central

    Kole, H K; Abdel-Ghany, M; Racker, E

    1988-01-01

    Five protein kinases are shown to serve as specific phosphatases in the absence of ADP. Although the rates of hydrolysis are very slow compared to the forward phosphorylation rates under optimal conditions, they are of the same order as the reverse reaction in the presence of ADP. Because cells contain approximately equal to 3 mM ATP, neither the reverse reaction nor the phosphatase is likely to play a physiological role. beta-casein B phosphorylated by the catalytic subunit of cAMP-dependent protein kinase (protein kinase A) is specifically dephosphorylated by protein kinase A but not by polypeptide-dependent protein kinase (protein kinase P). beta-casein B phosphorylated by protein kinase P is specifically dephosphorylated by protein kinase P but not by protein kinase A. Histone H1 phosphorylated by protein kinase C is dephosphorylated by the same enzyme in the absence of ADP. In all cases tested addition of ADP and F1-ATPase accelerates moderately the rate of dephosphorylation. Native H+-ATPase from yeast plasma membranes is isolated mainly in the phosphorylated form. It is dephosphorylated and rephosphorylated by protein kinase P but not by protein kinase A. Protein-tyrosine kinase of the epidermal growth factor receptor phosphorylates the random synthetic polypeptide poly(Glu80Tyr20). The phosphorylated polymer is specifically dephosphorylated in the absence of ADP by epidermal growth factor receptor preparations but not by insulin receptor preparations. The same polymer phosphorylated by insulin receptor is dephosphorylated by insulin receptor but not by epidermal growth factor receptor preparations. By using a cycle of dephosphorylation-rephosphorylation, it is possible to identify proteins that are phosphorylated by these protein kinases in vivo. Should this method be applicable to additional protein kinases, it should be possible to estimate the quantitative contribution of each protein kinase to a single phosphoprotein. Images PMID:2901092

  19. Multiple forms of phosphatase from human brain: isolation and partial characterization of affi-gel blue binding phosphatases.

    PubMed

    Cheng, L Y; Wang, J Z; Gong, C X; Pei, J J; Zaidi, T; Grundke-Iqbal, I; Iqbal, K

    2000-01-01

    Implication of protein phosphatases in Alzheimer disease led us to a systemic investigation of the identification of these enzyme activities in human brain. Human brain phosphatases eluted from DEAE-Sephacel with 0.22 M NaCl were resolved into two main groups by affi-gel blue chromatography, namely affi-gel blue-binding phosphatases and affi-gel blue-nonbinding phosphatases. Affi-gel blue-binding phosphatases were further separated into four different phosphatases, designated P1, P2, P3, and P4 by calmodulin-Sepharose 4B and poly-(L-lysine)-agarose chromatographies. These four phosphatases exhibited activities towards nonprotein phosphoester and two of them, P1 and P4, could dephosphorylate phosphoproteins. The activities of the four phosphatases differed in pH optimum, divalent metal ion requirements, sensitivities to various inhibitors and substrate affinities. The apparent molecular masses as estimated by gel-filtration for P1, P2, P3, and P4 were 97, 45, 42, and 125 kDa, respectively. P1 is markedly similar to PP2B from bovine brain and rabbit skeletal muscle. P4 was labeled with anti-PP2A antibody and may represent a new subtype of PP2A. P1 and P4 were also effective in dephosphorylating Alzheimer disease abnormally hyperphosphorylated tau (AD P-tau). The resulting dephosphorylated AD P-tau had its activity restored in promoting assembly of microtubules in vitro. These results suggest that P1 and P4 might be involved in the regulation of phosphorylation of tau in human brain, especially in neurodegenerative conditions like Alzheimer's disease which are characterized by the abnormal hyperphosphorylation of this protein.

  20. Teaching resources. Protein phosphatases.

    PubMed

    Salton, Stephen R

    2005-03-01

    This Teaching Resource provides lecture notes and slides for a class covering the structure and function of protein phosphatases and is part of the course "Cell Signaling Systems: A Course for Graduate Students." The lecture begins with a discussion of the importance of phosphatases in physiology, recognized by the award of a Nobel Prize in 1992, and then proceeds to describe the two types of protein phosphatases: serine/threonine and tyrosine phosphatases. The information covered includes the structure, regulation, and substrate specificity of protein phosphatases, with an emphasis on their importance in disease and clinical settings.

  1. Structural relationship between a bacterial developmental protein and eukaryotic PP2C protein phosphatases.

    PubMed

    Adler, E; Donella-Deana, A; Arigoni, F; Pinna, L A; Stragler, P

    1997-01-01

    Bacillus subtilis SpoIIE is a Ser protein phosphatase whose action on the phosphoprotein SpoIIAA triggers the cell type-specific activation of a sporulation transcription factor. Here we report that SpoIIE displays sequence similarity to the PP2C family of eukaryotic Ser/Thr protein phosphatases, and that residues common to these proteins are required for the function of both SpoIIE and TPD1, a yeast PP2C. These findings suggest that SpoIIE and the PP2C protein phosphatases are structurally related, and reveal a striking formal similarity between the SpoIIAA regulatory circuit and that of mammalian mitochondrial pyruvate dehydrogenase. This similarity may reflect an evolutionarily conserved mechanism of biological regulation based on the interplay of His protein kinase-like Ser kinases and PP2C-like protein phosphatases.

  2. Two ancient bacterial-like PPP family phosphatases from Arabidopsis are highly conserved plant proteins that possess unique properties.

    PubMed

    Uhrig, R Glen; Moorhead, Greg B

    2011-12-01

    Protein phosphorylation, catalyzed by the opposing actions of protein kinases and phosphatases, is a cornerstone of cellular signaling and regulation. Since their discovery, protein phosphatases have emerged as highly regulated enzymes with specificity that rivals their counteracting kinase partners. However, despite years of focused characterization in mammalian and yeast systems, many protein phosphatases in plants remain poorly or incompletely characterized. Here, we describe a bioinformatic, biochemical, and cellular examination of an ancient, Bacterial-like subclass of the phosphoprotein phosphatase (PPP) family designated the Shewanella-like protein phosphatases (SLP phosphatases). The SLP phosphatase subcluster is highly conserved in all plants, mosses, and green algae, with members also found in select fungi, protists, and bacteria. As in other plant species, the nucleus-encoded Arabidopsis (Arabidopsis thaliana) SLP phosphatases (AtSLP1 and AtSLP2) lack genetic redundancy and phylogenetically cluster into two distinct groups that maintain different subcellular localizations, with SLP1 being chloroplastic and SLP2 being cytosolic. Using heterologously expressed and purified protein, the enzymatic properties of both AtSLP1 and AtSLP2 were examined, revealing unique metal cation preferences in addition to a complete insensitivity to the classic serine/threonine PPP protein phosphatase inhibitors okadaic acid and microcystin. The unique properties and high conservation of the plant SLP phosphatases, coupled to their exclusion from animals, red algae, cyanobacteria, archaea, and most bacteria, render understanding the function(s) of this new subclass of PPP family protein phosphatases of particular interest.

  3. Combined effect of tissue stabilization and protein extraction methods on phosphoprotein analysis.

    PubMed

    Kofanova, Olga A; Fack, Fred; Niclou, Simone P; Betsou, Fay

    2013-06-01

    Preanalytical conditions applied during sample collection and processing can affect the detection or quantification of unstable phosphoprotein biomarkers. We evaluated the consequences of tissue stabilization and protein extraction methods on phosphoprotein analysis. The effects of stabilization techniques (heat stabilization, snap-freezing) and time on the levels of phosphoproteins, including phospho-Akt, p-ERK 1/2, p-IkBα, p-JNK, and p38 MAPK, were evaluated using a BioPlex phosphoprotein assay. Additionally, two different protein extraction protocols, using different extraction buffers (8 M urea buffer, or Bio-Rad buffer without urea) were tested. For snap-frozen samples, protein extraction yields were comparable with the two buffer systems. For heat-stabilized samples, total protein yields were significantly lower following extraction in non-urea buffer. However, the concentrations of specific phosphoproteins were significantly higher in heat-stabilized samples than in the corresponding snap-frozen samples, indicating that this tissue processing method better preserved phosphoproteins. Significant differences were found between the measured phosphoprotein levels in heat-stabilized and snap-frozen tissue, suggesting that alterations occur very rapidly after tissue excision. Our results suggest that heat stabilization can be used as a tissue processing method for subsequent phosphoprotein analyses, but also suggest that the BioPlex phosphoprotein assay could be used as a possible quality control method to assess tissue sample integrity.

  4. Involvement of the Rabies Virus Phosphoprotein Gene in Neuroinvasiveness

    PubMed Central

    Yamaoka, Satoko; Ito, Naoto; Ohka, Seii; Kaneda, Shohei; Nakamura, Hiroko; Agari, Takahiro; Masatani, Tatsunori; Nakagawa, Keisuke; Okada, Kazuma; Okadera, Kota; Mitake, Hiromichi; Fujii, Teruo

    2013-01-01

    Rabies virus (RABV), which is transmitted via a bite wound caused by a rabid animal, infects peripheral nerves and then spreads to the central nervous system (CNS) before causing severe neurological symptoms and death in the infected individual. Despite the importance of this ability of the virus to spread from a peripheral site to the CNS (neuroinvasiveness) in the pathogenesis of rabies, little is known about the mechanism underlying the neuroinvasiveness of RABV. In this study, to obtain insights into the mechanism, we conducted comparative analysis of two fixed RABV strains, Nishigahara and the derivative strain Ni-CE, which cause lethal and asymptomatic infections, respectively, in mice after intramuscular inoculation. Examination of a series of chimeric viruses harboring the respective genes from Nishigahara in the genetic background of Ni-CE revealed that the Nishigahara phosphoprotein (P) gene plays a major role in the neuroinvasiveness by mediating infection of peripheral nerves. The results obtained from both in vivo and in vitro experiments strongly suggested that the Nishigahara P gene, but not the Ni-CE P gene, is important for stable viral replication in muscle cells. Further investigation based on the previous finding that RABV phosphoprotein counteracts the host interferon (IFN) system demonstrated that the Nishigahara P gene, but not the Ni-CE P gene, functions to suppress expression of the beta interferon (IFN-β) gene (Ifn-β) and IFN-stimulated genes in muscle cells. In conclusion, we provide the first data strongly suggesting that RABV phosphoprotein assists viral replication in muscle cells by counteracting the host IFN system and, consequently, enhances infection of peripheral nerves. PMID:24027304

  5. Structural and functional basis of protein phosphatase 5 substrate specificity.

    PubMed

    Oberoi, Jasmeen; Dunn, Diana M; Woodford, Mark R; Mariotti, Laura; Schulman, Jacqualyn; Bourboulia, Dimitra; Mollapour, Mehdi; Vaughan, Cara K

    2016-08-09

    The serine/threonine phosphatase protein phosphatase 5 (PP5) regulates hormone- and stress-induced cellular signaling by association with the molecular chaperone heat shock protein 90 (Hsp90). PP5-mediated dephosphorylation of the cochaperone Cdc37 is essential for activation of Hsp90-dependent kinases. However, the details of this mechanism remain unknown. We determined the crystal structure of a Cdc37 phosphomimetic peptide bound to the catalytic domain of PP5. The structure reveals PP5 utilization of conserved elements of phosphoprotein phosphatase (PPP) structure to bind substrate and provides a template for many PPP-substrate interactions. Our data show that, despite a highly conserved structure, elements of substrate specificity are determined within the phosphatase catalytic domain itself. Structure-based mutations in vivo reveal that PP5-mediated dephosphorylation is required for kinase and steroid hormone receptor release from the chaperone complex. Finally, our data show that hyper- or hypoactivity of PP5 mutants increases Hsp90 binding to its inhibitor, suggesting a mechanism to enhance the efficacy of Hsp90 inhibitors by regulation of PP5 activity in tumors.

  6. Applying a Targeted Label-free Approach using LC-MS AMT Tags to Evaluate Changes in Protein Phosphorylation Following Phosphatase Inhibition

    SciTech Connect

    Yang, Feng; Jaitly, Navdeep; Jayachandran, Hemalatha; Lou, Quanzhou; Monroe, Matthew E.; Du, Xiuxia; Gritsenko, Marina A.; Zhang, Rui; Anderson, David J.; Purvine, Samuel O.; Adkins, Joshua N.; Moore, Ronald J.; Mottaz, Heather M.; Ding, Shi-Jian; Lipton, Mary S.; Camp, David G.; Udseth, Harold R.; Smith, Richard D.; Rossie, Sandra S.

    2007-10-12

    To identify phosphoproteins regulated by the phosphoprotein phosphatase (PPP) family of S/T phosphatases, we performed a large-scale characterization of changes in protein phosphorylation on extracts from HeLa cells treated with or without calyculin A, a potent PPP enzyme inhibitor. A label-free comparative Phosphoproteomics approach using immobilized metal ion affinity chromatography and targeted tandem mass spectrometry was employed to discover and identify signatures based upon distinctive changes in abundance. Overall, 232 proteins were identified as either direct or indirect targets for PPP enzyme regulation. Most of the present identifications represent novel PPP enzyme targets at the level of both phosphorylation site and protein. These include phosphorylation sites within signaling proteins such as p120 Catenin, A Kinase Anchoring Protein 8, JunB, and Type II Phosphatidyl Inositol 4 Kinase. These data can be used to define underlying signaling pathways and events regulated by the PPP family of S/T phosphatases.

  7. Applying a targeted label-free approach using LC-MS AMT tags to evaluate changes in protein phosphorylation following phosphatase inhibition.

    PubMed

    Yang, Feng; Jaitly, Navdeep; Jayachandran, Hemalatha; Luo, Quanzhou; Monroe, Matthew E; Du, Xiuxia; Gritsenko, Marina A; Zhang, Rui; Anderson, David J; Purvine, Samuel O; Adkins, Joshua N; Moore, Ronald J; Mottaz, Heather M; Ding, Shi-Jian; Lipton, Mary S; Camp, David G; Udseth, Harold R; Smith, Richard D; Rossie, Sandra

    2007-11-01

    To identify phosphoproteins regulated by the phosphoprotein phosphatase (PPP) family of S/T phosphatases, we performed a large-scale characterization of changes in protein phosphorylation on extracts from HeLa cells treated with or without calyculin A, a potent PPP enzyme inhibitor. A label-free comparative phosphoproteomics approach using immobilized metal ion affinity chromatography and targeted tandem mass spectrometry was employed to discover and identify signatures based upon distinctive changes in abundance. Overall, 232 proteins were identified as either direct or indirect targets for PPP enzyme regulation. Most of the present identifications represent novel PPP enzyme targets at the level of both phosphorylation site and protein. These include phosphorylation sites within signaling proteins such as p120 Catenin, A Kinase Anchoring Protein 8, JunB, and Type II Phosphatidyl Inositol 4 Kinase. These data can be used to define underlying signaling pathways and events regulated by the PPP family of S/T phosphatases.

  8. Multisystemic functions of alkaline phosphatases.

    PubMed

    Buchet, René; Millán, José Luis; Magne, David

    2013-01-01

    Human and mouse alkaline phosphatases (AP) are encoded by a multigene family expressed ubiquitously in multiple tissues. Gene knockout (KO) findings have helped define some of the precise exocytic functions of individual isozymes in bone, teeth, the central nervous system, and in the gut. For instance, deficiency in tissue-nonspecific alkaline phosphatase (TNAP) in mice (Alpl (-/-) mice) and humans leads to hypophosphatasia (HPP), an inborn error of metabolism characterized by epileptic seizures in the most severe cases, caused by abnormal metabolism of pyridoxal-5'-phosphate (the predominant form of vitamin B6) and by hypomineralization of the skeleton and teeth featuring rickets and early loss of teeth in children or osteomalacia and dental problems in adults caused by accumulation of inorganic pyrophosphate (PPi). Enzyme replacement therapy with mineral-targeting TNAP prevented all the manifestations of HPP in mice, and clinical trials with this protein therapeutic are showing promising results in rescuing life-threatening HPP in infants. Conversely, TNAP induction in the vasculature during generalized arterial calcification of infancy (GACI), type II diabetes, obesity, and aging can cause medial vascular calcification. TNAP inhibitors, discussed extensively in this book, are in development to prevent pathological arterial calcification. The brush border enzyme intestinal alkaline phosphatase (IAP) plays an important role in fatty acid (FA) absorption, in protecting gut barrier function, and in determining the composition of the gut microbiota via its ability to dephosphorylate lipopolysaccharide (LPS). Knockout mice (Akp3 (-/-)) deficient in duodenal-specific IAP (dIAP) become obese, and develop hyperlipidemia and hepatic steatosis when fed a high-fat diet (HFD). These changes are accompanied by upregulation in the jejunal-ileal expression of the Akp6 IAP isozyme (global IAP, or gIAP) and concomitant upregulation of FAT/CD36, a phosphorylated fatty acid

  9. Dopamine- and cAMP-regulated phosphoprotein DARPP-32: phosphorylation of Ser-137 by casein kinase I inhibits dephosphorylation of Thr-34 by calcineurin.

    PubMed Central

    Desdouits, F; Siciliano, J C; Greengard, P; Girault, J A

    1995-01-01

    Although protein phosphatases appear to be highly controlled in intact cells, relatively little is known about the physiological regulation of their activity. DARPP-32, a dopamine- and cAMP-regulated phosphoprotein of apparent M(r) 32,000, is phosphorylated in vitro by casein kinase I, casein kinase II, and cAMP-dependent protein kinase on sites phosphorylated in vivo. DARPP-32 phosphorylated on Thr-34 by cAMP-dependent protein kinase is a potent inhibitor of protein phosphatase 1 and an excellent substrate for calcineurin, a Ca2+/calmodulin-dependent protein phosphatase. Here we provide evidence, using both purified proteins and brain slices, that phosphorylation of DARPP-32 on Ser-137 by casein kinase I inhibits the dephosphorylation of Thr-34 by calcineurin. This inhibition occurs only when phospho-Ser-137 and phospho-Thr-34 are located on the same DARPP-32 molecule and is not dependent on the mode of activation of calcineurin. The results demonstrate that the inhibition is due to a modification in the properties of the substrate which alters its dephosphorylation rate. Thus, casein kinase I may play a physiological role in striatonigral neurons as a modulator of the regulation of protein phosphatase 1 via DARPP-32. Images Fig. 1 Fig. 2 PMID:7708705

  10. Dopamine- and cAMP-regulated phosphoprotein DARPP-32: phosphorylation of Ser-137 by casein kinase I inhibits dephosphorylation of Thr-34 by calcineurin.

    PubMed

    Desdouits, F; Siciliano, J C; Greengard, P; Girault, J A

    1995-03-28

    Although protein phosphatases appear to be highly controlled in intact cells, relatively little is known about the physiological regulation of their activity. DARPP-32, a dopamine- and cAMP-regulated phosphoprotein of apparent M(r) 32,000, is phosphorylated in vitro by casein kinase I, casein kinase II, and cAMP-dependent protein kinase on sites phosphorylated in vivo. DARPP-32 phosphorylated on Thr-34 by cAMP-dependent protein kinase is a potent inhibitor of protein phosphatase 1 and an excellent substrate for calcineurin, a Ca2+/calmodulin-dependent protein phosphatase. Here we provide evidence, using both purified proteins and brain slices, that phosphorylation of DARPP-32 on Ser-137 by casein kinase I inhibits the dephosphorylation of Thr-34 by calcineurin. This inhibition occurs only when phospho-Ser-137 and phospho-Thr-34 are located on the same DARPP-32 molecule and is not dependent on the mode of activation of calcineurin. The results demonstrate that the inhibition is due to a modification in the properties of the substrate which alters its dephosphorylation rate. Thus, casein kinase I may play a physiological role in striatonigral neurons as a modulator of the regulation of protein phosphatase 1 via DARPP-32.

  11. Acid and alkaline phosphatases of Capnocytophaga species. II. Isolation, purification, and characterization of the enzymes from Capnocytophaga ochracea.

    PubMed

    Poirier, T P; Holt, S C

    1983-10-01

    Capnocytophaga ochracea acid (AcP; EC 3.1.3.2) and alkaline (AlP; EC 3.1.3.1) phosphatase was isolated by Ribi cell disruption and purified by sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE.) Both phosphatases eluted from Sephadex G-150 consistent with molecular weights (migration) of 140 000 and 110 000. SDS-PAGE demonstrated a 72 000 and 55 000 subunit molecular migration for AcP and AlP, respectively. The kinetics of activity of purified AcP and AlP on p-nitrophenol phosphate and phosphoseryl residues of the phosphoproteins are presented.

  12. Protein profiling and phosphoprotein analysis by isoelectric focusing.

    PubMed

    Maccarrone, Giuseppina; Filiou, Michaela D

    2015-01-01

    Protein profiling enables the qualitative characterization of a proteome of interest. Phosphorylation is a post-translational modification with regulatory functions in a plethora of cell processes. We present an experimental workflow for simultaneous analysis of the proteome and phosphoproteome with no additional enrichment for phosphoproteins/phosphopeptides. Our approach is based on isoelectric focusing (IEF) which allows the separation of peptide mixtures on an immobilized pH gradient (IPG) according to their isoelectric point. Due to the negative charge of the phosphogroup, most of the phosphopeptides migrate toward acidic pH values. Peptides and phosphopeptides are then identified by mass spectrometry (MS) and phosphopeptide spectra are manually checked for the assignment of phosphorylation sites. Here, we apply this methodology to investigate synaptosome extracts from whole mouse brain. IEF-based peptide separation is an efficient method for peptide and phosphopeptide identification.

  13. An integrated workflow for characterizing intact phosphoproteins from complex mixtures

    PubMed Central

    Wu, Si; Yang, Feng; Zhao, Rui; Tolić, Nikola; Robinson, Errol W.; Camp, David; Smith, Richard D.; Paša-Tolić, Ljiljana

    2014-01-01

    The phosphorylation of any site on a given protein can affect its activity, degradation rate, ability to dock with other proteins or bind divalent cations, and/or its localization. These effects can operate within the same protein; in fact, multisite phosphorylation is a key mechanism for achieving signal integration in cells. Hence, knowing the overall phosphorylation signature of a protein is essential for understanding the "state" of a cell. However, current technologies to monitor the phosphorylation status of proteins are inefficient at determining the relative stoichiometries of phosphorylation at multiple sites. Here we report a new capability for comprehensive liquid chromatography mass spectrometry (LC/MS) analysis of intact phosphoproteins. The technology platform built upon integrated bottom-up and top-down approach that is facilitated by intact protein reversed-phase (RP)LC concurrently coupled with Fourier transform ion cyclotron resonance (FTICR) MS and fraction collection. As the use of conventional RPLC systems for phosphopeptide identification has proven challenging due to the formation of metal ion complexes at various metal surfaces during LC/MS and ESI-MS analysis, we have developed a “metal-free” RPLC-ESI-MS platform for phosphoprotein characterization. This platform demonstrated a significant sensitivity enhancement for phosphorylated casein proteins enriched from a standard protein mixture and revealed the presence of over 20 casein isoforms arising from genetic variants with varying numbers of phosphorylation sites. The integrated workflow was also applied to an enriched yeast phosphoproteome to evaluate the feasibility of this strategy for characterizing complex biological systems, and revealed ~16% of the detected yeast proteins to have multiple phosphorylation isoforms. Intact protein LC/MS platform for characterization of combinatorial posttranslational modifications (PTMs), with special emphasis on multisite phosphorylation, holds

  14. Centromeric binding and activity of Protein Phosphatase 4

    PubMed Central

    Lipinszki, Zoltan; Lefevre, Stephane; Savoian, Matthew S.; Singleton, Martin R.; Glover, David M.; Przewloka, Marcin R.

    2015-01-01

    The cell division cycle requires tight coupling between protein phosphorylation and dephosphorylation. However, understanding the cell cycle roles of multimeric protein phosphatases has been limited by the lack of knowledge of how their diverse regulatory subunits target highly conserved catalytic subunits to their sites of action. Phosphoprotein phosphatase 4 (PP4) has been recently shown to participate in the regulation of cell cycle progression. We now find that the EVH1 domain of the regulatory subunit 3 of Drosophila PP4, Falafel (Flfl), directly interacts with the centromeric protein C (CENP-C). Unlike other EVH1 domains that interact with proline-rich ligands, the crystal structure of the Flfl amino-terminal EVH1 domain bound to a CENP-C peptide reveals a new target-recognition mode for the phosphatase subunit. We also show that binding of Flfl to CENP-C is required to bring PP4 activity to centromeres to maintain CENP-C and attached core kinetochore proteins at chromosomes during mitosis. PMID:25562660

  15. Characterization of cationic acid phosphatase isozyme from rat liver mitochondria.

    PubMed

    Fujimoto, S; Murakami, K; Hosoda, T; Yamamoto, Y; Watanabe, K; Morinaka, Y; Ohara, A

    1992-05-01

    Acid phosphatase isozyme was highly purified from rat liver mitochondrial fraction. The enzyme showed an isoelectric point value of above 9.5 on isoelectric focusing, and the apparent molecular weight was estimated to be 32000 by Sephadex G-100 gel filtration or 16000 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The enzyme catalyzed the hydrolysis of adenosine 5'-triphosphate, adenosine 5'-diphosphate, thiamine pyrophosphate, inorganic pyrophosphate, and phosphoprotein such as casein and phosvitin, but not of several phosphomonoesters, except for p-nitrophenyl phosphate and o-phosphotyrosine. The enzyme was not inhibited by L-(+)-tartrate, and was significantly activated by Fe2+ and reducing agents such as ascorbic acid, L-cysteine,and dithiothreitol. The enzyme was found to be distributed in various rat tissues including liver, spleen, kidney, small intestine, lung, stomach, brain and heart, but not in skeletal muscle.

  16. 3-Phosphoglycerate Phosphatase in Plants

    PubMed Central

    Randall, D. D.; Tolbert, N. E.; Gremel, D.

    1971-01-01

    3-Phosphoglycerate phosphatase and phosphoglycolate phosphatase were found in leaves of all 52 plants examined. Activities of both phosphatases varied widely between 1 to 20 micromoles per minute per milligram chlorophyll. Plants were grouped into two categories based upon the relative ratio of activity of 3-phosphoglycerate phosphatase to phosphoglycolate phosphatase. This ratio varied between 2:1 to 4:1 in the C4-plants except corn leaves which had a low level of 3-phosphoglycerate phosphatase. This ratio was reversed and varied between 1:2 to 1:6 in all C3-plants except one bean variety which had large amounts of both phosphatases. By differential grinding procedures for C4 plants a major part of the 3-phosphoglycerate phosphatase was found in the mesophyll cells and P-glycolate phosphatase in the bundle sheath cells. Phosphoglycolate phosphatase, but not 3-phosphoglycerate phosphatase, was located in chloroplasts of C3- and C4- plants. Formation of 3-phosphoglycerate phosphatase increased 4- to 12-fold during greening of etiolated sugarcane leaves. This cytosol phosphatase displayed a diurnal variation in sugarcane leaves by increasing 50% during late daylight hours and early evening. It is proposed that the soluble form of 3-phosphoglycerate phosphatase is necessary for carbon transport between the bundle sheath and mesophyll cells during photosynthesis by C4-plants. In C3- and C4-plants this phosphatase initiates the conversion of 3-phosphoglycerate to serine which is an alternate metabolic pathway to glycolate metabolism and photorespiration. PMID:16657822

  17. Principles and examples of gel-based approaches for phosphoprotein analysis.

    PubMed

    Steinberger, Birgit; Mayrhofer, Corina

    2015-01-01

    Methods for analyzing the phosphorylation status of proteins are essential to investigate in detail key cellular processes, including signal transduction and cell metabolism. The transience of this post-translational modification and the generally low abundance of phosphoproteins require specific enrichment and/or detection steps prior to analysis. Here, we describe three gel-based approaches for the analysis of differentially expressed phosphoproteins. These approaches comprise (1) the sequential fluorescence staining of two-dimensional (2-D) gels using Pro-Q(®) Diamond and SYPRO(®) Ruby dyes to visualize and quantify phosphoproteins in total cellular lysates as well as (2) affinity enrichment of phosphoproteins in conjunction with sequential fluorescence staining of the 2-D gels and (3) affinity enrichment of proteins prior to pre-electrophoretic fluorescence labeling and 2-D gel electrophoresis.

  18. Alkaline phosphatase: an overview.

    PubMed

    Sharma, Ujjawal; Pal, Deeksha; Prasad, Rajendra

    2014-07-01

    Alkaline phosphatase (ALP; E.C.3.I.3.1.) is an ubiquitous membrane-bound glycoprotein that catalyzes the hydrolysis of phosphate monoesters at basic pH values. Alkaline phosphatase is divided into four isozymes depending upon the site of tissue expression that are Intestinal ALP, Placental ALP, Germ cell ALP and tissue nonspecific alkaline phosphatase or liver/bone/kidney (L/B/K) ALP. The intestinal and placental ALP loci are located near the end of long arm of chromosome 2 and L/B/K ALP is located near the end of the short arm of chromosome 1. Although ALPs are present in many mammalian tissues and have been studied for the last several years still little is known about them. The bone isoenzyme may be involved in mammalian bone calcification and the intestinal isoenzyme is thought to play a role in the transport of phosphate into epithelial cells of the intestine. In this review, we tried to provide an overview about the various forms, structure and functions of alkaline phosphatase with special focus on liver/bone/kidney alkaline phosphatase.

  19. Large scale identification and quantitative profiling of phosphoproteins expressed during seed filling in oilseed rape.

    PubMed

    Agrawal, Ganesh Kumar; Thelen, Jay J

    2006-11-01

    Seed filling is a dynamic, temporally regulated phase of seed development that determines the composition of storage reserves in mature seeds. Although the metabolic pathways responsible for storage reserve synthesis such as carbohydrates, oils, and proteins are known, little is known about their regulation. Protein phosphorylation is a ubiquitous form of regulation that influences many aspects of dynamic cellular behavior in plant biology. Here a systematic study has been conducted on five sequential stages (2, 3, 4, 5, and 6 weeks after flowering) of seed development in oilseed rape (Brassica napus L. Reston) to survey the presence and dynamics of phosphoproteins. High resolution two-dimensional gel electrophoresis in combination with a phosphoprotein-specific Pro-Q Diamond phosphoprotein fluorescence stain revealed approximately 300 phosphoprotein spots. Of these, quantitative expression profiles for 234 high quality spots were established, and hierarchical cluster analyses revealed the occurrence of six principal expression trends during seed filling. The identity of 103 spots was determined using LC-MS/MS. The identified spots represented 70 non-redundant phosphoproteins belonging to 10 major functional categories including energy, metabolism, protein destination, and signal transduction. Furthermore phosphorylation within 16 non-redundant phosphoproteins was verified by mapping the phosphorylation sites by LC-MS/MS. Although one of these sites was postulated previously, the remaining sites have not yet been reported in plants. Phosphoprotein data were assembled into a web database. Together this study provides evidence for the presence of a large number of functionally diverse phosphoproteins, including global regulatory factors like 14-3-3 proteins, within developing B. napus seed.

  20. Context Specificity in Causal Signaling Networks Revealed by Phosphoprotein Profiling.

    PubMed

    Hill, Steven M; Nesser, Nicole K; Johnson-Camacho, Katie; Jeffress, Mara; Johnson, Aimee; Boniface, Chris; Spencer, Simon E F; Lu, Yiling; Heiser, Laura M; Lawrence, Yancey; Pande, Nupur T; Korkola, James E; Gray, Joe W; Mills, Gordon B; Mukherjee, Sach; Spellman, Paul T

    2017-01-25

    Signaling networks downstream of receptor tyrosine kinases are among the most extensively studied biological networks, but new approaches are needed to elucidate causal relationships between network components and understand how such relationships are influenced by biological context and disease. Here, we investigate the context specificity of signaling networks within a causal conceptual framework using reverse-phase protein array time-course assays and network analysis approaches. We focus on a well-defined set of signaling proteins profiled under inhibition with five kinase inhibitors in 32 contexts: four breast cancer cell lines (MCF7, UACC812, BT20, and BT549) under eight stimulus conditions. The data, spanning multiple pathways and comprising ∼70,000 phosphoprotein and ∼260,000 protein measurements, provide a wealth of testable, context-specific hypotheses, several of which we experimentally validate. Furthermore, the data provide a unique resource for computational methods development, permitting empirical assessment of causal network learning in a complex, mammalian setting. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Positive Expression of Human Cytomegalovirus Phosphoprotein 65 in Atherosclerosis

    PubMed Central

    Wang, Zhe; Cai, Jun; Zhang, Mingming; Wang, Xiaojing; Chi, Hongjie; Feng, Haijun

    2016-01-01

    Previous studies showed that human cytomegalovirus (HCMV) is associated with atherosclerosis. However, local vascular atherosclerosis related HCMV infection and protein expression remain unclear. This study aimed to assess the relationship between HCMV infection and atherosclerosis. Formalin-fixed, paraffin-embedded peripheral artery specimens were obtained from 15 patients with atherosclerosis undergoing vascular surgery from 2008 to 2010 at Zhongnan Hospital, Wuhan University. Pathological analyses were carried out after hematoxylin and eosin (H&E) and Masson trichrome staining. In situ hybridization and immunohistochemistry with two different monoclonal antibodies were employed to detect HCMV nucleic acids and proteins, respectively. H&E and Masson trichrome staining showed homogeneous extracellular matrix in femoral artery, while smooth muscle fibers were interlaced with collagen fibers; in carotid artery, inflammatory cell infiltration, foam cell vascular change, cholesterol crystals, and layered collagen fibers were observed. In situ hybridization showed no expression of HCMV nucleic acids in all 15 cases. Immunohistochemical staining for protein immediate-early protein (IE1 72) was negative in all cases, while phosphoprotein 65 (pp65) expression was detected in 14 cases. A high rate of positive pp65 signals was found in patients with atherosclerosis, suggesting that local HCMV infection may be associated with the pathogenesis of atherosclerosis. Further studies on this relationship are warranted. PMID:27990427

  2. Transgenic Expression of Dentin Phosphoprotein Inhibits Skeletal Development

    PubMed Central

    Zhang, H.; Liu, P.; Wang, S.; Liu, C.; Jani, P.; Lu, Y.; Qin, C.

    2016-01-01

    Dentin sialophosphoprotein (DSPP) is proteolytically processed into an NH2-terminal fragment called dentin sialoprotein (DSP) and a COOH-terminal fragment known as dentin phosphoprotein (DPP). These two fragments are believed to perform distinct roles in formation of bone and dentin. To investigate the functions of DPP in skeletal development, we generated transgenic mice to overexpress hemagglutinin (HA)-tagged DPP under the control of a 3.6 kb type I collagen (Col1a1) promoter (designated as Col1a1-HA-DPP). The Col1a1-HA-DPP transgenic mice were significantly smaller by weight, had smaller skeletons and shorter long bones than their wild type littermates, as demonstrated by X-ray radiography. They displayed reduced trabecular bone formation and narrower zones of proliferative and hypertrophic chondrocytes in the growth plates of the long bones. Histological analyses showed that the transgenic mice had reduced cell proliferation in the proliferating zone, but lacked obvious defects in the chondrocyte differentiation. In addition, the transgenic mice with a high level of transgene expression developed spontaneous long bone fractures. In conclusion, overexpressing DPP inhibited skeletal development, suggesting that the balanced actions between the NH2- and COOH-terminal fragments of DSPP may be required for normal skeletal development. PMID:26972716

  3. Epitope mapping of Canine distemper virus phosphoprotein by monoclonal antibodies.

    PubMed

    Sugai, Akihiro; Kooriyama, Takanori; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

    2009-12-01

    The gene for phosphoprotein (P) of CDV encodes three different proteins, P, V, and C. The P protein is involved in viral gene transcription and replication. In the present study, we produced MAbs against a unique domain of the CDV-P protein, from aa 232 to 507, and determined their antigenic sites. By immunizing BALB/c mice with the recombinant P protein-specific fragment, we obtained six MAbs. Competitive binding inhibition assays revealed that they recognized two distinct regions of the P protein. Western blot analysis and immunofluorescence assays using deletion mutants of the unique C-terminus of the CDV-P protein revealed that all MAbs recognized a central short region (aa 233-303) of the CDV-P protein. In addition, linear and conformational epitopes have been determined, and at least four antigenic sites exist in the P protein central region. Furthermore, four of the MAbs were found to react with the P protein of recent Japanese field isolates but not with that of the older CDV strains, including a vaccine strain. Thus, these MAbs could be clinically useful for quick diagnosis during the CDV outbreaks.

  4. Spatial Phosphoprotein Profiling Reveals a Compartmentalized Extracellular Signal-regulated Kinase Switch Governing Neurite Growth and Retraction

    SciTech Connect

    Wang, Yingchun; Yang, Feng; Fu, Yi; Huang, Xiahe; Wang, Wei; Jiang, Xining; Gritsenko, Marina A.; Zhao, Rui; Monroe, Matthew E.; Pertz, Olivier C.; Purvine, Samuel O.; Orton, Daniel J.; Jacobs, Jon M.; Camp, David G.; Smith, Richard D.; Klemke, Richard L.

    2011-05-20

    Abstract - Brain development and spinal cord regeneration require neurite sprouting and growth cone navigation in response to extension and collapsing factors present in the extracellular environment. These external guidance cues control neurite growth cone extension and retraction processes through intracellular protein phosphorylation of numerous cytoskeletal, adhesion, and polarity complex signaling proteins. However, the complex kinase/substrate signaling networks that mediate neuritogenesis have not been investigated. Here, we compare the neurite phosphoproteome under growth and retraction conditions using neurite purification methodology combined with mass spectrometry. More than 4000 non-redundant phosphorylation sites from 1883 proteins have been annotated and mapped to signaling pathways that control kinase/phosphatase networks, cytoskeleton remodeling, and axon/dendrite specification. Comprehensive informatics and functional studies revealed a compartmentalized ERK activation/deactivation cytoskeletal switch that governs neurite growth and retraction, respectively. Our findings provide the first system-wide analysis of the phosphoprotein signaling networks that enable neurite growth and retraction and reveal an important molecular switch that governs neuritogenesis.

  5. Estimating the total number of phosphoproteins and phosphorylation sites in eukaryotic proteomes

    PubMed Central

    Vlastaridis, Panayotis; Kyriakidou, Pelagia; Chaliotis, Anargyros; Van de Peer, Yves; Oliver, Stephen G.

    2017-01-01

    Abstract Background: Phosphorylation is the most frequent post-translational modification made to proteins and may regulate protein activity as either a molecular digital switch or a rheostat. Despite the cornucopia of high-throughput (HTP) phosphoproteomic data in the last decade, it remains unclear how many proteins are phosphorylated and how many phosphorylation sites (p-sites) can exist in total within a eukaryotic proteome. We present the first reliable estimates of the total number of phosphoproteins and p-sites for four eukaryotes (human, mouse, Arabidopsis, and yeast). Results: In all, 187 HTP phosphoproteomic datasets were filtered, compiled, and studied along with two low-throughput (LTP) compendia. Estimates of the number of phosphoproteins and p-sites were inferred by two methods: Capture-Recapture, and fitting the saturation curve of cumulative redundant vs. cumulative non-redundant phosphoproteins/p-sites. Estimates were also adjusted for different levels of noise within the individual datasets and other confounding factors. We estimate that in total, 13 000, 11 000, and 3000 phosphoproteins and 230 000, 156 000, and 40 000 p-sites exist in human, mouse, and yeast, respectively, whereas estimates for Arabidopsis were not as reliable. Conclusions: Most of the phosphoproteins have been discovered for human, mouse, and yeast, while the dataset for Arabidopsis is still far from complete. The datasets for p-sites are not as close to saturation as those for phosphoproteins. Integration of the LTP data suggests that current HTP phosphoproteomics appears to be capable of capturing 70 % to 95 % of total phosphoproteins, but only 40 % to 60 % of total p-sites. PMID:28327990

  6. The generation of phosphoserine stretches in phosphoproteins: mechanism and significance.

    PubMed

    Cesaro, Luca; Pinna, Lorenzo A

    2015-10-01

    In the infancy of studies on protein phosphorylation the occurrence of clusters of three or more consecutive phosphoseryl residues in secreted and in cellular phosphoproteins was reported. Later however, while the reversible phosphorylation of Ser, Thr and Tyr residues was recognized to be the most frequent and general mechanism of cell regulation and signal transduction, the phenomenon of multi-phosphorylation of adjacent residues was entirely neglected. Nowadays, in the post-genomic era, the availability of large phosphoproteomics database makes possible a comprehensive re-visitation of this intriguing aspect of protein phosphorylation, aimed at shedding light on both its mechanistic occurrence and its functional meaning. Here we describe an analysis of the human phosphoproteome disclosing the existence of more than 800 rows of 3 to >10 consecutive phosphoamino acids, composed almost exclusively of phosphoserine, while clustered phosphothreonines and phosphotyrosines are almost absent. A scrutiny of these phosphorylated rows supports the conclusion that they are generated through the major contribution of a few hierarchical protein kinases, with special reference to CK2. Also well documented is the combined intervention of CK1 and GSK3, the former acting as priming and primed, the latter as primed kinase. The by far largest proportion of proteins containing (pS)n clusters display a nuclear localization where they play a prominent role in the regulation of transcription. Consistently the molecular function of the by far largest majority of these proteins is the ability to bind other macromolecules and/or nucleotides and metal ions. A "String" analysis performed under stringent conditions reveals that >80% of them are connected to each other by physical and/or functional links, and that this network of interactions mostly take place at the nuclear level.

  7. Unfair competition governs the interaction of pCPI-17 with myosin phosphatase (PP1-MYPT1).

    PubMed

    Filter, Joshua J; Williams, Byron C; Eto, Masumi; Shalloway, David; Goldberg, Michael L

    2017-04-07

    The small phosphoprotein pCPI-17 inhibits myosin light chain phosphatase (MLCP). Current models postulate that during muscle relaxation, phosphatases other than MLCP dephosphorylate and inactivate pCPI-17 to restore MLCP activity. We show here that such hypotheses are insufficient to account for the observed rapidity of pCPI-17 inactivation in mammalian smooth muscles. Instead, MCLP itself is the critical enzyme for pCPI-17 dephosphorylation. We call the mutual sequestration mechanism through which pCPI-17 and MLCP interact inhibition by unfair competition: MLCP protects pCPI-17 from other phosphatases, while pCPI-17 blocks other substrates from MLCP's active site. MLCP dephosphorylates pCPI-17 at a slow rate that is nonetheless both sufficient and necessary to explain the speed of pCPI-17 dephosphorylation and the consequent MLCP activation during muscle relaxation.

  8. Structural Basis for the Catalytic Activity of Human Serine/Threonine Protein Phosphatase-5

    NASA Technical Reports Server (NTRS)

    Swingle, M. R.; Honkanen, R.; Ciszak, E. M.

    2004-01-01

    Serinehhreonine protein phosphatase-5 (PP5) affects many signaling networks that regulate cell growth and cellular responses to stress. Here we report the crystal structure of the PP5 catalytic domain (PP5c) at a resolution of 1.6 A. From this structure we resolved the mechanism for PP5-mediated hydrolysis of phosphoprotein substrates, which requires the precise positioning of two metal ions within a con served Aspn-271-M(sub 1):M(sub 2)-W(sup 1)-His-427-His-304-Asp-274 catalytic motif. The structure of PPSc provides a structural basis for explaining the exceptional catalytic proficiency of protein phosphatases, which are among the most powerful known catalysts. Resolution of the entire C-terminus revealed a novel subdomain, and the structure of the PP5c should also aid development of type-specific inhibitors.

  9. Structural Basis for the Catalytic Activity of Human Serine/Threonine Protein Phosphatase-5

    NASA Technical Reports Server (NTRS)

    Swingle, M. R.; Honkanen, R.; Ciszak, E. M.

    2004-01-01

    Serinehhreonine protein phosphatase-5 (PP5) affects many signaling networks that regulate cell growth and cellular responses to stress. Here we report the crystal structure of the PP5 catalytic domain (PP5c) at a resolution of 1.6 A. From this structure we resolved the mechanism for PP5-mediated hydrolysis of phosphoprotein substrates, which requires the precise positioning of two metal ions within a con served Aspn-271-M(sub 1):M(sub 2)-W(sup 1)-His-427-His-304-Asp-274 catalytic motif. The structure of PPSc provides a structural basis for explaining the exceptional catalytic proficiency of protein phosphatases, which are among the most powerful known catalysts. Resolution of the entire C-terminus revealed a novel subdomain, and the structure of the PP5c should also aid development of type-specific inhibitors.

  10. Broad-Scale Phosphoprotein Profiling of Beta Adrenergic Receptor (β-AR) Signaling Reveals Novel Phosphorylation and Dephosphorylation Events

    PubMed Central

    Chruscinski, Andrzej J.; Singh, Harvir; Chan, Steven M.; Utz, Paul J.

    2013-01-01

    β-adrenergic receptors (β-ARs) are model G-protein coupled receptors that mediate signal transduction in the sympathetic nervous system. Despite the widespread clinical use of agents that target β-ARs, the signaling pathways that operate downstream of β-AR stimulation have not yet been completely elucidated. Here, we utilized a lysate microarray approach to obtain a broad-scale perspective of phosphoprotein signaling downstream of β-AR. We monitored the time course of phosphorylation states of 54 proteins after β-AR activation mouse embryonic fibroblast (MEF) cells. In response to stimulation with the non-selective β-AR agonist isoproterenol, we observed previously described phosphorylation events such as ERK1/2(T202/Y204) and CREB(S133), but also novel phosphorylation events such as Cdc2(Y15) and Pyk2(Y402). All of these events were mediated through cAMP and PKA as they were reproduced by stimulation with the adenylyl cyclase activator forskolin and were blocked by treatment with H89, a PKA inhibitor. In addition, we also observed a number of novel isoproterenol-induced protein dephosphorylation events in target substrates of the PI3K/AKT pathway: GSK3β(S9), 4E-BP1(S65), and p70s6k(T389). These dephosphorylations were dependent on cAMP, but were independent of PKA and correlated with reduced PI3K/AKT activity. Isoproterenol stimulation also led to a cAMP-dependent dephosphorylation of PP1α(T320), a modification known to correlate with enhanced activity of this phosphatase. Dephosphorylation of PP1α coincided with the secondary decline in phosphorylation of some PKA-phosphorylated substrates, suggesting that PP1α may act in a feedback loop to return these phosphorylations to baseline. In summary, lysate microarrays are a powerful tool to profile phosphoprotein signaling and have provided a broad-scale perspective of how β-AR signaling can regulate key pathways involved in cell growth and metabolism. PMID:24340001

  11. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions.

    PubMed

    Güzel, Yüksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Günther K

    2012-05-01

    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt.

  12. Phosphoprotein Stability in Clinical Tissue and Its Relevance for Reverse Phase Protein Microarray Technology

    PubMed Central

    Espina, Virginia; Mueller, Claudius; Liotta, Lance A.

    2013-01-01

    Phosphorylated proteins reflect the activity of specific cell signaling nodes in biological kinase protein networks. Cell signaling pathways can be either activated or deactivated depending on the phosphorylation state of the constituent proteins. The state of these kinase pathways reflects the in vivo activity of the cells and tissue at any given point in time. As such, cell signaling pathway information can be extrapolated to infer which phosphorylated proteins/pathways are driving an individual tumor’s growth. Reverse Phase Protein Microarrays (RPMA) are a sensitive and precise platform that can be applied to the quantitative measurement of hundreds of phosphorylated signal proteins from a small sample of tissue. Pre-analytical variability originating from tissue procurement and preservation may cause significant variability and bias in downstream molecular analysis. Depending on the ex vivo delay time in tissue processing, and the manner of tissue handling, protein biomarkers such as signal pathway phosphoproteins will be elevated or suppressed in a manner that does not represent the biomarker levels at the time of excision. Consequently, assessment of the state of these kinase networks requires stabilization, or preservation, of the phosphoproteins immediately post tissue procurement. We have employed reverse phase protein microarray analysis of phosphoproteins to study the factors influencing stability of phosphoproteins in tissue following procurement. Based on this analysis we have established tissue procurement guidelines for clinical research with an emphasis on quantifying phosphoproteins by RPMA. PMID:21901591

  13. Phosphatidyl glycerophosphate phosphatase.

    PubMed

    Chang, Y Y; Kennedy, E P

    1967-09-01

    An enzyme (phosphatidyl glycerophosphate phosphatase) that catalyzes the formation of phosphatidyl glycerol from phosphatidyl glycerophosphate has been rendered soluble by treatment of the particulate fraction of E. coli with Triton X-100 in the presence of EDTA, and has been partially purified. The enzyme is specific for phosphatidyl glycerophosphate and does not catalyze the hydrolysis of other simple phosphomonoesters. It requires Mg(++) for activity and is inhibited by sulfhydryl agents. Some other properties of the enzyme are also described.

  14. Improved staining of phosphoproteins with high sensitivity in polyacrylamide gels using Stains-All.

    PubMed

    Cong, Wei-Tao; Ye, Wei-Jian; Chen, Mao; Zhao, Ting; Zhu, Zhong-Xin; Niu, Chao; Ruan, Dan-Dan; Ni, Mao-Wei; Zhou, Xuan; Jin, Li-Tai

    2013-12-01

    An improved Stains-All (ISA) staining method for phosphoproteins in SDS-PAGE was described. Down to 0.5-1 ng phosphoproteins (α-casein, β-casein, or phosvitin) can be successfully selectively detected by ISA stain, which is approximately 120-fold higher than that of original Stains-All stain, but is similar to that of commonly used Pro-Q Diamond stain. Furthermore, unlike the original Stains-All protocol that was time consuming and light unstable, ISA stain could be completed within 60 min without resorting to protect the gels from light during the whole staining procedure. According to the results, it is concluded that ISA stain is a rapid, sensitive, specific, and economic staining method for a broad application to the research of phosphoproteins.

  15. Molecular evolution of dentin phosphoprotein among toothed and toothless animals

    PubMed Central

    2009-01-01

    Background Dentin sialophosphoprotein (DSPP) is the largest member of the SIBLING family and is the most abundant noncollagenous protein in dentin. DSPP is also expressed in non-mineralized tissues including metabolically active ductal epithelia and some cancers. Its function, however, is poorly defined. The carboxy-terminal fragment, dentin phosphoprotein (DPP) is encoded predominantly by a large repetitive domain that requires separate cloning/sequencing reactions and is, therefore, often incomplete in genomic databases. Comparison of DPP sequences from at least one member of each major branch in the mammalian evolutionary tree (including some "toothless" mammals) as well as one reptile and bird may help delineate its possible functions in both dentin and ductal epithelia. Results The BMP1-cleavage and translation-termination domains were sufficiently conserved to permit amplification/cloning/sequencing of most species' DPP. While the integrin-binding domain, RGD, was present in about half of species, only vestigial remnants of this tripeptide were identified in the others. The number of tandem repeats of the nominal SerSerAsp phosphorylation motif in toothed mammals (including baleen whale and platypus which lack teeth as adults), ranged from ~75 (elephant) to >230 (human). These repeats were not perfect, however, and patterns of intervening sequences highlight the rapidity of changes among even closely related species. Two toothless anteater species have evolved different sets of nonsense mutations shortly after their BMP1 motifs suggesting that while cleavage may be important for DSPP processing in other tissues, the DPP domain itself may be required only in dentin. The lizard DSPP had an intact BMP1 site, a remnant RGD motif, as well as a distinctly different Ser/Asp-rich domain compared to mammals. Conclusions The DPP domain of DSPP was found to change dramatically within mammals and was lost in two truly toothless animals. The defining aspect of DPP, the

  16. The dopamine and cAMP regulated phosphoprotein, 32 kDa (DARPP-32) signaling pathway: a novel therapeutic target in traumatic brain injury.

    PubMed

    Bales, James W; Yan, Hong Q; Ma, Xiecheng; Li, Youming; Samarasinghe, Ranmal; Dixon, C Edward

    2011-06-01

    Traumatic brain injury (TBI) causes persistent neurologic deficits. Current therapies, predominantly focused upon cortical and hippocampal cellular survival, have limited benefit on cognitive outcomes. Striatal damage is associated with deficits in executive function, learning, and memory. Dopamine and cAMP regulated phosphoprotein 32 (DARPP-32) is expressed within striatal medium spiny neurons and regulates striatal function. We found that controlled cortical impact injury in rats produces a chronic decrease in DARPP-32 phosphorylation at threonine-34 and an increase in protein phosphatase-1 activity. There is no effect of injury on threonine-75 phosphorylation or on DARPP-32 protein. Amantadine, shown to be efficacious in treating post-TBI cognitive deficits, given daily for two weeks is able to restore the loss of DARPP-32 phosphorylation and reduce protein phosphatase-1 activity. Amantadine also decreases the phosphorylation of threonine-75 consistent with activity as a partial N-methyl-D-aspartate (NMDA) receptor antagonist and partial dopamine agonist. These data demonstrate that targeting the DARPP-32 signaling cascade represents a promising novel therapeutic approach in the treatment of persistent deficits following a TBI.

  17. Prognostic significance of peroxiredoxin 1 and ezrin-radixin-moesin-binding phosphoprotein 50 in cholangiocarcinoma.

    PubMed

    Yonglitthipagon, Ponlapat; Pairojkul, Chawalit; Chamgramol, Yaovalux; Loukas, Alex; Mulvenna, Jason; Bethony, Jeffrey; Bhudhisawasdi, Vajarabhongsa; Sripa, Banchob

    2012-10-01

    We performed a comparative proteomic analysis of protein expression profiles in 4 cholangiocarcinoma cell lines: K100, M156, M213, and M139. The H69 biliary cell line was used as a control. Peroxiredoxin 1 and ezrin-radixin-moesin-binding phosphoprotein 50 were selected for further validation by immunohistochemistry using a cholangiocarcinoma tissue microarray (n = 301) to assess their prognostic value in this cancer. Both peroxiredoxin 1 and ezrin-radixin-moesin-binding phosphoprotein 50 were overexpressed in cholangiocarcinoma tissues compared with normal liver tissues. Of the 301 cholangiocarcinoma cases, overexpression of peroxiredoxin 1 in 103 (34.3%) was associated with an age-related effect in young patients (P = .011) and the absence of cholangiocarcinoma in lymphatic vessels and perineural tissues (P = .004 and P = .037, respectively). Expression of radixin-moesin-binding phosphoprotein 50 correlated with histopathologic type, with 180 (59.8%) of moderately or poorly differentiated tumors (P = .039) being higher, and was associated with the presence of cholangiocarcinoma in lymphatic and vascular vessels (P < .001 and P < .001, respectively). The high expression of radixin-moesin-binding phosphoprotein 50 and the low expression of peroxiredoxin 1 correlated with reduced survival by univariate analysis (P = .017 and P = .048, respectively). Moreover, the impact of peroxiredoxin 1 and radixin-moesin-binding phosphoprotein 50 expression on patient survival was an independent predictor in multivariate analyses (P = .004 and P = .025, respectively). Therefore, altered expression of peroxiredoxin 1 and radixin-moesin-binding phosphoprotein 50 may be used as prognostic markers in cholangiocarcinoma.

  18. PAPE (Prefractionation-Assisted Phosphoprotein Enrichment): A Novel Approach for Phosphoproteomic Analysis of Green Tissues from Plants

    PubMed Central

    Lassowskat, Ines; Naumann, Kai; Lee, Justin; Scheel, Dierk

    2013-01-01

    Phosphorylation is an important post-translational protein modification with regulatory roles in diverse cellular signaling pathways. Despite recent advances in mass spectrometry, the detection of phosphoproteins involved in signaling is still challenging, as protein phosphorylation is typically transient and/or occurs at low levels. In green plant tissues, the presence of highly abundant proteins, such as the subunits of the RuBisCO complex, further complicates phosphoprotein analysis. Here, we describe a simple, but powerful, method, which we named prefractionation-assisted phosphoprotein enrichment (PAPE), to increase the yield of phosphoproteins from Arabidopsis thaliana leaf material. The first step, a prefractionation via ammonium sulfate precipitation, not only depleted RuBisCO almost completely, but, serendipitously, also served as an efficient phosphoprotein enrichment step. When coupled with a subsequent metal oxide affinity chromatography (MOAC) step, the phosphoprotein content was highly enriched. The reproducibility and efficiency of phosphoprotein enrichment was verified by phospho-specific staining and, further, by mass spectrometry, where it could be shown that the final PAPE fraction contained a significant number of known and additionally novel (potential) phosphoproteins. Hence, this facile two-step procedure is a good prerequisite to probe the phosphoproteome and gain deeper insight into plant phosphorylation-based signaling events. PMID:28250405

  19. Dephosphorylation of Ser-137 in DARPP-32 by protein phosphatases 2A and 2C: different roles in vitro and in striatonigral neurons.

    PubMed Central

    Desdouits, F; Siciliano, J C; Nairn, A C; Greengard, P; Girault, J A

    1998-01-01

    DARPP-32 (dopamine- and cAMP-regulated phosphoprotein, Mr=32000) is highly expressed in striatonigral neurons in which its phosphorylation is regulated by several neurotransmitters including dopamine and glutamate. DARPP-32 becomes a potent inhibitor of protein phosphatase 1 when it is phosphorylated on Thr-34 by cAMP- or cGMP-dependent protein kinases. DARPP-32 is also phosphorylated on Ser-137 by protein kinase CK1 (CK1), in vitro and in vivo. This phosphorylation has an important regulatory role since it inhibits the dephosphorylation of Thr-34 by calcineurin in vitro and in striatonigral neurons. Here, we show that DARPP-32 phosphorylated by CK1 is a substrate in vitro for protein phosphatases 2A and 2C, but not protein phosphatase 1 or calcineurin. However, in substantia nigra slices, dephosphorylation of Ser-137 was markedly sensitive to decreased temperature, and not detectably affected by the presence of okadaic acid under conditions in which dephosphorylation of Thr-34 by protein phosphatase 2A was inhibited. These results suggest that, in neurons, phospho-Ser-137-DARPP-32 is dephosphorylated by protein phosphatase 2C, but not 2A. Thus, DARPP-32 appears to be a component of a regulatory cascade of phosphatases in which dephosphorylation of Ser-136 by protein phosphatase 2C facilitates dephosphorylation of Thr-34 by calcineurin, removing the cyclic nucleotide-induced inhibition of protein phosphatase 1. PMID:9461512

  20. Dephosphorylation of Ser-137 in DARPP-32 by protein phosphatases 2A and 2C: different roles in vitro and in striatonigral neurons.

    PubMed

    Desdouits, F; Siciliano, J C; Nairn, A C; Greengard, P; Girault, J A

    1998-02-15

    DARPP-32 (dopamine- and cAMP-regulated phosphoprotein, Mr=32000) is highly expressed in striatonigral neurons in which its phosphorylation is regulated by several neurotransmitters including dopamine and glutamate. DARPP-32 becomes a potent inhibitor of protein phosphatase 1 when it is phosphorylated on Thr-34 by cAMP- or cGMP-dependent protein kinases. DARPP-32 is also phosphorylated on Ser-137 by protein kinase CK1 (CK1), in vitro and in vivo. This phosphorylation has an important regulatory role since it inhibits the dephosphorylation of Thr-34 by calcineurin in vitro and in striatonigral neurons. Here, we show that DARPP-32 phosphorylated by CK1 is a substrate in vitro for protein phosphatases 2A and 2C, but not protein phosphatase 1 or calcineurin. However, in substantia nigra slices, dephosphorylation of Ser-137 was markedly sensitive to decreased temperature, and not detectably affected by the presence of okadaic acid under conditions in which dephosphorylation of Thr-34 by protein phosphatase 2A was inhibited. These results suggest that, in neurons, phospho-Ser-137-DARPP-32 is dephosphorylated by protein phosphatase 2C, but not 2A. Thus, DARPP-32 appears to be a component of a regulatory cascade of phosphatases in which dephosphorylation of Ser-136 by protein phosphatase 2C facilitates dephosphorylation of Thr-34 by calcineurin, removing the cyclic nucleotide-induced inhibition of protein phosphatase 1.

  1. Mechanistic insights into phosphoprotein-binding FHA domains.

    PubMed

    Liang, Xiangyang; Van Doren, Steven R

    2008-08-01

    of FHA domains by a bioinformatics approach. The phosphopeptide-dependent dynamics of an FHA domain, SH2 domain, and PTB domain suggest a common theme: rigid, preformed binding surfaces support van der Waals contacts that provide favorable binding enthalpy. Despite the lack of pronounced conformational changes in FHA domains linked to binding events, more subtle adjustments may be possible. In the one FHA domain tested, phosphothreonine peptide binding is accompanied by increased flexibility just outside the binding site and increased rigidity across the beta-sandwich. The folding of the same FHA domain progresses through near-native intermediates that stabilize the recognition loops in the center of the phosphoprotein-binding surface; this may promote rigidity in the interface and affinity for targets phosphorylated on threonine.

  2. Proteomic analysis of protein phosphatase Z1 from Candida albicans.

    PubMed

    Márkus, Bernadett; Szabó, Krisztina; Pfliegler, Walter P; Petrényi, Katalin; Boros, Enikő; Pócsi, István; Tőzsér, József; Csősz, Éva; Dombrádi, Viktor

    2017-01-01

    Protein phosphatase Z is a "novel type" fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon) software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0) that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly suggested a role for Ca

  3. Phosphoproteomic analysis reveals interconnected system-wide responses to perturbations of kinases and phosphatases in yeast.

    PubMed

    Bodenmiller, Bernd; Wanka, Stefanie; Kraft, Claudine; Urban, Jörg; Campbell, David; Pedrioli, Patrick G; Gerrits, Bertran; Picotti, Paola; Lam, Henry; Vitek, Olga; Brusniak, Mi-Youn; Roschitzki, Bernd; Zhang, Chao; Shokat, Kevan M; Schlapbach, Ralph; Colman-Lerner, Alejandro; Nolan, Garry P; Nesvizhskii, Alexey I; Peter, Matthias; Loewith, Robbie; von Mering, Christian; Aebersold, Ruedi

    2010-12-21

    The phosphorylation and dephosphorylation of proteins by kinases and phosphatases constitute an essential regulatory network in eukaryotic cells. This network supports the flow of information from sensors through signaling systems to effector molecules and ultimately drives the phenotype and function of cells, tissues, and organisms. Dysregulation of this process has severe consequences and is one of the main factors in the emergence and progression of diseases, including cancer. Thus, major efforts have been invested in developing specific inhibitors that modulate the activity of individual kinases or phosphatases; however, it has been difficult to assess how such pharmacological interventions would affect the cellular signaling network as a whole. Here, we used label-free, quantitative phosphoproteomics in a systematically perturbed model organism (Saccharomyces cerevisiae) to determine the relationships between 97 kinases, 27 phosphatases, and more than 1000 phosphoproteins. We identified 8814 regulated phosphorylation events, describing the first system-wide protein phosphorylation network in vivo. Our results show that, at steady state, inactivation of most kinases and phosphatases affected large parts of the phosphorylation-modulated signal transduction machinery-and not only the immediate downstream targets. The observed cellular growth phenotype was often well maintained despite the perturbations, arguing for considerable robustness in the system. Our results serve to constrain future models of cellular signaling and reinforce the idea that simple linear representations of signaling pathways might be insufficient for drug development and for describing organismal homeostasis.

  4. Isolation and Characterization of an Alkaline Phosphatase from Pea Thylakoids 1

    PubMed Central

    Kieleczawa, Jan; Coughlan, Sean J.; Hind, Geoffrey

    1992-01-01

    Endogenous dephosphorylation of the light-harvesting chlorophyll-protein complex of photosystem II in pea (Pisum sativum, L. cv Progress 9) thylakoids drives the state 2 to state 1 transition; the responsible enzyme is a thylakoid-bound, fluoride-sensitive phosphatase with a pH optimum of 8.0 (Bennett J [1980] Eur J Biochem 104: 85-89). An enzyme with these characteristics was isolated from well-washed thylakoids. Its molecular mass was estimated at 51.5 kD, and this monomer was catalytically active, although the activity was labile. The active site could be labeled with orthophosphate at pH 5.0. High levels of alkaline phosphatase activity were obtained with the assay substrate, 4-methylumbelliferyl phosphate (350 micromoles per minute per milligram purified enzyme). The isolated enzyme functioned as a phosphoprotein phosphatase toward phosphorylated histone III-S and phosphorylated, photosystem II-enriched particles from pea, with typical activities in the range of 200 to 600 picomoles per minute per milligram enzyme. These activities all had a pH optimum of 8.0 and were fluoride sensitive. The enzyme required magnesium ion for maximal activity but was not dependent on this ion. Evidence supporting a putative function for this phosphatase in dephosphorylation of thylakoid proteins came from the inhibition of this process by a polyclonal antibody preparation raised against the partially purified enzyme. ImagesFigure 2Figure 3 PMID:16668967

  5. A 63 kDa phosphoprotein undergoing rapid dephosphorylation during exocytosis in Paramecium cells shares biochemical characteristics with phosphoglucomutase.

    PubMed

    Treptau, T; Kissmehl, R; Wissmann, J D; Plattner, H

    1995-07-15

    We have enriched phosphoglucomutase (PGM; EC 5.4.2.2) approximately 20-fold from Paramecium tetraurelia cells by combined fractional precipitation with (NH4)2SO4, gel filtration and anion-exchange chromatography yielding two PGM peaks. Several parameters affecting PGM enzymic activity, molecular mass and pI were determined. Phosphorylation studies were done with isolated endogenous protein kinases. Like the 63 kDa phosphoprotein PP63, which is dephosphorylated within 80 ms during synchronous trichocyst exocytosis [Höhne-Zell, Knoll, Riedel-Gras, Hofer and Plattner (1992) Biochem. J. 286, 843-849], PGM has a molecular mass of 63 kDa and forms of identical pI. Since mammalian PGM activity depends on the presence of glucose 1,6-bisphosphate (Glc-1,6-P2) (which is lost during anion-exchange chromatography), we analysed this aspect with Paramecium PGM. In this case PGM activity was shown not to be lost, due to p-nitrophenyl phosphate-detectable phosphatase(s) (which we have separated from PGM), but also due to loss of Glc-1,6-P2. Like PGM from various vertebrate species, PGM activity from Paramecium can be fully re-established by addition of Glc-1,6-P2 at 10 nM, and it is also stimulated by bivalent cations and insensitive to chelating or thiol reagents. The PGM which we have isolated can be phosphorylated by endogenous cyclic-GMP-dependent protein kinase or by endogenous casein kinase. This results in three phosphorylated bands of identical molecular mass and pI values, as we have shown to occur with PP63 after phosphorylation in vivo (forms with pI 6.05, 5.95, 5.85). In ELISA, antibodies raised against PGM from rabbit skeletal muscle were reactive not only with original PGM but also with PGM fractions from Paramecium. Therefore, PGM and PP63 seem to be identical with regard to widely different parameters, i.e. co-elution by chromatography, molecular mass, phosphorylation by the two protein kinases tested, pI values of isoforms, and immuno-binding. Recent claims that

  6. A 63 kDa phosphoprotein undergoing rapid dephosphorylation during exocytosis in Paramecium cells shares biochemical characteristics with phosphoglucomutase.

    PubMed Central

    Treptau, T; Kissmehl, R; Wissmann, J D; Plattner, H

    1995-01-01

    We have enriched phosphoglucomutase (PGM; EC 5.4.2.2) approximately 20-fold from Paramecium tetraurelia cells by combined fractional precipitation with (NH4)2SO4, gel filtration and anion-exchange chromatography yielding two PGM peaks. Several parameters affecting PGM enzymic activity, molecular mass and pI were determined. Phosphorylation studies were done with isolated endogenous protein kinases. Like the 63 kDa phosphoprotein PP63, which is dephosphorylated within 80 ms during synchronous trichocyst exocytosis [Höhne-Zell, Knoll, Riedel-Gras, Hofer and Plattner (1992) Biochem. J. 286, 843-849], PGM has a molecular mass of 63 kDa and forms of identical pI. Since mammalian PGM activity depends on the presence of glucose 1,6-bisphosphate (Glc-1,6-P2) (which is lost during anion-exchange chromatography), we analysed this aspect with Paramecium PGM. In this case PGM activity was shown not to be lost, due to p-nitrophenyl phosphate-detectable phosphatase(s) (which we have separated from PGM), but also due to loss of Glc-1,6-P2. Like PGM from various vertebrate species, PGM activity from Paramecium can be fully re-established by addition of Glc-1,6-P2 at 10 nM, and it is also stimulated by bivalent cations and insensitive to chelating or thiol reagents. The PGM which we have isolated can be phosphorylated by endogenous cyclic-GMP-dependent protein kinase or by endogenous casein kinase. This results in three phosphorylated bands of identical molecular mass and pI values, as we have shown to occur with PP63 after phosphorylation in vivo (forms with pI 6.05, 5.95, 5.85). In ELISA, antibodies raised against PGM from rabbit skeletal muscle were reactive not only with original PGM but also with PGM fractions from Paramecium. Therefore, PGM and PP63 seem to be identical with regard to widely different parameters, i.e. co-elution by chromatography, molecular mass, phosphorylation by the two protein kinases tested, pI values of isoforms, and immuno-binding. Recent claims that

  7. [Alkaline phosphatase in Amoeba proteus].

    PubMed

    Sopina, V A

    2005-01-01

    In free-living Amoeba proteus (strain B), 3 phosphatase were found after disc-electrophoresis of 10 microg of protein in PAGE and using 1-naphthyl phosphate as a substrate a pH 9.0. These phosphatases differed in their electrophoretic mobilities - "slow" (1-3 bands), "middle" (one band) and "fast" (one band). In addition to 1-naphthyl phosphate, "slow" phosphatases were able to hydrolyse 2-naphthyl phosphate and p-nitrophenyl phosphate. They were slightly activated by Mg2+, completely inhibited by 3 chelators (EDTA, EGTA and 1,10-phenanthroline), L-cysteine, sodium dodecyl sulfate and Fe2+, Zn2+ and Mn2+ (50 mM), considerably inactivated by orthovanadate, molybdate, phosphatase inhibitor cocktail 1, p-nitrophenyl phosphate, Na2HPO4, DL-dithiothreitol and urea and partly inhibited by H2O2, DL-phenylalanine, 2-mercaptoethanol, phosphatase inhibitor cocktail 2 and Ca2+. Imidazole, L-(+)-tartrate, okadaic acid, NaF and sulfhydryl reagents -p-(hydroxy-mercuri)benzoate and N-ethylmaleimide - had no influence on the activity of "slow" phosphatases. "Middle" and "fast" phosphatases, in contrast to "slow" ones, were not inactivated by 3 chelators. The "middle" phosphatase differed from the "fast" one by smaller resistance to urea, Ca2+, Mn2+, phosphates and H2O2 and greater resistance to dithiothreitol and L-(+)-tartrate. In addition, the "fast" phosphatase was inhibited by L-cysteine but the "middle" one was activated by it. Of 5 tested ions (Mg2+, Cu2+, Mn2+, Ca2+ and Zn2+), only Zn2+ reactivated "slow" phosphatases after their inactivation by EDTA treatment. The reactivation of apoenzyme was only partial (about 35 %). Thus, among phosphatases found in amoebae at pH 9.0, only "slow" ones are Zn-metalloenzymes and may be considered as alkaline phosphatases (EC 3.1.3.1). It still remains uncertain, to which particular phosphatase class "middle" and "fast" phosphatases (pH 9.0) may belong.

  8. Probing Mechanistic Similarities Between Response Regulator Signaling Proteins and HAD Phosphatases

    PubMed Central

    Immormino, Robert M.; Starbird, Chrystal; Silversmith, Ruth E.; Bourret, Robert B.

    2015-01-01

    Response regulator signaling proteins and phosphatases of the haloacid dehalogenase (HAD) superfamily share strikingly similar folds, active site geometries, and reaction chemistry. Proteins from both families catalyze the transfer of a phosphoryl group from a substrate to one of their own aspartyl residues, and subsequent hydrolysis of the phosphoprotein. Notable differences include an additional Asp that functions as an acid/base catalyst and an active site well-structured prior to phosphorylation in HAD phosphatases. Both features contribute to substantially faster reactions than for response regulators. To investigate mechanisms underlying the functional differences between response regulators and HAD phosphatases, we characterized five double mutants of the response regulator CheY designed to mimic HAD phosphatases. Each mutant contained the extra Asp paired with a phosphatase-inspired substitution to potentially position the Asp properly. Only CheY DR (Arg as anchor) exhibited enhanced rates of both autophosphorylation with phosphoramidate and autodephosphorylation compared to wild type CheY. Crystal structures of CheY DR complexed with MoO42− or WO42− revealed active site hydrogen-bonding networks similar to those in HAD·substrate complexes, with the extra Asp positioned for direct interaction with a leaving group (phosphorylation) or nucleophile (dephosphorylation). However, CheY DR reaction kinetics did not exhibit the pH sensitivities expected for acid/base catalysis. Biochemical analysis indicated CheY DR had an enhanced propensity to adopt the active conformation without phosphorylation, but a crystal structure revealed unphosphorylated CheY DR was not locked in the active conformation. Thus, the enhanced reactivity of CheY DR reflected partial acquisition of catalytic and structural features of HAD phosphatases. PMID:25928369

  9. Comparative studies of rat recombinant purple acid phosphatase and bone tartrate-resistant acid phosphatase.

    PubMed

    Ek-Rylander, B; Barkhem, T; Ljusberg, J; Ohman, L; Andersson, K K; Andersson, G

    1997-01-15

    The tartrate-resistant acid phosphatase (TRAP) of rat osteoclasts has been shown to exhibit high (85-94%) identity at the amino acid sequence level with the purple acid phosphatase (PAP) from bovine spleen and with pig uteroferrin. These iron-containing purple enzymes contain a binuclear iron centre, with a tyrosinate-to-Fe(III) charge-transfer transition responsible for the purple colour. In the present study, production of rat osteoclast TRAP could be achieved at a level of 4.3 mg/litre of medium using a baculovirus expression system. The enzyme was purified to apparent homogeneity using a combination of cation-exchange, hydrophobic-interaction, lectin-affinity and gel-permeation chromatography steps. The protein as isolated had a purple colour, a specific activity of 428 units/mg of protein and consisted of the single-chain form of molecular mass 34 kDa, with only trace amounts of proteolytically derived subunits. The recombinant enzyme had the ability to dephosphorylate bone matrix phosphoproteins, as previously shown for bone TRAP. Light absorption spectroscopy of the isolated purple enzyme showed a lambda max at 544 nm, which upon reduction with ascorbic acid changed to 515 nm, concomitant with the transition to a pink colour. EPR spectroscopic analysis of the reduced enzyme at 3.6 K revealed a typical mu-hydr(oxo)-bridged mixed-valent Fe(II)Fe(III) signal with g-values at 1.96, 1.74 and 1.60, proving that recombinant rat TRAP belongs to the family of PAPs. To validate the use of recombinant PAP in substituting for the rat bone counterpart in functional studies, various comparative studies were carried out. The enzyme isolated from bone exhibited a lower K(m) for p-nitrophenyl phosphate and was slightly more sensitive to PAP inhibitors such as molybdate, tungstate, arsenate and phosphate. In contrast with the recombinant enzyme, TRAP from bone was isolated predominantly as the proteolytically cleaved, two-subunit, form. Both the recombinant enzyme and rat

  10. ARPP-21, a cyclic AMP-regulated phosphoprotein enriched in dopamine-innervated brain regions. I. Purification and characterization of the protein from bovine caudate nucleus.

    PubMed

    Hemmings, H C; Greengard, P

    1989-03-01

    ARPP-21 (cAMP-regulated phosphoprotein, Mr = 21,000 as determined by SDS/PAGE) is a major cytosolic substrate for cAMP-stimulated protein phosphorylation in dopamine-innervated regions of rat CNS (Walaas et al., 1983c). This acidic phosphoprotein has now been identified in bovine caudate nucleus cytosol and purified to homogeneity from this source. The purification procedure involved diethylaminoethyl-cellulose chromatography, ammonium sulfate fractionation, phenyl-Sepharose CL-4B chromatography, and fast protein liquid chromatography using Mono Q anion-exchange resin. Two isoforms of ARPP-21 (ARPP-21A and ARPP-21B) were obtained, which were present in approximately equal amounts in the starting material. ARPP-21A was purified 2610-fold with a final yield of 20% and ARPP-21B was purified 2940-fold with a final yield of 21%. The purified preparations of both isoforms were judged to be homogenous by SDS/PAGE. ARPP-21A and ARPP-21B yielded identical 2-dimensional thin-layer tryptic phosphopeptide maps, identical amino acid compositions and closely related, but distinct, reverse-phase high-pressure liquid chromatograms of tryptic digests. The amino acid composition of ARPP-21 showed a high content of glutamic acid/glutamine, and no methionine, tryptophan, tyrosine, phenylalanine, or histidine. ARPP-21 was stable to heat denaturation and to 50% (vol/vol) ethanol treatment and was partially soluble at pH 2. The Mr determined for ARPP-21 by SDS/PAGE was 21,000. The Stokes radius of ARPP-21 was 26.3 A, and the sedimentation coefficient of ARPP-21 was 1.3 S; these values yield a calculated molecular mass of 13,700 Da and a frictional ratio of 1.7, indicative of an elongated tertiary structure. ARPP-21 was an excellent substrate for cAMP-dependent protein kinase and was either not phosphorylated or only poorly phosphorylated by cGMP-dependent protein kinase, calcium/calmodulin-dependent protein kinase I, calcium/calmodulin-dependent protein kinase II, casein kinase II, or

  11. Soybean root nodule acid phosphatase.

    PubMed Central

    Penheiter, A R; Duff, S M; Sarath, G

    1997-01-01

    Acid phosphatases are ubiquitous enzymes that exhibit activity against a variety of substrates in vitro, although little is known about their intracellular function. In this study, we report the isolation, characterization, and partial sequence of the major acid phosphatase from soybean (Glycine max L.) root nodules. The phosphatase was purified predominantly as a heterodimer with subunits of 28 and 31 kD; homodimers of both subunits were also observed and exhibited phosphatase activity. In addition to the general phosphatase substrate, p-nitrophenyl phosphate, the heterodimeric form of the enzyme readily hydrolyzed 5'-nucleotides, flavin mononucleotide, and O-phospho-L-Tyr. Low or negligible activity was observed with ATP or polyphosphate. Purified nodule acid phosphatase was stimulated by magnesium, inhibited by calcium and EDTA, and competitively inhibited by cGMP and cAMP with apparent Ki values of 7 and 12 microM, respectively. Partial N-terminal and internal sequencing of the nodule acid phosphatase revealed homology to the soybean vegetative storage proteins. There was a 17-fold increase in enzyme activity and a noticeable increase in protein levels detected by immunoblotting methods during nodule development. Both of these parameters were low in young nodules and reached a peak in mature, functional nodules, suggesting that this enzyme is important for efficient nodule metabolism. PMID:9193092

  12. Bacterial-like PPP protein phosphatases: novel sequence alterations in pathogenic eukaryotes and peculiar features of bacterial sequence similarity.

    PubMed

    Kerk, David; Uhrig, R Glen; Moorhead, Greg B

    2013-01-01

    Reversible phosphorylation is a widespread modification affecting the great majority of eukaryotic cellular proteins, and whose effects influence nearly every cellular function. Protein phosphatases are increasingly recognized as exquisitely regulated contributors to these changes. The PPP (phosphoprotein phosphatase) family comprises enzymes, which catalyze dephosphorylation at serine and threonine residues. Nearly a decade ago, "bacterial-like" enzymes were recognized with similarity to proteins from various bacterial sources: SLPs (Shewanella-like phosphatases), RLPHs (Rhizobiales-like phosphatases), and ALPHs (ApaH-like phosphatases). A recent article from our laboratory appearing in Plant Physiology characterizes their extensive organismal distribution, abundance in plant species, predicted subcellular localization, motif organization, and sequence evolution. One salient observation is the distinct evolutionary trajectory followed by SLP genes and proteins in photosynthetic eukaryotes vs. animal and plant pathogens derived from photosynthetic ancestors. We present here a closer look at sequence data that emphasizes the distinctiveness of pathogen SLP proteins and that suggests that they might represent novel drug targets. A second observation in our original report was the high degree of similarity between the bacterial-like PPPs of eukaryotes and closely related proteins of the "eukaryotic-like" phyla Myxococcales and Planctomycetes. We here reflect on the possible implications of these observations and their importance for future research.

  13. Psy2 Targets the PP4 Family Phosphatase Pph3 To Dephosphorylate Mth1 and Repress Glucose Transporter Gene Expression

    PubMed Central

    Ma, Hui; Han, Bong-Kwan; Guaderrama, Marisela; Aslanian, Aaron; Yates, John R.; Hunter, Tony

    2014-01-01

    The reversible nature of protein phosphorylation dictates that any protein kinase activity must be counteracted by protein phosphatase activity. How phosphatases target specific phosphoprotein substrates and reverse the action of kinases, however, is poorly understood in a biological context. We address this question by elucidating a novel function of the conserved PP4 family phosphatase Pph3-Psy2, the yeast counterpart of the mammalian PP4c-R3 complex, in the glucose-signaling pathway. Our studies show that Pph3-Psy2 specifically targets the glucose signal transducer protein Mth1 via direct binding of the EVH1 domain of the Psy2 regulatory subunit to the polyproline motif of Mth1. This activity is required for the timely dephosphorylation of the downstream transcriptional repressor Rgt1 upon glucose withdrawal, a critical event in the repression of HXT genes, which encode glucose transporters. Pph3-Psy2 dephosphorylates Mth1, an Rgt1 associated corepressor, but does not dephosphorylate Rgt1 at sites associated with inactivation, in vitro. We show that Pph3-Psy2 phosphatase antagonizes Mth1 phosphorylation by protein kinase A (PKA), the major protein kinase activated in response to glucose, in vitro and regulates Mth1 function via putative PKA phosphorylation sites in vivo. We conclude that the Pph3-Psy2 phosphatase modulates Mth1 activity to facilitate precise regulation of HXT gene expression by glucose. PMID:24277933

  14. In vivo effects of microinjected alkaline phosphatase and its low molecular weight substrates on the first meiotic cell division in Xenopus laevis oocytes.

    PubMed Central

    Hermann, J; Mulner, O; Bellé, R; Marot, J; Tso, J; Ozon, R

    1984-01-01

    Xenopus laevis oocytes were microinjected with low molecular weight phosphoesters such as 2-glycerophosphate, phosphotyrosine, phosphoserine, phosphothreonine, 4-nitrophenyl phosphate, and orthophosphate. These compounds were able to induce a considerable reduction in the time course of progesterone-induced maturation, with 2-glycerophosphate being the most effective. The basal level of cAMP and its drop during maturation were not affected by the microinjection of 2-glycerophosphate. The injection of alkaline phosphatase (EC 3.1.3.1.) from calf intestine at a low concentration (10 ng per oocyte) was able to decrease or abolish the effect of 2-glycerophosphate. At higher concentration (25 ng per oocyte) this enzyme totally blocked progesterone- or maturation-promoting factor-induced maturation. Alkaline phosphatase might behave in vivo as a phosphoprotein phosphatase active towards phosphotyrosine-containing proteins. In addition, our results indicate that phosphate or phosphoester-containing buffers should be avoided in the course of maturation-promoting factor purification. PMID:6089179

  15. CTL0511 from Chlamydia trachomatis Is a Type 2C Protein Phosphatase with Broad Substrate Specificity

    PubMed Central

    Claywell, Ja E.

    2016-01-01

    ABSTRACT Protein phosphorylation has become increasingly recognized for its role in regulating bacterial physiology and virulence. Chlamydia spp. encode two validated Hanks'-type Ser/Thr protein kinases, which typically function with cognate protein phosphatases and appear capable of global protein phosphorylation. Consequently, we sought to identify a Ser/Thr protein phosphatase partner for the chlamydial kinases. CTL0511 from Chlamydia trachomatis L2 434/Bu, which has homologs in all sequenced Chlamydia spp., is a predicted type 2C Ser/Thr protein phosphatase (PP2C). Recombinant maltose-binding protein (MBP)-tagged CTL0511 (rCTL0511) hydrolyzed p-nitrophenyl phosphate (pNPP), a generic phosphatase substrate, in a MnCl2-dependent manner at physiological pH. Assays using phosphopeptide substrates revealed that rCTL0511 can dephosphorylate phosphorylated serine (P-Ser), P-Thr, and P-Tyr residues using either MnCl2 or MgCl2, indicating that metal usage can alter substrate preference. Phosphatase activity was unaffected by PP1, PP2A, and PP3 phosphatase inhibitors, while mutation of conserved PP2C residues significantly inhibited activity. Finally, phosphatase activity was detected in elementary body (EB) and reticulate body (RB) lysates, supporting a role for protein dephosphorylation in chlamydial development. These findings support that CTL0511 is a metal-dependent protein phosphatase with broad substrate specificity, substantiating a reversible phosphorylation network in C. trachomatis. IMPORTANCE Chlamydia spp. are obligate intracellular bacterial pathogens responsible for a variety of diseases in humans and economically important animal species. Our work demonstrates that Chlamydia spp. produce a PP2C capable of dephosphorylating P-Thr, P-Ser, and P-Tyr and that Chlamydia trachomatis EBs and RBs possess phosphatase activity. In conjunction with the chlamydial Hanks'-type kinases Pkn1 and PknD, validation of CTL0511 fulfills the enzymatic requirements for a

  16. Protein phosphatase and kinase activities possibly involved in exocytosis regulation in Paramecium tetraurelia.

    PubMed

    Kissmehl, R; Treptau, T; Hofer, H W; Plattner, H

    1996-07-01

    In Paramecium tetraurelia cells synchronous exocytosis induced by aminoethyldextran (AED) is accompanied by an equally rapid dephosphorylation of a 63 kDa phosphoprotein (PP63) within 80 ms. In vivo, rephosphorylation occurs within a few seconds after AED triggering. In homogenates (P)P63 can be solubilized in all three phosphorylation states (phosphorylated, dephosphorylated and rephosphorylated) and thus tested in vitro. By using chelators of different divalent cations, de- and rephosphorylation of PP63 and P63 respectively can be achieved by an endogenous protein phosphatase/kinase system. Dephosphorylation occurs in the presence of EDTA, whereas in the presence of EGTA this was concealed by phosphorylation by endogenous kinase(s), thus indicating that phosphorylation of P63 is calcium-independent. Results obtained with protein phosphatase inhibitors (okadaic acid, calyculin A) allowed us to exclude a protein serine/threonine phosphatase of type I (with selective sensitivity in Paramecium). Protein phosphatase 2C is also less likely to be a candidate because of its requirement for high Mg2+ concentrations. According to previous evidence a protein serine/threonine phosphatase of type 2B (calcineurin; CaN) is possibly involved. We have now found that bovine brain CaN dephosphorylates PP63 in vitro. Taking into account the specific requirements of this phosphatase in vitro, with p-nitrophenyl phosphate as a substrate, we have isolated a cytosolic phosphatase of similar characteristics by combined preparative gel electrophoresis and affinity-column chromatography. In Paramecium this phosphatase also dephosphorylates PP63 in vitro (after 32P labelling in vivo). Using various combinations of ion exchange, affinity and hydrophobic interaction chromatography we have also isolated three different protein kinases from the soluble fraction, i.e. a cAMP-dependent protein kinase (PKA), a cGMP-dependent protein kinase (PKG) and a casein kinase. Among the kinases tested, PKA

  17. Expression of truncated phosphoproteins of Nipah virus and Hendra virus in Escherichia coli for the differentiation of henipavirus infections.

    PubMed

    Chen, Ji-Ming; Yaiw, Koon Chu; Yu, Meng; Wang, Lin-Fa; Wang, Qing-Hua; Crameri, Gary; Wang, Zhi-Liang

    2007-06-01

    The genus Henipavirus in the family Paramyxoviridae compromises two newly identified dangerous pathogens, Nipah virus and Hendra virus. Phosphoprotein of the two viruses is one of the major immunodominant antigens and the most divergent protein in the viral genomes. We have now expressed two pairs of truncated phosphoproteins of the two viruses in Escherichia coli in a soluble form using a vector tailored from pET32a. The truncated recombinant phosphoproteins were purified with His-Tag affinity chromatography and their antigenicity was determined by western blotting and ELISA. The longer pair of truncated recombinant phosphoproteins, covering amino acid residues 4-550, was more antigenic than the shorter one and of potential utility in the serological differentiation of henipavirus infections.

  18. Structural Genomics of Protein Phosphatases

    SciTech Connect

    Almo,S.; Bonanno, J.; Sauder, J.; Emtage, S.; Dilorenzo, T.; Malashkevich, V.; Wasserman, S.; Swaminathan, S.; Eswaramoorthy, S.; et al

    2007-01-01

    The New York SGX Research Center for Structural Genomics (NYSGXRC) of the NIGMS Protein Structure Initiative (PSI) has applied its high-throughput X-ray crystallographic structure determination platform to systematic studies of all human protein phosphatases and protein phosphatases from biomedically-relevant pathogens. To date, the NYSGXRC has determined structures of 21 distinct protein phosphatases: 14 from human, 2 from mouse, 2 from the pathogen Toxoplasma gondii, 1 from Trypanosoma brucei, the parasite responsible for African sleeping sickness, and 2 from the principal mosquito vector of malaria in Africa, Anopheles gambiae. These structures provide insights into both normal and pathophysiologic processes, including transcriptional regulation, regulation of major signaling pathways, neural development, and type 1 diabetes. In conjunction with the contributions of other international structural genomics consortia, these efforts promise to provide an unprecedented database and materials repository for structure-guided experimental and computational discovery of inhibitors for all classes of protein phosphatases.

  19. Extremely high maternal alkaline phosphatase serum concentration with syncytiotrophoblastic origin

    PubMed Central

    Boronkai, A; Than, N G; Magenheim, R; Bellyei, S; Szigeti, A; Deres, P; Hargitai, B; Sumegi, B; Papp, Z; Rigo, J

    2005-01-01

    An extremely high alkaline phosphatase (AP) concentration (3609 IU/litre) was found in a 20 year old primigravida at 37 week’s gestation, prompting an examination of its histological and cellular origin. Immunohistochemistry and western blots using antibodies against AP, Ki-67, phospho-protein kinase B (Akt), phospho-p44/42 mitogen activated protein kinase/extracellular signal regulated kinase 1/2 (MAPK/Erk1/2), phospho-glycogen synthase kinase-3β (GSK-3β), phospho-stress activated protein kinase/c-Jun N-terminal kinase, total-Akt, total-GSK-3β, and phospho-p38-MAPK were carried out on index and control placental samples of the same gestational age. Compared with controls, staining of the index placenta showed minimal AP labelling of the brush border and remarkable positivity of the intervillous space. Cytotrophoblastic proliferation was 8–10% in the index placenta compared with 1–2% in controls. The index placenta also had raised concentrations of protein kinases with important roles in cell differentiation. The proliferation and differentiation rates of the cytotrophoblasts were found to be five times higher in index samples than in controls. It is hypothesised that loss of syncytial membranes in immature villi led to increased AP concentrations in the maternal circulation and decreased AP staining of the placenta. Loss of the syncytium might also stimulate increased proliferation of villous cytotrophoblasts, which would then fuse and maintain the syncytium. PMID:15623487

  20. Quantitative Phosphoproteomics Reveals Novel Phosphorylation Events in Insulin Signaling Regulated by Protein Phosphatase 1 Regulatory Subunit 12A

    PubMed Central

    Zhang, Xiangmin; Ma, Danjun; Caruso, Michael; Lewis, Monique; Qi, Yue; Yi, Zhengping

    2014-01-01

    Serine/threonine protein phosphatase 1 regulatory subunit 12A (PPP1R12A) modulates the activity and specificity of the catalytic subunit of protein phosphatase 1, regulating various cellular processes via dephosphorylation. Nonetheless, little is known about phosphorylation events controlled by PPP1R12A in skeletal muscle insulin signaling. Here, we used quantitative phosphoproteomics to generate a global picture of phosphorylation events regulated by PPP1R12A in a L6 skeletal muscle cell line, which were engineered for inducible PPP1R12A knockdown. Phosphoproteomics revealed 3876 phosphorylation sites (620 were novel) in these cells. Furthermore, PPP1R12A knockdown resulted in increased overall phosphorylation in L6 cells at the basal condition, and changed phosphorylation levels for 698 sites (assigned to 295 phosphoproteins) at the basal and/or insulin-stimulated conditions. Pathway analysis on the 295 phosphoproteins revealed multiple significantly enriched pathways related to insulin signaling, such as mTOR signaling and RhoA signaling. Moreover, phosphorylation levels for numerous regulatory sites in these pathways were significantly changed due to PPP1R12A knockdown. These results indicate that PPP1R12A indeed plays a role in skeletal muscle insulin signaling, providing novel insights into the biology of insulin action. This new information may facilitate the design of experiments to better understand mechanisms underlying skeletal muscle insulin resistance and type 2 diabetes. PMID:24972320

  1. Mutational analysis of a Ser/Thr phosphatase. Identification of residues important in phosphoesterase substrate binding and catalysis.

    PubMed

    Zhuo, S; Clemens, J C; Stone, R L; Dixon, J E

    1994-10-21

    The Ser/Thr phosphoprotein phosphatases (PPases) display similarities in amino acid sequence and biochemical properties. Most members of this family require transition metal ions for activity. The smallest family member, the bacteriophage lambda PPase (lambda-PPase), has been successfully overexpressed in Escherichia coli, purified, and characterized (Zhuo, S., Clemens, J.C., Hakes, D.J., Barford, D., and Dixon, J. E. (1993) J. Biol. Chem. 268, 17754-17761). Site-directed mutagenesis has now been employed to define amino acid residues in lambda-PPase required for metal ion binding and catalysis. Conservative amino acid substitutions at residues Asp20, His22, Asp49, His76, and Glu77 affected lambda-PPase catalysis and metal ion binding, whereas substitutions at residues Arg53 and Arg73 affected catalysis and substrate binding. Each of these residues is invariant in all phosphoprotein phosphatases, suggesting that these residues may play important roles in binding and catalysis in all of the PPases. Computer-assisted sequence alignment further revealed that lambda-PPase residues Asp20, His22, Asp49, His76, Arg53, and Arg73 lie within three larger regions of PPase sequence identity with the consensus sequence (DXH-(approximately 25)-GDXXD-(approximately 25)-GNHD/E). This motif can be found in a wide variety of phosphoesterases unrelated to the PPases and defines structural and catalytic features utilized by a diverse group of enzymes for the hydrolysis of phosphate esters.

  2. Identification of the 64 kilodalton chloroplast stromal phosphoprotein as phosphoglucomutase. [Pisum sativum

    SciTech Connect

    Salvucci, M.E.; Drake, R.R.; Broadbent, K.P.; Haley, B.E. ); Hanson, K.R.; McHale, N.A. )

    1990-05-01

    Phosphorylation of the 64 kilodalton stromal phosphoprotein by incubation of pea (Pisum sativum) chloroplast extracts with ({gamma}-{sup 32}P)ATP decreased in the presence of Glc-6-P and Glc-1,6-P{sub 2}, but was stimulated by glucose. Two-dimensional gel electrophoresis following incubation of intact chloroplasts and stromal extracts with ({gamma}-{sup 32}P)ATP, or incubation of stromal extracts and partially purified phosphoglucomutase (EC 2.7.5.1) with ({sup 32}P)Glc-1-P showed that the identical 64 kilodalton polypeptide was labeled. A 62 kilodalton polypeptide was phosphorylated by incubation of tobacco (Nicotiana sylvestris) stromal extracts with either ({gamma}-{sup 32}P)ATP or ({sup 32}P)Glc-1-P. In contrast, an analogous polypeptide was not phosphorylated in extracts from a tobacco mutant deficient in plastid phosphoglucomutase activity. The results indicate that the 64 (or 62) kilodalton chloroplast stromal phosphoprotein is phosphoglucomutase.

  3. Virion basic phosphoprotein from human cytomegalovirus contains O-linked N-acetylglucosamine.

    PubMed Central

    Benko, D M; Haltiwanger, R S; Hart, G W; Gibson, W

    1988-01-01

    A 149-kDa virion protein of human strains of cytomegalovirus is the principal acceptor for galactose added in vitro by bovine milk galactosyltransferase. Peptide comparisons with other biochemical characteristics of the galactosylated protein identified it as the virus-encoded basic phosphoprotein. This protein is an abundant constituent of the virion and is located in the tegument region, between the capsid and the envelope, rather than in the envelope layer with the recognized virion glycoproteins. The galactosylated carbohydrate was resistant to a commercial preparation of endoglycosidase F but was sensitive to removal by alkali-induced beta-elimination, indicating an O-linkage to the protein. Chromatographic and electrophoretic determinations identified the beta-eliminated material as the alditol of Gal beta 1-4GlcNAc, establishing that the human cytomegalovirus virion basic phosphoprotein contains single O-linked residues of N-acetylglucosamine. Images PMID:2833746

  4. Combined use of nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 for hepatocellular carcinoma detection in high-risk chronic hepatitis C patients.

    PubMed

    Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K

    2017-10-01

    Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (<5 cm) tumour) were recruited. The gene products of c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p < 0.0001) in the positivity rate of c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.

  5. Beyond the Dopamine Receptor: Regulation and Roles of Serine/Threonine Protein Phosphatases

    PubMed Central

    Walaas, Sven Ivar; Hemmings, Hugh Caroll; Greengard, Paul; Nairn, Angus Clark

    2011-01-01

    Dopamine plays an important modulatory role in the central nervous system, helping to control critical aspects of motor function and reward learning. Alteration in normal dopaminergic neurotransmission underlies multiple neurological diseases including schizophrenia, Huntington’s disease, and Parkinson’s disease. Modulation of dopamine-regulated signaling pathways is also important in the addictive actions of most drugs of abuse. Our studies over the last 30 years have focused on the molecular actions of dopamine acting on medium spiny neurons, the predominant neurons of the neostriatum. Striatum-enriched phosphoproteins, particularly dopamine and adenosine 3′:5′-monophosphate-regulated phosphoprotein of 32 kDa (DARPP-32), regulator of calmodulin signaling (RCS), and ARPP-16, mediate pleiotropic actions of dopamine. Notably, each of these proteins, either directly or indirectly, regulates the activity of one of the three major subclasses of serine/threonine protein phosphatases, PP1, PP2B, and PP2A, respectively. For example, phosphorylation of DARPP-32 at Thr34 by protein kinase A results in potent inhibition of PP1, leading to potentiation of dopaminergic signaling at multiple steps from the dopamine receptor to the nucleus. The discovery of DARPP-32 and its emergence as a critical molecular integrator of striatal signaling will be discussed, as will more recent studies that highlight novel roles for RCS and ARPP-16 in dopamine-regulated striatal signaling pathways. PMID:21904525

  6. Atrazine Affects Phosphoprotein and Protein Expression in MCF-10A Human Breast Epithelial Cells

    PubMed Central

    Huang, Peixin; Yang, John; Song, Qisheng; Sheehan, David

    2014-01-01

    Atrazine, a member of the 2-chloro-s-triazine family of herbicides, is the most widely used pesticide in the world and often detected in agriculture watersheds. Although it was generally considered as an endocrine disruptor, posing a potential threat to human health, the molecular mechanisms of atrazine effects remain unclear. Using two-dimensional gel electrophoresis, we identified a panel of differentially expressed phosphoproteins and total proteins in human breast epithelial MCF-10A cells after being exposed to environmentally relevant concentrations of atrazine. Atrazine treatments for 6 h resulted in differential expression of 4 phosphoproteins and 8 total-proteins as compared to the control cells (>1.5-fold, p < 0.05). MALDI-TOF MS/MS analysis revealed that the differentially expressed proteins belong to various cellular compartments (nucleus, cytosol, membrane) and varied in function, including those regulating the stress response such as peroxiredoxin I, HSP70 and HSP27; structural proteins such as tropomyosin and profilin 1; and oncogenesis proteins such as ANP32A. Six of the 12 identified proteins were verified by quantitative PCR for their transcript levels. The most up-regulated phosphoprotein by atrazine treatment, ANP32A, was further analyzed for its expression, distribution and cellular localization using Western blot and immunocytochemical approaches. The results revealed that ANP32 expression after atrazine treatment increased dose and time dependently and was primarily located in the nucleus. This study may provide new evidence on the potential toxicity of atrazine in human cells. PMID:25275270

  7. Highly selective recovery of phosphopeptides using trypsin-assisted digestion of precipitated lanthanide-phosphoprotein complexes.

    PubMed

    Güzel, Yüksel; Rainer, Matthias; Mirza, Munazza R; Messner, Christoph B; Bonn, Günther K

    2013-05-21

    The basic idea of this study was to recover phosphopeptides after trypsin-assisted digestion of precipitated phosphoproteins using trivalent lanthanide ions. In the first step, phosphoproteins were extracted from the protein solution by precipitation with La(3+) and Ce(3+) ions, forming stable pellets. Additionally, the precipitated lanthanide-phosphoprotein complexes were suspended and directly digested on-pellet using trypsin. Non-phosphorylated peptides were released into the supernatants by enzymatic cleavage and phosphopeptides remained bound on the precipitated pellet. Further washing steps improved the removal of non-phosphorylated peptides. For the recovery of phosphopeptides the precipitated pellets were dissolved in 3.7% hydrochloric acid. The performance of this method was evaluated by several experiments using MALDI-TOF MS measurements and delivered the highest selectivity for phosphopeptides. This can be explained by the overwhelming preference of lanthanides for binding to oxygen-containing anions such as phosphates. The developed enrichment method was evaluated with several types of biological samples, including fresh milk and egg white. The uniqueness and the main advantages of the presented approach are the enrichment on the protein-level and the recovery of phosphopeptides on the peptide-level. This allows much easier handling, as the number of molecules on the peptide level is unavoidably higher, by complicating every enrichment strategy.

  8. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    PubMed

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro.

  9. Atrazine affects phosphoprotein and protein expression in MCF-10A human breast epithelial cells.

    PubMed

    Huang, Peixin; Yang, John; Song, Qisheng

    2014-10-01

    Atrazine, a member of the 2-chloro-s-triazine family of herbicides, is the most widely used pesticide in the world and often detected in agriculture watersheds. Although it was generally considered as an endocrine disruptor, posing a potential threat to human health, the molecular mechanisms of atrazine effects remain unclear. Using two-dimensional gel electrophoresis, we identified a panel of differentially expressed phosphoproteins and total proteins in human breast epithelial MCF-10A cells after being exposed to environmentally relevant concentrations of atrazine. Atrazine treatments for 6 h resulted in differential expression of 4 phosphoproteins and 8 total-proteins as compared to the control cells (>1.5-fold, p<0.05). MALDI-TOF MS/MS analysis revealed that the differentially expressed proteins belong to various cellular compartments (nucleus, cytosol, membrane) and varied in function, including those regulating the stress response such as peroxiredoxin I, HSP70 and HSP27; structural proteins such as tropomyosin and profilin 1; and oncogenesis proteins such as ANP32A. Six of the 12 identified proteins were verified by quantitative PCR for their transcript levels. The most up-regulated phosphoprotein by atrazine treatment, ANP32A, was further analyzed for its expression, distribution and cellular localization using Western blot and immunocytochemical approaches. The results revealed that ANP32 expression after atrazine treatment increased dose and time dependently and was primarily located in the nucleus. This study may provide new evidence on the potential toxicity of atrazine in human cells.

  10. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana.

    PubMed

    Lassowskat, Ines; Böttcher, Christoph; Eschen-Lippold, Lennart; Scheel, Dierk; Lee, Justin

    2014-01-01

    Mitogen-activated protein kinases (MAPKs) target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3, and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses) is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phospho)proteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g., WRKY transcription factors and proteins encoded by the genes from the "PEN" pathway required for penetration resistance to filamentous pathogens). Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org).

  11. The SIT4 protein phosphatase functions in late G1 for progression into S phase.

    PubMed Central

    Sutton, A; Immanuel, D; Arndt, K T

    1991-01-01

    Saccharomyces cerevisiae strains containing temperature-sensitive mutations in the SIT4 protein phosphatase arrest in late G1 at the nonpermissive temperature. Order-of-function analysis shows that SIT4 is required in late G1 for progression into S phase. While the levels of SIT4 do not change in the cell cycle, SIT4 associates with two high-molecular-weight phosphoproteins in a cell-cycle-dependent fashion. In addition, we have identified a polymorphic gene, SSD1, that in some versions can suppress the lethality due to a deletion of SIT4 and can also partially suppress the phenotypic defects due to a null mutation in BCY1. The SSD1 protein is implicated in G1 control and has a region of similarity to the dis3 protein of Schizosaccharomyces pombe. We have also identified a gene, PPH2alpha, that in high copy number can partially suppress the growth defect of sit4 strains. The PPH2 alpha gene encodes a predicted protein that is 80% identical to the catalytic domain of mammalian type 2A protein phosphatases but also has an acidic amino-terminal extension not present in other phosphatases. Images PMID:1848673

  12. Analysis of phosphatases in ER-negative breast cancers identifies DUSP4 as a critical regulator of growth and invasion.

    PubMed

    Mazumdar, Abhijit; Poage, Graham M; Shepherd, Jonathan; Tsimelzon, Anna; Hartman, Zachary C; Den Hollander, Petra; Hill, Jamal; Zhang, Yun; Chang, Jenny; Hilsenbeck, Susan G; Fuqua, Suzanne; Kent Osborne, C; Mills, Gordon B; Brown, Powel H

    2016-08-01

    Estrogen receptor (ER)-negative cancers have a poor prognosis, and few targeted therapies are available for their treatment. Our previous analyses have identified potential kinase targets critical for the growth of ER-negative, progesterone receptor (PR)-negative and HER2-negative, or "triple-negative" breast cancer (TNBC). Because phosphatases regulate the function of kinase signaling pathways, in this study, we investigated whether phosphatases are also differentially expressed in ER-negative compared to those in ER-positive breast cancers. We compared RNA expression in 98 human breast cancers (56 ER-positive and 42 ER-negative) to identify phosphatases differentially expressed in ER-negative compared to those in ER-positive breast cancers. We then examined the effects of one selected phosphatase, dual specificity phosphatase 4 (DUSP4), on proliferation, cell growth, migration and invasion, and on signaling pathways using protein microarray analyses of 172 proteins, including phosphoproteins. We identified 48 phosphatase genes are significantly differentially expressed in ER-negative compared to those in ER-positive breast tumors. We discovered that 31 phosphatases were more highly expressed, while 11 were underexpressed specifically in ER-negative breast cancers. The DUSP4 gene is underexpressed in ER-negative breast cancer and is deleted in approximately 50 % of breast cancers. Induced DUSP4 expression suppresses both in vitro and in vivo growths of breast cancer cells. Our studies show that induced DUSP4 expression blocks the cell cycle at the G1/S checkpoint; inhibits ERK1/2, p38, JNK1, RB, and NFkB p65 phosphorylation; and inhibits invasiveness of TNBC cells. These results suggest that that DUSP4 is a critical regulator of the growth and invasion of triple-negative breast cancer cells.

  13. Prediction and verification of novel peptide targets of protein tyrosine phosphatase 1B.

    PubMed

    Li, Xun; Köhn, Maja

    2016-08-01

    Phosphotyrosine peptides are useful starting points for inhibitor design and for the search for protein tyrosine phosphatase (PTP) phosphoprotein substrates. To identify novel phosphopeptide substrates of PTP1B, we developed a computational prediction protocol based on a virtual library of protein sequences with known phosphotyrosine sites. To these we applied sequence-based methods, biologically meaningful filters and molecular docking. Five peptides were selected for biochemical testing of their potential as PTP1B substrates. All five peptides were equally good substrates for PTP1B compared to a known peptide substrate whereas appropriate control peptides were not recognized, showing that our protocol can be used to identify novel peptide substrates of PTP1B.

  14. Stable Isotope Metabolic Labeling-based Quantitative Phosphoproteomic Analysis of Arabidopsis Mutants Reveals Ethylene-regulated Time-dependent Phosphoproteins and Putative Substrates of Constitutive Triple Response 1 Kinase*

    PubMed Central

    Yang, Zhu; Guo, Guangyu; Zhang, Manyu; Liu, Claire Y.; Hu, Qin; Lam, Henry; Cheng, Han; Xue, Yu; Li, Jiayang; Li, Ning

    2013-01-01

    Ethylene is an important plant hormone that regulates numerous cellular processes and stress responses. The mode of action of ethylene is both dose- and time-dependent. Protein phosphorylation plays a key role in ethylene signaling, which is mediated by the activities of ethylene receptors, constitutive triple response 1 (CTR1) kinase, and phosphatase. To address how ethylene alters the cellular protein phosphorylation profile in a time-dependent manner, differential and quantitative phosphoproteomics based on 15N stable isotope labeling in Arabidopsis was performed on both one-minute ethylene-treated Arabidopsis ethylene-overly-sensitive loss-of-function mutant rcn1-1, deficient in PP2A phosphatase activity, and a pair of long-term ethylene-treated wild-type and loss-of-function ethylene signaling ctr1-1 mutants, deficient in mitogen-activated kinase kinase kinase activity. In total, 1079 phosphopeptides were identified, among which 44 were novel. Several one-minute ethylene-regulated phosphoproteins were found from the rcn1-1. Bioinformatic analysis of the rcn1-1 phosphoproteome predicted nine phosphoproteins as the putative substrates for PP2A phosphatase. In addition, from CTR1 kinase-enhanced phosphosites, we also found putative CTR1 kinase substrates including plastid transcriptionally active protein and calcium-sensing receptor. These regulatory proteins are phosphorylated in the presence of ethylene. Analysis of ethylene-regulated phosphosites using the group-based prediction system with a protein–protein interaction filter revealed a total of 14 kinase–substrate relationships that may function in both CTR1 kinase- and PP2A phosphatase-mediated phosphor-relay pathways. Finally, several ethylene-regulated post-translational modification network models have been built using molecular systems biology tools. It is proposed that ethylene regulates the phosphorylation of arginine/serine-rich splicing factor 41, plasma membrane intrinsic protein 2A, light

  15. A systems toxicology approach identifies Lyn as a key signaling phosphoprotein modulated by mercury in a B lymphocyte cell model

    SciTech Connect

    Caruso, Joseph A.; Stemmer, Paul M.; Dombkowski, Alan; Caruthers, Nicholas J.; Gill, Randall; Rosenspire, Allen J.

    2014-04-01

    Network and protein–protein interaction analyses of proteins undergoing Hg{sup 2+}-induced phosphorylation and dephosphorylation in Hg{sup 2+}-intoxicated mouse WEHI-231 B cells identified Lyn as the most interconnected node. Lyn is a Src family protein tyrosine kinase known to be intimately involved in the B cell receptor (BCR) signaling pathway. Under normal signaling conditions the tyrosine kinase activity of Lyn is controlled by phosphorylation, primarily of two well known canonical regulatory tyrosine sites, Y-397 and Y-508. However, Lyn has several tyrosine residues that have not yet been determined to play a major role under normal signaling conditions, but are potentially important sites for phosphorylation following mercury exposure. In order to determine how Hg{sup 2+} exposure modulates the phosphorylation of additional residues in Lyn, a targeted MS assay was developed. Initial mass spectrometric surveys of purified Lyn identified 7 phosphorylated tyrosine residues. A quantitative assay was developed from these results using the multiple reaction monitoring (MRM) strategy. WEHI-231 cells were treated with Hg{sup 2+}, pervanadate (a phosphatase inhibitor), or anti-Ig antibody (to stimulate the BCR). Results from these studies showed that the phosphoproteomic profile of Lyn after exposure of the WEHI-231 cells to a low concentration of Hg{sup 2+} closely resembled that of anti-Ig antibody stimulation, whereas exposure to higher concentrations of Hg{sup 2+} led to increases in the phosphorylation of Y-193/Y-194, Y-501 and Y-508 residues. These data indicate that mercury can disrupt a key regulatory signal transduction pathway in B cells and point to phospho-Lyn as a potential biomarker for mercury exposure. - Highlights: • Inorganic mercury (Hg{sup 2+}) induces changes in the WEHI-231 B cell phosphoproteome. • The B cell receptor (BCR) signaling pathway was the pathway most affected by Hg{sup 2+}. • The Src family phosphoprotein kinase Lyn was the

  16. Significant and unique changes in phosphorylation levels of four phosphoproteins in two apple rootstock genotypes under drought stress.

    PubMed

    Ren, Jing; Mao, Juan; Zuo, Cunwu; Calderón-Urrea, Alejandro; Dawuda, Mohammed Mujitaba; Zhao, Xin; Li, Xinwen; Chen, Baihong

    2017-07-14

    Drought stress is a major problem around the world and there is still little molecular mechanism about how fruit crops deal with moderate drought stress. Here, the physiological and phosphoproteomic responses of drought-sensitive genotype (M26) and drought-tolerant genotype (MBB) under moderate drought stress were investigated. Our results of the physiology analysis indicated that the MBB genotype could produce more osmosis-regulating substances. Furthermore, phosphoproteins from leaves of both genotypes under moderate drought stress were analyzed using the isobaric tags for relative and absolute quantification technology. A total of 595 unique phosphopeptides, 682 phosphorylated sites, and 446 phosphoproteins were quantitatively analyzed in the two genotypes. Five and thirty-five phosphoproteins with the phosphorylation levels significantly changed (PLSC) were identified in M26 and MBB, respectively. Among these, four PLSC phosphoproteins were common to both genotypes, perhaps indicating a partial overlap of the mechanisms to moderate drought stress. Gene ontology analyses revealed that the PLSC phosphoproteins represent a unique combination of metabolism, transcription, translation, and protein processing, suggesting that the response in apple to moderate drought stress encompasses a new and unique homeostasis of major cellular processes. The basic trend was an increase in protein and organic molecules abundance related to drought. These increases were higher in MBB than in M26. Our study is the first to address the phosphoproteome of apple rootstocks in response to moderate drought stress, and provide insights into the molecular regulation mechanisms of apple rootstock under moderate drought stress.

  17. Complete sequence analysis of cDNA clones encoding rat whey phosphoprotein: homology to a protease inhibitor.

    PubMed

    Dandekar, A M; Robinson, E A; Appella, E; Qasba, P K

    1982-07-01

    Lactoprotein clones have been isolated from a rat mammary gland recombinant library of cDNA plasmids. Clones p-Wp 52 and p-Wp 47 were shown by hybrid selection, in vitro translation, and immunoprecipitation to represent a cloned DNA sequence encoding rat whey phosphoprotein. We report here the nucleotide sequence of the cDNA insert of p-Wp 52 and shows that it encodes the complete whey phosphoprotein sequence. The encoded sequence shows a high content of half-cystine, glutamic acid, aspartic acid, and serine but an absence of tyrosine. The half-cystines appear in unique arrangements and are repeated in two domains of the protein. The second domain has striking similarities with the second domain of the red sea turtle protease inhibitor. Clone p-Wp 52 has allowed the study of expression of whey phosphoprotein mRNA during functional differentiation of rat mammary gland and in mammary tumors. The whey phosphoprotein mRNA is detected during midpregnancy and lactation in the rat mammary gland but is barely detected in mammary tumors in which other milk protein mRNAs are expressed. The whey phosphoprotein gene in these tumors is hypermethylated, correlating with the reduced expression of this gene.

  18. Characterization of the interactions between the nucleoprotein and the phosphoprotein of Henipavirus.

    PubMed

    Habchi, Johnny; Blangy, Stéphanie; Mamelli, Laurent; Jensen, Malene Ringkjøbing; Blackledge, Martin; Darbon, Hervé; Oglesbee, Michael; Shu, Yaoling; Longhi, Sonia

    2011-04-15

    The Henipavirus genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that recruits the polymerase complex via the phosphoprotein (P). In a previous study, we reported that in henipaviruses, the N-terminal domain of the phosphoprotein and the C-terminal domain of the nucleoprotein (N(TAIL)) are both intrinsically disordered. Here we show that Henipavirus N(TAIL) domains are also disordered in the context of full-length nucleoproteins. We also report the cloning, purification, and characterization of the C-terminal X domains (P(XD)) of Henipavirus phosphoproteins. Using isothermal titration calorimetry, we show that N(TAIL) and P(XD) form a 1:1 stoichiometric complex that is stable under NaCl concentrations as high as 1 M and has a K(D) in the μM range. Using far-UV circular dichroism and nuclear magnetic resonance, we show that P(XD) triggers an increase in the α-helical content of N(TAIL). Using fluorescence spectroscopy, we show that P(XD) has no impact on the chemical environment of a Trp residue introduced at position 527 of the Henipavirus N(TAIL) domain, thus arguing for the lack of stable contacts between the C termini of N(TAIL) and P(XD). Finally, we present a tentative structural model of the N(TAIL)-P(XD) interaction in which a short, order-prone region of N(TAIL) (α-MoRE; amino acids 473-493) adopts an α-helical conformation and is embedded between helices α2 and α3 of P(XD), leading to a relatively small interface dominated by hydrophobic contacts. The present results provide the first detailed experimental characterization of the N-P interaction in henipaviruses and designate the N(TAIL)-P(XD) interaction as a valuable target for rational antiviral approaches.

  19. Identification of Crosstalk between Phosphoprotein Signaling Pathways in RAW 264.7 Macrophage Cells

    PubMed Central

    Gupta, Shakti; Maurya, Mano Ram; Subramaniam, Shankar

    2010-01-01

    Signaling pathways mediate the effect of external stimuli on gene expression in cells. The signaling proteins in these pathways interact with each other and their phosphorylation levels often serve as indicators for the activity of signaling pathways. Several signaling pathways have been identified in mammalian cells but the crosstalk between them is not well understood. Alliance for Cellular Signaling (AfCS) has measured time-course data in RAW 264.7 macrophage cells on important phosphoproteins, such as the mitogen-activated protein kinases (MAPKs) and signal transducer and activator of transcription (STATs), in single- and double-ligand stimulation experiments for 22 ligands. In the present work, we have used a data-driven approach to analyze the AfCS data to decipher the interactions and crosstalk between signaling pathways in stimulated macrophage cells. We have used dynamic mapping to develop a predictive model using a partial least squares approach. Significant interactions were selected through statistical hypothesis testing and were used to reconstruct the phosphoprotein signaling network. The proposed data-driven approach is able to identify most of the known signaling interactions such as protein kinase B (Akt) → glycogen synthase kinase 3α/β (GSKα/β) etc., and predicts potential novel interactions such as P38 → RSK and GSK → ezrin/radixin/moesin. We have also shown that the model has good predictive power for extrapolation. Our novel approach captures the temporal causality and directionality in intracellular signaling pathways. Further, case specific analysis of the phosphoproteins in the network has led us to propose hypothesis about inhibition (phosphorylation) of GSKα/β via P38. PMID:20126526

  20. Alkaline Phosphatase in Normal Infants

    PubMed Central

    Stephen, Joan M. L.; Stephenson, Pearl

    1971-01-01

    Alkaline phosphatase was measured in plasma from children receiving vitamin D supplements in day nurseries in the London area, and from children exposed to sunlight in the West Indies. The distribution of values showed that there was no precise upper limit which could be used in the diagnosis of subclinical vitamin D deficiency. PMID:5576029

  1. Calmodulin-dependent protein phosphatase from Neurospora crassa. Molecular cloning and expression of recombinant catalytic subunit.

    PubMed

    Higuchi, S; Tamura, J; Giri, P R; Polli, J W; Kincaid, R L

    1991-09-25

    A cDNA for the catalytic subunit of a calmodulin (CaM)-dependent protein phosphatase was cloned from Neurospora crassa. The open reading frame of 1557 base pairs encoded a protein of Mr approximately 59,580 and was followed by a 3'-untranslated region of 363 base pairs including the poly(A) tail. Based on primer extension analysis, the mRNA transcript in vivo was 2403 base pairs. Expression of this CaM-protein phosphatase mRNA was developmentally regulated, being highest during early mycelial growth; production of the corresponding protein followed mRNA with a time lag of 8-12 h. Polymerase chain reaction amplification of genomic DNA revealed three small introns, the positions of which coincided with those in the mouse gene, indicating evolutionary conservation of these structures. The deduced sequence showed approximately 75% identity with the mammalian homologue, calcineurin, in aligned regions. A region of 40 amino acids preceding the CaM-binding domain was essentially unchanged, suggesting conservation of a crucial interaction site. Three small segments in the carboxyl half of the protein were unrelated to the mammalian gene and may constitute "variable regions" that confer substrate specificity to the enzyme. An active recombinant catalytic subunit was expressed in bacteria and purified by CaM-Sepharose chromatography. This preparation was stimulated 2- 3-fold by CaM and showed a p-nitrophenol phosphatase activity equal to that of the bovine brain holoenzyme, although its dephosphorylation of phosphoprotein substrates was markedly different. These findings demonstrate that the catalytic subunit of this phosphatase can exhibit high activity in the absence of its intrinsic Ca(2+)-binding subunit.

  2. Molecular mimicry in virus infection: crossreaction of measles virus phosphoprotein or of herpes simplex virus protein with human intermediate filaments.

    PubMed Central

    Fujinami, R S; Oldstone, M B; Wroblewska, Z; Frankel, M E; Koprowski, H

    1983-01-01

    Using monoclonal antibodies, we demonstrate that the phosphoprotein of measles virus and a protein of herpes simplex virus type 1 crossreact with an intermediate filament protein of human cells. This intermediate filament protein, probably vimentin, has a molecular weight of 52,000, whereas the molecular weights of the measles viral phosphoprotein and the herpes virus protein are 70,000 and 146,000, respectively. Crossreactivity was shown by immunofluorescent staining of infected and uninfected cells and by immunoblotting. The monoclonal antibody against measles virus phosphoprotein did not react with herpes simplex virus protein and vice versa, indicating that these monoclonal antibodies recognize different antigenic determinants on the intermediate filament molecule. The significance of these results in explaining the appearance of autoantibodies during virus infections in humans is discussed. Images PMID:6300911

  3. A simple, rapid and low-cost staining method for gel-electrophoresis separated phosphoproteins via the fluorescent purpurin dye.

    PubMed

    Cong, Weitao; Shen, Jiayi; Xuan, Yuanhu; Zhu, Xinliang; Ni, Maowei; Zhu, Zhongxin; Hong, Guoying; Lu, Xianghong; Jin, Litai

    2014-12-07

    A novel fluorescence detection method for phosphoproteins in 1-D and 2-D SDS-PAGE by using purpurin is developed in this study. Phosphoproteins as low as 4-8 ng could be specifically detected by purpurin within 60 min, and the detection limit is similar to or better than that of Pro-Q Diamond staining. Only 2 steps (staining and destaining) are needed for purpurin staining without requiring excessive fixing and washing steps, and for single use, $0.8 is enough for purpurin staining. By comprehensively comparing with Pro-Q Diamond staining, it is concluded that purpurin staining is a simple, rapid and low-cost staining method for a broad application to the research of phosphoproteins.

  4. Phosphoproteomes of Strongylocentrotus purpuratus shell and tooth matrix: identification of a major acidic sea urchin tooth phosphoprotein, phosphodontin

    PubMed Central

    2010-01-01

    Background Sea urchin is a major model organism for developmental biology and biomineralization research. However, identification of proteins involved in larval skeleton formation and mineralization processes in the embryo and adult, and the molecular characterization of such proteins, has just gained momentum with the sequencing of the Strongylocentrotus purpuratus genome and the introduction of high-throughput proteomics into the field. Results The present report contains the determination of test (shell) and tooth organic matrix phosphoproteomes. Altogether 34 phosphoproteins were identified in the biomineral organic matrices. Most phosphoproteins were specific for one compartment, only two were identified in both matrices. The sea urchin phosphoproteomes contained several obvious orthologs of mammalian proteins, such as a Src family tyrosine kinase, protein kinase C-delta 1, Dickkopf-1 and other signal transduction components, or nucleobindin. In most cases phosphorylation sites were conserved between sea urchin and mammalian proteins. However, the majority of phosphoproteins had no mammalian counterpart. The most interesting of the sea urchin-specific phosphoproteins, from the perspective of biomineralization research, was an abundant highly phosphorylated and very acidic tooth matrix protein composed of 35 very similar short sequence repeats, a predicted N-terminal secretion signal sequence, and an Asp-rich C-terminal motif, contained in [Glean3:18919]. Conclusions The 64 phosphorylation sites determined represent the most comprehensive list of experimentally identified sea urchin protein phosphorylation sites at present and are an important addition to the recently analyzed Strongylocentrotus purpuratus shell and tooth proteomes. The identified phosphoproteins included a major, highly phosphorylated protein, [Glean3:18919], for which we suggest the name phosphodontin. Although not sequence-related to such highly phosphorylated acidic mammalian dental

  5. Enzymatic characteristics of an ApaH-like phosphatase, PrpA, and a diadenosine tetraphosphate hydrolase, ApaH, from Myxococcus xanthus.

    PubMed

    Sasaki, Masashi; Takegawa, Kaoru; Kimura, Yoshio

    2014-09-17

    We characterized the activities of the Myxococcus xanthus ApaH-like phosphatases PrpA and ApaH, which share homologies with both phosphoprotein phosphatases and diadenosine tetraphosphate (Ap4A) hydrolases. PrpA exhibited a phosphatase activity towards p-nitrophenyl phosphate (pNPP), tyrosine phosphopeptide and tyrosine-phosphorylated protein, and a weak hydrolase activity towards ApnA and ATP. In the presence of Mn(2+), PrpA hydrolyzed Ap4A into AMP and ATP, whereas in the presence of Co(2+) PrpA hydrolyzed Ap4A into two molecules of ADP. ApaH exhibited high phosphatase activity towards pNPP, and hydrolase activity towards ApnA and ATP. Mn(2+) was required for ApaH-mediated pNPP dephosphorylation and ATP hydrolysis, whereas Co(2+) was required for ApnA hydrolysis. Thus, PrpA and ApaH may function mainly as a tyrosine protein phosphatase and an ApnA hydrolase, respectively.

  6. Crystal structure of lipid phosphatase Escherichia coli phosphatidylglycerophosphate phosphatase B

    PubMed Central

    Fan, Junping; Jiang, Daohua; Zhao, Yan; Liu, Jianfeng; Zhang, Xuejun Cai

    2014-01-01

    Membrane-integrated type II phosphatidic acid phosphatases (PAP2s) are important for numerous bacterial to human biological processes, including glucose transport, lipid metabolism, and signaling. Escherichia coli phosphatidylglycerol-phosphate phosphatase B (ecPgpB) catalyzes removing the terminal phosphate group from a lipid carrier, undecaprenyl pyrophosphate, and is essential for transport of many hydrophilic small molecules across the membrane. We determined the crystal structure of ecPgpB at a resolution of 3.2 Å. This structure shares a similar folding topology and a nearly identical active site with soluble PAP2 enzymes. However, the substrate binding mechanism appears to be fundamentally different from that in soluble PAP2 enzymes. In ecPgpB, the potential substrate entrance to the active site is located in a cleft formed by a V-shaped transmembrane helix pair, allowing lateral movement of the lipid substrate entering the active site from the membrane lipid bilayer. Activity assays of point mutations confirmed the importance of the catalytic residues and potential residues involved in phosphate binding. The structure also suggests an induced-fit mechanism for the substrate binding. The 3D structure of ecPgpB serves as a prototype to study eukaryotic PAP2 enzymes, including human glucose-6-phosphatase, a key enzyme in the homeostatic regulation of blood glucose concentrations. PMID:24821770

  7. Crystal structure of lipid phosphatase Escherichia coli phosphatidylglycerophosphate phosphatase B.

    PubMed

    Fan, Junping; Jiang, Daohua; Zhao, Yan; Liu, Jianfeng; Zhang, Xuejun Cai

    2014-05-27

    Membrane-integrated type II phosphatidic acid phosphatases (PAP2s) are important for numerous bacterial to human biological processes, including glucose transport, lipid metabolism, and signaling. Escherichia coli phosphatidylglycerol-phosphate phosphatase B (ecPgpB) catalyzes removing the terminal phosphate group from a lipid carrier, undecaprenyl pyrophosphate, and is essential for transport of many hydrophilic small molecules across the membrane. We determined the crystal structure of ecPgpB at a resolution of 3.2 Å. This structure shares a similar folding topology and a nearly identical active site with soluble PAP2 enzymes. However, the substrate binding mechanism appears to be fundamentally different from that in soluble PAP2 enzymes. In ecPgpB, the potential substrate entrance to the active site is located in a cleft formed by a V-shaped transmembrane helix pair, allowing lateral movement of the lipid substrate entering the active site from the membrane lipid bilayer. Activity assays of point mutations confirmed the importance of the catalytic residues and potential residues involved in phosphate binding. The structure also suggests an induced-fit mechanism for the substrate binding. The 3D structure of ecPgpB serves as a prototype to study eukaryotic PAP2 enzymes, including human glucose-6-phosphatase, a key enzyme in the homeostatic regulation of blood glucose concentrations.

  8. Robust production of recombinant phosphoproteins using cell-free protein synthesis

    PubMed Central

    Oza, Javin P.; Aerni, Hans R.; Pirman, Natasha L.; Barber, Karl W.; ter Haar, Charlotte M.; Rogulina, Svetlana; Amrofell, Matthew B.; Isaacs, Farren J.; Rinehart, Jesse; Jewett, Michael C.

    2015-01-01

    Understanding the functional and structural consequences of site-specific protein phosphorylation has remained limited by our inability to produce phosphoproteins at high yields. Here we address this limitation by developing a cell-free protein synthesis (CFPS) platform that employs crude extracts from a genomically recoded strain of Escherichia coli for site-specific, co-translational incorporation of phosphoserine into proteins. We apply this system to the robust production of up to milligram quantities of human MEK1 kinase. Then, we recapitulate a physiological signalling cascade in vitro to evaluate the contributions of site-specific phosphorylation of mono- and doubly phosphorylated forms on MEK1 activity. We discover that only one phosphorylation event is necessary and sufficient for MEK1 activity. Our work sets the stage for using CFPS as a rapid high-throughput technology platform for direct expression of programmable phosphoproteins containing multiple phosphorylated residues. This work will facilitate study of phosphorylation-dependent structure–function relationships, kinase signalling networks and kinase inhibitor drugs. PMID:26350765

  9. Proteomic profiling of the phosphoproteins in the rat thalamus, hippocampus and frontal lobe after propofol anesthesia

    PubMed Central

    2014-01-01

    Background Propofol is a safe and effective intravenous anesthetic that is widely used for the induction and maintenance of anesthesia during surgery. However, the mechanism by which propofol exerts its anesthetic effect remains unknown. The rapid onset of phosphorylation modifications coincides with that of propofol anesthesia. Methods Propofol-anesthetized rat models were built and phosphorylated proteins in the thalamus, hippocampus and frontal lobe were enriched the to analyze the changes in these phosphoproteins after propofol anesthesia. Results Sixteen of these phosphoprotein spots were successfully identified using MALDI-TOF MS and a subsequent comparative sequence search in the Mascot database. Of these proteins, keratin 18 and the tubulin 2c chain are cytoskeletal proteins; keratin 18 and gelsolin are relevant to alcohol drowsiness. Based on Western blot analysis, we also confirmed that the phosphorylation of these proteins is directly induced by propofol, indicating that propofol anesthesia may be relevant to cytoskeletal proteins and alcohol drowsiness. Conclusions These identified propofol-induced phosphorylations of proteins provide meaningful contributions for further studying the anesthetic mechanism of propofol. PMID:24410762

  10. Selection and characterization of single-chain recombinant antibodies against phosphoprotein of Newcastle disease virus.

    PubMed

    Li, Benqiang; Ye, Jiaxin; Lin, Yuan; Wang, Man; Jia, Rui; Zhu, Jianguo

    2014-09-01

    Phosphoprotein (P), involved in virus RNA replication and transcription, had become a new target for the research on treating Newcastle disease virus (NDV). Here we described the cloning and expression of phosphoprotein from NDV, and then screened the anti-P antibodies from the chicken single chain fragment variable (scFv) library, which were generated from chickens immunized with the ND vaccines. As a first step, the recombinant expression vector pET28a-P was successfully constructed. In a following step, two anti-P positive scFv clones from the scFv library were selected by indirect enzyme-linked immunosorbent assay (ELISA) method. The sequence analysis of two positive clones showed that there were more variation in complementary determine region (CDR) of VH and VL, and the CDR3 in VH exhibited a significant change in amino acid number and type. In another experiment, the purified scFv antibodies used in the assay was shown to be specific for NDV-P by western blot. The results indicated that the strategy we used in this experiment proved to be convenient way for screening scFv antibody, which paved a new way for the immunization diagnosis and the exploration of integrated control of NDV.

  11. Protein tyrosine phosphatase: enzymatic assays.

    PubMed

    Montalibet, Jacqueline; Skorey, Kathryn I; Kennedy, Brian P

    2005-01-01

    Activity assays for tyrosine phosphatases are based on the hydrolysis of a arylphosphate moiety from a synthetic substrate yielding a spectroscopically active product. Many different substrates can be used for these assays with p-nitrophenyl phosphate (pNPP), fluorescein diphosphate (FDP), and 6,8-difluoro-4-methylumbellyferyl phosphate (DiFMUP) being the most efficient and versatile. Equally, larger molecules such as phosphotyrosyl peptides can also be used to mimic more natural substrates. Activity assays include the determinations of the rate of dephosphorylation and calculations of kinetic constants such as k(cat) and K(M). These assays are useful to identify and characterize tyrosine phosphatases and are commonly used to evaluate the efficiency of inhibitors.

  12. Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

    PubMed

    Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

    2014-06-01

    Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Substrate specificity and pH dependence of homogeneous wheat germ acid phosphatase.

    PubMed

    Van Etten, R L; Waymack, P P

    1991-08-01

    The broad substrate specificity of a homogeneous isoenzyme of wheat germ acid phosphatase (WGAP) was extensively investigated by chromatographic, electrophoretic, NMR, and kinetic procedures. WGAP exhibited no divalent metal ion requirement and was unaffected upon incubation with EDTA or o-phenanthroline. A comparison of two catalytically homogeneous isoenzymes revealed little difference in substrate specificity. The specificity of WGAP was established by determining the Michaelis constants for a wide variety of substrates. p-Nitrophenyl phosphate, pyrophosphate, tripolyphosphate, and ATP were preferred substrates while lesser activities were seen toward sugar phosphates, trimetaphosphate, phosphoproteins, and (much less) phosphodiesters. An extensive table of Km and Vmax values is given. The pathway for the hydrolysis of trimetaphosphate was examined by colorimetric and 31P NMR methods and it was found that linear tripolyphosphate is not a free intermediate in the enzymatic reaction. In contrast to literature reports, homogeneous wheat germ acid phosphatase exhibits no measurable carboxylesterase activity, nor does it hydrolyze phenyl phosphonothioate esters or phytic acid at significant rates.

  14. Combining Genetic Perturbations and Proteomics to Examine Kinase-Phosphatase Networks in Drosophila Embryos

    PubMed Central

    Sopko, Richelle; Foos, Marianna; Vinayagam, Arunachalam; Zhai, Bo; Binari, Richard; Hu, Yanhui; Randklev, Sakara; Perkins, Lizabeth A.; Gygi, Steven P.; Perrimon, Norbert

    2014-01-01

    Summary Connecting phosphorylation events to kinases and phosphatases is key to understanding the molecular organization and signaling dynamics of networks. We have generated a validated set of transgenic RNA-interference reagents for knockdown and characterization of all protein kinases and phosphatases present during early Drosophila melanogaster development. These genetic tools enable collection of sufficient quantities of embryos depleted of single gene products for proteomics. As a demonstration of an application of the collection, we have used multiplexed isobaric-labeling for quantitative proteomics to derive global phosphorylation signatures associated with kinase-depleted embryos, in order to systematically link phosphosites with relevant kinases. We demonstrate how this strategy uncovers kinase consensus motifs and prioritizes phosphoproteins for kinase target validation. We validate this approach by providing auxiliary evidence for Wee kinase-directed regulation of the chromatin regulator Stonewall. Further, we show how correlative phosphorylation at the site level can indicate function, as exemplified by Sterile20-like kinase-dependent regulation of Stat92E. PMID:25284370

  15. Alkaline phosphatase of Physarum polycephalum is insoluble.

    PubMed

    Furuhashi, Kiyoshi

    2008-02-01

    The plasmodia of Physarum polycephalum grow as multinucleated cells in the presence of sufficient humidity and nutriment. Under non-illuminating conditions, stresses such as low temperature or high concentrations of salts transform the plasmodia into spherules whereas dehydration induces sclerotization. Some phosphatases including protein phosphatase and acid phosphatase have been purified from the plasmodia, but alkaline phosphatase remains to be elucidated. Phosphatase of the plasmodia, spherules and sclerotia was visualized by electrophoresis gel-staining assay using 5-bromo-4-chloro-3-indolyl phosphate. Insoluble fractions of the sclerotia were abundant in phosphatase activity. The phosphatase which was extracted by nonionic detergent was subjected to column chromatography and preparative electrophoresis. Purified phosphatase showed the highest activity at pH 8.8, indicating that this enzyme belongs to alkaline phosphatase. The apparent molecular mass from sodium dodecyl sulfate-polyacrylamide gel electrophoresis under non-reducing condition was estimated to be 100 kDa whereas that under reducing was 105 kDa. An amount of 1% sodium dodecyl sulfate or 0.5 M NaCl had no effects on the activity although the phosphatase showed heat instability, Mg(2+)-dependency and sensitivity to 2-glycerophosphate or NaF. The extracting conditions and enzymatic properties suggest that this alkaline phosphatase which is in a membrane-bound form plays important roles in phosphate metabolism.

  16. The glucose-6-phosphatase system.

    PubMed Central

    van Schaftingen, Emile; Gerin, Isabelle

    2002-01-01

    Glucose-6-phosphatase (G6Pase), an enzyme found mainly in the liver and the kidneys, plays the important role of providing glucose during starvation. Unlike most phosphatases acting on water-soluble compounds, it is a membrane-bound enzyme, being associated with the endoplasmic reticulum. In 1975, W. Arion and co-workers proposed a model according to which G6Pase was thought to be a rather unspecific phosphatase, with its catalytic site oriented towards the lumen of the endoplasmic reticulum [Arion, Wallin, Lange and Ballas (1975) Mol. Cell. Biochem. 6, 75--83]. Substrate would be provided to this enzyme by a translocase that is specific for glucose 6-phosphate, thereby accounting for the specificity of the phosphatase for glucose 6-phosphate in intact microsomes. Distinct transporters would allow inorganic phosphate and glucose to leave the vesicles. At variance with this substrate-transport model, other models propose that conformational changes play an important role in the properties of G6Pase. The last 10 years have witnessed important progress in our knowledge of the glucose 6-phosphate hydrolysis system. The genes encoding G6Pase and the glucose 6-phosphate translocase have been cloned and shown to be mutated in glycogen storage disease type Ia and type Ib respectively. The gene encoding a G6Pase-related protein, expressed specifically in pancreatic islets, has also been cloned. Specific potent inhibitors of G6Pase and of the glucose 6-phosphate translocase have been synthesized or isolated from micro-organisms. These as well as other findings support the model initially proposed by Arion. Much progress has also been made with regard to the regulation of the expression of G6Pase by insulin, glucocorticoids, cAMP and glucose. PMID:11879177

  17. Stimulation of tumor necrosis factor alpha production in human monocytes by inhibitors of protein phosphatase 1 and 2A

    PubMed Central

    1992-01-01

    The protein phosphatase 1 and 2A inhibitor, okadaic acid, has been shown to stimulate many cellular functions by increasing the phosphorylation state of phosphoproteins. In human monocytes, okadaic acid by itself stimulates tumor necrosis factor alpha (TNF-alpha) mRNA accumulation and TNF-alpha synthesis. Calyculin A, a more potent inhibitor of phosphatase 1, has similar effects. TNF-alpha mRNA accumulation in okadaic acid-treated monocytes is due to increased TNF- alpha mRNA stability and transcription rate. The increase in TNF-alpha mRNA stability is more remarkable in okadaic acid-treated monocytes than the mRNA stability of other cytokines, such as interleukin 1 alpha (IL-1 alpha), IL-1 beta, and IL-6. Gel retardation studies show the stimulation of AP-1, AP-2, and NF-kappa B binding activities in okadaic acid-stimulated monocytes. This increase may correlate with the increase in TNF-alpha mRNA transcription rate. In addition to the stimulation of TNF-alpha secretion by monocytes, okadaic acid appears to modulate TNF-alpha precursor processing, as indicated by a marked increase in the cell-associated 26-kD precursor. These results suggest that active basal phosphorylation/dephosphorylation occurs in monocytes, and that protein phosphatase 1 or 2A is important in regulating TNF-alpha gene transcription, translation, and posttranslational modification. PMID:1324971

  18. Isolation of a calcium-binding phosphoprotein from the oocytes and hemolymph of the blood-sucking insect Rhodnius prolixus.

    PubMed

    Silva-Neto, M A; Atella, G C; Fialho, E; Paes, M C; Zingali, R B; Petretski, J H; Alves, E W; Masuda, H

    1996-11-22

    A novel calcium-binding phosphoprotein was isolated from the oocytes of the blood-sucking bug Rhodnius prolixus. This protein exhibits an apparent molecular mass of 18 kDa on gel filtration, but migrates as an 8-kDa band on N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine/SDS-polyacrylamide gels. It has a high content of serine (24% of the total number of residues), and phosphoserine is the sole amino acid phosphorylated in vivo. A similar protein was partially purified from the hemolymph. It resembles the oocyte form of the protein in its NH2-terminal sequence and its ability to be taken up by growing ovaries. 45Ca binding to the oocyte phosphoprotein was determined after SDS-polyacrylamide gel electrophoresis followed by blotting on nitrocellulose membranes. Titration of Ca2+-binding sites shows a high capacity (approximately 50 mol/mol of protein), but a low affinity (K0.5 congruent with 10(-3) M). Based on these characteristics, we have named this protein Rhodnius calcium-binding phosphoprotein. It resembles phosvitin, a phosphoprotein present in the oocytes of nonmammalian vertebrates.

  19. Identification of nuclear phosphoproteins as novel tobacco markers in mouse lung tissue following short-term exposure to tobacco smoke

    PubMed Central

    Niimori-Kita, Kanako; Ogino, Kiyoshi; Mikami, Sayaka; Kudoh, Shinji; Koizumi, Daikai; Kudoh, Noritaka; Nakamura, Fumiko; Misumi, Masahiro; Shimomura, Tadasuke; Hasegawa, Koki; Usui, Fumihiko; Nagahara, Noriyuki; Ito, Takaaki

    2014-01-01

    Smoking is a risk factor for lung diseases, including chronic obstructive pulmonary disease and lung cancer. However, the molecular mechanisms mediating the progression of these diseases remain unclear. Therefore, we sought to identify signaling pathways activated by tobacco-smoke exposure, by analyzing nuclear phosphoprotein expression using phosphoproteomic analysis of lung tissue from mice exposed to tobacco smoke. Sixteen mice were exposed to tobacco smoke for 1 or 7 days, and the expression of phosphorylated peptides was analyzed by mass spectrometry. A total of 253 phosphoproteins were identified, including FACT complex subunit SPT16 in the 1-day exposure group, keratin type 1 cytoskeletal 18 (K18), and adipocyte fatty acid-binding protein, in the 7-day exposure group, and peroxiredoxin-1 (OSF3) and spectrin β chain brain 1 (SPTBN1), in both groups. Semi-quantitative analysis of the identified phosphoproteins revealed that 33 proteins were significantly differentially expressed between the control and exposed groups. The identified phosphoproteins were classified according to their biological functions. We found that the identified proteins were related to inflammation, regeneration, repair, proliferation, differentiation, morphogenesis, and response to stress and nicotine. In conclusion, we identified proteins, including OSF3 and SPTBN1, as candidate tobacco smoke-exposure markers; our results provide insights into the mechanisms of tobacco smoke-induced diseases. PMID:25349779

  20. Ca2+ uptake, Ca2+-ATPase activity, phosphoprotein formation and phosphate turnover in a microsomal fraction of smooth muscle.

    PubMed

    Raeymaekers, L; Hasselbach, W

    1981-05-15

    Vesicles capable of phosphate-stimulated calcium uptake were isolated from the microsomal fraction of the smooth muscle of the pig stomach according to a previously described procedure which consists in increasing the density of the vesicles by loading them with calcium phosphate and isolating them by centrifugation [Raeymaekers, L., Agostini, B., and Hasselbach, W. (1981) Histochemistry, 70, 139--150]. These vesicles, which contain calcium phosphate deposits, are able to accumulate an additional amount of calcium. This calcium uptake is accompanied by calcium-stimulated ATPase activity and by the formation of an acid-stable phosphoprotein. The acid-denatured phosphoprotein is dephosphorylated by hydroxylamine, which indicates that an acylphosphate is formed. This phosphoprotein probably represents a phosphorylated transport intermediate similar to that seen with the Ca2+-ATPase of sarcoplasmic reticulum of skeletal muscle. As with the Ca2+-ATPase of sarcoplasmic reticulum vesicles, this vesicular fraction catalyses an exchange between inorganic phosphate and the gamma-phosphate of ATP (ATP-Pi exchange) which is dependent on the presence of intravesicular calcium, and an exchange of phosphate between ATP and ADP (ATP-ADP exchange). The results further indicate that the turnover rate of the calcium pump, calculated from the ratio of calcium-stimulated ATPase activity to the steady-state level of phosphoprotein, is similar to that of Ca2+-ATPase of sarcoplasmic reticulum of skeletal muscle.

  1. Structural Basis for the Catalytic Activity of Human Serine/Threonine Protein Phosphatase type 5 (PP5)

    NASA Technical Reports Server (NTRS)

    Swingle, Mark R.; Ciszak, Ewa M.; Honkanen, Richard E.

    2004-01-01

    Serine/threonine protein phosphatase-5 (PP5) is a member of the PPP-gene family of protein phosphatases that is widely expressed in mammalian tissues and is highly conserved among eukaryotes. PP5 associates with several proteins that affect signal transduction networks, including the glucocorticoid receptor (GR)-heat shock protein-90 (Hsp90)-heterocomplex, the CDC16 and CDC27 subunits of the anaphase-promoting complex, elF2alpha kinase, the A subunit of PP2A, the G12-alpha / G13-alpha subunits of heterotrimeric G proteins and DNA-PK. The catalytic domain of PP5 (PP5c) shares 35-45% sequence identity with the catalytic domains of other PPP-phosphatases, including protein phosphatase-1 (PP1), -2A (PP2A), -2B / calcineurin (PP2B), -4 (PP4), -6 (PP6), and -7 (PP7). Like PP1, PP2A and PP4, PP5 is also sensitive to inhibition by okadaic acid, microcystin, cantharidin, tautomycin, and calyculin A. Here we report the crystal structure of the PP5 catalytic domain (PP5c) at a resolution of 1.6 angstroms. From this structure we propose a mechanism for PP5-mediated hydrolysis of phosphoprotein substrates, which requires the precise positioning of two metal ions within a conserved Asp(sup 271)-M(sub 1):M(sub 2)-W(sup 1)-His(sup 304)-Asp(sup 274) catalytic motif. The structure of PP5c provides a possible structural basis for explaining the exceptional catalytic proficiency of protein phosphatases, which are among the most powerful known catalysts. Resolution of the entire C-terminus revealed a novel subdomain, and the structure of the PP5c should also aid development of type-specific inhibitors.

  2. Structural Basis for the Catalytic Activity of Human Serine/Threonine Protein Phosphatase type 5 (PP5)

    NASA Technical Reports Server (NTRS)

    Swingle, Mark R.; Ciszak, Ewa M.; Honkanen, Richard E.

    2004-01-01

    Serine/threonine protein phosphatase-5 (PP5) is a member of the PPP-gene family of protein phosphatases that is widely expressed in mammalian tissues and is highly conserved among eukaryotes. PP5 associates with several proteins that affect signal transduction networks, including the glucocorticoid receptor (GR)-heat shock protein-90 (Hsp90)-heterocomplex, the CDC16 and CDC27 subunits of the anaphase-promoting complex, elF2alpha kinase, the A subunit of PP2A, the G12-alpha / G13-alpha subunits of heterotrimeric G proteins and DNA-PK. The catalytic domain of PP5 (PP5c) shares 35-45% sequence identity with the catalytic domains of other PPP-phosphatases, including protein phosphatase-1 (PP1), -2A (PP2A), -2B / calcineurin (PP2B), -4 (PP4), -6 (PP6), and -7 (PP7). Like PP1, PP2A and PP4, PP5 is also sensitive to inhibition by okadaic acid, microcystin, cantharidin, tautomycin, and calyculin A. Here we report the crystal structure of the PP5 catalytic domain (PP5c) at a resolution of 1.6 angstroms. From this structure we propose a mechanism for PP5-mediated hydrolysis of phosphoprotein substrates, which requires the precise positioning of two metal ions within a conserved Asp(sup 271)-M(sub 1):M(sub 2)-W(sup 1)-His(sup 304)-Asp(sup 274) catalytic motif. The structure of PP5c provides a possible structural basis for explaining the exceptional catalytic proficiency of protein phosphatases, which are among the most powerful known catalysts. Resolution of the entire C-terminus revealed a novel subdomain, and the structure of the PP5c should also aid development of type-specific inhibitors.

  3. Inositol polyphosphate phosphatases in human disease.

    PubMed

    Hakim, Sandra; Bertucci, Micka C; Conduit, Sarah E; Vuong, David L; Mitchell, Christina A

    2012-01-01

    Phosphoinositide signalling molecules interact with a plethora of effector proteins to regulate cell proliferation and survival, vesicular trafficking, metabolism, actin dynamics and many other cellular functions. The generation of specific phosphoinositide species is achieved by the activity of phosphoinositide kinases and phosphatases, which phosphorylate and dephosphorylate, respectively, the inositol headgroup of phosphoinositide molecules. The phosphoinositide phosphatases can be classified as 3-, 4- and 5-phosphatases based on their specificity for dephosphorylating phosphates from specific positions on the inositol head group. The SAC phosphatases show less specificity for the position of the phosphate on the inositol ring. The phosphoinositide phosphatases regulate PI3K/Akt signalling, insulin signalling, endocytosis, vesicle trafficking, cell migration, proliferation and apoptosis. Mouse knockout models of several of the phosphoinositide phosphatases have revealed significant physiological roles for these enzymes, including the regulation of embryonic development, fertility, neurological function, the immune system and insulin sensitivity. Importantly, several phosphoinositide phosphatases have been directly associated with a range of human diseases. Genetic mutations in the 5-phosphatase INPP5E are causative of the ciliopathy syndromes Joubert and MORM, and mutations in the 5-phosphatase OCRL result in Lowe's syndrome and Dent 2 disease. Additionally, polymorphisms in the 5-phosphatase SHIP2 confer diabetes susceptibility in specific populations, whereas reduced protein expression of SHIP1 is reported in several human leukaemias. The 4-phosphatase, INPP4B, has recently been identified as a tumour suppressor in human breast and prostate cancer. Mutations in one SAC phosphatase, SAC3/FIG4, results in the degenerative neuropathy, Charcot-Marie-Tooth disease. Indeed, an understanding of the precise functions of phosphoinositide phosphatases is not only

  4. BECN1-dependent CASP2 incomplete autophagy induction by binding to rabies virus phosphoprotein

    PubMed Central

    Liu, Juan; Wang, Hailong; Gu, Jinyan; Deng, Tingjuan; Yuan, Zhuangchuan; Hu, Boli; Xu, Yunbin; Yan, Yan; Zan, Jie; Liao, Min; DiCaprio, Erin; Li, Jianrong; Su, Shuo; Zhou, Jiyong

    2017-01-01

    ABSTRACT Autophagy is an essential component of host immunity and used by viruses for survival. However, the autophagy signaling pathways involved in virus replication are poorly documented. Here, we observed that rabies virus (RABV) infection triggered intracellular autophagosome accumulation and results in incomplete autophagy by inhibiting autophagy flux. Subsequently, we found that RABV infection induced the reduction of CASP2/caspase 2 and the activation of AMP-activated protein kinase (AMPK)-AKT-MTOR (mechanistic target of rapamycin) and AMPK-MAPK (mitogen-activated protein kinase) pathways. Further investigation revealed that BECN1/Beclin 1 binding to viral phosphoprotein (P) induced an incomplete autophagy via activating the pathways CASP2-AMPK-AKT-MTOR and CASP2-AMPK-MAPK by decreasing CASP2. Taken together, our data first reveals a crosstalk of BECN1 and CASP2-dependent autophagy pathways by RABV infection. PMID:28129024

  5. Structure of the C-Terminal Domain of Lettuce Necrotic Yellows Virus Phosphoprotein

    PubMed Central

    Martinez, Nicolas; Ribeiro, Euripedes A.; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W. H.

    2013-01-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules. PMID:23785215

  6. Cytorhabdovirus phosphoprotein shows RNA silencing suppressor activity in plants, but not in insect cells.

    PubMed

    Mann, Krin S; Johnson, Karyn N; Dietzgen, Ralf G

    2015-02-01

    RNA silencing in plants and insects provides an antiviral defense and as a countermeasure most viruses encode RNA silencing suppressors (RSS). For the family Rhabdoviridae, no detailed functional RSS studies have been reported in plant hosts and insect vectors. In agroinfiltrated Nicotiana benthamiana leaves we show for the first time for a cytorhabdovirus, lettuce necrotic yellows virus (LNYV), that one of the nucleocapsid core proteins, phosphoprotein (P) has relatively weak local RSS activity and delays systemic silencing of a GFP reporter. Analysis of GFP small RNAs indicated that the P protein did not prevent siRNA accumulation. To explore RSS activity in insects, we used a Flock House virus replicon system in Drosophila S2 cells. In contrast to the plant host, LNYV P protein did not exhibit RSS activity in the insect cells. Taken together our results suggest that P protein may target plant-specific components of RNA silencing post siRNA biogenesis.

  7. Recombinant phosphoprotein based single serum dilution ELISA for rapid serological detection of Newcastle disease virus.

    PubMed

    Das, Moushumee; Kumar, Sachin

    2015-12-01

    Newcastle disease virus (NDV) is the causative agent of a highly contagious disease in avian species. All strains of NDV belong to avian paramyxovirus serotype-1. The disease is endemic in different parts of the world and vaccination is the only way to protect birds from NDV infection. The virus non-structural phosphoprotein (P) is the second most abundant protein and a major modulator of viral replication. Although P protein shows lesser evolutionary divergence among NDV isolates, it is known to be highly divergent among different avian paramyxovirus serotypes. In the present study, a recombinant P protein based single serum dilution ELISA was developed which showed better sensitivity, specificity and accuracy as compared to conventional methods for NDV detection. The recombinant P protein based ELISA could be an alternative to existing diagnostics against NDV infection in chickens.

  8. Secreted Phosphoprotein 1 and Sex-Specific Differences in Silica-Induced Pulmonary Fibrosis in Mice

    PubMed Central

    Latoche, Joseph D.; Ufelle, Alexander Chukwuma; Fazzi, Fabrizio; Ganguly, Koustav; Leikauf, George D.; Fattman, Cheryl L.

    2016-01-01

    Background: Fibrotic lung diseases occur predominantly in males, and reports describe better survival in affected females. Male mice are more sensitive to silica-induced lung fibrosis than silica-treated female mice. Secreted phosphoprotein 1 (SPP1, also known as osteopontin) increases in pulmonary fibrosis, and Spp1 transcription may be regulated by estrogen or estrogen receptor–related receptors. Objective: We determined whether differences in silica-induced SPP1 levels contribute to sex differences in lung fibrosis. Methods: Male and female mice were treated with 0.2 g/kg intratracheal silica, and lung injury was assessed 1, 3, or 14 days post-exposure. Gene-targeted (Spp1–/–) mice, control Spp1+/+ (C57BL/6J) mice, ovariectomized (OVX) female mice, and estrogen-treated male mice were treated with silica, and lung injury was assessed. Results: Silica-induced SPP1 in lung tissue, bronchoalveolar lavage, and serum increased more in male than in female mice. Following silica treatment, bronchoalveolar lavage cell infiltrates decreased in female Spp1–/– mice compared with female Spp1+/+ mice, and lung hydroxyproline decreased in male Spp1–/– mice compared with male Spp1+/+ mice. OVX female mice had increased lung SPP1 expression in response to silica compared with silica-treated sham female mice. Silica-induced lung collagen and hydroxyproline (markers of fibrosis), and SPP1 levels decreased in estrogen-treated males compared with untreated males. Conclusion: These findings suggest that sex-specific differences in SPP1 levels contribute to the differential sensitivity of male and female mice to the development of silica-induced fibrosis. Citation: Latoche JD, Ufelle AC, Fazzi F, Ganguly K, Leikauf GD, Fattman CL. 2016. Secreted phosphoprotein 1 and sex-specific differences in silica-induced pulmonary fibrosis in mice. Environ Health Perspect 124:1199–1207; http://dx.doi.org/10.1289/ehp.1510335 PMID:26955063

  9. Regulation and subcellular localization of the microtubule-destabilizing stathmin family phosphoproteins in cortical neurons.

    PubMed

    Gavet, Olivier; El Messari, Saïd; Ozon, Sylvie; Sobel, André

    2002-06-01

    Stathmin is a ubiquitous cytosolic phosphoprotein, preferentially expressed in the nervous system, and the generic element of a protein family that includes the neural-specific proteins SCG10, SCLIP, and RB3 and its splice variants, RB3' and RB3". All phosphoproteins of the family share with stathmin its tubulin binding and microtubule (MT)-destabilizing activities. To understand better the specific roles of these proteins in neuronal cells, we performed a comparative study of their expression, regulation, and intracellular distribution in embryonic cortical neurons in culture. We found that stathmin is highly expressed ( approximately 0.25% of total proteins) and uniformly present in the various neuronal compartments (cell body, dendrites, axon, growth cones). It appeared mainly unphosphorylated or weakly phosphorylated on one site, and antisera to specific phosphorylated sites (serines 16, 25, or 38) did not reveal a differential regulation of its phosphorylation among neuronal cell compartments. However, they revealed a subpopulation of cells in which stathmin was highly phosphorylated on serine 16, possibly by CaM kinase II also active in a similar subpopulation. The other proteins of the stathmin family are expressed about 100-fold less than stathmin in partially distinct neuronal populations, RB3 being detected in only about 20% of neurons in culture. In contrast to stathmin, they are each mostly concentrated at the Golgi apparatus and are also present along dendrites and axons, including growth cones. Altogether, our results suggest that the different members of the stathmin family have complementary, at least partially distinct functions in neuronal cell regulation, in particular in relation to MT dynamics. Copyright 2002 Wiley-Liss, Inc.

  10. Spatiotemporal phosphoprotein distribution and associated cytokine response of a traumatic injury.

    PubMed

    Han, Alice A; Currie, Holly N; Loos, Matthew S; Vrana, Julie A; Fabyanic, Emily B; Prediger, Maren S; Boyd, Jonathan W

    2016-03-01

    Molecular mechanisms of wound healing have been extensively characterized, providing a better understanding of the processes involved in wound repair and offering advances in treatment methods. Both spatial and temporal investigations of injury biomarkers have helped to pinpoint significant time points and locations during the recovery process, which may be vital in managing the injury and making the appropriate diagnosis. This study addresses spatial and temporal differences of phosphoproteins found in skeletal muscle tissue following a traumatic femur fracture, which were further compared to co-localized cytokine responses. In particular, several proteins (Akt, ERK, c-Jun, CREB, JNK, MEK1, and p38) and post-translational phosphorylations (p-Akt, p-c-Jun, p-CREB, p-ERK1/2, p-MEK1, p-p38, p-GSK3α/β, p-HSP27, p-p70S6K, and p-STAT3) associated with inflammation, new tissue formation, and remodeling were found to exhibit significant spatial and temporal differences in response to the traumatic injury. Quadratic discriminant analysis of all measured responses, including cytokine concentrations from previously published findings, was used to classify temporal and spatial observations at high predictive rates, further confirming that distinct spatiotemporal distributions for total protein, phosphorylation signaling, and cytokine (IL-1α, IL-1ß, IL2, IL6, TNF-α, and MIP-1α) responses exist. Finally, phosphoprotein measurements were found to be significantly correlated to cytokine concentrations, suggesting coordinated intracellular and extracellular activity during crucial periods of repair. This study represents a first attempt to monitor and assess integrated changes in extracellular and intracellular signaling in response to a traumatic injury in muscle tissues, which may provide a framework for future research to improve both our understanding of wounds and their treatment options.

  11. [Protein phosphatases: structure and function].

    PubMed

    Bulanova, E G; Budagian, V M

    1994-01-01

    The process of protein and enzyme systems phosphorylation is necessary for cell growth, differentiation and preparation for division and mitosis. The conformation changes of protein as a result of phosphorylation lead to increased enzyme activity and enhanced affinity to substrates. A large group of enzymes--protein kinases--is responsible for phosphorylation process in cell, which are divided into tyrosine- and serine-threonine-kinases depending on their ability to phosphorylate appropriate amino acid residues. In this review has been considered the functional importance and structure of protein phosphatases--enzymes, which are functional antagonists of protein kinases.

  12. Phosphatidylinositolphosphate phosphatase activities and cancer

    PubMed Central

    Rudge, Simon A.; Wakelam, Michael J. O.

    2016-01-01

    Signaling through the phosphoinositide 3-kinase pathways mediates the actions of a plethora of hormones, growth factors, cytokines, and neurotransmitters upon their target cells following receptor occupation. Overactivation of these pathways has been implicated in a number of pathologies, in particular a range of malignancies. The tight regulation of signaling pathways necessitates the involvement of both stimulatory and terminating enzymes; inappropriate activation of a pathway can thus result from activation or inhibition of the two signaling arms. The focus of this review is to discuss, in detail, the activities of the identified families of phosphoinositide phosphatase expressed in humans, and how they regulate the levels of phosphoinositides implicated in promoting malignancy. PMID:26302980

  13. Biochemistry and structure of phosphoinositide phosphatases.

    PubMed

    Kim, Young Jun; Jahan, Nusrat; Bahk, Young Yil

    2013-01-01

    Phosphoinositides are the phosphorylated derivatives of phosphatidylinositol, and play a very significant role in a diverse range of signaling processes in eukaryotic cells. A number of phosphoinositide-metabolizing enzymes, including phosphoinositide-kinases and phosphatases are involved in the synthesis and degradation of these phospholipids. Recently, the function of various phosphatases in the phosphatidylinositol signaling pathway has been of great interest. In the present review we summarize the structural insights and biochemistry of various phosphatases in regulating phosphoinositide metabolism.

  14. Insulin-receptor phosphotyrosyl-protein phosphatases.

    PubMed Central

    King, M J; Sale, G J

    1988-01-01

    Calmodulin-dependent protein phosphatase has been proposed to be an important phosphotyrosyl-protein phosphatase. The ability of the enzyme to attack autophosphorylated insulin receptor was examined and compared with the known ability of the enzyme to act on autophosphorylated epidermal-growth-factor (EGF) receptor. Purified calmodulin-dependent protein phosphatase was shown to catalyse the complete dephosphorylation of phosphotyrosyl-(insulin receptor). When compared at similar concentrations, 32P-labelled EGF receptor was dephosphorylated at greater than 3 times the rate of 32P-labelled insulin receptor; both dephosphorylations exhibited similar dependence on metal ions and calmodulin. Native phosphotyrosyl-protein phosphatases in cell extracts were also characterized. With rat liver, heart or brain, most (75%) of the native phosphatase activity against both 32P-labelled insulin and EGF receptors was recovered in the particulate fraction of the cell, with only 25% in the soluble fraction. This subcellular distribution contrasts with results of previous studies using artificial substrates, which found most of the phosphotyrosyl-protein phosphatase activity in the soluble fraction of the cell. Properties of particulate and soluble phosphatase activity against 32P-labelled insulin and EGF receptors are reported. The contribution of calmodulin-dependent protein phosphatase activity to phosphotyrosyl-protein phosphatase activity in cell fractions was determined by utilizing the unique metal-ion dependence of calmodulin-dependent protein phosphatase. Whereas Ni2+ (1 mM) markedly activated the calmodulin-dependent protein phosphatase, it was found to inhibit potently both particulate and soluble phosphotyrosyl-protein phosphatase activity. In fractions from rat liver, brain and heart, total phosphotyrosyl-protein phosphatase activity against both 32P-labelled receptors was inhibited by 99.5 +/- 6% (mean +/- S.E.M., 30 observations) by Ni2+. Results of Ni2+ inhibition

  15. Protein phosphatases and Alzheimer's disease.

    PubMed

    Braithwaite, Steven P; Stock, Jeffry B; Lombroso, Paul J; Nairn, Angus C

    2012-01-01

    Alzheimer's Disease (AD) is characterized by progressive loss of cognitive function, linked to marked neuronal loss. Pathological hallmarks of the disease are the accumulation of the amyloid-β (Aβ) peptide in the form of amyloid plaques and the intracellular formation of neurofibrillary tangles (NFTs). Accumulating evidence supports a key role for protein phosphorylation in both the normal and pathological actions of Aβ as well as the formation of NFTs. NFTs contain hyperphosphorylated forms of the microtubule-binding protein tau, and phosphorylation of tau by several different kinases leads to its aggregation. The protein kinases involved in the generation and/or actions of tau or Aβ are viable drug targets to prevent or alleviate AD pathology. However, it has also been recognized that the protein phosphatases that reverse the actions of these protein kinases are equally important. Here, we review recent advances in our understanding of serine/threonine and tyrosine protein phosphatases in the pathology of AD. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Pediatric reference intervals for alkaline phosphatase.

    PubMed

    Zierk, Jakob; Arzideh, Farhad; Haeckel, Rainer; Cario, Holger; Frühwald, Michael C; Groß, Hans-Jürgen; Gscheidmeier, Thomas; Hoffmann, Reinhard; Krebs, Alexander; Lichtinghagen, Ralf; Neumann, Michael; Ruf, Hans-Georg; Steigerwald, Udo; Streichert, Thomas; Rascher, Wolfgang; Metzler, Markus; Rauh, Manfred

    2017-01-01

    Interpretation of alkaline phosphatase activity in children is challenging due to extensive changes with growth and puberty leading to distinct sex- and age-specific dynamics. Continuous percentile charts from birth to adulthood allow accurate consideration of these dynamics and seem reasonable for an analyte as closely linked to growth as alkaline phosphatase. However, the ethical and practical challenges unique to pediatric reference intervals have restricted the creation of such percentile charts, resulting in limitations when clinical decisions are based on alkaline phosphatase activity. We applied an indirect method to generate percentile charts for alkaline phosphatase activity using clinical laboratory data collected during the clinical care of patients. A total of 361,405 samples from 124,440 patients from six German tertiary care centers and one German laboratory service provider measured between January 2004 and June 2015 were analyzed. Measurement of alkaline phosphatase activity was performed on Roche Cobas analyzers using the IFCC's photometric method. We created percentile charts for alkaline phosphatase activity in girls and boys from birth to 18 years which can be used as reference intervals. Additionally, data tables of age- and sex-specific percentile values allow the incorporation of these results into laboratory information systems. The percentile charts provided enable the appropriate differential diagnosis of changes in alkaline phosphatase activity due to disease and changes due to physiological development. After local validation, integration of the provided percentile charts into result reporting facilitates precise assessment of alkaline phosphatase dynamics in pediatrics.

  17. HuPho: the human phosphatase portal.

    PubMed

    Liberti, Susanna; Sacco, Francesca; Calderone, Alberto; Perfetto, Livia; Iannuccelli, Marta; Panni, Simona; Santonico, Elena; Palma, Anita; Nardozza, Aurelio P; Castagnoli, Luisa; Cesareni, Gianni

    2013-01-01

    Phosphatases and kinases contribute to the regulation of protein phosphorylation homeostasis in the cell. Phosphorylation is a key post-translational modification underlying the regulation of many cellular processes. Thus, a comprehensive picture of phosphatase function and the identification of their target substrates would aid a systematic approach to a mechanistic description of cell signalling. Here we present a website designed to facilitate the retrieval of information about human protein phosphatases. To this end we developed a search engine to recover and integrate information annotated in several publicly available web resources. In addition we present a text-mining-assisted annotation effort aimed at extracting phosphatase related data reported in the scientific literature. The HuPho (human phosphatases) website can be accessed at http://hupho.uniroma2.it.

  18. Phosphoprotein affinity purification identifies proteins involved in S-adenosyl-L-methionine-induced enhancement of antibiotic production in Streptomyces coelicolor.

    PubMed

    Meng, Lingzhu; Yang, Seung Hwan; Palaniyandi, Sasikumar Arunachalam; Lee, Sung-Kwon; Lee, In-Ae; Kim, Tae-Jong; Suh, Joo-Won

    2011-01-01

    Streptomycetes are the major natural source of clinical antibiotics. The enhanced secondary metabolite production of many streptomycetes by S-adenosylmethionine (SAM) in previous studies suggested the existence of a common SAM regulatory effect. We screened nine proteins using the phosphoprotein purification column from Streptomyces coelicolor. Among them, genes (SCO5477, SCO5113, SCO4647, SCO4885 and SCO1793) for five proteins were disrupted by insertion mutation. The undecylprodigiosin and actinorhodin productions were changed in all mutations. The SAM-induced enhancement of actinorhodin production was abolished by all mutations except SCO4885 mutation, which reduced the production of actinorhodin and undecylprodigiosin with SAM treatment. This study demonstrates that phosphoprotein affinity purification can be used as a screening method to identify the proteins involved SAM signaling.

  19. A Druggable Pocket at the Nucleocapsid/Phosphoprotein Interaction Site of Human Respiratory Syncytial Virus

    PubMed Central

    Ouizougun-Oubari, Mohamed; Pereira, Nelson; Tarus, Bogdan; Galloux, Marie; Lassoued, Safa; Fix, Jenna; Tortorici, M. Alejandra; Hoos, Sylviane; Baron, Bruno; England, Patrick; Desmaële, Didier; Couvreur, Patrick; Bontems, François; Rey, Félix A.; Eléouët, Jean-François; Slama-Schwok, Anny

    2015-01-01

    ABSTRACT Presently, respiratory syncytial virus (RSV), the main cause of severe respiratory infections in infants, cannot be treated efficiently with antivirals. However, its RNA-dependent polymerase complex offers potential targets for RSV-specific drugs. This includes the recognition of its template, the ribonucleoprotein complex (RNP), consisting of genomic RNA encapsidated by the RSV nucleoprotein, N. This recognition proceeds via interaction between the phosphoprotein P, which is the main polymerase cofactor, and N. The determinant role of the C terminus of P, and more particularly of the last residue, F241, in RNP binding and viral RNA synthesis has been assessed previously. Here, we provide detailed structural insight into this crucial interaction for RSV polymerase activity. We solved the crystallographic structures of complexes between the N-terminal domain of N (N-NTD) and C-terminal peptides of P and characterized binding by biophysical approaches. Our results provide a rationale for the pivotal role of F241, which inserts into a well-defined N-NTD pocket. This primary binding site is completed by transient contacts with upstream P residues outside the pocket. Based on the structural information of the N-NTD:P complex, we identified inhibitors of this interaction, selected by in silico screening of small compounds, that efficiently bind to N and compete with P in vitro. One of the compounds displayed inhibitory activity on RSV replication, thereby strengthening the relevance of N-NTD for structure-based design of RSV-specific antivirals. IMPORTANCE Respiratory syncytial virus (RSV) is a widespread pathogen that is a leading cause of acute lower respiratory infections in infants worldwide. RSV cannot be treated efficiently with antivirals, and no vaccine is presently available, with the development of pediatric vaccines being particularly challenging. Therefore, there is a need for new therapeutic strategies that specifically target RSV. The interaction

  20. Borna disease virus phosphoprotein modulates epigenetic signaling in neurons to control viral replication.

    PubMed

    Bonnaud, Emilie M; Szelechowski, Marion; Bétourné, Alexandre; Foret, Charlotte; Thouard, Anne; Gonzalez-Dunia, Daniel; Malnou, Cécile E

    2015-06-01

    Understanding the modalities of interaction of neurotropic viruses with their target cells represents a major challenge that may improve our knowledge of many human neurological disorders for which viral origin is suspected. Borna disease virus (BDV) represents an ideal model to analyze the molecular mechanisms of viral persistence in neurons and its consequences for neuronal homeostasis. It is now established that BDV ensures its long-term maintenance in infected cells through a stable interaction of viral components with the host cell chromatin, in particular, with core histones. This has led to our hypothesis that such an interaction may trigger epigenetic changes in the host cell. Here, we focused on histone acetylation, which plays key roles in epigenetic regulation of gene expression, notably for neurons. We performed a comparative analysis of histone acetylation patterns of neurons infected or not infected by BDV, which revealed that infection decreases histone acetylation on selected lysine residues. We showed that the BDV phosphoprotein (P) is responsible for these perturbations, even when it is expressed alone independently of the viral context, and that this action depends on its phosphorylation by protein kinase C. We also demonstrated that BDV P inhibits cellular histone acetyltransferase activities. Finally, by pharmacologically manipulating cellular acetylation levels, we observed that inhibiting cellular acetyl transferases reduces viral replication in cell culture. Our findings reveal that manipulation of cellular epigenetics by BDV could be a means to modulate viral replication and thus illustrate a fascinating example of virus-host cell interaction. Persistent DNA viruses often subvert the mechanisms that regulate cellular chromatin dynamics, thereby benefitting from the resulting epigenetic changes to create a favorable milieu for their latent and persistent states. Here, we reasoned that Borna disease virus (BDV), the only RNA virus known to

  1. Specificity of a protein phosphatase inhibitor from rabbit skeletal muscle.

    PubMed Central

    Cohen, P; Nimmo, G A; Antoniw, J F

    1977-01-01

    A hear-stable protein, which is a specific inhibitor of protein phosphatase-III, was purified 700-fold from skeletal muscle by a procedure that involved heat-treatment at 95 degrees C, chromatography on DEAE-cellulose and gel filtration on Sephadex G-100. The final step completely resolved the protein phosphatase inhibitor from the protein inhibitor of cyclic AMP-dependent protein kinase. The phosphorylase phosphatase, beta-phosphorylase kinase phosphatase, glycogen synthase phosphatase-1 and glycogen synthase phosphatase-2 activities of protein phosphatase-III [Antoniw, J. F., Nimmo, H. G., Yeaman, S. J. & Cohen, P.(1977) Biochem.J. 162, 423-433] were inhibited in a very similar manner by the protein phosphatase inhibitor and at least 95% inhibition was observed at high concentrations of inhibitor. The two forms of protein phosphatase-III, termed IIIA and IIIB, were equally susceptible to the protein phosphatase inhibitor. The protein phosphatase inhibitor was at least 200 times less effective in inhibiting the activity of protein phosphatase-I and protein phosphatase-II. The high degree of specificity of the inhibitor for protein phosphatase-III was used to show that 90% of the phosphorylase phosphatase and glycogen synthase phosphatase activities measured in muscle extracts are catalysed by protein phosphatase-III. Protein phosphatase-III was tightly associated with the protein-glycogen complex that can be isolated from skeletal muscle, whereas the protein phosphatase inhibitor and protein phosphatase-II were not. The results provide further evidence that the enzyme that catalyses the dephosphorylation of the alpha-subunit of phosphorylase kinase (protein phosphatase-II) and the enzyme that catalyses the dephosphorylation of the beta-subunit of phosphorylase kinase (protein phosphatase-III) are distinct. The results suggest that the protein phosphatase inhibitor may be a useful probe for differentiating different classes of protein phosphatases in mammalian

  2. Phosphoprotein Isotope-Coded Solid-Phase Tag Approach for Enrichment and Quantitative Analysis of Phosphopeptides from Complex Mixtures

    SciTech Connect

    Qian, Weijun ); Goshe, Michael B.; Camp, David G. ); Yu, Li-Rong ); Tang, Keqi ); Smith, Richard D. )

    2003-10-15

    Many cellular processes are regulated by reversible protein phosphorylation and the ability to identify and quantify phosphoproteins from proteomes is essential for gaining a better understanding of these dynamic cellular processes. However, a sensitive, efficient and global method capable of addressing the phosphoproteome has yet to be developed. Here we describe an improved stable-isotope labeling method using a Phosphoprotein Isotope-coded Solid-phase Tag (PhIST) for isolating and measuring the relative abundance of phosphorylated peptides from complex peptide mixtures resulting from the enzymatic digestion of extracted proteins. The PhIST approach is an extension of the previously reported Phosphoprotein Isotope-coded Affinity Tag (PhIAT)approach developed by our laboratory1-2, where the O-phosphate moiety on phosphoseryl or phosphothreonyl residues were derivatized by hydroxide ion-medated B-elimination followed by the addition of 1,2-ethanedithiol (EDT). Instead of using the biotin affinity tag, peptides containing the EDT moiety were captured and labeled in one step using isotope-coded solid-phase reagents containing either light (12C6, 14N) or heavy (13C6, 15N) stable isotopes. The captured peptides labeled with the isotope-coded tags were released from the solid-phase support by UV photocleavage and analyzed by capillary LC-MS/MS. The efficiency and sensitivity of the PhIST labeling approach for identification of phosphopeptides from mixtures was demonstrated using casein phosphoproteins. Its utility for proteomic applications is demonstrated by the labeling of soluble proteins from human breast cancer cell line.

  3. Characterization of phosphoproteins and protein kinase activity of virions, noninfectious enveloped particles, and dense bodies of human cytomegalovirus.

    PubMed Central

    Roby, C; Gibson, W

    1986-01-01

    Phosphorylation of the proteins of human cytomegalovirus (CMV) virions, noninfectious enveloped particles (NIEPs), and dense bodies was investigated. Analyses of particles phosphorylated in vivo showed the following. Virions contain three predominant phosphoproteins (i.e., basic phosphoprotein and upper and lower matrix proteins) and at least nine minor phosphorylated species. NIEPs contain all of these and one additional major species, the assembly protein. Dense bodies contain only one (i.e., lower matrix) of the predominant and four of the minor virion phosphoproteins. Two-dimensional (charge-size) separations in denaturing polyacrylamide gels showed that the relative net charges of the predominant phosphorylated species ranged from the basic phosphoprotein to the more neutral upper matrix protein. In vitro assays showed that purified virions of human CMV have an associated protein kinase activity. The activity was detected only after disrupting the envelope; it had a pH optimum of approximately 9 to 9.5 and required a divalent cation, preferring magnesium to manganese. In vitro, this activity catalyzed phosphorylation of the virion proteins observed to be phosphorylated in vivo. Peptide comparisons indicated that the sites phosphorylated in vitro are a subset of those phosphorylated in vivo, underscoring the probable biological relevance of the kinase activity. Casein, phosvitin, and to a minor extent lysine-rich histones served as exogenous phosphate acceptors. Arginine-rich and lysine-rich histones and protamine sulfate, as well as the polyamines spermine and spermidine, stimulated incorporation of phosphate into the endogenous viral proteins. Virions of all human and simian CMV strains tested showed this activity. Analyses of other virus particles, including three intracellular capsid forms (i.e., A, B, and C capsids), NIEPs, and dense bodies, indicated that the active enzyme was not present in the capsid. Rate-velocity sedimentation of disrupted virions

  4. Growth-associated phosphoprotein expression is increased in the supragranular regions of the dentate gyrus following pilocarpine-induced seizures in rats.

    PubMed

    Naffah-Mazzacoratti, M G; Funke, M G; Sanabria, E R; Cavalheiro, E A

    1999-01-01

    Neuroplasticity has been investigated considering the neuronal growth-associated phosphoprotein as a marker of neuronal adaptive capabilities. In the present work, studying the hippocampal reorganization observed in the epilepsy model induced by pilocarpine, we carried out quantitative western blotting associated with immunohistochemistry to determine the distribution of growth-associated phosphoprotein in the hippocampus of rats in acute, silent and chronic periods of this epilepsy model. The fibers and punctate elements from the inner molecular layer of the dentate gyrus were strongly immunostained in animals killed 5 h after status epilepticus, compared with the same region in control animals. Rats presenting partial seizures showed no alterations in the immunostaining pattern compared with saline-treated animals. The hippocampal dentate gyrus of animals during the seizure-free period and presenting spontaneous recurrent seizures was also characterized by strong growth-associated phosphoprotein immunostaining of fibers and punctate elements in the inner molecular layer, contrasting with the control group. As determined by western blotting analysis, growth-associated phosphoprotein levels increased following status epilepticus and remained elevated at the later time-points, both during the silent period and during the period of chronic recurring seizures. Pilocarpine-treated animals, which did not develop status epilepticus, showed no change in growth-associated phosphoprotein levels, indicating that status epilepticus is important to induce growth-associated phosphoprotein overexpression. The measurement of this overexpression could represent one of the early signals of hippocampal reorganization due to status epilepticus-induced damage.

  5. Comparative Phosphoproteomic Analysis under High-Nitrogen Fertilizer Reveals Central Phosphoproteins Promoting Wheat Grain Starch and Protein Synthesis

    PubMed Central

    Zhen, Shoumin; Deng, Xiong; Zhang, Ming; Zhu, Gengrui; Lv, Dongwen; Wang, Yaping; Zhu, Dong; Yan, Yueming

    2017-01-01

    Nitrogen (N) is a macronutrient important for plant growth and development. It also strongly influences starch and protein synthesis, closely related to grain yield and quality. We performed the first comparative phosphoproteomic analysis of developing wheat grains in response to high-N fertilizer. Physiological and biochemical analyses showed that application of high-N fertilizer resulted in significant increases in leaf length and area, chlorophyll content, the activity of key enzymes in leaves such as nitrate reductase (NR), and in grains such as sucrose phosphate synthase (SPS), sucrose synthase (SuSy), and ADP glucose pyrophosphorylase (AGPase). This enhanced enzyme activity led to significant improvements in starch content, grain yield, and ultimately, bread making quality. Comparative phosphoproteomic analysis of developing grains under the application of high-N fertilizer performed 15 and 25 days post-anthesis identified 2470 phosphosites among 1372 phosphoproteins, of which 411 unique proteins displayed significant changes in phosphorylation level (>2-fold or <0.5-fold). These phosphoproteins are involved mainly in signaling transduction, starch synthesis, energy metabolism. Pro-Q diamond staining and Western blotting confirmed our phosphoproteomic results. We propose a putative pathway to elucidate the important roles of the central phosphoproteins regulating grain starch and protein synthesis. Our results provide new insights into the molecular mechanisms of protein phosphorylation modifications involved in grain development, yield and quality formation. PMID:28194157

  6. DNA topoisomerase II alpha is the major chromosome protein recognized by the mitotic phosphoprotein antibody MPM-2.

    PubMed Central

    Taagepera, S; Rao, P N; Drake, F H; Gorbsky, G J

    1993-01-01

    We have determined that the major mitotic phosphoprotein in chromosomes recognized by the antiphosphoprotein antibody MPM-2 is the 170-kDa isoform of topoisomerase II (topo II), the isoform predominant in proliferating cells. As a prerequisite to making this discovery, it was necessary to develop protocols to protect chromosomal proteins from dephosphorylation during cell extraction and chromosome isolation procedures. Immunofluorescence analysis of the large chromosomes prepared from Indian Muntjac cells revealed colocalization of MPM-2 and anti-topo II antibodies to the chromosomal centromeres and to the axial regions of the chromosomal arms. For biochemical fractionation studies, large quantities of chromosomes from the P388D1 mouse lymphocyte cell line were isolated and treated to remove DNA and histone proteins. Immunoblot and immunoprecipitation experiments with this chromosome scaffold fraction identified the major MPM-2-reactive phosphoprotein to be DNA topo II. Using a panel of anti-peptide antibodies specific to the isoforms of topo II, we determined that the major phosphoprotein recognized by MPM-2 is the 170-kDa isoform of topo II, topo II alpha. The 180-kDa isoform, topo II beta, present in the isolated chromosomes in much smaller quantities, is also recognized by MPM-2. The mitotic phosphorylation of the topo II proteins may be critical for proper chromosome condensation and segregation. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7690961

  7. The transforming proteins of PRCII virus and Rous sarcoma virus form a complex with the same two cellular phosphoproteins.

    PubMed Central

    Adkins, B; Hunter, T; Sefton, B M

    1982-01-01

    P105 and P110, the presumptive transforming proteins of PRCII avian sarcoma virus, have been found to be present in transformed chicken cells in two forms: as monomers and as part of a complex which contains both a 50,000-dalton and a 90,000-dalton cellular phosphoprotein. The 90,000-dalton cellular protein was found to be identical to one of the proteins in chicken cells whose synthesis is induced by stress. The 50,000-dalton protein was found to contain phosphotyrosine when isolated from the complex and therefore may be a substrate for the tyrosine protein kinase activity which is associated with P105 and P110. These same two cellular phosphoproteins have previously been shown to be present in a complex with pp60src, the tyrosine protein kinase which is the transforming protein of Rous sarcoma virus. However, not all avian sarcoma virus transforming proteins with associated tyrosine protein kinase activities form a complex efficiently with these cellular proteins. Little if any of P90, the putative transforming protein of Yamaguchi 73 virus, was found in a complex with the 50,000-dalton and 90,000-dalton cellular phosphoproteins. Images PMID:6180178

  8. The PAXgene® Tissue System Preserves Phosphoproteins in Human Tissue Specimens and Enables Comprehensive Protein Biomarker Research

    PubMed Central

    Gündisch, Sibylle; Schott, Christina; Wolff, Claudia; Tran, Kai; Beese, Christian; Viertler, Christian; Zatloukal, Kurt; Becker, Karl-Friedrich

    2013-01-01

    Precise quantitation of protein biomarkers in clinical tissue specimens is a prerequisite for accurate and effective diagnosis, prognosis, and personalized medicine. Although progress is being made, protein analysis from formalin-fixed and paraffin-embedded tissues is still challenging. In previous reports, we showed that the novel formalin-free tissue preservation technology, the PAXgene Tissue System, allows the extraction of intact and immunoreactive proteins from PAXgene-fixed and paraffin-embedded (PFPE) tissues. In the current study, we focused on the analysis of phosphoproteins and the applicability of two-dimensional gel electrophoresis (2D-PAGE) and enzyme-linked immunosorbent assay (ELISA) to the analysis of a variety of malignant and non-malignant human tissues. Using western blot analysis, we found that phosphoproteins are quantitatively preserved in PFPE tissues, and signal intensities are comparable to that in paired, frozen tissues. Furthermore, proteins extracted from PFPE samples are suitable for 2D-PAGE and can be quantified by ELISA specific for denatured proteins. In summary, the PAXgene Tissue System reliably preserves phosphoproteins in human tissue samples, even after prolonged fixation or stabilization times, and is compatible with methods for protein analysis such as 2D-PAGE and ELISA. We conclude that the PAXgene Tissue System has the potential to serve as a versatile tissue fixative for modern pathology. PMID:23555997

  9. Mumps Virus Nucleoprotein Enhances Phosphorylation of the Phosphoprotein by Polo-Like Kinase 1.

    PubMed

    Pickar, Adrian; Zengel, James; Xu, Pei; Li, Zhuo; He, Biao

    2015-11-25

    The viral RNA-dependent RNA polymerases (vRdRps) of nonsegmented, negative-sense viruses (NNSVs) consist of the enzymatic large protein (L) and the phosphoprotein (P). P is heavily phosphorylated, and its phosphorylation plays a critical role in viral RNA synthesis. Since NNSVs do not encode kinases, P is phosphorylated by host kinases. In this study, we investigate the roles that viral proteins play in the phosphorylation of mumps virus (MuV) P. We found that nucleoprotein (NP) enhances the phosphorylation of P. We have identified the serine/threonine kinase Polo-like kinase 1 (PLK1) as a host kinase that phosphorylates P and have found that phosphorylation of P by PLK1 is enhanced by NP. The PLK1 binding site in MuV P was mapped to residues 146 to 148 within the S(pS/T)P motif, and the phosphorylation site was identified as residues S292 and S294. It has previously been shown that P acts as a chaperone for NP, which encapsidates viral genomic RNA to form the NP-RNA complex, the functional template for viral RNA synthesis. Thus, it is assumed that phosphorylation of P may regulate NP's ability to form the NP-RNA complex, thereby regulating viral RNA synthesis. Our work demonstrates that MuV NP affects phosphorylation of P, suggesting that NP can regulate viral RNA synthesis by regulating phosphorylation of P. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Mumps Virus Nucleoprotein Enhances Phosphorylation of the Phosphoprotein by Polo-Like Kinase 1

    PubMed Central

    Pickar, Adrian; Zengel, James; Xu, Pei; Li, Zhuo

    2015-01-01

    ABSTRACT The viral RNA-dependent RNA polymerases (vRdRps) of nonsegmented, negative-sense viruses (NNSVs) consist of the enzymatic large protein (L) and the phosphoprotein (P). P is heavily phosphorylated, and its phosphorylation plays a critical role in viral RNA synthesis. Since NNSVs do not encode kinases, P is phosphorylated by host kinases. In this study, we investigate the roles that viral proteins play in the phosphorylation of mumps virus (MuV) P. We found that nucleoprotein (NP) enhances the phosphorylation of P. We have identified the serine/threonine kinase Polo-like kinase 1 (PLK1) as a host kinase that phosphorylates P and have found that phosphorylation of P by PLK1 is enhanced by NP. The PLK1 binding site in MuV P was mapped to residues 146 to 148 within the S(pS/T)P motif, and the phosphorylation site was identified as residues S292 and S294. IMPORTANCE It has previously been shown that P acts as a chaperone for NP, which encapsidates viral genomic RNA to form the NP-RNA complex, the functional template for viral RNA synthesis. Thus, it is assumed that phosphorylation of P may regulate NP's ability to form the NP-RNA complex, thereby regulating viral RNA synthesis. Our work demonstrates that MuV NP affects phosphorylation of P, suggesting that NP can regulate viral RNA synthesis by regulating phosphorylation of P. PMID:26608325

  11. Knockdown of Golgi phosphoprotein 2 inhibits hepatocellular carcinoma cell proliferation and motility

    PubMed Central

    Liu, Yiming; Zhang, Xiaodi; Sun, Ting; Jiang, Junchang; Li, Ying; Chen, Mingliang; Wei, Zhen; Jiang, Weiqin; Zhou, Linfu

    2016-01-01

    Golgi phosphoprotein 2 (GP73) is highly expressed in hepatocellular carcinoma (HCC) cells, where it serves as a biomarker and indicator of disease progression. We used MTS assays, anchorage-independent cell colony formation assays and a xenograft tumor model to show that GP73-specific siRNAs inhibit HCC proliferation in HepG2, SMMC-7721, and Huh7 cell lines and in vivo. Following GP73 silencing, levels of p-Rb, a factor related to metastasis, were reduced, but cell cycle progression was unaffected. Our results suggest that GP73 silencing may not directly suppress proliferation, but may instead inhibit cell motility. Results from proliferation assays suggest GP73 reduces expression of epithelial mesenchymal transition (EMT)-related factors and promotes cell motility, while transwell migration and invasion assays indicated a possible role in metastasis. Immunofluorescence co-localization microscopy and immunoblotting showed that GP73 decreases expression of N-cadherin and E-cadherin, two key factors in EMT, which may in turn decrease intracellular adhesive forces and promote cell motility. This study confirmed that GP73 expression leads to increased expression of EMT-related proteins and that GP73 silencing reduces HCC cell migration in vitro. These findings suggest that GP73 silencing through siRNA delivery may provide a novel low-toxicity therapy for the inhibition of tumor proliferation and metastasis. PMID:26870893

  12. Stress-induced phosphoprotein-1 maintains the stability of JAK2 in cancer cells

    PubMed Central

    Jung, Shih-Ming; Tsai, Chi-Neu; Lin, Chiao-Yun; Chen, Shun-Hua; Sue, Shih-Che; Wang, Tzu-Hao; Wang, Hsin-Shih; Lai, Chyong-Huey

    2016-01-01

    Overexpression of stress-induced phosphoprotein 1 (STIP1) − a co-chaperone of heat shock protein (HSP) 70/HSP90 – and activation of the JAK2-STAT3 pathway occur in several tumors. Combined treatment with a HSP90 inhibitor and a JAK2 inhibitor exert synergistic anti-cancer effects. Here, we show that STIP1 stabilizes JAK2 protein in ovarian and endometrial cancer cells. Knock-down of endogenous STIP1 decreased JAK2 and phospho-STAT3 protein levels. The N-terminal fragment of STIP1 interacts with the N-terminus of JAK2, whereas the C-terminal DP2 domain of STIP1 mediates the interaction with HSP90 and STAT3. A peptide fragment in the DP2 domain of STIP1 (peptide 520) disrupted the interaction between STIP1 and HSP90 and induced cell death through JAK2 suppression. In an animal model, treatment with peptide 520 inhibited tumor growth. In summary, STIP1 modulates the function of the HSP90-JAK2-STAT3 complex. Peptide 520 may have therapeutic potential in the treatment of JAK2-overexpressing tumors. PMID:27409672

  13. Short interfering RNAs targeting a vampire-bat related rabies virus phosphoprotein mRNA.

    PubMed

    Ono, Ekaterina Alexandrovna Durymanova; Taniwaki, Sueli Akemi; Brandão, Paulo

    The aim of this study was to assess the in vitro and in vivo effects of short-interfering RNAs (siRNAs) against rabies virus phosphoprotein (P) mRNA in a post-infection treatment for rabies as an extension of a previous report (Braz J Microbiol. 2013 Nov 15;44(3):879-82). To this end, rabies virus strain RABV-4005 (related to the Desmodus rotundus vampire bat) were used to inoculate BHK-21 cells and mice, and the transfection with each of the siRNAs was made with Lipofectamine-2000™. In vitro results showed that siRNA 360 was able to inhibit the replication of strain RABV-4005 with a 1log decrease in virus titter and 5.16-fold reduction in P mRNA, 24h post-inoculation when compared to non-treated cells. In vivo, siRNA 360 was able to induce partial protection, but with no significant difference when compared to non-treated mice. These results indicate that, despite the need for improvement for in vivo applications, P mRNA might be a target for an RNAi-based treatment for rabies. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  14. Nicotinamide attenuates the decrease of astrocytic phosphoprotein PEA-15 in focal cerebral ischemic injury.

    PubMed

    Koh, Phil-Ok

    2012-03-01

    Nicotinamide exerts neuroprotective effects against focal cerebral ischemic injury. Phosphoprotein enriched in astrocytes 15 (PEA-15) is prominently expressed in astrocytes that exert broad anti-apoptotic functions. This study investigated whether nicotinamide modulates PEA-15 and levels of two phosphorylated PEA-15 (Serine 104 and 116) in an animal model of middle cerebral artery occlusion (MCAO)-induced injury. Adult male rats were treated with vehicle or nicotinamide (500 mg/kg) 2 hr after the onset of MCAO and cerebral cortices were collected at 24 hr after MCAO. In a proteomic approach, MCAO induced decreases of PEA-15 levels, while nicotinamide treatment attenuated the injury-induced decrease in PEA-15. The results of Western blot analysis suggest that nicotinamide prevented injury-induced reduction in phospho-PEA-15 (Serine 104) and phospho-PEA-15 (Serine 116) levels. The phosphorylation of PEA-15 exerts anti-apoptotic functions, and reduction of PEA-15 phosphorylation leads to apoptotic cell death. These results suggest that nicotinamide exerts a neuroprotective effect by attenuating the injury-induced decreases of PEA-15 and phospho-PEA-15 (Ser 104 and Ser 116) proteins.

  15. The measles virus phosphoprotein interacts with the linker domain of STAT1

    SciTech Connect

    Devaux, Patricia Priniski, Lauren; Cattaneo, Roberto

    2013-09-15

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.

  16. In Vivo Analysis of the Major Exocytosis-sensitive Phosphoprotein in Tetrahymena

    PubMed Central

    Chilcoat, N. Doane; Turkewitz, Aaron P.

    1997-01-01

    Phosphoglucomutase (PGM) is a ubiquitous highly conserved enzyme involved in carbohydrate metabolism. A number of recently discovered PGM-like proteins in a variety of organisms have been proposed to function in processes other than metabolism. In addition, sequence analysis suggests that several of these may lack PGM enzymatic activity. The best studied PGM-like protein is parafusin, a major phosphoprotein in the ciliate Paramecium tetraurelia that undergoes rapid and massive dephosphorylation when cells undergo synchronous exocytosis of their dense-core secretory granules. Indirect genetic and biochemical evidence also supports a role in regulated exocytotic membrane fusion. To examine this matter directly, we have identified and cloned the parafusin homologue in Tetrahymena thermophila, a ciliate in which protein function can be studied in vivo. The unique T. thermophila gene, called PGM1, encodes a protein that is closely related to parafusin by sequence and by characteristic post-translational modifications. Comparison of deduced protein sequences, taking advantage of the known atomic structure of rabbit muscle PGM, suggests that both ciliate enzymes and all other PGM-like proteins have PGM activity. We evaluated the activity and function of PGM1 through gene disruption. Surprisingly, ΔPGM1 cells displayed no detectable defect in exocytosis, but showed a dramatic decrease in PGM activity. Both our results, and reinterpretation of previous data, suggest that any potential role for PGM-like proteins in regulated exocytosis is unlikely to precede membrane fusion. PMID:9382866

  17. Frameshift mutations in dentin phosphoprotein and dependence of dentin disease phenotype on mutation location.

    PubMed

    Nieminen, Pekka; Papagiannoulis-Lascarides, Lisa; Waltimo-Siren, Janna; Ollila, Päivi; Karjalainen, Sara; Arte, Sirpa; Veerkamp, Jaap; Tallon Walton, Victoria; Chimenos Küstner, Eduard; Siltanen, Tarja; Holappa, Heidi; Lukinmaa, Pirjo-Liisa; Alaluusua, Satu

    2011-04-01

    We describe results from a mutational analysis of the region of the dentin sialophosphoprotein (DSPP) gene encoding dentin phosphoprotein (DPP) in 12 families with dominantly inherited dentin diseases. In eight families (five mutations in the N-terminal third of DPP), the clinical and radiologic features were uniform and compatible with dentin dysplasia type II (DD-II) with major clinical signs in the deciduous dentition. In the other families (four mutations in the more C-terminal part), the permanent teeth also were affected, and the diseases could be classified as variants of dentinogenesis imperfecta. Attrition was not prominent, but periapical infections were common. Discoloring with varying intensity was evident, and pulps and root canals were obliterated in the permanent dentition. All mutations caused a frameshift that replaced the Ser-Ser-Asx repeat by a code for a hydrophobic downstream sequence of approximately original length. We conclude that frameshift mutations in DSPP explain a significant part of dentin diseases. Furthermore, we propose that the location of the mutation is reflected in the phenotypic features as a gradient from DD-II to more severe disease that does not conform to the classic definitions of DI-II. Copyright © 2011 American Society for Bone and Mineral Research.

  18. The phosphoprotein gene of a dolphin morbillivirus isolate exhibits genomic variation at the editing site.

    PubMed

    Bolt, G; Alexandersen, S; Blixenkrone-Møller, M

    1995-12-01

    The nucleotide sequence of the phosphoprotein (P) gene of a dolphin morbillivirus (DMV) isolate was determined. Like those of other morbilliviruses the DMV P gene encoded P and C proteins in overlapping open reading frames and V protein by editing the P gene transcript. Among P mRNA based clones the editing site variants GGGC, GGGG, GAGC and GGGGGGC predicting a P protein, and the variants GGGGC and GGGGGG predicting a V protein, were found. Surprisingly, the three variants GGGC, GGGG and GAGC were also found among clones generated from genomic RNA of the DMV isolate. Thus, more than one viral genome type appeared to be present in cells infected with the DMV isolate. By a similar analysis of the virus genomes in the tissue from which the DMV isolate was obtained, only the GGGC type was found, indicating that the GGGG and GAGC types arose during adaptation of the virus to growth in cell cultures. No editing site variants likely to have arisen by editing the GAGC type were encountered, and it remains ot be determined whether mRNA encoding V protein can be transcribed from genomes with this editing site. Using antisera raised against the common N terminus and unique C termini of the predicted P and V proteins, the in vivo expression of these proteins was demonstrated.

  19. IgM antigen receptor complex contains phosphoprotein products of B29 and mb-1 genes.

    PubMed Central

    Campbell, K S; Hager, E J; Friedrich, R J; Cambier, J C

    1991-01-01

    Membrane immunoglobulin M (mIgM) and mIgD are major B-lymphocyte antigen receptors, which function by internalizing antigens for processing and presentation to T cells and by transducing essential signals for proliferation and differentiation. Although ligation of mIgM or mIgD results in rapid activation of a phospholipase C and a tyrosine kinase(s), these receptors have cytoplasmic tails of only three amino acid residues (Lys-Val-Lys), which seem ill suited for direct physical coupling with cytoplasmic signal transduction structures. In this report, we identify the alpha, beta, and gamma components of the mIgM-associated phosphoprotein complex, which may play a role in signal transduction. Proteolytic peptide mapping demonstrated that the IgM-alpha chain differs from Ig-beta and Ig-gamma. The chains were purified, and amino-terminal sequencing revealed identity with two previously cloned B-cell-specific genes. One component, IgM-alpha, is a product of the mb-1 gene, and the two additional components, Ig-beta and Ig-gamma, are products of the B29 gene. Immunoblotting analysis using rabbit antibodies prepared against predicted peptide sequences of each gene product confirmed the identification of these mIgM-associated proteins. The deduced sequence indicates that these receptor subunits lack inherent protein kinase domains but include common tyrosine-containing sequence motifs, which are likely sites of induced tyrosine phosphorylation. Images PMID:2023945

  20. Sulphation of secreted phosphoprotein I (SPPI, osteopontin) is associated with mineralized tissue formation

    SciTech Connect

    Nagata, T.; Todescan, R.; Goldberg, H.A.; Zhang, Q.; Sodek, J. )

    1989-11-30

    Secreted phosphoprotein I (SPPI) is a prominent structural protein in mineralized connective tissues. Rat bone cells in culture produce several forms of SPPI that differ in post-translational modifications such as phosphorylation and sulphation. To determine the significance of protein sulphation in bone formation, the synthesis of SPPI was studied in vitro using rat bone marrow cells (RBMC) which form bone-like tissue when grown in the presence of dexamethasone (Dex) and beta-glycerophosphate (beta-GP). In the presence of 10(-7) M Dex SPPI expression was stimulated 4-5-fold. Radiolabelling multilayered RBMCs for 48 h with (35S)-methionine, Na2(35SO4), or Na3(32PO4) revealed that two major phosphorylated forms of SPPI were secreted into the culture medium: a highly phosphorylated form migrating at 44 kDa on 15% SDS-PAGE and a less phosphorylated 55 kDa form. In the mineralized tissue formed in the presence of Dex and beta-GP, both forms of SPPI, in addition to proteoglycans and a 67 kDa protein, incorporated significant amounts of (35SO4). Sulphation of SPPI was not observed in the absence of mineral formation, indicating that the sulphation of SPPI is closely associated with mineralization and that it can be used as a sensitive and specific marker for the osteoblastic phenotype.

  1. Borna Disease Virus Phosphoprotein Impairs the Developmental Program Controlling Neurogenesis and Reduces Human GABAergic Neurogenesis

    PubMed Central

    Scordel, Chloé; Szelechowski, Marion; Poulet, Aurélie; Richardson, Jennifer; Benchoua, Alexandra; Gonzalez-Dunia, Daniel; Eloit, Marc; Coulpier, Muriel

    2015-01-01

    It is well established that persistent viral infection may impair cellular function of specialized cells without overt damage. This concept, when applied to neurotropic viruses, may help to understand certain neurologic and neuropsychiatric diseases. Borna disease virus (BDV) is an excellent example of a persistent virus that targets the brain, impairs neural functions without cell lysis, and ultimately results in neurobehavioral disturbances. Recently, we have shown that BDV infects human neural progenitor cells (hNPCs) and impairs neurogenesis, revealing a new mechanism by which BDV may interfere with brain function. Here, we sought to identify the viral proteins and molecular pathways that are involved. Using lentiviral vectors for expression of the bdv-p and bdv-x viral genes, we demonstrate that the phosphoprotein P, but not the X protein, diminishes human neurogenesis and, more particularly, GABAergic neurogenesis. We further reveal a decrease in pro-neuronal factors known to be involved in neuronal differentiation (ApoE, Noggin, TH and Scg10/Stathmin2), demonstrating that cellular dysfunction is associated with impairment of specific components of the molecular program that controls neurogenesis. Our findings thus provide the first evidence that a viral protein impairs GABAergic human neurogenesis, a process that is dysregulated in several neuropsychiatric disorders. They improve our understanding of the mechanisms by which a persistent virus may interfere with brain development and function in the adult. PMID:25923687

  2. Retinophilin is a light-regulated phosphoprotein required to suppress photoreceptor dark noise in Drosophila.

    PubMed

    Mecklenburg, Kirk L; Takemori, Nobuaki; Komori, Naoka; Chu, Brian; Hardie, Roger C; Matsumoto, Hiroyuki; O'Tousa, Joseph E

    2010-01-27

    Photoreceptor cells achieve high sensitivity, reliably detecting single photons, while limiting the spontaneous activation events responsible for dark noise. We used proteomic, genetic, and electrophysiological approaches to characterize Retinophilin (RTP) (CG10233) in Drosophila photoreceptors and establish its involvement in dark-noise suppression. RTP possesses membrane occupation and recognition nexus (MORN) motifs, a structure shared with mammalian junctophilins and other membrane-associated proteins found within excitable cells. We show the MORN repeats, and both the N- and C-terminal domains, are required for RTP localization in the microvillar light-gathering organelle, the rhabdomere. RTP exists in multiple phosphorylated isoforms under dark conditions and is dephosphorylated by light exposure. An RTP deletion mutant exhibits a high rate of spontaneous membrane depolarization events in dark conditions but retains the normal kinetics of the light response. Photoreceptors lacking neither inactivation nor afterpotential C (NINAC) myosin III, a motor protein/kinase, also display a similar dark-noise phenotype as the RTP deletion. We show that NINAC mutants are depleted for RTP. These results suggest the increase in dark noise in NINAC mutants is attributable to lack of RTP and, furthermore, defines a novel role for NINAC in the rhabdomere. We propose that RTP is a light-regulated phosphoprotein that organizes rhabdomeric components to suppress random activation of the phototransduction cascade and thus increases the signaling fidelity of dark-adapted photoreceptors.

  3. An abundant nucleolar phosphoprotein is associated with ribosomal DNA in Tetrahymena macronuclei.

    PubMed Central

    McGrath, K E; Smothers, J F; Dadd, C A; Madireddi, M T; Gorovsky, M A; Allis, C D

    1997-01-01

    An abundant 52-kDa phosphoprotein was identified and characterized from macronuclei of the ciliated protozoan Tetrahymena thermophila. Immunoblot analyses combined with light and electron microscopic immunocytochemistry demonstrate that this polypeptide, termed Nopp52, is enriched in the nucleoli of transcriptionally active macronuclei and missing altogether from transcriptionally inert micronuclei. The cDNA sequence encoding Nopp52 predicts a polypeptide whose amino-terminal half consists of multiple acidic/serine-rich regions alternating with basic/proline-rich regions. Multiple serines located in these acidic stretches lie within casein kinase II consensus motifs, and Nopp52 is an excellent substrate for casein kinase II in vitro. The carboxyl-terminal half of Nopp52 contains two RNA recognition motifs and an extreme carboxyl-terminal domain rich in glycine, arginine, and phenylalanine, motifs common in many RNA processing proteins. A similar combination and order of motifs is found in vertebrate nucleolin and yeast NSR1, suggesting that Nopp52 is a member of a family of related nucleolar proteins. NSR1 and nucleolin have been implicated in transcriptional regulation of rDNA and rRNA processing. Consistent with a role in ribosomal gene metabolism, rDNA and Nopp52 colocalize in situ, as well as by cross-linking and immunoprecipitation experiments, demonstrating an association between Nopp52 and rDNA in vivo. Images PMID:9017598

  4. Dentin sialoprotein and dentin phosphoprotein have distinct roles in dentin mineralization

    PubMed Central

    Suzuki, Shigeki; Sreenath, Taduru; Haruyama, Naoto; Honeycutt, Cherlita; Terse, Anita; Cho, Andrew; Kohler, Thomas; Müller, Ralph; Goldberg, Michel; Kulkarni, Ashok B.

    2009-01-01

    Dentin sialophosphoprotein (DSPP), a major non-collagenous matrix protein of odontoblasts, is proteolytically cleaved into dentin sialoprotein (DSP) and dentin phosphoprotein (DPP). Our previous studies revealed that DSPP null mice display a phenotype similar to human autosomal dominant dentinogenesis imperfecta, in which teeth have widened predentin and irregular dentin mineralization resulting in sporadic unmineralized areas in dentin and frequent pulp exposure. Earlier in vitro studies suggested that DPP, but not DSP, plays a significant role in initiation and maturation of dentin mineralization. However, the precise in vivo roles of DSP and DPP are far from clear. Here we report the generation of DPPcKO mice, in which only DSP is expressed in a DSPP null background, resulting in a conditional DPP knockout. DPPcKO teeth show a partial rescue of the DSPP null phenotype with the restored predentin width, an absence of irregular unmineralized areas in dentin, and less frequent pulp exposure. Micro-computed tomography (micro-CT) analysis of DPPcKO molars further confirmed this partial rescue with a significant recovery in the dentin volume, but not in the dentin mineral density. These results indicate distinct roles of DSP and DPP in dentin mineralization, with DSP regulating initiation of dentin mineralization, and DPP being involved in the maturation of mineralized dentin. PMID:19348940

  5. Structural studies on the authentic mumps virus nucleocapsid showing uncoiling by the phosphoprotein

    PubMed Central

    Cox, Robert; Pickar, Adrian; Qiu, Shihong; Tsao, Jun; Rodenburg, Cynthia; Dokland, Terje; Elson, Andrew; He, Biao; Luo, Ming

    2014-01-01

    Mumps virus (MuV) is a highly contagious pathogen, and despite extensive vaccination campaigns, outbreaks continue to occur worldwide. The virus has a negative-sense, single-stranded RNA genome that is encapsidated by the nucleocapsid protein (N) to form the nucleocapsid (NC). NC serves as the template for both transcription and replication. In this paper we solved an 18-Å–resolution structure of the authentic MuV NC using cryo-electron microscopy. We also observed the effects of phosphoprotein (P) binding on the MuV NC structure. The N-terminal domain of P (PNTD) has been shown to bind NC and appeared to induce uncoiling of the helical NC. Additionally, we solved a 25-Å–resolution structure of the authentic MuV NC bound with the C-terminal domain of P (PCTD). The location of the encapsidated viral genomic RNA was defined by modeling crystal structures of homologous negative strand RNA virus Ns in NC. Both the N-terminal and C-terminal domains of MuV P bind NC to participate in access to the genomic RNA by the viral RNA-dependent-RNA polymerase. These results provide critical insights on the structure-function of the MuV NC and the structural alterations that occur through its interactions with P. PMID:25288750

  6. Protein tyrosine phosphatases as potential therapeutic targets

    PubMed Central

    He, Rong-jun; Yu, Zhi-hong; Zhang, Ruo-yu; Zhang, Zhong-yin

    2014-01-01

    Protein tyrosine phosphorylation is a key regulatory process in virtually all aspects of cellular functions. Dysregulation of protein tyrosine phosphorylation is a major cause of human diseases, such as cancers, diabetes, autoimmune disorders, and neurological diseases. Indeed, protein tyrosine phosphorylation-mediated signaling events offer ample therapeutic targets, and drug discovery efforts to date have brought over two dozen kinase inhibitors to the clinic. Accordingly, protein tyrosine phosphatases (PTPs) are considered next-generation drug targets. For instance, PTP1B is a well-known targets of type 2 diabetes and obesity, and recent studies indicate that it is also a promising target for breast cancer. SHP2 is a bona-fide oncoprotein, mutations of which cause juvenile myelomonocytic leukemia, acute myeloid leukemia, and solid tumors. In addition, LYP is strongly associated with type 1 diabetes and many other autoimmune diseases. This review summarizes recent findings on several highly recognized PTP family drug targets, including PTP1B, Src homology phosphotyrosyl phosphatase 2(SHP2), lymphoid-specific tyrosine phosphatase (LYP), CD45, Fas associated phosphatase-1 (FAP-1), striatal enriched tyrosine phosphatases (STEP), mitogen-activated protein kinase/dual-specificity phosphatase 1 (MKP-1), phosphatases of regenerating liver-1 (PRL), low molecular weight PTPs (LMWPTP), and CDC25. Given that there are over 100 family members, we hope this review will serve as a road map for innovative drug discovery targeting PTPs. PMID:25220640

  7. Dolichyl-phosphate phosphatase and dolichyl-diphosphate phosphatase in rat-liver microsomes.

    PubMed

    Belocopitow, E; Boscoboinik, D

    1982-06-15

    Dolichyl-phosphate phosphatase and dolichyl-diphosphate phosphatase activities of a liver-cell microsomal preparation were solubilized by treatment with Triton X-100. The 100,000 X g supernatant was then passed through a column of Sepharose-4B--concanavalin A. Both enzyme activities were found in the percolate. This treatment eliminated inhibition by ATP and glucose 6-phosphate in both phosphatase activities. In each case the activities were inhibited by higher concentrations of enzyme preparation due to the presence of phospholipids. The inhibitory effects of either phosphatidylcholine or phosphatidylethanolamine were due to competition for detergent. On the other hand, the effect produced by phosphatidic acid appeared to be different, since it did not change the optimal concentration of Triton X-100 for the two enzymes. Dolichyl-phosphate phosphatase was strongly inhibited by both Pi and PPi, whereas dolichyl-diphosphate phosphatase was only slightly inhibited by Pi and not at all by PPi. Dolichyl-diphosphate phosphatase was more inhibited by divalent cations than dolichyl-phosphate phosphatase. The apparent Km of dolichyl-phosphate phosphatase for dolichyl phosphate was 0.15 mM. Dolichol also inhibited dolichyl-phosphate phosphatase, but it produced a stronger inhibition on dolichyl-diphosphate phosphatase. The inhibitory effect of dolichol was not entirely due to detergent competition.

  8. Archaeal signal transduction: impact of protein phosphatase deletions on cell size, motility, and energy metabolism in Sulfolobus acidocaldarius.

    PubMed

    Reimann, Julia; Esser, Dominik; Orell, Alvaro; Amman, Fabian; Pham, Trong Khoa; Noirel, Josselin; Lindås, Ann-Christin; Bernander, Rolf; Wright, Phillip C; Siebers, Bettina; Albers, Sonja-Verena

    2013-12-01

    In this study, the in vitro and in vivo functions of the only two identified protein phosphatases, Saci-PTP and Saci-PP2A, in the crenarchaeal model organism Sulfolobus acidocaldarius were investigated. Biochemical characterization revealed that Saci-PTP is a dual-specific phosphatase (against pSer/pThr and pTyr), whereas Saci-PP2A exhibited specific pSer/pThr activity and inhibition by okadaic acid. Deletion of saci_pp2a resulted in pronounced alterations in growth, cell shape and cell size, which could be partially complemented. Transcriptome analysis of the three strains (Δsaci_ptp, Δsaci_pp2a and the MW001 parental strain) revealed 155 genes that were differentially expressed in the deletion mutants, and showed significant changes in expression of genes encoding the archaella (archaeal motility structure), components of the respiratory chain and transcriptional regulators. Phosphoproteome studies revealed 801 unique phosphoproteins in total, with an increase in identified phosphopeptides in the deletion mutants. Proteins from most functional categories were affected by phosphorylation, including components of the motility system, the respiratory chain, and regulatory proteins. In the saci_pp2a deletion mutant the up-regulation at the transcript level, as well as the observed phosphorylation pattern, resembled starvation stress responses. Hypermotility was also observed in the saci_pp2a deletion mutant. The results highlight the importance of protein phosphorylation in regulating essential cellular processes in the crenarchaeon S. acidocaldarius.

  9. Evolution of alkaline phosphatases in primates.

    PubMed Central

    Goldstein, D J; Rogers, C; Harris, H

    1982-01-01

    Alkaline phosphatase [orthophosphoric-monoester phosphohydrolase (alkaline optimum), EC 3.1.3.1] in placenta, intestine, liver, kidney, bone, and lung from a variety of primate species has been characterized by quantitative inhibition, thermostability, and immunological studies. Characteristic human placental-type alkaline phosphatase occurs in placentas of great apes (chimpanzee and orangutan) but not in placentas of other primates, including gibbon. It is also present in trace amounts in human lung but not in lung or other tissues of various Old and New World monkeys. However, a distinctive alkaline phosphatase resembling it occurs in substantial amounts in lungs from Old World monkeys but not New World monkeys. It appears that duplication of alkaline phosphatase genes and mutations of genetic elements controlling their tissue expression have occurred relatively recently in mammalian evolution. Images PMID:6950431

  10. A Drosophila protein-tyrosine phosphatase associates with an adapter protein required for axonal guidance.

    PubMed

    Clemens, J C; Ursuliak, Z; Clemens, K K; Price, J V; Dixon, J E

    1996-07-19

    We have used the yeast two-hybrid system to isolate a novel Drosophila adapter protein, which interacts with the Drosophila protein-tyrosine phosphatase (PTP) dPTP61F. Absence of this protein in Drosophila causes the mutant photoreceptor axon phenotype dreadlocks (dock) (Garrity, P. A., Rao, Y., Salecker, I., and Zipursky, S. L.(1996) Cell 85, 639-650). Dock is similar to the mammalian oncoprotein Nck and contains three Src homology 3 (SH3) domains and one Src homology 2 (SH2) domain. The interaction of dPTP61F with Dock was confirmed in vivo by immune precipitation experiments. A sequence containing five PXXP motifs from the non-catalytic domain of the PTP is sufficient for interaction with Dock. This suggests that binding to the PTP is mediated by one or more of the SH3 domains of Dock. Immune precipitations of Dock also co-precipitate two tyrosine-phosphorylated proteins having molecular masses of 190 and 145 kDa. Interactions between Dock and these tyrosine-phosphorylated proteins are likely mediated by the Dock SH2 domain. These findings identify potential signal-transducing partners of Dock and propose a role for dPTP61F and the unidentified phosphoproteins in axonal guidance.

  11. Multiple Functions of the Eya Phosphotyrosine Phosphatase

    PubMed Central

    2015-01-01

    Eyes absent (Eya), a protein conserved from plants to humans and best characterized as a transcriptional coactivator, is also the prototype for a novel class of eukaryotic aspartyl protein tyrosine phosphatases. This minireview discusses recent breakthroughs in elucidating the substrates and cellular events regulated by Eya's tyrosine phosphatase function and highlights some of the complexities, new questions, and surprises that have emerged from efforts to understand how Eya's unusual multifunctionality influences developmental regulation and signaling. PMID:26667035

  12. Analysis of Smad Phosphatase Activity In Vitro.

    PubMed

    Shen, Tao; Qin, Lan; Lin, Xia

    2016-01-01

    Phosphorylation of Smad1/5/8 at the C-terminal SXS motif by BMP type I receptors is one of the most critical events in BMP signaling. Conversely, protein phosphatases that dephosphorylate phospho-Smad1/5/8 can consequently prevent or terminate BMP signaling. PPM1H is an undercharacterized phosphatase in the PPM family. We recently demonstrated that PPM1H can dephosphorylate Smad1 in the cytoplasm and block BMP signaling responses in cellular assays. Here we describe in vitro method showing that PPM1H is a bona fide phosphatase for Smad1/5/8. PPM1H is produced as GST fusion protein in E. coli, and purified against glutathione sepharose beads. Bacterially purified recombinant PPM1H possesses phosphatase activity toward artificial substrate para-nitrophenyl phosphate (pNPP). Recombinant PPM1H also dephosphorylates immuno-purified phosphorylated Smad1 in test tubes. These direct in vitro phosphatase assays provide convincing evidence demonstrating the role of PPM1H as a specific phosphatase for P-Smad1.

  13. Autophagy Signaling in Prostate Cancer: Identification of a Novel Phosphatase

    DTIC Science & Technology

    2011-08-01

    polynucleotide kinase 3’-phosphatase17 71 CACGTGAACAGGGACACGCTA CACGTGTGAGACAGCCCTGAA CGGGAAGTCCACCTTTCTCAA CAAGCTGGTGATCTTCACCAA PPAP2A phosphatidic acid ...phosphatase type 2A8 97 AACCCTGTCTGTTTACTGTAA CTGACATTGCCAAGTATTCAA CATGCTGTTTGTGGCACTTTA CCGGGCAGAGACCATGTTTGA PPAP2B phosphatidic acid phosphatase...type 2B8 98 AGCGATCGTCCCGGAGAGCAA CAGCACAATTTCAGAAGAAAT CCGGATCTATTACCTGAAGAA CCGGGCACTTGCATACTCTTA PPAP2C phosphatidic acid phosphatase type 2C8 99

  14. Phosphorylation of paramyxovirus phosphoprotein and its role in viral gene expression

    PubMed Central

    Fuentes, Sandra M; Sun, Dengyun; Schmitt, Anthony P; He, Biao

    2010-01-01

    Paramyxoviruses include many important human and animal pathogens such as measles virus, mumps virus, human parainfluenza viruses, and respiratory syncytial virus, as well as emerging viruses such as Nipah virus and Hendra virus. The paramyxovirus RNA-dependent RNA polymerase consists of the phosphoprotein (P) and the large protein. Both of these proteins are essential for viral RNA synthesis. The P protein is phosphorylated at multiple sites, probably by more than one host kinase. While it is thought that the phosphorylation of P is important for its role in viral RNA synthesis, the precise role of P protein phosphorylation remains an enigma. For instance, it was demonstrated that the putative CKII phosphorylation sites of the P protein of respiratory syncytial virus play a role in viral RNA synthesis using a minigenome replicon system; however, mutating these putative CKII phosphorylation sites within a viral genome had no effect on viral RNA synthesis, leading to the hypothesis that P protein phosphorylation, at least by CKII, does not play a role in viral RNA synthesis. Recently, it has been reported that the phosphorylation state of the P protein of parainfluenza virus 5, a prototypical paramyxovirus, correlates with the ability of P protein to synthesize viral RNA, indicating that P protein phosphorylation does in fact play a role in viral RNA synthesis. Furthermore, host kinases PLK1, as well as AKT1 have been found to play critical roles in paramyxovirus RNA synthesis through regulation of P protein phosphorylation status. Beyond furthering our understanding of paramyxovirus RNA replication, these recent discoveries may also result in a new paradigm in treating infections caused by these viruses, as host kinases that regulate paramyxovirus replication are investigated as potential targets of therapeutic intervention. PMID:20020826

  15. Vasodilator-Stimulated Phosphoprotein Deficiency Potentiates PAR-1-induced Increase in Endothelial Permeability in Mouse Lungs

    PubMed Central

    Profirovic, Jasmina; Han, Jingyan; Andreeva, Alexandra V.; Neamu, Radu F.; Pavlovic, Sasha; Vogel, Stephen M.; Walter, Ulrich; Voyno-Yasenetskaya, Tatyana A.

    2010-01-01

    Vasodilator-stimulated phosphoprotein (VASP) is implicated in the protection of the endothelial barrier in vitro and in vivo. VASP function in thrombin signaling in the endothelial cells (ECs) is not known. For the first time we studied the effects of VASP deficiency on EC permeability and pulmonary vascular permeability in response to thrombin receptor stimulation. We provided the evidence that VASP deficiency potentiates the increase in endothelial permeability induced by activation of thrombin receptor in cultured human umbilical vein endothelial cells (HUVECs) and isolated mouse lungs. Using transendothelial resistance measurement, we showed that siRNA-mediated VASP downregulation in HUVECs leads to a potentiation of thrombin- and protease-activated receptor 1 (PAR-1) agonist-induced increase in endothelial permeability. Compared to control cells, VASP-deficient HUVECs had delayed endothelial junctional reassembly and abrogated VE-cadherin cytoskeletal anchoring in the recovery phase after thrombin stimulation, as demonstrated by immunofluorescence studies and cell fractionation analysis, respectively. Measurement of the capillary filtration coefficient in isolated mouse lungs demonstrated that VASP−/− mice have increased microvascular permeability in response to infusion with PAR-1 agonist compared to wild type mice. Lack of VASP led to decreased Rac1 activation both in VASP-deficient HUVECs after thrombin stimulation and VASP−/− mouse lungs after PAR-1 agonist infusion, indicating that VASP effects on thrombin signaling may correlated with changes in Rac1 activity. This study demonstrates that VASP may play critical and complex role in the regulation of thrombin-dependent disruption of the endothelial barrier function. PMID:20945373

  16. Structural disorder within Henipavirus nucleoprotein and phosphoprotein: from predictions to experimental assessment.

    PubMed

    Habchi, Johnny; Mamelli, Laurent; Darbon, Hervé; Longhi, Sonia

    2010-07-21

    Henipaviruses are newly emerged viruses within the Paramyxoviridae family. Their negative-strand RNA genome is packaged by the nucleoprotein (N) within alpha-helical nucleocapsid that recruits the polymerase complex made of the L protein and the phosphoprotein (P). To date structural data on Henipaviruses are scarce, and their N and P proteins have never been characterized so far. Using both computational and experimental approaches we herein show that Henipaviruses N and P proteins possess large intrinsically disordered regions. By combining several disorder prediction methods, we show that the N-terminal domain of P (PNT) and the C-terminal domain of N (NTAIL) are both mostly disordered, although they contain short order-prone segments. We then report the cloning, the bacterial expression, purification and characterization of Henipavirus PNT and NTAIL domains. By combining gel filtration, dynamic light scattering, circular dichroism and nuclear magnetic resonance, we show that both NTAIL and PNT belong to the premolten globule sub-family within the class of intrinsically disordered proteins. This study is the first reported experimental characterization of Henipavirus P and N proteins. The evidence that their respective N-terminal and C-terminal domains are highly disordered under native conditions is expected to be invaluable for future structural studies by helping to delineate N and P protein domains amenable to crystallization. In addition, following previous hints establishing a relationship between structural disorder and protein interactivity, the present results suggest that Henipavirus PNT and NTAIL domains could be involved in manifold protein-protein interactions.

  17. Structural Disorder within Henipavirus Nucleoprotein and Phosphoprotein: From Predictions to Experimental Assessment

    PubMed Central

    Darbon, Hervé; Longhi, Sonia

    2010-01-01

    Henipaviruses are newly emerged viruses within the Paramyxoviridae family. Their negative-strand RNA genome is packaged by the nucleoprotein (N) within α-helical nucleocapsid that recruits the polymerase complex made of the L protein and the phosphoprotein (P). To date structural data on Henipaviruses are scarce, and their N and P proteins have never been characterized so far. Using both computational and experimental approaches we herein show that Henipaviruses N and P proteins possess large intrinsically disordered regions. By combining several disorder prediction methods, we show that the N-terminal domain of P (PNT) and the C-terminal domain of N (NTAIL) are both mostly disordered, although they contain short order-prone segments. We then report the cloning, the bacterial expression, purification and characterization of Henipavirus PNT and NTAIL domains. By combining gel filtration, dynamic light scattering, circular dichroism and nuclear magnetic resonance, we show that both NTAIL and PNT belong to the premolten globule sub-family within the class of intrinsically disordered proteins. This study is the first reported experimental characterization of Henipavirus P and N proteins. The evidence that their respective N-terminal and C-terminal domains are highly disordered under native conditions is expected to be invaluable for future structural studies by helping to delineate N and P protein domains amenable to crystallization. In addition, following previous hints establishing a relationship between structural disorder and protein interactivity, the present results suggest that Henipavirus PNT and NTAIL domains could be involved in manifold protein-protein interactions. PMID:20657787

  18. Borna Disease Virus Phosphoprotein Represses p53-Mediated Transcriptional Activity by Interference with HMGB1

    PubMed Central

    Zhang, Guoqi; Kobayashi, Takeshi; Kamitani, Wataru; Komoto, Satoshi; Yamashita, Makiko; Baba, Satoko; Yanai, Hideyuki; Ikuta, Kazuyoshi; Tomonaga, Keizo

    2003-01-01

    Borna disease virus (BDV) is a noncytolytic, neurotropic RNA virus that has a broad host range in warm-blooded animals, probably including humans. Recently, it was demonstrated that a 24-kDa phosphoprotein (P) of BDV directly binds to a multifunctional protein, amphoterin-HMGB1, and inhibits its function in cultured neural cells (W. Kamitani, Y. Shoya, T. Kobayashi, M. Watanabe, B. J. Lee, G. Zhang, K. Tomonaga, and K. Ikuta, J. Virol. 75:8742-8751, 2001). This observation suggested that expression of BDV P may cause deleterious effects in cellular functions by interference with HMGB1. In this study, we further investigated the significance of the binding between P and HMGB1. We demonstrated that P directly binds to the A-box domain on HMGB1, which is also responsible for interaction with a tumor suppression factor, p53. Recent works have demonstrated that binding between HMGB1 and p53 enhances p53-mediated transcriptional activity. Thus, we examined whether BDV P affects the transcriptional activity of p53 by interference with HMGB1. Mammalian two-hybrid analysis revealed that p53 and P competitively interfere with the binding of each protein to HMGB1 in a p53-deficient cell line, NCI-H1299. In addition, P was able to significantly decrease p53-mediated transcriptional activation of the cyclin G promoter. Furthermore, we showed that activation of p21waf1 expression was repressed in cyclosporine-treated BDV-infected cells, as well as p53-transduced NCI-H1299 cells. These results suggested that BDV P may be a unique inhibitor of p53 activity via binding to HMGB1. PMID:14581561

  19. 14-3-3 phosphoprotein interaction networks – does isoform diversity present functional interaction specification?

    PubMed Central

    Paul, Anna-Lisa; Denison, Fiona C.; Schultz, Eric R.; Zupanska, Agata K.; Ferl, Robert J.

    2012-01-01

    The 14-3-3 proteins have emerged as major phosphoprotein interaction proteins and thereby constitute a key node in the Arabidopsis Interactome Map, a node through which a large number of important signals pass. Throughout their history of discovery and description, the 14-3-3s have been described as protein families and there has been some evidence that the different 14-3-3 family members within any organism might carry isoform-specific functions. However, there has also been evidence for redundancy of 14-3-3 function, suggesting that the perceived 14-3-3 diversity may be the accumulation of neutral mutations over evolutionary time and as some 14-3-3 genes develop tissue or organ-specific expression. This situation has led to a currently unresolved question – does 14-3-3 isoform sequence diversity indicate functional diversity at the biochemical or cellular level? We discuss here some of the key observations on both sides of the resulting debate, and present a set of contrastable observations to address the theory functional diversity does exist among 14-3-3 isoforms. The resulting model suggests strongly that there are indeed functional specificities in the 14-3-3s of Arabidopsis. The model further suggests that 14-3-3 diversity and specificity should enter into the discussion of 14-3-3 roles in signal transduction and be directly approached in 14-3-3 experimentation. It is hoped that future studies involving 14-3-3s will continue to address specificity in experimental design and analysis. PMID:22934100

  20. Rabies virus phosphoprotein interacts with mitochondrial Complex I and induces mitochondrial dysfunction and oxidative stress.

    PubMed

    Kammouni, Wafa; Wood, Heidi; Saleh, Ali; Appolinario, Camila M; Fernyhough, Paul; Jackson, Alan C

    2015-08-01

    Our previous studies in an experimental model of rabies showed neuronal process degeneration in association with severe clinical disease. Cultured adult rodent dorsal root ganglion neurons infected with challenge virus standard (CVS)-11 strain of rabies virus (RABV) showed axonal swellings and reduced axonal growth with evidence of oxidative stress. We have shown that CVS infection alters a variety of mitochondrial parameters and increases reactive oxygen species (ROS) production and mitochondrial Complex I activity vs. mock infection. We have hypothesized that a RABV protein targets mitochondria and triggers dysfunction. Mitochondrial extracts of mouse neuroblastoma cells were analyzed with a proteomics approach. We have identified peptides belonging to the RABV nucleocapsid protein (N), phosphoprotein (P), and glycoprotein (G), and our data indicate that the extract was most highly enriched with P. P was also detected by immunoblotting in RABV-infected purified mitochondrial extracts and also in Complex I immunoprecipitates from the extracts but not in mock-infected extracts. A plasmid expressing P in cells increased Complex I activity and increased ROS generation, whereas expression of other RABV proteins did not. We have analyzed recombinant plasmids encoding various P gene segments. Expression of a peptide from amino acid 139-172 increased Complex I activity and ROS generation similar to expression of the entire P protein, whereas peptides that did not contain this region did not increase Complex I activity or induce ROS generation. These results indicate that a region of the RABV P interacts with Complex I in mitochondria causing mitochondrial dysfunction, increased generation of ROS, and oxidative stress.

  1. Secreted Phosphoprotein 1 Is a Determinant of Lung Function Development in Mice

    PubMed Central

    Martin, Timothy M.; Concel, Vincent J.; Upadhyay, Swapna; Bein, Kiflai; Brant, Kelly A.; George, Leema; Mitra, Ankita; Thimraj, Tania A.; Fabisiak, James P.; Vuga, Louis J.; Fattman, Cheryl; Kaminski, Naftali; Schulz, Holger; Leikauf, George D.

    2014-01-01

    Secreted phosphoprotein 1 (Spp1) is located within quantitative trait loci associated with lung function that was previously identified by contrasting C3H/HeJ and JF1/Msf mouse strains that have extremely divergent lung function. JF1/Msf mice with diminished lung function had reduced lung SPP1 transcript and protein during the peak stage of alveologenesis (postnatal day [P]14–P28) as compared with C3H/HeJ mice. In addition to a previously identified genetic variant that altered runt-related transcription factor 2 (RUNX2) binding in the Spp1 promoter, we identified another promoter variant in a putative RUNX2 binding site that increased the DNA protein binding. SPP1 induced dose-dependent mouse lung epithelial-15 cell proliferation. Spp1(−/−) mice have decreased specific total lung capacity/body weight, higher specific compliance, and increased mean airspace chord length (Lm) compared with Spp1(+/+) mice. Microarray analysis revealed enriched gene ontogeny categories, with numerous genes associated with lung development and/or respiratory disease. Insulin-like growth factor 1, Hedgehog-interacting protein, wingless-related mouse mammary tumor virus integration site 5A, and NOTCH1 transcripts decreased in the lung of P14 Spp1(−/−) mice as determined by quantitative RT-PCR analysis. SPP1 promotes pneumocyte growth, and mice lacking SPP1 have smaller, more compliant lungs with enlarged airspace (i.e., increased Lm). Microarray analysis suggests a dysregulation of key lung developmental transcripts in gene-targeted Spp1(−/−) mice, particularly during the peak phase of alveologenesis. In addition to its known roles in lung disease, this study supports SPP1 as a determinant of lung development in mice. PMID:24816281

  2. Phosphoprotein enriched in astrocytes (PEA)-15: A potential therapeutic target in multiple disease states

    PubMed Central

    Greig, Fiona H.; Nixon, Graeme F.

    2014-01-01

    Phosphoprotein enriched in astrocytes-15 (PEA-15) is a cytoplasmic protein that sits at an important junction in intracellular signalling and can regulate diverse cellular processes, such as proliferation and apoptosis, dependent upon stimulation. Regulation of these processes occurs by virtue of the unique interaction of PEA-15 with other signalling proteins. PEA-15 acts as a cytoplasmic tether for the mitogen-activated protein kinases, extracellular signal-regulated kinase 1/2 (ERK1/2) preventing nuclear localisation. In order to release ERK1/2, PEA-15 requires to be phosphorylated via several potential pathways. PEA-15 (and its phosphorylation state) therefore regulates many ERK1/2-dependent processes, including proliferation, via regulating ERK1/2 nuclear translocation. In addition, PEA-15 contains a death effector domain (DED) which allows interaction with other DED-containing proteins. PEA-15 can bind the DED-containing apoptotic adaptor molecule, Fas-associated death domain protein (FADD) which is also dependent on the phosphorylation status of PEA-15. PEA-15 binding of FADD can inhibit apoptosis as bound FADD cannot participate in the assembly of apoptotic signalling complexes. Through these protein–protein interactions, PEA-15-regulated cellular effects have now been investigated in a number of disease-related studies. Changes in PEA-15 expression and regulation have been observed in diabetes mellitus, cancer, neurological disorders and the cardiovascular system. These changes have been suggested to contribute to the pathology related to each of these disease states. As such, new therapeutic targets based around PEA-15 and its associated interactions are now being uncovered and could provide novel avenues for treatment strategies in multiple diseases. PMID:24657708

  3. Characterization of the major phosphoprotein and its kinase on the surface of the rat adipocyte

    SciTech Connect

    Kang, E.S.; Chiang, T.M.

    1986-12-01

    Intact rat fat cell exposed to 12.5 ..mu..M (..gamma..-32P)ATP incorporate label into specific proteins within minutes. By solubilizing the reaction mixture with SDS which bypasses the subcellular fractionation steps, the labeled proteins can be identified in autoradiographs of SDS-PAGE gels. The most prominently labeled protein has an M/sub r/ of 42,000. Localization of this component to the cell surface can be made on the basis of inhibition of phosphorylation by addition of a protein derived from the rat brain with protein kinase inhibitory property, susceptibility of the phosphorylated protein to the tryptic digestion, inhibition of phosphorylation of this protein after brief exposure to melittin. To rule out the possibility that the cell surface protein might be a mitochondrial contaminant from broken cells, /sup 32/Pi-labeled and (..gamma..-/sup 32/P)ATP-labeled cells were chromatographed on a rabbit anti-pyruvate dehydrogenase antibody-Sepharose 4B column. A single labeled peak was detected upon elution of the bound fraction only in the /sup 32/pi-labeled sample, and not in the (..gamma..-/sup 32/P)ATP-labeled sample. Subcellular fractionation studies of intact cells labeled depending on whether a continuous sucrose gradient or a discontinuous sucrose gradient was used. Finally, comparison of the autoradiographs of two-dimensional (2D) gels show different isoelectric points for 42,000 M/sub r/ components in (..gamma..-/sup 32/P)ATP- and /sup 32/Pi-labeled cells. These and other experiments support the likelihood that phosphoproteins of 42,000 M/sub r/ are present at two sites in the intact rat fat cell, the cell surface and at an intracellular site, most likely the mitochondria.

  4. Vasodilator-Stimulated Phosphoprotein Activity Is Required for Coxiella burnetii Growth in Human Macrophages

    PubMed Central

    Colonne, Punsiri M.; Winchell, Caylin G.; Graham, Joseph G.; Onyilagha, Frances I.; MacDonald, Laura J.; Doeppler, Heike R.; Storz, Peter; Kurten, Richard C.; Beare, Paul A.; Voth, Daniel E.

    2016-01-01

    Coxiella burnetii is an intracellular bacterial pathogen that causes human Q fever, an acute flu-like illness that can progress to chronic endocarditis and liver and bone infections. Humans are typically infected by aerosol-mediated transmission, and C. burnetii initially targets alveolar macrophages wherein the pathogen replicates in a phagolysosome-like niche known as the parasitophorous vacuole (PV). C. burnetii manipulates host cAMP-dependent protein kinase (PKA) signaling to promote PV formation, cell survival, and bacterial replication. In this study, we identified the actin regulatory protein vasodilator-stimulated phosphoprotein (VASP) as a PKA substrate that is increasingly phosphorylated at S157 and S239 during C. burnetii infection. Avirulent and virulent C. burnetii triggered increased levels of phosphorylated VASP in macrophage-like THP-1 cells and primary human alveolar macrophages, and this event required the Cα subunit of PKA. VASP phosphorylation also required bacterial protein synthesis and secretion of effector proteins via a type IV secretion system, indicating the pathogen actively triggers prolonged VASP phosphorylation. Optimal PV formation and intracellular bacterial replication required VASP activity, as siRNA-mediated depletion of VASP reduced PV size and bacterial growth. Interestingly, ectopic expression of a phospho-mimetic VASP (S239E) mutant protein prevented optimal PV formation, whereas VASP (S157E) mutant expression had no effect. VASP (S239E) expression also prevented trafficking of bead-containing phagosomes to the PV, indicating proper VASP activity is critical for heterotypic fusion events that control PV expansion in macrophages. Finally, expression of dominant negative VASP (S157A) in C. burnetii-infected cells impaired PV formation, confirming importance of the protein for proper infection. This study provides the first evidence of VASP manipulation by an intravacuolar bacterial pathogen via activation of PKA in human

  5. Mineralization induction effects of osteopontin, bone sialoprotein, and dentin phosphoprotein on a biomimetic collagen substrate.

    PubMed

    Zurick, Kevin M; Qin, Chunlin; Bernards, Matthew T

    2013-06-01

    Native bone tissue is composed of a matrix of collagen, noncollagenous proteins, and calcium phosphate minerals, which are primarily hydroxyapatite. The SIBLING (small integrin-binding ligand, N-linked glycoprotein) family of proteins is the primary noncollagenous protein group found in mineralized tissues. In this work, the mineralization induction capabilities of three of the SIBLING members, bone sialoprotein (BSP), osteopontin (OPN), and the calcium-binding subdomain of dentin sialophosphoprotein, dentin phosphoprotein (DPP), are directly compared on a biomimetic collagen substrate. A self-assembled, loosely aligned collagen fibril substrate was prepared, and then (125) I-radiolabeled adsorption isotherms were developed for BSP, OPN, and DPP. The results showed that BSP exhibited the highest binding capacity for collagen at lower concentrations, followed by DPP and OPN. However, at the highest concentrations, all three proteins had similar adsorption levels. The adsorption isotherms were then used to identify conditions that resulted in identical amounts of adsorbed protein. These substrates were prepared and placed in simulated body fluid for 5, 10, and 24 h at 37°C. The resulting mineral morphology was assessed by atomic force microscopy, and the composition was determined using photochemical assays. Mineralization was seen in the presence of all the proteins. However, DPP was seen to be the only protein that formed individual mineral nodules similar to those seen in developing bone. This suggests that DPP plays a significant role in the biomineralization process and that the incorporation of DPP into tissue engineering constructs may facilitate the induction of biomimetic mineral formation.

  6. Phosphoprotein secretome of tumor cells as a source of candidates for breast cancer biomarkers in plasma.

    PubMed

    Zawadzka, Anna M; Schilling, Birgit; Cusack, Michael P; Sahu, Alexandria K; Drake, Penelope; Fisher, Susan J; Benz, Christopher C; Gibson, Bradford W

    2014-04-01

    Breast cancer is a heterogeneous disease whose molecular diversity is not well reflected in clinical and pathological markers used for prognosis and treatment selection. As tumor cells secrete proteins into the extracellular environment, some of these proteins reach circulation and could become suitable biomarkers for improving diagnosis or monitoring response to treatment. As many signaling pathways and interaction networks are altered in cancerous tissues by protein phosphorylation, changes in the secretory phosphoproteome of cancer tissues could reflect both disease progression and subtype. To test this hypothesis, we compared the phosphopeptide-enriched fractions obtained from proteins secreted into conditioned media (CM) derived from five luminal and five basal type breast cancer cell lines using label-free quantitative mass spectrometry. Altogether over 5000 phosphosites derived from 1756 phosphoproteins were identified, several of which have the potential to qualify as phosphopeptide plasma biomarker candidates for the more aggressive basal and also the luminal-type breast cancers. The analysis of phosphopeptides from breast cancer patient plasma and controls allowed us to construct a discovery list of phosphosites under rigorous collection conditions, and second to qualify discovery candidates generated from the CM studies. Indeed, a set of basal-specific phosphorylation CM site candidates derived from IBP3, CD44, OPN, FSTL3, LAMB1, and STC2, and luminal-specific candidates derived from CYTC and IBP5 were selected and, based on their presence in plasma, quantified across all cell line CM samples using Skyline MS1 intensity data. Together, this approach allowed us to assemble a set of novel cancer subtype specific phosphopeptide candidates for subsequent biomarker verification and clinical validation.

  7. Secreted phosphoprotein 24 kD inhibits nerve root inflammation induced by bone morphogenetic protein-2.

    PubMed

    Tian, Haijun; Li, Chen-Shuang; Scott, Trevor P; Montgomery, Scott R; Phan, Kevin; Lao, Lifeng; Zhang, Wei; Li, Yawei; Hayashi, Tetsuo; Takahashi, Shinji; Alobaidaan, Raed; Ruangchainikom, Monchai; Zhao, Ke-Wei; Brochmann, Elsa J; Murray, Samuel S; Wang, Jeffrey C; Daubs, Michael D

    2015-02-01

    Bone morphogenetic protein-2 (BMP-2) has been used to successfully promote spine fusion, but side-effects including nerve inflammation have been observed. To investigate the direct neurotoxic effects of BMP-2 and test the hypotheses that the use of BMP binding proteins, such as secreted phosphoprotein 24 kD (Spp24), can reduce or eliminate these effects. In vitro experiments and in vivo analysis in a rodent model. In vitro, dorsal root ganglion cells were cultured in the presence of BMP-2 with and without Spp24 and calcitonin gene-related peptide and Substance P, markers of neuroinflammation, were measured by immunohistochemistry. In vivo, rats underwent a left-sided laminotomy at L5 to expose the S1 nerve root and were randomized into four different groups according to the intervention at the laminotomy site: collagen sponge only (no BMP-2 or Spp24), BMP-2 in a collagen sponge only, BMP-2 in a collagen sponge+an empty collagen sponge to act as a barrier, and BMP-2 in a collagen sponge+Spp24 in a collagen sponge to act as a barrier. Functional evaluation was done using the Basso, Beattie, and Bresnahan scale and immunohistochemical analyses were performed using calcitonin gene-related peptide and Substance P staining. The neuroinflammatory effects of BMP-2 in vitro were ameliorated by the addition of Spp24. Similarly, in vivo, Spp24 reduced the expression of markers on neuroinflammation in animals treated with BMP-2 and also improved the function after BMP-2 administration. These results confirm that BMP binding proteins have great potential as adjuvant therapies to limit BMP-2 related side-effects in spine surgery. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Neuronal stathmins: a family of phosphoproteins cooperating for neuronal development, plasticity and regeneration.

    PubMed

    Chauvin, Stéphanie; Sobel, André

    2015-03-01

    Nervous system development, plasticity and regeneration require numerous, coordinated and finely tuned subcellular mechanisms. Phosphoproteins of the stathmin family, originally identified as intracellular signal relay proteins, are mostly or exclusively expressed in the nervous system with a high level of expression during brain development. Vertebrate stathmins 1-4 all possess a C-terminal "stathmin-like domain" that binds or releases tubulin in a phosphorylation dependent way, and hence participates in the control of microtubule dynamics, an essential process for neuronal differentiation. Contrary to stathmin 1, stathmins 2-4 possess an N-terminal extension whose reversible palmitoylation specifically targets them to the Golgi and intracellular membranes. Regulation of stathmins 2-4 palmitoylation is therefore an important regulatory mechanism that controls their shuttling to various neuronal compartments where they can then act locally. Expression of stathmins is upregulated during neuronal differentiation and plasticity, and altered in numerous neurodegenerative diseases. Experimental perturbation of stathmins expression in Drosophila or in neurons in culture revealed their importance in neuronal growth and differentiation, each stathmin fulfilling at least partially distinct and likely complementary roles. On the other hand, knock-out of stathmins in mice, with the exception of stathmin 2, resulted in mostly mild or no detected phenotype, revealing likely compensations among stathmins. Altogether, through their combinatorial expression and regulation by phosphorylation and by palmitoylation, and through their interactions with tubulin and other neuronal protein targets, the various stathmins appear as essential regulators of neuronal differentiation at the various stages during development and plasticity of the nervous system.

  9. The serine/threonine phosphatase DhSIT4 modulates cell cycle, salt tolerance and cell wall integrity in halo tolerant yeast Debaryomyces hansenii.

    PubMed

    Chawla, Srishti; Kundu, Debasree; Randhawa, Anmoldeep; Mondal, Alok K

    2017-03-30

    The highly conserved family of Phosphoprotein phosphatases (PPP) regulates several major physiological processes in yeast. However, very little is known about the PPP orthologs from the yeast species inhabiting extreme environmental niches. In the present study we have identified DhSIT4, a member of PPP6 class of serine threonine phosphatases from the halotolerant yeast Debaryomyces hansenii. Deletion of DhSIT4 in D. hansenii was not lethal but the mutant exhibited reduced growth due to its effect on the cell cycle. The knock out mutant Dhsit4Δ showed sensitivity towards Li(+), Na(+) and cell wall damaging agents. The expression of DhSit4p rescued salt, caffeine and calcofluor white sensitivity of Dhmpk1Δ strain and thereby indicating a genetic interaction of this phosphatase with the cell wall integrity pathway in this species. Our study also demonstrated the antagonistic roles of DhSit4p and DhPpz1p in maintaining the cell cycle and ion homeostasis in D. hansenii.

  10. Assessing the biological activity of the glucan phosphatase laforin

    PubMed Central

    Romá-Mateo, Carlos; Raththagala, Madushi; Gentry, Mathew S.; Sanz, Pascual

    2017-01-01

    Summary Glucan phosphatases are a recently discovered family of enzymes that dephosphorylate either starch or glycogen and are essential for proper starch metabolism in plants and glycogen metabolism in humans. Mutations in the gene encoding the only human glucan phosphatase, laforin, result in the fatal, neurodegenerative, epilepsy known as Lafora disease. Here, we describe phosphatase assays to assess both generic laforin phosphatase activity and laforin’s unique glycogen phosphatase activity. PMID:27514803

  11. Comparative analysis of salt-responsive phosphoproteins in maize leaves using Ti(4+)--IMAC enrichment and ESI-Q-TOF MS.

    PubMed

    Hu, Yufeng; Guo, Shuangxi; Li, Xuexian; Ren, Xueqin

    2013-02-01

    Salinity is one of the most common abiotic stresses encountered by plants. Reversible protein phosphorylation is involved in plant defense processes against salinity stress. Here, we performed global phosphopeptide mapping through enrichment by our synthesized PVA-phosphate-Ti(4+) IMAC coupled with subsequent identification by ESI-Q-TOF MS. A total of 104 peptide sequences containing 139 phosphorylation sites were determined from 70 phosphoproteins of the control leaves. In contrast, 124 phosphopeptides containing 143 phosphorylated sites from 92 phosphoproteins were identified in salt-stressed maize leaves. Compared with the control, 47 proteins were phosphorylated, 25 were dephosphorylated, and 45 overlapped. Among the 72 differential phosphoproteins, 35 were known salt stress response proteins and the rest had not been reported in the literature. To dissect the differential phosphorylation, gene ontology annotations were retrieved for the differential phosphoproteins. The results revealed that cell signaling pathway members such as calmodulin and 14-3-3 proteins were regulated in response to 24-h salt stress. Multiple putative salt-responsive phosphoproteins seem to be involved in the regulation of photosynthesis-related processes. These results may help to understand the salt-inducible phosphorylation processes of maize leaves.

  12. Multimer staining of cytomegalovirus phosphoprotein 65-specific T cells for diagnosis and therapeutic purposes: a comparative study.

    PubMed

    Yao, Junxia; Bechter, Clemens; Wiesneth, Markus; Härter, Georg; Götz, Marlies; Germeroth, Lothar; Guillaume, Philippe; Hasan, Ferishte; von Harsdorf, Stephanie; Mertens, Thomas; Michel, Detlef; Döhner, Hartmut; Bunjes, Donald; Schmitt, Michael; Schmitt, Anita

    2008-05-15

    Cytomegalovirus (CMV) disease represents a serious complication after allogeneic peripheral blood stem cell (PBSC) transplantation. If possible, stem cell donors for transplantation are selected on the basis of their CMV serostatus. However, the cytomegalovirus-specific immune status can be further characterized by measuring CMV phosphoprotein 65-specific CD8(+) T cell frequencies using tetramers, pentamers, and streptamers. We therefore investigated the specificity and sensitivity of all 3 methods and compared the results to patient serostatus. Twenty-three samples from CMV-seropositive healthy volunteers and 15 samples from CMV-seropositive patients before and after allogeneic PBSC transplantation were stained with tetramers, pentamers, or streptamers and analyzed by flow cytometry. Similar frequencies of CD8(+) and multimer(+) T cells could be measured by all 3 multimer technologies. The lowest background signals (< or =0.02%) were obtained using tetramer technology. Frequencies of 0.19%-2.48% of CMV phosphoprotein 65 495-503-specific CD8(+) T cells were detected in healthy volunteers. Antigen-specific T cells were detected in only 11 (48%) of 23 seropositive healthy volunteers. CMV antigenemia before day 100 after allogeneic PBSC transplantation occurred in 2 of 3 patients without any specific T cells. These findings demonstrate the power of multimer staining and a certain limitation of serologic testing to define appropriate donors for transplantation. Therefore, whenever possible, CMV-seropositive donors of transplants to seropositive recipients should be screened for their CD8(+) T cell frequency. All 3 multimer technologies can be used, yielding similar results. The streptamer technology additionally offers the advantage of selecting CMV phosphoprotein 65-specific CD8(+) T cells at the good manufacturing practice level for adoptive T cell transfer.

  13. Purification of a 53kD pI 4. 8 cytosolic phosphoprotein from HL60

    SciTech Connect

    Biser, P.S.; Spearman, T.N.; Bruzzone, M.; Durham, J.P.

    1987-05-01

    In order to study the potential role of a 53kD pI 4.8 phosphoprotein in the differentiation of HL60 using monoclonal antibodies, a partial purification has been carried out. Cytosol from cells differentiated with 1 M retinoic acid was applied to a DEAE-cellulose column and eluted with a linear NaCl gradient. Fractions were screened by in vitro phosphorylation of aliquots using /sup 32/P ATP and highly purified protein kinase C, SDS-PAGE, and autoradiography. Fraction which showed autoradiographic bands of the correct molecular weight were further analyzed using 2-D electrophoresis involving isolectric focusing over a pH range of 4-6 followed by SDS-PAGE on a 10% slab gel. Autoradiograms of these gels showed the 53 kD pI 4.8 phosphoprotein to elute with a peak at 0.24 NaCl. This 53 kD pI 4.8 protein was identified as the 53kD pI 4.8 phosphoprotein whose synthesis and phosphorylation is induced by retinoic acid by DEAE chromatography of cytosol from cells labelled in vivo with /sup 32/PO/sub 4//sup -2/ followed by 2-D electrophoresis. Fractions containing the 53 kD pI 4.8 protein were concentrated and applied to a chromatofocusing column which was eluted with a gradient from pH 6 to 4. Analysis of fractions via in vitro phosphorylation and SDS PAGE showed the 53 kD pI 4.8 protein eluting with a peak at pH 4.8 as a silver-stained band well separated from contaminating proteins. Experiments are currently in progress to produce monoclonal antibodies to the 53 kD pI 4.8 protein using the partially purified antigen.

  14. Determinants for substrate specificity of the bacterial PP2C protein phosphatase tPphA from Thermosynechococcus elongatus.

    PubMed

    Su, Jiyong; Forchhammer, Karl

    2013-01-01

    Members of the Mg(2+)- or Mn(2+)-dependent protein phosphatases/PP2C-like serine/threonine phosphatases (PPM/PP2C) are abundant and widely distributed in prokaryotes and eukaryotes, where they regulate diverse signal transduction pathways. Despite low sequence conservation, the structure of their catalytic core is highly conserved except for a flexible loop termed the flap subdomain. Bacterial PPM/PP2C members without C- or N-terminal regulatory domains still recognize their substrates. Based on the crystal structure of tPphA (a PPM/PP2C member from the cyanobacterium Thermosynechococcus elongatus), variants of tPphA were generated by site-directed mutagenesis to identify substrate specificity determinants. Furthermore, a PPM/PP2C chimera containing the tPphA catalytic core and the flap subdomain of human PP2Cα was also generated. tPphA variants and the chimera were tested towards different artificial substrates and native phosphorylated P(II). A binding assay combining chemical crosslinking and pull-down was designed to analyze the binding of the various phosphatase variants to phosphoprotein P(II) . Together, these data showed that the metal 1-metal 2 cluster in the catalytic center, but not the catalytically active metal 3, is required for the binding of phosphorylated substrate. Residues outside the catalytic center are pivotal for the recognition and turnover of phosphorylated protein substrate. In particular, a histidine residue (His39) of tPphA was identified to play a specific role in protein substrate dephosphorylation. Furthermore, mutations in the variable flap subdomain can affect enzyme activity as well as substrate specificity.

  15. Molecular cloning of the type 5, iron-containing, tartrate-resistant acid phosphatase from human placenta.

    PubMed

    Ketcham, C M; Roberts, R M; Simmen, R C; Nick, H S

    1989-01-05

    The type 5, iron-containing, tartrate-resistant acid phosphatase (TR-AP) constitutes a relatively minor intracellular isozyme of acid phosphatase in the human that is immunologically related to uteroferrin, a secreted progesterone-induced protein of the porcine uterus. Here, the purification of small amounts of TR-AP from human placenta is described. When a placental lambda gt11 cDNA library was screened with two short 32P-labeled cDNA clones from within the coding region of uteroferrin, a 1412-base pair cDNA was identified that encodes the entire human TR-AP isozyme. This cDNA contains an open reading frame of 969 base pairs, corresponding to a protein of 323 amino acids. A putative signal sequence of 19 amino acids and two potential glycosylation sites are present. The deduced amino acid sequence of the human TR-AP is 85% identical to that of porcine uteroferrin (whose sequence is also reported here in complete form for the first time) and 82% identical to the corresponding regions of a partial amino acid sequence of a bovine spleen phosphoprotein phosphatase. Northern blotting techniques employing a labeled TR-AP cDNA probe revealed the presence of a 1.5-kilobase transcript in white cells from a patient with hairy cell leukemia, in human K562 erythroleukemic cells, and in Epstein-Barr virus-transformed human B-cells, but not in a human T-cell line. Culture of K562 cells in presence of 10(-8) M phorbol 12-myristate 13-acetate ester for 48-72 h enhanced TR-AP activity per cell about 30-fold and led to a corresponding increase in TR-AP mRNA levels.

  16. Revisiting the Evolutionary History and Roles of Protein Phosphatases with Kelch-Like Domains in Plants1[C][W

    PubMed Central

    Maselli, Gustavo A.; Slamovits, Claudio H.; Bianchi, Javier I.; Vilarrasa-Blasi, Josep; Caño-Delgado, Ana I.; Mora-García, Santiago

    2014-01-01

    Protein phosphatases with Kelch-like domains (PPKL) are members of the phosphoprotein phosphatases family present only in plants and alveolates. PPKL have been described as positive effectors of brassinosteroid (BR) signaling in plants. Most of the evidence supporting this role has been gathered using one of the four homologs in Arabidopsis (Arabidopsis thaliana), BRASSINOSTEROID-INSENSITIVE1 SUPPRESSOR (BSU1). We reappraised the roles of the other three members of the family, BSL1, BSL2, and BSL3, through phylogenetic, functional, and genetic analyses. We show that BSL1 and BSL2/BSL3 belong to two ancient evolutionary clades that have been highly conserved in land plants. In contrast, BSU1-type genes are exclusively found in the Brassicaceae and display a remarkable sequence divergence, even among closely related species. Simultaneous loss of function of the close paralogs BSL2 and BSL3 brings about a peculiar array of phenotypic alterations, but with marginal effects on BR signaling; loss of function of BSL1 is, in turn, phenotypically silent. Still, the products of these three genes account for the bulk of PPKL-related activity in Arabidopsis and together have an essential role in the early stages of development that BSU1 is unable to supplement. Our results underline the functional relevance of BSL phosphatases in plants and suggest that BSL2/BSL3 and BSU1 may have contrasting effects on BR signaling. Given that BSU1-type genes have likely undergone a functional shift and are phylogenetically restricted, we caution that inferences based on these genes to the whole family or to other species may be misleading. PMID:24492333

  17. Identification of the adipocyte acid phosphatase as a PAO-sensitive tyrosyl phosphatase.

    PubMed Central

    Shekels, L. L.; Smith, A. J.; Van Etten, R. L.; Bernlohr, D. A.

    1992-01-01

    We have partially purified an 18-kDa cytoplasmic protein from 3T3-L1 cells, which dephosphorylates pNPP and the phosphorylated adipocyte lipid binding protein (ALBP), and have identified it by virtue of kinetic and immunological criteria as an acid phosphatase (EC 3.1.3.2). The cytoplasmic acid phosphatase was inactivated by phenylarsine oxide (PAO) (Kinact = 10 microM), and the inactivation could be reversed by the dithiol, 2,3-dimercaptopropanol (Kreact = 23 microM), but not the monothiol, 2-mercaptoethanol. Cloning of the human adipocyte acid phosphatase revealed that two isoforms exist, termed HAAP alpha and HAAP beta (human adipocyte acid phosphatase), which are distinguished by a 34-amino acid isoform-specific domain. Sequence analysis shows HAAP alpha and HAAP beta share 74% and 90% identity with the bovine liver acid phosphatase, respectively, and 99% identity with both isoenzymes of the human red cell acid phosphatase but no sequence similarity to the protein tyrosine phosphatases (EC 3.1.3.48). HAAP beta has been cloned into Escherichia coli, expressed, and purified as a glutathione S-transferase fusion protein. Recombinant HAAP beta was shown to dephosphorylate pNPP and phosphoALBP and to be inactivated by PAO and inhibited by vanadate (Ki = 17 microM). These results describe the adipocyte acid phosphatase as a cytoplasmic enzyme containing conformationally vicinal cysteine residues with properties that suggest it may dephosphorylate tyrosyl phosphorylated cellular proteins. PMID:1304913

  18. Determination of alkali-labile phosphoprotein phosphorus from fish plasma using the Tb(3+)-tiron complex as a fluorescence probe.

    PubMed

    Lv, Xue-Fei; Zhao, Yi-Bing; Zhou, Qun-Fang; Jiang, Gui-Bin; Song, Mao-Yong

    2007-01-01

    A sensitive method based on the fluorescence quenching effect of the Tb(3+)-Tiron complex is proposed for the determination of alkali-labile phosphoprotein phosphorus (ALP) released from fish plasma. The detection limit was 5.4 ng/ml (S/N = 2), and the relative standard deviation of the quenching effect (6 replicates) was 4.6%. The results obtained by the proposed method were in good agreement with those obtained by the colorimetric assay. The advantages of the present method are its relatively simple detection procedure, the lack of toxic organic solvents, and high sensitivity.

  19. One-Step Preservation of Phosphoproteins and Tissue Morphology at Room Temperature for Diagnostic and Research Specimens

    PubMed Central

    Mueller, Claudius; Edmiston, Kirsten H.; Carpenter, Calvin; Gaffney, Eoin; Ryan, Ciara; Ward, Ronan; White, Susan; Memeo, Lorenzo; Colarossi, Cristina; Petricoin, Emanuel F.; Liotta, Lance A.; Espina, Virginia

    2011-01-01

    Background There is an urgent need to measure phosphorylated cell signaling proteins in cancer tissue for the individualization of molecular targeted kinase inhibitor therapy. However, phosphoproteins fluctuate rapidly following tissue procurement. Snap-freezing preserves phosphoproteins, but is unavailable in most clinics and compromises diagnostic morphology. Formalin fixation preserves tissue histomorphology, but penetrates tissue slowly, and is unsuitable for stabilizing phosphoproteins. We originated and evaluated a novel one-step biomarker and histology preservative (BHP) chemistry that stabilizes signaling protein phosphorylation and retains formalin-like tissue histomorphology with equivalent immunohistochemistry in a single paraffin block. Results Total protein yield extracted from BHP-fixed, routine paraffin-embedded mouse liver was 100% compared to snap-frozen tissue. The abundance of 14 phosphorylated proteins was found to be stable over extended fixation times in BHP fixed paraffin embedded human colon mucosa. Compared to matched snap-frozen tissue, 8 phosphoproteins were equally preserved in mouse liver, while AMPKβ1 Ser108 was slightly elevated after BHP fixation. More than 25 tissues from mouse, cat and human specimens were evaluated for preservation of histomorphology. Selected tissues were evaluated in a multi-site, independent pathology review. Tissue fixed with BHP showed equivalent preservation of cytoplasmic and membrane cytomorphology, with significantly better nuclear chromatin preservation by BHP compared to formalin. Immunohistochemical staining of 13 non-phosphorylated proteins, including estrogen receptor alpha, progesterone receptor, Ki-67 and Her2, was equal to or stronger in BHP compared to formalin. BHP demonstrated significantly improved immunohistochemical detection of phosphorylated proteins ERK Thr202/Tyr204, GSK3-α/β Ser21/Ser9, p38-MAPK Thr180/Tyr182, eIF4G Ser1108 and Acetyl-CoA Carboxylase Ser79. Conclusion In a single

  20. Alkaline phosphatase and bone calcium parameters.

    PubMed

    Fauran-Clavel, M J; Oustrin, J

    1986-01-01

    Effects of cadmium, an alkaline phosphatase inhibitor, on the calcium content of rat bone were investigated in vivo by a radioisotopic method. Disturbance of bone metabolism is observed in both the superficial (delta) and slow exchanges (Ve), which are also significantly decreased. The crystallized calcium bone compartment (E) is also strongly affected. It appears that changes in the superficial calcium exchanges cause the observed decrease in the crystallized calcium mass. The slowing of osteogenesis is confirmed by the decrease of serum alkaline phosphatase activity. A statistical examination of the correlation coefficient reveals a close link (P less than 0.01) between serum alkaline phosphatase activity and the influx of superficial calcium (Vo+) and, as a result, the crystallized bone calcium parameters. These results show that cadmium can be used to study the relationship between alkaline phosphatase and calcification. The present observations allow us to consider the possibility that alkaline phosphatase may play a role in determining the calcium content of the crystallized phases in deep bone through its action on the tissue surface.

  1. The histidine phosphatase superfamily: structure and function.

    PubMed

    Rigden, Daniel J

    2008-01-15

    The histidine phosphatase superfamily is a large functionally diverse group of proteins. They share a conserved catalytic core centred on a histidine which becomes phosphorylated during the course of the reaction. Although the superfamily is overwhelmingly composed of phosphatases, the earliest known and arguably best-studied member is dPGM (cofactor-dependent phosphoglycerate mutase). The superfamily contains two branches sharing very limited sequence similarity: the first containing dPGM, fructose-2,6-bisphosphatase, PhoE, SixA, TIGAR [TP53 (tumour protein 53)-induced glycolysis and apoptosis regulator], Sts-1 and many other activities, and the second, smaller, branch composed mainly of acid phosphatases and phytases. Human representatives of both branches are of considerable medical interest, and various parasites contain superfamily members whose inhibition might have therapeutic value. Additionally, several phosphatases, notably the phytases, have current or potential applications in agriculture. The present review aims to draw together what is known about structure and function in the superfamily. With the benefit of an expanding set of histidine phosphatase superfamily structures, a clearer picture of the conserved elements is obtained, along with, conversely, a view of the sometimes surprising variation in substrate-binding and proton donor residues across the superfamily. This analysis should contribute to correcting a history of over- and mis-annotation in the superfamily, but also suggests that structural knowledge, from models or experimental structures, in conjunction with experimental assays, will prove vital for the future description of function in the superfamily.

  2. Acid phosphatase/phosphotransferases from enteric bacteria.

    PubMed

    Mihara, Y; Utagawa, T; Yamada, H; Asano, Y

    2001-01-01

    We have investigated the enzymatic phosphorylation of nucleosides and found that Morganella morganii phoC acid phosphatase exhibits regioselective pyrophosphate (PP(i))-nucleoside phosphotransferase activity. In this study, we isolated genes encoding an acid phosphatase with regioselective phosphotransferase activity (AP/PTase) from Providencia stuartii, Enterobacter aerogenes, Escherichia blattae and Klebsiella planticola, and compared the primary structures and enzymatic characteristics of these enzymes with those of AP/PTase (PhoC acid phosphatase) from M. morganii. The enzymes were highly homologous in primary structure with M. morganii AP/PTase, and are classified as class A1 acid phosphatases. The synthesis of inosine-5'-monophosphate (5'-IMP) by E. coli overproducing each acid phosphatase was investigated. The P. stuartii enzyme, which is most closely related to the M. morganii enzyme, exhibited high 5'-IMP productivity, similar to the M. morganii enzyme. The 5'-IMP productivities of the E. aerogenes, E. blattae and K. planticola enzymes were inferior to those of the former two enzymes. This result underlines the importance of lower K(m) values for efficient nucleotide production. As these enzymes exhibited a very high degree of homology at the amino acid sequence level, it is likely that local sequence differences in the binding pocket are responsible for the differences in the nucleoside-PP(i) phosphotransferase reaction.

  3. Phosphoprotein F1: purification and characterization of a brain kinase C substrate related to plasticity.

    PubMed

    Chan, S Y; Murakami, K; Routtenberg, A

    1986-12-01

    To study the role of protein kinase C (PKC) and its substrates in neuronal function, we have investigated the in vitro endogenous phosphorylation of the neuronal phosphoprotein F1 after induction of synaptic plasticity by long-term potentiation (LTP). The protein F1 phosphorylation was found to increase 5 min (Routtenberg et al., 1985), 1 hr (Lovinger et al., 1986) and 3 d (Lovinger et al., 1985) after LTP. The characteristics of this protein bear close similarities to a number of proteins characterized in various neuronal systems, such as B50 (brain specific, synaptosome-enriched protein), pp46 (a growth cone protein), and GAP 43 (nerve growth and regeneration-associated protein). A positive identification of the purified protein F1 with these proteins would link protein F1 to the developmental growth of axons, nerve regeneration, and polyphosphoinositide metabolism, as well as adult plasticity. We have therefore purified and partially characterized native protein F1 so that a meaningful comparison among the properties of these proteins can be made. Using synaptosomal plasma membrane (P2') as starting material, subsequent purification involved pH extraction, 40-80% ammonium sulfate precipitation, hydroxylapatite, and phenyl-Sepharose column chromatography. This procedure achieved greater than 800-fold purification and about 45% yield relative to P2'. Purified protein F1 (Mr = 47,000, pI = 4.5) was found to be a hydrophilic molecule and was phosphorylated by 1000-fold purified PKC in the presence of phosphatidylserine (PS) and Ca2+. The Ka of PS activation is about 15 micrograms/ml (approximately 20 microM), and that of Ca2+ is about 25 microM. Diolein and DiC:8 (a synthetic diacylglycerol) lowered the requirement of Ca2+ for maximal stimulation from 100 to 5 microM. Ca2+-calmodulin kinases type I and II did not phosphorylate protein F1. The phosphoamino acid analysis showed that 97% of the total incorporated 32P-phosphate was on the serine residue. Phosphopeptide

  4. Vasodilator-stimulated phosphoprotein-phosphorylation assay in patients on clopidogrel: does standardisation matter?

    PubMed

    Freynhofer, Matthias K; Bruno, Veronika; Willheim, Martin; Hübl, Wolfgang; Wojta, Johann; Huber, Kurt

    2012-03-01

    The vasodilator-stimulated phosphoprotein-phosphorylation (VASP-P) flow-cytometric assay is mainly used in clinical trials to measure thienopyridine effects. However, there are remarkable differences in the reported optimal cut-offs, ranging from 48-61% platelet reactivity index (PRI). We therefore investigated whether a lack of standardisation might explain the differences in the cut-offs. We measured VASP-P in 62 individuals. PRI was calculated using the mean, geometric mean and median fluorescence intensities (FI). Stability of the blood-samples (time-to-assay, 0-2 days) and stability of the processed samples (0-120 minutes) within the recommended time-span were tested. Time-to-assay significantly influenced the PRI (p<0.001): the PRI from mean FI after two days was lower compared to values on day 1 (52 ± 22.9 vs. 57.7 ± 24.1, p<0.001). The PRI from the geometric mean FI after two days was lower compared to day 0 as well as day 1 (51.3 ± 23 vs. 58.2 ± 24.2 and vs. 59.1 ± 23.7, both p<0.001). The PRI from median FI was stable over time (day 0: 59.1 ± 25%, day 1: 59.7 ± 24.1% and day 2: 56.4 ± 23.9%, all p=ns). Furthermore, the lag time of the processed samples significantly altered the PRI (all p<0.001) with a maximum difference for PRI based on geometric mean FI after 90 minutes compared to baseline (Δ=3.92%PRI, p<0.001). The differences in the reported cut-offs might be explained by a lack of standardisation. More precise standardisation is inevitable, as the PRI significantly depends on the method of calculation, the time-to-assay as well as on the lag time after processing. Tolerably stable results were obtained for the PRI from the median FI.

  5. Structure-function analysis of the 3' phosphatase component of T4 polynucleotide kinase/phosphatase.

    PubMed

    Zhu, Hui; Smith, Paul; Wang, Li Kai; Shuman, Stewart

    2007-09-15

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  6. Structure-Function Analysis of the 3' Phosphatase Component of T4 Polynucleotide Kinase/phosphatase

    SciTech Connect

    Zhu,H.; Smith, P.; Wang, L.; Shuman, S.

    2007-01-01

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  7. AKAP phosphatase complexes in the heart.

    PubMed

    Redden, John M; Dodge-Kafka, Kimberly L

    2011-10-01

    Directed protein phosphorylation is indisputably critical for a multitude of cellular processes. A growing body of research demonstrates A kinase anchoring proteins (AKAPs) to mediate a significant number of phosphorylation events in the heart. By acting as molecular tethers for the regulatory subunit of protein kinase A, AKAPs focus kinase activity onto specific substrate. In the time since their discovery, the AKAP model has evolved in appreciation of the broader role these scaffolds play in coordinating multiple signaling enzymes to efficiently regulate dynamic cellular processes. The focus of this review is on the emerging role of AKAPs in regulating the 3 main cardiac phosphatases: Protein Phosphatase 1 by AKAP18 and Yotiao, and Protein Phosphatases 2A and 2B by muscle specific A-kinase anchoring protein.

  8. A specific sucrose phosphatase from plant tissues

    PubMed Central

    Hawker, J. S.; Hatch, M. D.

    1966-01-01

    1. A phosphatase that hydrolyses sucrose phosphate (phosphorylated at the 6-position of fructose) was isolated from sugar-cane stem and carrot roots. With partially purified preparations fructose 6-phosphate, glucose 6-phosphate, fructose 1-phosphate, glucose 1-phosphate and fructose 1,6-diphosphate are hydrolysed at between 0 and 2% of the rate for sucrose phosphate. 2. The activity of the enzyme is increased fourfold by the addition of Mg2+ ions and inhibited by EDTA, fluoride, inorganic phosphate, pyrophosphate, Ca2+ and Mn2+ ions. Sucrose (50mm) reduces activity by 60%. 3. The enzyme exhibits maximum activity between pH6·4 and 6·7. The Michaelis constant for sucrose phosphate is between 0·13 and 0·17mm. 4. At least some of the specific phosphatase is associated with particles having the sedimentation properties of mitochondria. 5. A similar phosphatase appears to be present in several other plant species. PMID:4290548

  9. CDC25 phosphatases as potential human oncogenes.

    PubMed

    Galaktionov, K; Lee, A K; Eckstein, J; Draetta, G; Meckler, J; Loda, M; Beach, D

    1995-09-15

    Cyclin-dependent kinases (CDKs) are activated by CDC25 phosphatases, which remove inhibitory phosphate from tyrosine and threonine residues. In human cells, CDC25 proteins are encoded by a multigene family, consisting of CDC25A, CDC25B, and CDC25C. In rodent cells, human CDC25A or CDC25B but not CDC25C phosphatases cooperate with either Ha-RASG12V or loss of RB1 in oncogenic focus formation. Such transformants were highly aneuploid, grew in soft agar, and formed high-grade tumors in nude mice. Overexpression of CDC25B was detected in 32 percent of human primary breast cancers tested. The CDC25 phosphatases may contribute to the development of human cancer.

  10. The cell wall-targeted purple acid phosphatase AtPAP25 is critical for acclimation of Arabidopsis thaliana to nutritional phosphorus deprivation.

    PubMed

    Del Vecchio, Hernan A; Ying, Sheng; Park, Joonho; Knowles, Vicki L; Kanno, Satomi; Tanoi, Keitaro; She, Yi-Min; Plaxton, William C

    2014-11-01

    Plant purple acid phosphatases (PAPs) belong to a relatively large gene family whose individual functions are poorly understood. Three PAP isozymes that are up-regulated in the cell walls of phosphate (Pi)-starved (-Pi) Arabidopsis thaliana suspension cells were purified and identified by MS as AtPAP12 (At2g27190), AtPAP25 (At4g36350) and AtPAP26 (At5g34850). AtPAP12 and AtPAP26 were previously isolated from the culture medium of -Pi cell cultures, and shown to be secreted by roots of Arabidopsis seedlings to facilitate Pi scavenging from soil-localized organophosphates. AtPAP25 exists as a 55 kDa monomer containing complex NX(S/T) glycosylation motifs at Asn172, Asn367 and Asn424. Transcript profiling and immunoblotting with anti-AtPAP25 immune serum indicated that AtPAP25 is exclusively synthesized under -Pi conditions. Coupled with potent mixed-type inhibition of AtPAP25 by Pi (I50 = 50 μm), this indicates a tight feedback control by Pi that prevents AtPAP25 from being synthesized or functioning as a phosphatase except when Pi levels are quite low. Promoter-GUS reporter assays revealed AtPAP25 expression in shoot vascular tissue of -Pi plants. Development of an atpap25 T-DNA insertion mutant was arrested during cultivation on soil lacking soluble Pi, but rescued upon Pi fertilization or complementation with AtPAP25. Transcript profiling by quantitative RT-PCR indicated that Pi starvation signaling was attenuated in the atpap25 mutant. AtPAP25 exhibited near-optimal phosphatase activity with several phosphoproteins and phosphoamino acids as substrates. We hypothesize that AtPAP25 plays a key signaling role during Pi deprivation by functioning as a phosphoprotein phosphatase rather than as a non-specific scavenger of Pi from extracellular P-monoesters. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  11. Protein kinase and protein phosphatase expression in the central nervous system of G93A mSOD over-expressing mice.

    PubMed

    Hu, Jie Hong; Chernoff, Ken; Pelech, Steven; Krieger, Charles

    2003-04-01

    The expressions of 78 protein kinases, 24 protein phosphatases and 31 phosphoproteins were investigated by Kinetworks trade mark analysis in brain and spinal cord tissue of transgenic mice over-expressing G93A mutant superoxide dismutase (mSOD), a murine model of amyotrophic lateral sclerosis (ALS). In the brains of affected mSOD mice, we observed increased expression of cAMP-dependent protein kinase (PKA, 111% increase compared with control), and protein phosphatase 2B Aalpha-catalytic subunit (calcineurin, 109% increase), and reductions in the levels of PAK3 (76% decrease) and protein phosphatase 2C Cbeta-subunit (32% decrease). Increased Ser259 phosphorylation of Raf1 (126% increase) in mSOD mice correlated with higher expression of p73 Raf1 (147% increase). There was also increased p73 Raf1 (69% increase) and Ser259 phosphorylation (45% increase) in the spinal cords of mSOD mice. While adducin underwent enhanced phosphorylation (alphaS724, 90% increase; gammaS662, 290% increase) in mSOD brain, its phosphorylation was lower in the mSOD spinal cord (alphaS724, 53% decrease; gammaS662, 46% decrease). In spinal cords of affected mSOD mice, we also observed elevated expression of casein kinase 1delta (CK1delta, 157% increase), JAK2 (84% increase), PKA (183% increase), protein kinase C (PKC) delta (123% increase), p124 PKC micro (142% increase), and RhoA kinase (221% increase), and enhanced phosphorylation of extracellular regulated kinases 1 (ERK1, T202/Y204, 90% increase), and 2 (ERK2, T185/Y187, 73% increase), p38 MAP kinase (T180/Y182, 1570% increase), and PKBalpha (T308, 154% increase; S473, 61% increase). There was also reduced phosphorylation of RB (S780, 45% decrease; S807/S811, 65% decrease), Src (Y418, 63% decrease) and p40 SAPK/JNKbeta (T183/Y185, 43% decrease). Variability in the expression of kinases, phosphatases and phosphorylation of their substrates was observed even in mutant animals having a similar phenotype. The expression and phosphorylation

  12. Low molecular mass phosphoproteins from the frog rod outer segments form a complex with 48 kDa protein.

    PubMed

    Krapivinsky, G B; Malenyov, A L; Zaikina, I V; Fesenko, E E

    1992-09-01

    Upon separation of cAMP-dependent low molecular mass phosphoproteins [Components I and II; Polans et al. (1979) J. gen. Physiol. 74, 595-613] from the frog rod outer segments by gel-chromatography, isoelectric focusing, non-denaturating electrophoresis and ion-exchange chromatography, they behave like subunits of the oligomeric complex. Apparent molecular mass of the complex determined by gel-chromatography is 52-57 kDa and by non-denaturating gradient electrophoresis is 62-66 kDa. The isoelectric point of the complex is 5.5. The elution profile of Components I and II upon gel-chromatography and ion-exchange chromatography coincides with that of major rod outer segment 48 kDa protein. The isoelectric point for them also coincides with the isoelectric point of 48 kDa protein. The amount of low molecular mass phosphoproteins is sealed rods is equal to one molecule per 60 rhodopsin molecules and coincides with that of a 48 kDa protein. It is suggested that in solution Components I and II form an oligomeric complex with 48 kDa protein.

  13. A peptide targeted against phosphoprotein and leader RNA interaction inhibits growth of Chandipura virus -- an emerging rhabdovirus.

    PubMed

    Roy, Arunava; Chakraborty, Prasenjit; Polley, Smarajit; Chattopadhyay, Dhrubajyoti; Roy, Siddhartha

    2013-11-01

    The fatal illness caused by Chandipura virus (CHPV), an emerging pathogen, presently lacks any therapeutic option. Previous research suggested that interaction between the virally encoded phosphoprotein (P) and the positive sense leader RNA (le-RNA) may play an important role in the viral lifecycle. In this report, we have identified a β-sheet/loop motif in the C-terminal domain of the CHPV P protein as essential for this interaction. A synthetic peptide encompassing this motif and spanning a continuous stretch of 36 amino acids (Pep208-243) was found to bind the le-RNA in vitro and inhibit CHPV growth in infected cells. Furthermore, a stretch of three amino acid residues at position 217-219 was identified as essential for this interaction, both in vitro and in infected cells. siRNA knockdown-rescue experiments demonstrated that these three amino acid residues are crucial for the leader RNA binding function of P protein in the CHPV life cycle. Mutations of these three amino acid residues render the peptide completely ineffective against CHPV. Effect of inhibition of phosphoprotein-leader RNA interaction on viral replication was assayed. Peptide Pep208-243 tagged with a cell penetrating peptide was found to inhibit CHPV replication as ascertained by real time RT-PCR. The specific inhibition of viral growth observed using this peptide suggests a new possibility for designing of anti-viral agents against Mononegavirale group of human viruses.

  14. A rapid and simple 8-quinolinol-based fluorescent stain of phosphoproteins in polyacrylamide gel after electrophoresis.

    PubMed

    Wang, Xu; Hwang, Sun-Young; Cong, Wei-Tao; Jin, Li-Tai; Choi, Jung-Kap

    2015-10-01

    In order to obtain an easy and rapid protocol to visualize phosphoproteins in SDS-PAGE, a fluorescent detection method named 8-Quinolinol (8-Q) stain is described. 8-Q can form ternary complexes in the gel matrix contributed by the affinity of aluminum ion (Al(3+) ) to the phosphate groups on the proteins and the metal chelating property of 8-Quinolinol, exhibiting strong fluorescence in ultraviolet light. It can visualize as little as 4∼8 ng of α-casein and β-casein, 16∼32 ng of ovalbumin and κ-casein which is more sensitive than Stains-All but less sensitive than Pro-Q Diamond. The protocol of 8-Q requires only 70 min in 0.75 mm mini-size or 1.0 mm large-size gels with five changes of solutions without destaining step; Pro-Q takes at least 250 min with 11 changes of solutions. In addition, the new method was confirmed by the study of dephosphorylation and LC-MS/MS, respectively. The approach to visualize phosphoprotein utilizing 8-Q could be an alternative to simplify the analytical operations for phosphoproteomics research.

  15. The Glycosylphosphatidylinositol-Anchored Phosphatase from Spirodela oligorrhiza Is a Purple Acid Phosphatase1

    PubMed Central

    Nakazato, Hiroshi; Okamoto, Takashi; Nishikoori, Miwa; Washio, Kenji; Morita, Naoki; Haraguchi, Kensaku; Thompson, Guy A.; Okuyama, Hidetoshi

    1998-01-01

    We recently presented clear evidence that the major low-phosphate-inducible phosphatase of the duckweed Spirodela oligorrhiza is a glycosylphosphatidylinositol (GPI)-anchored protein, and, to our knowledge, is the first described from higher plants (N. Morita, H. Nakazato, H. Okuyama, Y. Kim, G.A. Thompson, Jr. [1996] Biochim Biophys Acta 1290: 53–62). In this report the purified 57-kD phosphatase is shown to be a purple metalloenzyme containing Fe and Mn atoms and having an absorption maximum at 556 nm. The phosphatase activity was only slightly inhibited by tartrate, as expected for a purple acid phosphatase (PAP). Furthermore, the protein cross-reacted with an anti-Arabidopsis PAP antibody on immunoblots. The N-terminal amino acid sequence of the phosphatase was very similar to those of Arabidopsis, red kidney bean (Phaseolus vulgaris), and soybean (Glycine max) PAP. Extracts of S. oligorrhiza plants incubated with the GPI-specific precursor [3H]ethanolamine were treated with antibodies raised against the purified S. oligorrhiza phosphatase. Radioactivity from the resulting immunoprecipitates was specifically associated with a 57-kD band on sodium dodecyl sulfate-polyacrylamide gels. These results, together with previous findings, strongly indicate that the GPI-anchored phosphatase of S. oligorrhiza is a PAP. PMID:9808746

  16. Sprouty-Related Ena/Vasodilator-Stimulated Phosphoprotein Homology 1-Domain-Containing Protein-2 Critically Regulates Influenza A Virus-Induced Pneumonia.

    PubMed

    Ito, Toshihiro; Itakura, Junya; Takahashi, Sakuma; Sato, Miwa; Mino, Megumi; Fushimi, Soichiro; Yamada, Masao; Morishima, Tuneo; Kunkel, Steven L; Matsukawa, Akihiro

    2016-07-01

    Influenza A virus causes acute respiratory infections that induce annual epidemics and occasional pandemics. Although a number of studies indicated that the virus-induced intracellular signaling events are important in combating influenza virus infection, the mechanism how specific molecule plays a critical role among various intracellular signaling events remains unknown. Raf/MEK/extracellular signal-regulated kinase cascade is one of the key signaling pathways during influenza virus infection, and the Sprouty-related Ena/vasodilator-stimulated phosphoprotein homology 1-domain-containing protein has recently been identified as a negative regulator of Raf-dependent extracellular signal-regulated kinase activation. Here, we examined the role of Raf/MEK/extracellular signal-regulated kinase cascade through sprouty-related Ena/vasodilator-stimulated phosphoprotein homology 1-domain-containing protein in influenza A viral infection because the expression of sprouty-related Ena/vasodilator-stimulated phosphoprotein homology 1-domain-containing protein was significantly enhanced in human influenza viral-induced pneumonia autopsy samples. Prospective animal trial. Research laboratory. Wild-type and sprouty-related Ena/vasodilator-stimulated phosphoprotein homology 1-domain-containing protein-2 knockout mice inoculated with influenza A. Wild-type or sprouty-related Ena/vasodilator-stimulated phosphoprotein homology 1-domain-containing protein-2 knockout mice were infected by intranasal inoculation of influenza A (A/PR/8). An equal volume of phosphate-buffered saline was inoculated intranasally into mock-infected mice. Influenza A infection of sprouty-related Ena/vasodilator-stimulated phosphoprotein homology 1-domain-containing protein-2 knockout mice led to higher mortality with greater viral load, excessive inflammation, and enhanced cytokine production than wild-type mice. Administration of MEK inhibitor, U0126, improved mortality and reduced both viral load and

  17. Phosphatase activities analyzed by in vivo expressions.

    PubMed

    Schweighofer, Alois; Ayatollahi, Zahra; Meskiene, Irute

    2009-01-01

    Protein phosphatases act to reverse phosphorylation-related modifications induced by protein kinases. Type 2C protein phosphatases (PP2C) are monomeric Ser/Thr phosphatases that require a metal for their activity and are abundant in prokaryotes and eukaryotes. In plants, such as Medicago and Arabidopsis PP2Cs control several essential processes, including ABA signaling, development, and wound-induced mitogen-activated protein kinase (MAPK) pathways. In vitro assays with recombinant proteins and yeast two-hybrid systems usually provide initial information about putative PP2C substrates; however, these observations have to be verified in vivo. Therefore, a method for transient expression in isolated Arabidopsis suspension cell protoplasts was developed to assay PP2C action in living cells. This system has proven to be very useful in producing active enzymes and their substrates and in performing enzymatic reactions in vivo. Transient gene expression in isolated cells enabled assembly of functional protein kinase cascades and the creation of phosphorylated targets for PP2Cs. The method is based on the co-transformation and transient co-expression of different PP2C proteins with MAPK. It shows that epitope-tagged PP2C and MAPK proteins exhibit high enzymatic activities and produce substantial protein amounts easily monitored by Western blot analysis. Additionally, PP2C phosphatase activities can be directly tested in protein extracts from protoplasts, suggesting a possibility for analysis of activities of new PP2C family members.

  18. Phosphatase hydrolysis of organic phosphorus compounds

    USDA-ARS?s Scientific Manuscript database

    Phosphatases are diverse groups of enzymes that deserve special attention because of the significant roles they play in mineralizing organic phosphorus (P) into inorganic available form. For getting more insight on the enzymatically hydrolysis of organic P, in this work, we compared the catalytic pa...

  19. Assaying inositol and phosphoinositide phosphatase enzymes.

    PubMed

    Donahue, Janet L; Ercetin, Mustafa; Gillaspy, Glenda E

    2013-01-01

    One critical aspect of phosphoinositide signaling is the turnover of signaling molecules in the pathway. These signaling molecules include the phosphatidylinositol phosphates (PtdInsPs) and inositol phosphates (InsPs). The enzymes that catalyze the breakdown of these molecules are thus important potential regulators of signaling, and in many cases the activity of such enzymes needs to be measured and compared to other enzymes. PtdInsPs and InsPs are broken down by sequential dephosphorylation reactions which are catalyzed by a set of specific phosphatases. Many of the phosphatases can act on both PtdInsP and InsP substrates. The protocols described in this chapter detail activity assays that allow for the measurement of PtdInsP and InsP phosphatase activities in vitro starting with native or recombinant enzymes. Three different assays are described that have different equipment requirements and allow one to test a range of PtdInsP and InsP phosphatases that act on different substrates.

  20. Phosphatase activities as biosignatures of extant life

    NASA Astrophysics Data System (ADS)

    Kobayashi, K.; Itoh, Y.; Edazawa, Y.; Moroi, A.; Takano, Y.

    It has been recognized that terrestrial biosphere expands to such extreme environments as deep subsurface lithosphere high temperature hot springs and stratosphere Possible extraterrestrial biospheres in Mars Europa and Titan are being discussed Many biosignatures or biomarkers have been proposed to detect microbial activities in such extreme environments Phosphate esters are essential for the terrestrial life since they are constituents of nucleic acids and cell mebranes Thus all the terrestrial organisms have phosphatases that are enzymes catalyzing hydrolysis of phosphate esters We analyzed phosphatase activities in the samples obtained in extreme environments such as submarine hydrothermal systems and discussed whether they can be used as biosignatures for extant life Core samples and chimney samples were collected at the Suiyo Seamount Izu-Bonin Arc the Pacific Ocean in 2001 and 2002 and in South Mariana hydrothermal systems the Pacific Oceanas in 2003 both in a part of the Archaean Park Project Phosphatase activity in solid rock samples was measured spectrometrically by using 25 mM p-nitrophenyl phosphate pH 8 0 or pH 6 5 as a substrate as follows Pulverized samples were incuvated with substrate solution for an hour and then production rate of p-nitrophenol was calculated with absorbance at 410 nm Phosphatase activity in extracts was measured fluorometrically by using 4-methylumberyferryl phosphate as a substrate Concentration of amino acids and their enantiomeric ratio were determined by HPLC after HF digestion of the

  1. Tyrosine phosphatase activity in mitochondria: presence of Shp-2 phosphatase in mitochondria.

    PubMed

    Salvi, M; Stringaro, A; Brunati, A M; Agostinelli, E; Arancia, G; Clari, G; Toninello, A

    2004-09-01

    Tyrosine phosphorylation by unidentified enzymes has been observed in mitochondria, with recent evidence indicating that non-receptorial tyrosine kinases belonging to the Src family, which represent key players in several transduction pathways, are constitutively present in mitochondria. The extent of protein phosphorylation reflects a coordination balance between the activities of specific kinases and phophatases. The present study demonstrates that purified rat brain mitochondria possess endogenous tyrosine phosphatase activity. Mitochondrial phosphatases were found to be capable of dephosphorylating different exogenous substrates, including paranitrophenylphosphate, (32)P-poly(Glu-Tyr)(4:1) and (32)P-angiotensin. These activities are strongly inhibited by peroxovanadate, a well-known inhibitor of tyrosine phosphatases, but not by inhibitors of alkali or Ser/Thr phosphatases, and mainly take place in the intermembrane space and outer mitochondrial membrane. Using a combination of approaches, we identified the tyrosine phosphatase Shp-2 in mitochondria. Shp-2 plays a crucial role in a number of intracellular signalling cascades and is probably involved in several human diseases. It thus represents the first tyrosine phosphatase shown to be present in mitochondria.

  2. [Leucocyte alkaline phosphatase in normal and pathological pregnancy (author's transl)].

    PubMed

    Stark, K H; Zaki, I; Sobolewski, K

    1981-01-01

    The activities of leucocyte alkaline phosphatase were determined in 511 patients with normal and pathological pregnancy. Mean values were compared and the enzyme followed up, and the conclusion was drawn that leucocyte alkaline phosphatase was no safe indicator of foetal condition. No direct relationship were found to exist between leucocyte alkaline phosphatase, total oestrogens, HSAP, HLAP, HPL, and oxytocinase.

  3. Development of pre-implantation porcine embryos cultured within alginate hydrogel systems either supplemented with secreted phosphoprotein 1 or conjugated with arg-gly-asp peptide

    USDA-ARS?s Scientific Manuscript database

    Although deficiencies in porcine embryo elongation play a significant role on early embryonic mortality and establishment of within–litter developmental variation, the exact mechanisms of elongation are poorly understood. Secreted phosphoprotein 1 (SPP1) is increased within the uterine milieu during...

  4. The FLI-1 transcription factor is a short-lived phosphoprotein in T cells.

    PubMed

    Zhang, Xian K; Watson, Dennis K

    2005-03-01

    The FLI-1 transcription factor is a member of the ETS gene family, most closely related to ERG. In this study, the FLI-1 protein products were characterized using a specific monoclonal antibody previously developed against bacterially expressed protein. In the human T-cell line Jurkat, both isoforms of FLI-1, p51 and p48, are phosphorylated, primarily on serine residues. FLI-1 phosphorylation is increased by a Ca(2+)-mediated process, and inhibitor studies indicate that protein phosphatase 2A, at least in part, controls FLI-1 phosphorylation level. FLI-1 phosphorylation is not stimulated by phorbal 12-myristate 13-acetate (PMA), a protein kinase C activator, and in this it differs from ERG protein phosphorylation. The p51 isoform has a half-life of 105 min, and p48 has a half-life of 80 min; in contrast, the ERG protein is much more stable with a half-life of 21 h. Newly synthesized FLI-1 protein decreased during human T cell activation. Our data suggest that although the FLI-1 and ERG genes are highly homologous, their distinct properties may contribute to their different roles in gene regulation.

  5. M phase phosphoprotein 1 is a human plus-end-directed kinesin-related protein required for cytokinesis

    PubMed Central

    Abaza, Aouatef; Soleilhac, Jean-Marc; Westendorf, Joanne; Piel, Matthieu; Crevel, Isabelle; Roux, Aurelien; Pirollet, Fabienne

    2003-01-01

    Summary The human M-Phase Phosphoprotein 1 (MPP1), previously identified through a screening of a subset of proteins specifically phosphorylated at the G2/M transition (1), is characterized as a plus-end-directed kinesin-related protein. Recombinant MPP1 exhibits in vitro microtubule-binding and microtubule-bundling properties as well as microtubules-stimulated ATPase activity. In gliding experiments using polarity-marked microtubules, MPP1 is a slow molecular motor that moves towards the microtubule plus-end at a 0.07 μm/s speed. In cycling cells, MPP1 localizes mainly to the nuclei in interphase. During mitosis, MPP1 is diffuse throughout the cytoplasm in metaphase and subsequently localizes to the midzone to further concentrate on the midbody. MPP1 suppression by RNA interference induces failure of cell division late in cytokinesis. We conclude that MPP1 is a new mitotic molecular motor required for completion of cytokinesis. PMID:12740395

  6. Structural Disorder within Paramyxoviral Nucleoproteins and Phosphoproteins in Their Free and Bound Forms: From Predictions to Experimental Assessment

    PubMed Central

    Habchi, Johnny; Longhi, Sonia

    2015-01-01

    We herein review available computational and experimental data pointing to the abundance of structural disorder within the nucleoprotein (N) and phosphoprotein (P) from three paramyxoviruses, namely the measles (MeV), Nipah (NiV) and Hendra (HeV) viruses. We provide a detailed molecular description of the mechanisms governing the disorder-to-order transition that the intrinsically disordered C-terminal domain (NTAIL) of their N proteins undergoes upon binding to the C-terminal X domain (PXD) of the homologous P proteins. We also show that NTAIL–PXD complexes are “fuzzy”, i.e., they possess a significant residual disorder, and discuss the possible functional significance of this fuzziness. Finally, we emphasize the relevance of N–P interactions involving intrinsically disordered proteins as promising targets for new antiviral approaches, and end up summarizing the general functional advantages of disorder for viruses. PMID:26184170

  7. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    SciTech Connect

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  8. How order and disorder within paramyxoviral nucleoproteins and phosphoproteins orchestrate the molecular interplay of transcription and replication.

    PubMed

    Longhi, Sonia; Bloyet, Louis-Marie; Gianni, Stefano; Gerlier, Denis

    2017-09-01

    In this review, we summarize computational and experimental data gathered so far showing that structural disorder is abundant within paramyxoviral nucleoproteins (N) and phosphoproteins (P). In particular, we focus on measles, Nipah, and Hendra viruses and highlight both commonalities and differences with respect to the closely related Sendai virus. The molecular mechanisms that control the disorder-to-order transition undergone by the intrinsically disordered C-terminal domain (NTAIL) of their N proteins upon binding to the C-terminal X domain (XD) of the homologous P proteins are described in detail. By having a significant residual disorder, NTAIL-XD complexes are illustrative examples of "fuzziness", whose possible functional significance is discussed. Finally, the relevance of N-P interactions as promising targets for innovative antiviral approaches is underscored, and the functional advantages of structural disorder for paramyxoviruses are pinpointed.

  9. Inflammation-associated repression of vasodilator-stimulated phosphoprotein (VASP) reduces alveolar-capillary barrier function during acute lung injury

    PubMed Central

    Henes, Janek; Schmit, Marthe A.; Morote-Garcia, Julio C.; Mirakaj, Valbona; Köhler, David; Glover, Louise; Eldh, Therese; Walter, Ulrich; Karhausen, Jörn; Colgan, Sean P.; Rosenberger, Peter

    2009-01-01

    Acute lung injury (ALI) is an inflammatory disorder associated with reduced alveolar-capillary barrier function, increased pulmonary vascular permeability, and infiltration of leukocytes into the alveolar space. Pulmonary function might be compromised, its most severe form being the acute respiratory distress syndrome. A protein central to physiological barrier properties is vasodilator-stimulated phosphoprotein (VASP). Given the fact that VASP expression is reduced during periods of cellular hypoxia, we investigated the role of VASP during ALI. Initial studies revealed reduced VASP expressional levels through cytokines in vitro. Studies in the putative human VASP promoter identified NF-κB as a key regulator of VASP transcription. This VASP repression results in increased paracellular permeability and migration of neutrophils in vitro. In a model of LPS-induced ALI, VASP−/− mice demonstrated increased pulmonary damage compared with wild-type animals. These findings were confirmed in a second model of ventilator-induced lung injury. Studies employing bone marrow chimeric animals identified tissue-specific repression of VASP as the underlying cause of decreased barrier properties of the alveolar-capillary barrier during ALI. Taken together these studies identify tissue-specific VASP as a central protein in the control of the alveolar-capillary barrier properties during ALI.—Henes, J., Schmit, M. A., Morote-Garcia, J. C., Mirakaj, V., Köhler, D., Glover, L., Eldh, T., Walter, U., Karhausen, J., Colgan, S. P., Rosenberger, P. Inflammation-associated repression of vasodilator-stimulated phosphoprotein (VASP) reduces alveolar-capillary barrier function during acute lung injury. PMID:19690214

  10. Determination of the non-ionic detergent insolubility and phosphoprotein associations of glycosylphosphatidylinositol-anchored proteins expressed on T cells.

    PubMed Central

    Solomon, K R; Mallory, M A; Finberg, R W

    1998-01-01

    Glycosylphosphatidylinositol (GPI)-anchored proteins are poorly solublized in non-ionic detergents such as Triton X-100 and Nonidet P40, but are easily solublized by detergents with high critical micelle concentrations such as octylglucoside. This solubility profile has been suggested to be due to the localization of GPI-anchored proteins to lipid microdomains rich in cholesterol and sphingolipids. Additionally, GPI-anchored proteins expressed on haemopoietic cells have been shown to associate with src-family tyrosine kinases and heterotrimeric G proteins. Despite these observations, the non-ionic detergent insolubility of GPI-anchored proteins on haemopoietic cells has not been quantified nor has a relationship between the non-ionic detergent insolubility of these proteins and their association with signal-transduction molecules been identified. Here we show that GPI-anchored proteins found on T-cell tumours and activated T cells, although significantly more insoluble then transmembrane proteins, are not uniform in their detergent insolubility. Whereas CD59 was between 4% and 13% soluble, CD48 was between 13% and 25% soluble, CD55 was between 20% and 30% soluble, and CD109 was between 34% and 75% soluble. The ability of these GPI-anchored proteins to associate with phosphoproteins was correlated with their detergent insolubility: the more detergent-insoluble that a GPI-anchored protein was, the greater the level of phosphoprotein associations. These experiments reveal a relationship between non-ionic detergent insolubility and association with signal-transduction molecules and suggest a cause-and-effect relationship between these two properties. In total, these experiments support the hypothesis that the association of GPI-anchored proteins with signalling molecules is due to their sorting to lipid microdomains. PMID:9716490

  11. Heat Shock Protein 70 Regulates Degradation of the Mumps Virus Phosphoprotein via the Ubiquitin-Proteasome Pathway

    PubMed Central

    Kubota, Toru; Kita, Shunsuke; Nakatsu, Yuichiro; Aoki, Natsuko; Mori, Yoshio; Maenaka, Katsumi; Takeda, Makoto; Kidokoro, Minoru

    2014-01-01

    ABSTRACT Mumps virus (MuV) infection induces formation of cytoplasmic inclusion bodies (IBs). Growing evidence indicates that IBs are the sites where RNA viruses synthesize their viral RNA. However, in the case of MuV infection, little is known about the viral and cellular compositions and biological functions of the IBs. In this study, pulldown purification and N-terminal amino acid sequencing revealed that stress-inducible heat shock protein 70 (Hsp72) was a binding partner of MuV phosphoprotein (P protein), which was an essential component of the IB formation. Immunofluorescence and immunoblotting analyses revealed that Hsp72 was colocalized with the P protein in the IBs, and its expression was increased during MuV infection. Knockdown of Hsp72 using small interfering RNAs (siRNAs) had little, if any, effect on viral propagation in cultured cells. Knockdown of Hsp72 caused accumulation of ubiquitinated P protein and delayed P protein degradation. These results show that Hsp72 is recruited to IBs and regulates the degradation of MuV P protein through the ubiquitin-proteasome pathway. IMPORTANCE Formation of cytoplasmic inclusion bodies (IBs) is a common characteristic feature in mononegavirus infections. IBs are considered to be the sites of viral RNA replication and transcription. However, there have been few studies focused on host factors recruited to the IBs and their biological functions. Here, we identified stress-inducible heat shock protein 70 (Hsp72) as the first cellular partner of mumps virus (MuV) phosphoprotein (P protein), which is an essential component of the IBs and is involved in viral RNA replication/transcription. We found that the Hsp72 mobilized to the IBs promoted degradation of the MuV P protein through the ubiquitin-proteasome pathway. Our data provide new insight into the role played by IBs in mononegavirus infection. PMID:25552722

  12. Determination of the non-ionic detergent insolubility and phosphoprotein associations of glycosylphosphatidylinositol-anchored proteins expressed on T cells.

    PubMed

    Solomon, K R; Mallory, M A; Finberg, R W

    1998-09-01

    Glycosylphosphatidylinositol (GPI)-anchored proteins are poorly solublized in non-ionic detergents such as Triton X-100 and Nonidet P40, but are easily solublized by detergents with high critical micelle concentrations such as octylglucoside. This solubility profile has been suggested to be due to the localization of GPI-anchored proteins to lipid microdomains rich in cholesterol and sphingolipids. Additionally, GPI-anchored proteins expressed on haemopoietic cells have been shown to associate with src-family tyrosine kinases and heterotrimeric G proteins. Despite these observations, the non-ionic detergent insolubility of GPI-anchored proteins on haemopoietic cells has not been quantified nor has a relationship between the non-ionic detergent insolubility of these proteins and their association with signal-transduction molecules been identified. Here we show that GPI-anchored proteins found on T-cell tumours and activated T cells, although significantly more insoluble then transmembrane proteins, are not uniform in their detergent insolubility. Whereas CD59 was between 4% and 13% soluble, CD48 was between 13% and 25% soluble, CD55 was between 20% and 30% soluble, and CD109 was between 34% and 75% soluble. The ability of these GPI-anchored proteins to associate with phosphoproteins was correlated with their detergent insolubility: the more detergent-insoluble that a GPI-anchored protein was, the greater the level of phosphoprotein associations. These experiments reveal a relationship between non-ionic detergent insolubility and association with signal-transduction molecules and suggest a cause-and-effect relationship between these two properties. In total, these experiments support the hypothesis that the association of GPI-anchored proteins with signalling molecules is due to their sorting to lipid microdomains.

  13. Immobilization of a phosphonated analog of matrix phosphoproteins within cross-linked collagen as a templating mechanism for biomimetic mineralization

    PubMed Central

    Gu, Li-sha; Kim, Young Kyung; Liu, Yan; Takahashi, Kei; Arun, Senthil; Wimmer, Courtney E.; Osorio, Raquel; Ling, Jun-qi; Looney, Stephen W.; Pashley, David H.; Tay, Franklin R.

    2010-01-01

    Immobilization of phosphoproteins on a collagen matrix is important for induction of intrafibrillar apatite mineralization. Unlike phosphate esters, polyphosphonic acid has no reactive sites for covalent binding to collagen amine groups. Binding of polyvinylphosphonic acid (PVPA), a biomimetic templating analog of matrix phosphoproteins, to collagen was found to be electrostatic in nature. Thus, an alternative retention mechanism was designed for immobilization of PVPA to collagen by cross-linking the latter with carbodiimide (EDC). This mechanism is based on the principle of size exclusion entrapment of PVPA molecules within the internal water compartments of collagen. By cross-linking collagen with EDC, a zero-length cross-linking agent, the sieving property of collagen is increased, enabling the PVPA to be immobilized within the collagen. Absence of covalent cross-linking between PVPA and collagen was confirmed by FT-IR spectroscopy. Based on these results, a concentration range for immobilized PVPA to template intrafibrillar apatite deposition was established and validated using a single-layer reconstituted type I collagen mineralization model. In the presence of a polyacrylic acid-containing mineralization medium, optimal intrafibrillar mineralization of the EDC-cross-linked collagen was achieved using 500 and 1,000 μg/mL PVPA. The mineralized fibrils exhibited a hierarchical order of intrafibrillar mineral infiltration, as manifested by the appearance of electron-dense periodicity within unstained fibrils. Understanding the basic processes in intrafibrillar mineralization of reconstituted collagen creates opportunities for the design of tissue engineering materials for hard tissue repair and regeneration. PMID:20688200

  14. Phosphatase of Regenerating Liver 3 (PRL3) Provokes a Tyrosine Phosphoproteome to Drive Prometastatic Signal Transduction*

    PubMed Central

    Walls, Chad D.; Iliuk, Anton; Bai, Yunpeng; Wang, Mu; Tao, W. Andy; Zhang, Zhong-Yin

    2013-01-01

    Phosphatase of regenerating liver 3 (PRL3) is suspected to be a causative factor toward cellular metastasis when in excess. To date, the molecular basis for PRL3 function remains an enigma, making efforts at distilling a concerted mechanism for PRL3-mediated metastatic dissemination very difficult. We previously discovered that PRL3 expressing cells exhibit a pronounced increase in protein tyrosine phosphorylation. Here we take an unbiased mass spectrometry-based approach toward identifying the phosphoproteins exhibiting enhanced levels of tyrosine phosphorylation with a goal to define the “PRL3-mediated signaling network.” Phosphoproteomic data support intracellular activation of an extensive signaling network normally governed by extracellular ligand-activated transmembrane growth factor, cytokine, and integrin receptors in the PRL3 cells. Additionally, data implicate the Src tyrosine kinase as the major intracellular kinase responsible for “hijacking” this network and provide strong evidence that aberrant Src activation is a major consequence of PRL3 overexpression. Importantly, the data support a PDGF(α/β)-, Eph (A2/B3/B4)-, and Integrin (β1/β5)-receptor array as being the predominant network coordinator in the PRL3 cells, corroborating a PRL3-induced mesenchymal-state. Within this network, we find that tyrosine phosphorylation is increased on a multitude of signaling effectors responsible for Rho-family GTPase, PI3K-Akt, STAT, and ERK activation, linking observations made by the field as a whole under Src as a primary signal transducer. Our phosphoproteomic data paint the most comprehensive picture to date of how PRL3 drives prometastatic molecular events through Src activation. PMID:24030100

  15. [ATPase and phosphatase activity of drone brood].

    PubMed

    Bodnarchuk, L I; Stakhman, O S

    2004-01-01

    Most researches on insect enzymes concern carbohydrate and nitrogenous exchange. Data on ATPase activity for larval material of drone brood are absent in the available literature. The drone brood is one of the least investigated apiproducts. Allowing for the important role of ATPase in the vital functions of the insect cells our work was aimed at the study of ATPase of the drone blood activity and that of alkaline and acid phosphatases. When studying liophylised preparations of the drone brood homogenate we have found out high activity of Mg2+, Na+, K+-, Ca2+- and Mg2+-ATPase and of alkaline and acid phosphatase, that is the possible explanation of the high-intensity power and plastic processes proceeding during growth and development of larvae.

  16. Phosphorylation and microtubule association of the Opitz syndrome protein mid-1 is regulated by protein phosphatase 2A via binding to the regulatory subunit α4

    PubMed Central

    Liu, Jun; Prickett, Todd D.; Elliott, Elizabeth; Meroni, Germana; Brautigan, David L.

    2001-01-01

    Opitz syndrome (OS) is a human genetic disease characterized by deformities such as cleft palate that are attributable to defects in embryonic development at the midline. Gene mapping has identified OS mutations within a protein called Mid1. Wild-type Mid1 predominantly colocalizes with microtubules, in contrast to mutant versions of Mid1 that appear clustered in the cytosol. Using yeast two-hybrid screening, we found that the α4-subunit of protein phosphatases 2A/4/6 binds Mid1. Epitope-tagged α4 coimmunoprecipitated endogenous or coexpressed Mid1 from COS7 cells, and this required only the conserved C-terminal region of α4. Localization of Mid1 and α4 was influenced by one another in transiently transfected cells. Mid1 could recruit α4 onto microtubules, and high levels of α4 could displace Mid1 into the cytosol. Metabolic 32P labeling of cells showed that Mid1 is a phosphoprotein, and coexpression of full-length α4 decreased Mid1 phosphorylation, indicative of a functional interaction. Association of green fluorescent protein–Mid1 with microtubules in living cells was perturbed by inhibitors of MAP kinase activation. The conclusion is that Mid1 association with microtubules, which seems important for normal midline development, is regulated by dynamic phosphorylation involving MAP kinase and protein phosphatase that is targeted specifically to Mid1 by α4. Human birth defects may result from environmental or genetic disruption of this regulatory cycle. PMID:11371618

  17. Assessment and kinetics of soil phosphatase in Brazilian Savanna systems.

    PubMed

    Ferreira, Adão S; Espíndola, Suéllen P; Campos, Maria Rita C

    2016-05-31

    The activity and kinetics of soil phosphatases are important indicators to evaluate soil quality in specific sites such as the Cerrado (Brazilian Savanna). This study aimed to determine the activity and kinetic parameters of soil phosphatase in Cerrado systems. Soil phosphatase activity was assessed in samples of native Cerrado (NC), no-tillage (NT), conventional tillage (CT) and pasture with Brachiaria brizantha (PBb) and evaluated with acetate buffer (AB), tris-HCl buffer (TB), modified universal buffer (MUB) and low MUB. The Michaelis-Menten equation and Eadie-Hofstee model were applied to obtain the kinetic parameters of soil phosphatase using different concentrations of p-nitrophenol phosphate (p-NPP). MUB showed the lowest soil phosphatase activity in all soils whereas AB in NC and NT presented the highest. Low MUB decreased interferences in the assessment of soil phosphatase activity when compared to MUB, suggesting that organic acids interfere on the soil phosphatase activity. In NC and NT, soil phosphatase activity performed with TB was similar to AB and low MUB. Km values from the Michaels-Menten equation were higher in NC than in NT, which indicate a lower affinity of phosphatase activity for the substrate in NC. Vmax values were also higher in NC than in NT. The Eadie-Hofstee model suggests that NC had more phosphatase isoforms than NT. The study showed that buffer type is of fundamental importance when assessing soil phosphatase activity in Cerrado soils.

  18. Evaluation of APHA and AOAC methods for phosphatase in cheese.

    PubMed

    Murthy, G K; Cox, S

    1988-01-01

    Varieties of market cheese were analyzed for alkaline phosphatase by the modified rapid colorimetric method of the American Public Health Association (APHA) and the official AOAC method, 16.304-16.306. In the APHA method, 5 g cheese (pH less than 7.0) is macerated with 2 mL 1:1 carbonate buffer, or 2 mL water (for cheese with pH greater than 7.0). Addition of 0.1 mL magnesium acetate (1 mg magnesium) to test portions of cheese extracts yielded reproducible and quantitative recovery of added phosphatase. In the AOAC method, macerating 0.5 g cheese with 1 mL borate buffer before adding milk phosphatase improved recovery among cheeses. Addition of magnesium ion increased phosphatase activity in some cheeses. Phosphatases in blue mold-ripened and Swiss cheeses were inactivated by heat faster than was milk phosphatase, yet milk phosphatase added to various soft cheeses was completely inactivated at 60 degrees C for 10 min. The lability of phosphatase was due to the heat-denaturing effect of NaCl present in finished cheeses. Some Mexican style soft cheeses contained both heat-labile and heat-stable phosphatases. These data suggest that the phosphatase test to differentiate milk and microbial phosphatases on the basis of repasteurization and analysis of cheese is no longer valid.

  19. Selective Effects of PDE10A Inhibitors on Striatopallidal Neurons Require Phosphatase Inhibition by DARPP-321,2,3

    PubMed Central

    Polito, Marina; Guiot, Elvire; Gangarossa, Giuseppe; Longueville, Sophie; Doulazmi, Mohamed; Valjent, Emmanuel; Hervé, Denis; Girault, Jean-Antoine; Paupardin-Tritsch, Danièle; Castro, Liliana R. V.

    2015-01-01

    Abstract Type 10A phosphodiesterase (PDE10A) is highly expressed in the striatum, in striatonigral and striatopallidal medium-sized spiny neurons (MSNs), which express D1 and D2 dopamine receptors, respectively. PDE10A inhibitors have pharmacological and behavioral effects suggesting an antipsychotic profile, but the cellular bases of these effects are unclear. We analyzed the effects of PDE10A inhibition in vivo by immunohistochemistry, and imaged cAMP, cAMP-dependent protein kinase A (PKA), and cGMP signals with biosensors in mouse brain slices. PDE10A inhibition in mouse striatal slices produced a steady-state increase in intracellular cAMP concentration in D1 and D2 MSNs, demonstrating that PDE10A regulates basal cAMP levels. Surprisingly, the PKA-dependent AKAR3 phosphorylation signal was strong in D2 MSNs, whereas D1 MSNs remained unresponsive. This effect was also observed in adult mice in vivo since PDE10A inhibition increased phospho-histone H3 immunoreactivity selectively in D2 MSNs in the dorsomedial striatum. The PKA-dependent effects in D2 MSNs were prevented in brain slices and in vivo by mutation of the PKA-regulated phosphorylation site of 32 kDa dopamine- and cAMP-regulated phosphoprotein (DARPP-32), which is required for protein phosphatase-1 inhibition. These data highlight differences in the integration of the cAMP signal in D1 and D2 MSNs, resulting from stronger inhibition of protein phosphatase-1 by DARPP-32 in D2 MSNs than in D1 MSNs. This study shows that PDE10A inhibitors share with antipsychotic medications the property of activating preferentially PKA-dependent signaling in D2 MSNs. PMID:26465004

  20. Role of Protein Tyrosine Phosphatases in Plants

    PubMed Central

    Shankar, Alka; Agrawal, Nisha; Sharma, Manisha; Pandey, Amita; Pandey, Girdhar K.

    2015-01-01

    Reversible protein phosphorylation is a crucial regulatory mechanism that controls many biological processes in eukaryotes. In plants, phosphorylation events primarily occur on serine (Ser) and threonine (Thr) residues, while in certain cases, it was also discovered on tyrosine (Tyr) residues. In contrary to plants, extensive reports on Tyr phosphorylation regulating a large numbers of biological processes exist in animals. Despite of such prodigious function in animals, Tyr phosphorylation is a least studied mechanism of protein regulation in plants. Recently, various chemical analytical procedures have strengthened the view that Tyr phosphorylation is equally prevalent in plants as in animals. However, regardless of Tyr phosphorylation events occuring in plants, no evidence could be found for the existence of gene encoding for Tyr phosphorylation i.e. the typical Tyr kinases. Various methodologies have suggested that plant responses to stress signals and developmental processes involved modifications in protein Tyr phosphorylation. Correspondingly, various reports have established the role of PTPs (Protein Tyrosine Phosphatases) in the dephosphorylation and inactivation of mitogen activated protein kinases (MAPKs) hence, in the regulation of MAPK signaling cascade. Besides this, many dual specificity protein phosphatases (DSPs) are also known to bind starch and regulate starch metabolism through reversible phosphorylation. Here, we are emphasizing the significant progress on protein Tyr phosphatases to understand the role of these enzymes in the regulation of post-translational modification in plant physiology and development. PMID:26962298

  1. Two potential fish glycerol-3-phosphate phosphatases.

    PubMed

    Raymond, James A

    2015-06-01

    Winter-acclimated rainbow smelt (Osmerus mordax Mitchill) produce high levels of glycerol as an antifreeze. A common pathway to glycerol involves the enzyme glycerol-3-phosphate phosphatase (GPP), but no GPP has yet been identified in fish or any other animal. Here, two phosphatases assembled from existing EST libraries (from winter-acclimated smelt and cold-acclimated smelt hepatocytes) were found to resemble a glycerol-associated phosphatase from a glycerol-producing alga, Dunaliella salina, and a recently discovered GPP from a bacterium, Mycobacterium tuberculosis. Recombinant proteins were generated and were found to have GPP activity on the order of a few μMol Pi/mg enzyme/min. The two enzymes have acidic pH optima (~5.5) similar to that previously determined for GPP activity in liver tissue, with about 1/3 of their peak activities at neutral pH. The two enzymes appear to account for the GPP activity of smelt liver, but due to their reduced activities at neutral pH, their contributions to glycerol production in vivo remain unclear. Similar enzymes may be active in a glycerol-producing insect, Dendroctonus ponderosae.

  2. Phosphatidylinositol-3 kinase-dependent translational regulation of Id1 involves the PPM1G phosphatase

    PubMed Central

    Xu, Kaiming; Wang, Lanfang; Feng, Wei; Feng, Yue; Shu, Hui-Kuo G.

    2016-01-01

    Id1 is a helix-loop-helix transcriptional modulator that increases the aggressiveness of malignant glial neoplasms. Since most glioblastomas (GBMs) show increased phosphatidylinositol-3 kinase (PI-3K) signaling, we sought to determine whether this pathway regulates Id1 expression. Higher basal Id1 expression correlates with dysregulated PI-3K signaling in multiple established GBM cell lines. Further characterization of PI-3K-dependent Id1 regulation reveals that chemical or genetic inhibition of PI-3K signaling reduces Id1 protein but not mRNA expression. Overall, PI-3K signaling appears to enhance Id1 translation with no significant effect on its stability. PI-3K signaling is known to regulate protein translation through mTORC1-dependent phosphorylation of 4E-BP1, which reduces its association with and inhibition of the translation initiation factor eIF4E. Interestingly, while inhibition of PI-3K and AKT lowers 4E-BP1 phosphorylation and expression of Id1 in all cases, inhibition of TORC1 with rapamycin does not consistently have a similar effect suggesting an alternative mechanism for PI-3K-dependent regulation of Id1 translation. We now identify a potential role for the serine-threonine phosphatase PPM1G in translational regulation of Id1 protein expression. PPM1G knockdown by siRNA increase both 4E-BP1 phosphorylation and Id1 expression and PPM1G and 4E-BP1 co-associates in GBM cells. Furthermore, PPM1G is a phosphoprotein and this phosphorylation appears to be regulated by PI-3K activity. Finally, PI-3K inhibition increases PPM1G activity when assessed by an in vitro phosphatase assay. Our findings provide the first evidence that the PI-3K/AKT signaling pathway modulates PPM1G activity resulting in a shift in the balance between hyper- and hypo-phosphorylated 4E-BP1 and translational regulation of Id1 expression. PMID:27065332

  3. Activation of WIP1 Phosphatase by HTLV-1 Tax Mitigates the Cellular Response to DNA Damage

    PubMed Central

    Dayaram, Tajhal; Lemoine, Francene J.; Donehower, Lawrence A.; Marriott, Susan J.

    2013-01-01

    Genomic instability stemming from dysregulation of cell cycle checkpoints and DNA damage response (DDR) is a common feature of many cancers. The cancer adult T cell leukemia (ATL) can occur in individuals infected with human T cell leukemia virus type 1 (HTLV-1), and ATL cells contain extensive chromosomal abnormalities, suggesting that they have defects in the recognition or repair of DNA damage. Since Tax is the transforming protein encoded by HTLV-1, we asked whether Tax can affect cell cycle checkpoints and the DDR. Using a combination of flow cytometry and DNA repair assays we showed that Tax-expressing cells exit G1 phase and initiate DNA replication prematurely following damage. Reduced phosphorylation of H2AX (γH2AX) and RPA2, phosphoproteins that are essential to properly initiate the DDR, was also observed in Tax-expressing cells. To determine the cause of decreased DDR protein phosphorylation in Tax-expressing cells, we examined the cellular phosphatase, WIP1, which is known to dephosphorylate γH2AX. We found that Tax can interact with Wip1 in vivo and in vitro, and that Tax-expressing cells display elevated levels of Wip1 mRNA. In vitro phosphatase assays showed that Tax can enhance Wip1 activity on a γH2AX peptide target by 2-fold. Thus, loss of γH2AX in vivo could be due, in part, to increased expression and activity of WIP1 in the presence of Tax. siRNA knockdown of WIP1 in Tax-expressing cells rescued γH2AX in response to damage, confirming the role of WIP1 in the DDR. These studies demonstrate that Tax can disengage the G1/S checkpoint by enhancing WIP1 activity, resulting in reduced DDR. Premature G1 exit of Tax-expressing cells in the presence of DNA lesions creates an environment that tolerates incorporation of random mutations into the host genome. PMID:23405243

  4. Primary structure of rat secretory acid phosphatase and comparison to other acid phosphatases.

    PubMed

    Roiko, K; Jänne, O A; Vihko, P

    1990-05-14

    Overlapping cDNA clones encoding rat prostatic acid phosphatase (rPAP) were isolated by using two human prostatic acid phosphatase (hPAP)-encoding cDNAs to screen rat prostatic cDNA libraries. The isolated cDNAs encompassed a total of 1626 nucleotides (nt), of which 1143 nt corresponded to the protein coding sequence encoding a mature polypeptide of 350 amino acids (aa) and a 31-aa long signal peptide-like sequence. The deduced Mr of the mature rPAP was 40,599. RNA blot analysis indicated the presence of three mRNA species (4.9, 2.3 and 1.5 kb in size) in the rat prostate. The deduced aa sequences of rPAP and hPAP show 75% identity, whereas the similarity between rPAP and human lysosomal acid phosphatase (hLAP) is only 45%. Furthermore, the sequence similarity between rPAP and rat lysosomal acid phosphatase (rLAP) is 46% at the aa level. Similar to hPAP, but unlike hLAP and rLAP, the rPAP sequence lacks a membrane-anchoring domain indicating the secretory character of this phosphatase. All six cysteines present in the overlapping areas of the mature rPAP, hPAP, rLAP and hLAP proteins are positionally conserved, suggesting that these residues are important for the tertiary structure of acid phosphatases (APs). The previously reported active site residues, two arginines and one histidine, are also conserved in these APs.

  5. Phosphoinositide phosphatases: just as important as the kinases.

    PubMed

    Dyson, Jennifer M; Fedele, Clare G; Davies, Elizabeth M; Becanovic, Jelena; Mitchell, Christina A

    2012-01-01

    Phosphoinositide phosphatases comprise several large enzyme families with over 35 mammalian enzymes identified to date that degrade many phosphoinositide signals. Growth factor or insulin stimulation activates the phosphoinositide 3-kinase that phosphorylates phosphatidylinositol (4,5)-bisphosphate [PtdIns(4,5)P(2)] to form phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P(3)], which is rapidly dephosphorylated either by PTEN (phosphatase and tensin homologue deleted on chromosome 10) to PtdIns(4,5)P(2), or by the 5-phosphatases (inositol polyphosphate 5-phosphatases), generating PtdIns(3,4)P(2). 5-phosphatases also hydrolyze PtdIns(4,5)P(2) forming PtdIns(4)P. Ten mammalian 5-phosphatases have been identified, which regulate hematopoietic cell proliferation, synaptic vesicle recycling, insulin signaling, and embryonic development. Two 5-phosphatase genes, OCRL and INPP5E are mutated in Lowe and Joubert syndrome respectively. SHIP [SH2 (Src homology 2)-domain inositol phosphatase] 2, and SKIP (skeletal muscle- and kidney-enriched inositol phosphatase) negatively regulate insulin signaling and glucose homeostasis. SHIP2 polymorphisms are associated with a predisposition to insulin resistance. SHIP1 controls hematopoietic cell proliferation and is mutated in some leukemias. The inositol polyphosphate 4-phosphatases, INPP4A and INPP4B degrade PtdIns(3,4)P(2) to PtdIns(3)P and regulate neuroexcitatory cell death, or act as a tumor suppressor in breast cancer respectively. The Sac phosphatases degrade multiple phosphoinositides, such as PtdIns(3)P, PtdIns(4)P, PtdIns(5)P and PtdIns(3,5)P(2) to form PtdIns. Mutation in the Sac phosphatase gene, FIG4, leads to a degenerative neuropathy. Therefore the phosphatases, like the lipid kinases, play major roles in regulating cellular functions and their mutation or altered expression leads to many human diseases.

  6. Structural analysis of the PP2C phosphatase tPphA from Thermosynechococcus elongatus: a flexible flap subdomain controls access to the catalytic site.

    PubMed

    Schlicker, Christine; Fokina, Oleksandra; Kloft, Nicole; Grüne, Tim; Becker, Stefan; Sheldrick, George M; Forchhammer, Karl

    2008-02-15

    The homologue of the phosphoprotein PII phosphatase PphA from Thermosynechococcus elongatus, termed tPphA, was identified and its structure was resolved in two different space groups, C222(1) and P4(1)2(1)2, at a resolution of 1.28 and 3.05 A, respectively. tPphA belongs to a large and widely distributed subfamily of Mg(2+)/Mn(2+)-dependent phosphatases of the PPM superfamily characterized by the lack of catalytic and regulatory domains. The core structure of tPphA shows a high degree of similarity to the two PPM structures identified so far. In contrast to human PP2C, but similar to Mycobacterium tuberculosis phosphatase PstP, the catalytic centre exhibits a third metal ion in addition to the dinuclear metal centre universally conserved in all PPM members. The fact that the third metal is only liganded by amino acids, which are universally conserved in all PPM members, implies that the third metal could be general for all members of this family. As a specific feature of tPphA, a flexible subdomain, previously recognized as a flap domain, could be revealed. Comparison of different structural isomers of tPphA as well as site-specific mutagenesis implied that the flap domain is involved in substrate binding and catalytic activity. The structural arrangement of the flap domain was accompanied by a large side-chain movement of an Arg residue (Arg169) at the basis of the flap. Mutation of this residue strongly impaired protein stability as well as catalytic activity, emphasizing the importance of this amino acid for the regional polysterism of the flap subdomain and confirming the assumption that flap domain flexibility is involved in catalysis.

  7. Carboxyarabinitol-1-P phosphatase of Phaseolus vulgaris

    SciTech Connect

    Kobza, J.; Moore, B.d.; Seemann, J.R. )

    1990-05-01

    The activity of carboxyarabinitol-1-P (CA1P) phosphatase was detected in clarified stromal extracts by the generation of {sup 14}C-carboxyarabinitol from {sup 14}C-CA1P. Carboxyribitol-1-P dependent activity was 3% of the CA1P dependent activity, indicating the enzyme was specific for CA1P. Inclusion of DTT in the assay was required for maximum velocity, but it appears that the enzyme is not regulated by thioredoxin in vivo. Activity o f the CA1P phosphatase was stimulated by RuBP, NADPH and FBP, though the latter two metabolites were required at nonphysiological concentrations in order to achieve significant stimulation. Contrary to a previous report on purified tobacco enzyme, ATP stimulated the CA1P phosphatase activity. In the presence of 1 mM RuBP or ATP, rates of 2 or 3 {mu}mol mg{sup {minus}1} Chl h{sup {minus}1}, respectively, were observed at 1 mM CA1P. These rates were 3-4 fold higher than the rate observed in the absence of effectors and are 2-4 times the in vivo rate of degradation of CA1P during dark/light transitions. The rates from bean were about 7 fold higher than rates reported for the enzyme from tobacco. Changes in the levels of ATP and RuBP associated with dark/light transitions could modulate the enzyme activity in vivo, but it remains to be established if this is the only mechanism for the required regulation of the enzyme.

  8. Auxiliary phosphatases in two-component signal transduction.

    PubMed

    Silversmith, Ruth E

    2010-04-01

    Signal termination in two-component systems occurs by loss of the phosphoryl group from the response regulator protein. This review explores our current understanding of the structures, catalytic mechanisms and means of regulation of the known families of phosphatases that catalyze response regulator dephosphorylation. The CheZ and CheC/CheX/FliY families, despite different overall structures, employ identical catalytic strategies using an amide side chain to orient a water molecule for in-line attack of the aspartyl phosphate. Spo0E phosphatases contain sequence and structural features that suggest a strategy similar to the chemotaxis phosphatases but the mechanism used by the Rap phosphatases is not yet elucidated. Identification of features shared by phosphatase families may aid in the identification of currently unrecognized classes of response regulator phosphatases. Copyright 2010 Elsevier Ltd. All rights reserved.

  9. Effect of Bacteria and Amoebae on Rhizosphere Phosphatase Activity

    PubMed Central

    Gould, W. Douglas; Coleman, David C.; Rubink, Amy J.

    1979-01-01

    The contributions of various components of soil microflora and microfauna to rhizosphere phosphatase activity were determined with hydroponic cultures. Three treatments were employed: (i) plants alone (Bouteloua gracilis (H.B.K.) Lag. ex Steud.) (ii) plants plus bacteria (Pseudomonas sp.), and (iii) plants plus bacteria plus amoebae (Acanthamoeba sp.). No alkaline phosphatase was detected, but an appreciable amount of acid phosphatase activity (120 to 500 nmol of p-nitrophenylphosphate hydrolyzed per h per plant) was found in the root culture solutions. The presence of bacteria or bacteria and amoebae increased the amount of acid phosphatase in solution, and properties of additional activity were identical to properties of plant acid phosphatase. The presence of bacteria or bacteria and amoebae increased both solution and root phosphatase activities at most initial phosphate concentrations. PMID:16345390

  10. Desialylated alkaline phosphatase: activation by 4-nitrophenol.

    PubMed

    Nayudu, P R

    1984-01-01

    Mouse ileal alkaline phosphatase is a sialyl enzyme (12-14 moles per mole of enzyme). When partially desialylated by treatment with neuraminidase, the enzyme loses most of its activity, associated with reduced apparent Vmax and Km. Part of that loss, however, is recovered as the product 4-nitrophenol's concentration builds up in the cuvette. Experimental results are presented to demonstrate that the activation is due to the binding of 4-nitrophenol as a ligand by the partially desialylated enzyme and that both the loss of activity by sialic acid removal and activation by ligand-binding are correlated with changes in protein conformation.

  11. Ultraviolet light-induced crosslinking of two major phosphoproteins and poly(A)+RNA from free polyribosomes; changes in phosphorylation by inhibitors of transcription and translation

    SciTech Connect

    Schweiger, A.; Kostka, G.; Weiss, E.

    1986-04-14

    Polyribosomes were isolated without the use of detergents, irradiated with ultraviolet light and labelled in the presence of (gamma-/sup 32/P) adenosine 5'-triphosphate. Poly(A)+RNA-protein structures separated by chromatography on oligo (dT)-cellulose contained up to 1o crosslinked proteins as shown by SDS-polyacrylamide gel electrophoresis. These included a 71 kDa poly(A)-bound species and two major phosphoproteins of 66 and 13o kDa. Pretreatment of rats with inhibitors of transcription and translation caused different and significant alterations in the labelling of the two phosphoproteins, suggesting that phosphorylation of proteins closely associated with mRNA may be involved in the regulation of the stability of this RNA or its binding to structural elements in the cell.

  12. Identification and Characterization of the Binding Site of the Respiratory Syncytial Virus Phosphoprotein to RNA-Free Nucleoprotein

    PubMed Central

    Galloux, Marie; Gabiane, Gaëlle; Sourimant, Julien; Richard, Charles-Adrien; England, Patrick; Moudjou, Mohammed; Aumont-Nicaise, Magali; Fix, Jenna; Rameix-Welti, Marie-Anne

    2015-01-01

    ABSTRACT The RNA genome of respiratory syncytial virus (RSV) is constitutively encapsidated by the viral nucleoprotein N, thus forming a helical nucleocapsid. Polymerization of N along the genomic and antigenomic RNAs is concomitant to replication and requires the preservation of an unassembled monomeric nucleoprotein pool. To this end, and by analogy with Paramyxoviridae and Rhabdoviridae, it is expected that the viral phosphoprotein P acts as a chaperone protein, forming a soluble complex with the RNA-free form of N (N0-P complex). Here, we have engineered a mutant form of N that is monomeric, is unable to bind RNA, still interacts with P, and could thus mimic the N0 monomer. We used this N mutant, designated Nmono, as a substitute for N0 in order to characterize the P regions involved in the N0-P complex formation. Using a series of P fragments, we determined by glutathione S-transferase (GST) pulldown assays that the N and C termini of P are able to interact with Nmono. We analyzed the functional role of amino-terminal residues of P by site-directed mutagenesis, using an RSV polymerase activity assay based on a human RSV minireplicon, and found that several residues were critical for viral RNA synthesis. Using GST pulldown and surface plasmon resonance assays, we showed that these critical residues are involved in the interaction between P[1-40] peptide and Nmono in vitro. Finally, we showed that overexpression of the peptide P[1-29] can inhibit the polymerase activity in the context of the RSV minireplicon, thus demonstrating that targeting the N0-P interaction could constitute a potential antiviral strategy. IMPORTANCE Respiratory syncytial virus (RSV) is the leading cause of lower respiratory tract illness in infants. Since no vaccine or efficient antiviral treatment is available against RSV, it is essential to better understand how the viral machinery functions in order to develop new antiviral strategies. RSV phosphoprotein P, the main RNA polymerase

  13. Phosphatase specificity and pathway insulation in signaling networks.

    PubMed

    Rowland, Michael A; Harrison, Brian; Deeds, Eric J

    2015-02-17

    Phosphatases play an important role in cellular signaling networks by regulating the phosphorylation state of proteins. Phosphatases are classically considered to be promiscuous, acting on tens to hundreds of different substrates. We recently demonstrated that a shared phosphatase can couple the responses of two proteins to incoming signals, even if those two substrates are from otherwise isolated areas of the network. This finding raises a potential paradox: if phosphatases are indeed highly promiscuous, how do cells insulate themselves against unwanted crosstalk? Here, we use mathematical models to explore three possible insulation mechanisms. One approach involves evolving phosphatase KM values that are large enough to prevent saturation by the phosphatase's substrates. Although this is an effective method for generating isolation, the phosphatase becomes a highly inefficient enzyme, which prevents the system from achieving switch-like responses and can result in slow response kinetics. We also explore the idea that substrate degradation can serve as an effective phosphatase. Assuming that degradation is unsaturatable, this mechanism could insulate substrates from crosstalk, but it would also preclude ultrasensitive responses and would require very high substrate turnover to achieve rapid dephosphorylation kinetics. Finally, we show that adaptor subunits, such as those found on phosphatases like PP2A, can provide effective insulation against phosphatase crosstalk, but only if their binding to substrates is uncoupled from their binding to the catalytic core. Analysis of the interaction network of PP2A's adaptor domains reveals that although its adaptors may isolate subsets of targets from one another, there is still a strong potential for phosphatase crosstalk within those subsets. Understanding how phosphatase crosstalk and the insulation mechanisms described here impact the function and evolution of signaling networks represents a major challenge for

  14. Inorganic Phosphate as an Important Regulator of Phosphatases

    PubMed Central

    Dick, Claudia Fernanda; Dos-Santos, André Luiz Araújo; Meyer-Fernandes, José Roberto

    2011-01-01

    Cellular metabolism depends on the appropriate concentration of intracellular inorganic phosphate (Pi). Pi starvation-responsive genes appear to be involved in multiple metabolic pathways, implying a complex Pi regulation system in microorganisms and plants. A group of enzymes is required for absorption and maintenance of adequate phosphate levels, which is released from phosphate esters and anhydrides. The phosphatase system is particularly suited for the study of regulatory mechanisms because phosphatase activity is easily measured using specific methods and the difference between the repressed and derepressed levels of phosphatase activity is easily detected. This paper analyzes the protein phosphatase system induced during phosphate starvation in different organisms. PMID:21755037

  15. Regulated protein kinases and phosphatases in cell cycle decisions.

    PubMed

    Novak, Bela; Kapuy, Orsolya; Domingo-Sananes, Maria Rosa; Tyson, John J

    2010-12-01

    Many aspects of cell physiology are controlled by protein kinases and phosphatases, which together determine the phosphorylation state of targeted substrates. Some of these target proteins are themselves kinases or phosphatases or other components of a regulatory network characterized by feedback and feed-forward loops. In this review we describe some common regulatory motifs involving kinases, phosphatases, and their substrates, focusing particularly on bistable switches involved in cellular decision processes. These general principles are applied to cell cycle transitions, with special emphasis on the roles of regulated phosphatases in orchestrating progression from one phase to the next of the DNA replication-division cycle.

  16. Functional size of the thylakoid phosphatases determined by radiation inactivation.

    PubMed

    Hsu, L H; Tzeng, C M; Pan, R L

    1993-02-22

    Radiation inactivation technique was employed to determine the functional size of phosphatases from thylakoid membrane. The enzymatic activities of phosphatases decayed in a simple function with the increase of radiation dosage. D37 values of 18.8 +/- 2.4-14.1 +/- 1.5 Mrad were obtained, using phosphoserine, phosphothreonine, p-nitrophenol phosphate, and phospho-histone V-S, respectively, as substrates. The molecular masses of 48.2 +/- 6.3-61 +/- 5.7 kDa were yielded by target theory analysis. We thus speculate that the thylakoid alkaline phosphatase is probably a monomer while acid phosphatase is functionally a dimer in situ.

  17. Regulated protein kinases and phosphatases in cell cycle decisions

    PubMed Central

    Novak, Bela; Kapuy, Orsolya; Domingo-Sananes, Maria Rosa; Tyson, John J

    2013-01-01

    Many aspects of cell physiology are controlled by protein kinases and phosphatases, which together determine the phosphorylation state of targeted substrates. Some of these target proteins are themselves kinases or phosphatases or other components of a regulatory network characterized by feedback and feed-forward loops. In this review we describe some common regulatory motifs involving kinases, phosphatases, and their substrates, focusing particularly on bistable switches involved in cellular decision processes. These general principles are applied to cell cycle transitions, with special emphasis on the roles of regulated phosphatases in orchestrating progression from one phase to the next of the DNA replication-division cycle. PMID:20678910

  18. Identification on Membrane and Characterization of Phosphoproteins Using an Alkoxide-Bridged Dinuclear Metal Complex as a Phosphate-Binding Tag Molecule

    PubMed Central

    Nakanishi, Tsuyoshi; Ando, Eiji; Furuta, Masaru; Kinoshita, Eiji; Kinoshita-Kikuta, Emiko; Koike, Tohru; Tsunasawa, Susumu; Nishimura, Osamu

    2007-01-01

    We have developed a method for on-membrane direct identification of phosphoproteins, which are detected by a phosphate-binding tag (Phos-tag) that has an affinity to phosphate groups with a chelated Zn2+ ion. This rapid profiling approach for phosphoproteins combines chemical inkjet technology for microdispensing of reagents onto a tiny region of target proteins with mass spectrometry for on-membrane digested peptides. Using this method, we analyzed human epidermoid carcinoma cell lysates of A-431 cells stimulated with epidermal growth factor, and identified six proteins with intense signals upon affinity staining with the phosphate-binding tag. It was already known that these proteins are phosphorylated, and our new approach proved to be effective at rapid profiling of phosphoproteins. Furthermore, we tried to determine their phosphorylation sites by MS/MS analysis after in-gel digestion of the corresponding spots on the 2DE gel to the rapid on-membrane identifications. As one example of use of information gained from the rapid-profiling approach, we successfully characterized a phosphorylation site at Ser-113 on prostaglandin E synthase 3. PMID:18166671

  19. Identification of phosphoproteins in Arabidopsis thaliana leaves using polyethylene glycol fractionation, immobilized metal-ion affinity chromatography, two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Aryal, Uma K; Krochko, Joan E; Ross, Andrew R S

    2012-01-01

    Reversible protein phosphorylation is a key regulatory mechanism in cells. Identification and characterization of phosphoproteins requires specialized enrichment methods, due to the relatively low abundance of these proteins, and is further complicated in plants by the high abundance of Rubisco in green tissues. We present a novel method for plant phosphoproteome analysis that depletes Rubisco using polyethylene glycol fractionation and utilizes immobilized metal-ion affinity chromatography to enrich phosphoproteins. Subsequent protein separation by one- and two-dimensional gel electrophoresis is further improved by extracting the PEG-fractionated protein samples with SDS/phenol and methanol/chloroform to remove interfering compounds. Using this approach, we identified 132 phosphorylated proteins in a partial Arabidopsis leaf extract. These proteins are involved in a range of biological processes, including CO(2) fixation, protein assembly and folding, stress response, redox regulation, and cellular metabolism. Both large and small subunits of Rubisco were phosphorylated at multiple sites, and depletion of Rubisco enhanced detection of less abundant phosphoproteins, including those associated with state transitions between photosystems I and II. The discovery of a phosphorylated form of AtGRP7, a self-regulating RNA-binding protein that affects floral transition, as well as several previously uncharacterized ribosomal proteins confirm the utility of this approach for phosphoproteome analysis and its potential to increase our understanding of growth and development in plants.

  20. A novel phosphoprotein analysis scheme for assessing changes in premalignant and malignant breast cell lines using 2D liquid separations, protein microarrays and tandem mass spectrometry

    PubMed Central

    Patwa, Tasneem H.; Wang, Yanfei; Miller, Fred R.; Goodison, Steve; Pennathur, Subramaniam; Barder, Timothy J.; Lubman, David M.

    2008-01-01

    An analysis of phosphorylation changes that occur during cancer progression would provide insights into the molecular pathways responsible for a malignant phenotype. In this study we employed a novel coupling of 2D-liquid separations and protein microarray technology to reveal changes in phosphoprotein status between premalignant (AT1) and malignant (CA1a) cell lines derived from the human MCF10A breast cell lines. Intact proteins were first separated according to their isoelectric point and hydrophobicities, then arrayed on SuperAmine glass slides. Phosphoproteins were detected using the universal, inorganic phospho-sensor dye, ProQ Diamond. Using this dye, out of 140 spots that were positive for phosphorylation, a total of 85 differentially expressed spots were detected over a pH range of 7.2 to 4.0. Proteins were identified and their peptides sequenced by mass spectrometry. The strategy enabled the identification of 75 differentially expressed phosphoproteins, from which 51 phosphorylation sites in 27 unique proteins were confirmed. Interestingly, the majority of differentially expressed phosphorylated proteins observed were nuclear proteins. Three regulators of apoptosis, Bad, Bax and Acinus, were also differentially phosphorylated in the two cell lines. Further development of this strategy will facilitate an understanding of the mechanisms involved in malignancy progression and other disease-related phenotypes. PMID:19194518

  1. A novel phosphoprotein analysis scheme for assessing changes in premalignant and malignant breast cell lines using 2D liquid separations, protein microarrays and tandem mass spectrometry.

    PubMed

    Patwa, Tasneem H; Wang, Yanfei; Miller, Fred R; Goodison, Steve; Pennathur, Subramaniam; Barder, Timothy J; Lubman, David M

    2008-01-01

    An analysis of phosphorylation changes that occur during cancer progression would provide insights into the molecular pathways responsible for a malignant phenotype. In this study we employed a novel coupling of 2D-liquid separations and protein microarray technology to reveal changes in phosphoprotein status between premalignant (AT1) and malignant (CA1a) cell lines derived from the human MCF10A breast cell lines. Intact proteins were first separated according to their isoelectric point and hydrophobicities, then arrayed on SuperAmine glass slides. Phosphoproteins were detected using the universal, inorganic phospho-sensor dye, ProQ Diamond. Using this dye, out of 140 spots that were positive for phosphorylation, a total of 85 differentially expressed spots were detected over a pH range of 7.2 to 4.0. Proteins were identified and their peptides sequenced by mass spectrometry. The strategy enabled the identification of 75 differentially expressed phosphoproteins, from which 51 phosphorylation sites in 27 unique proteins were confirmed. Interestingly, the majority of differentially expressed phosphorylated proteins observed were nuclear proteins. Three regulators of apoptosis, Bad, Bax and Acinus, were also differentially phosphorylated in the two cell lines. Further development of this strategy will facilitate an understanding of the mechanisms involved in malignancy progression and other disease-related phenotypes.

  2. Biology of tartrate-resistant acid phosphatase.

    PubMed

    Lamp, E C; Drexler, H G

    2000-11-01

    Tartrate-resistant acid phosphatase (TRAP) is a member of the ubiquitously expressed enzyme family of the acid phosphatases. Nearly 30 years ago, TRAP became known to hematologists as cytochemical marker enzyme of hairy cell leukemia. Physiologically, TRAP is primarily a cytochemical marker of macrophages, osteoclasts and dendritic cells. TRAP is localized intracellularly in the lysosomal compartment. Recent data suggest also secretion of TRAP by some cell types, in particular by osteoclasts. Human, mouse and rat TRAP are biochemically well characterized. While the complete genomic sequence of TRAP has been elucidated, only limited information on the genetic details of the gene and its regulation is available. It appears that the intracellular iron content is involved in the regulation of the enzyme. The physiological substrates for this enzyme have not been identified yet and consequently the functional role of TRAP remains completely unknown, though some hypotheses have been forwarded, e.g. involvement in bone resorption and iron homeostasis (transport, metabolism). Taken together, research on the biology of TRAP has been intensive and has led to considerable progress on a number of fronts, including the cloning of the gene. Further studies are, however, still required to determine the role of TRAP in vivo.

  3. Protein Phosphatases and Alzheimer’s Disease

    PubMed Central

    Braithwaite, Steven P.; Stock, Jeffry B.; Lombroso, Paul J.; Nairn, Angus C.

    2013-01-01

    Alzheimer’s Disease (AD) is characterized by progressive loss of cognitive function, linked to marked neuronal loss. Pathological hallmarks of the disease are the accumulation of the amyloid-β (Aβ) peptide in the form of amyloid plaques and the intracellular formation of neurofibrillary tangles (NFTs). Accumulating evidence supports a key role for protein phosphorylation in both the normal and pathological actions of Aβ as well as the formation of NFTs. NFTs contain hyperphosphorylated forms of the microtubule-binding protein tau, and phosphorylation of tau by several different kinases leads to its aggregation. The protein kinases involved in the generation and/or actions of tau or Aβ are viable drug targets to prevent or alleviate AD pathology. However, it has also been recognized that the protein phosphatases that reverse the actions of these protein kinases are equally important. Here, we review recent advances in our understanding of serine/threonine and tyrosine protein phosphatases in the pathology of AD. PMID:22340724

  4. Phosphoprotein Keratin 23 accumulates in MSS but not MSI colon cancers in vivo and impacts viability and proliferation in vitro.

    PubMed

    Birkenkamp-Demtroder, Karin; Mansilla, Francisco; Sørensen, Flemming Brandt; Kruhøffer, Mogens; Cabezón, Teresa; Christensen, Lise Lotte; Aaltonen, Lauri A; Verspaget, Hein W; Ørntoft, Torben Falck

    2007-09-01

    Transcript profiling of 27 normal colon mucosas and 258 adenocarcinomas showed Keratin23 to be increased in 78% microsatellite-stable tumors, while microsatellite-instable tumors showed low transcript levels, comparable to normal mucosas. Immunohistochemical analyses demonstrated that 88% of microsatellite-instable tumors were negative for Keratin23 protein, while 70% of MSS tumors and metastases derived from MSS-tumors showed high Keratin23 levels. Immunofluorescence analysis localized Keratin23 in the Golgi-apparatus. Golgi accumulation was unique for gastrointestinal adenocarcinomas. Immunoprecipitation and 2D-blot analysis revealed Keratin23 to be a 46.8 kDa phosphoprotein. Keratin23 impaired the proliferation of human colon cancer cells significantly, leading to cell death in microsatellite-instable but not microsatellite-stable cell lines, while COS7 cells experienced multiple nuclei and apoptosis. Keratin23 expression correlated significantly with transcription factor CEBPB. In conclusion, Keratin23 expression is a novel and important difference between microsatellite-stable and microsatellite-instable colon cancers.

  5. Phosphoprotein network analysis of white adipose tissues unveils deregulated pathways in response to high-fat diet

    PubMed Central

    Asfa, Alli Shaik; Qiu, Beiying; Wee, Sheena; Choi, Hyungwon; Gunaratne, Jayantha; Tergaonkar, Vinay

    2016-01-01

    Despite efforts in the last decade, signaling aberrations associated with obesity remain poorly understood. To dissect molecular mechanisms that define this complex metabolic disorder, we carried out global phosphoproteomic analysis of white adipose tissue (WAT) from mice fed on low-fat diet (LFD) and high-fat diet (HFD). We quantified phosphorylation levels on 7696 peptides, and found significant differential phosphorylation levels in 282 phosphosites from 191 proteins, including various insulin-responsive proteins and metabolic enzymes involved in lipid homeostasis in response to high-fat feeding. Kinase-substrate prediction and integrated network analysis of the altered phosphoproteins revealed underlying signaling modulations during HFD-induced obesity, and suggested deregulation of lipogenic and lipolytic pathways. Mutation of the differentially-regulated novel phosphosite on cytoplasmic acetyl-coA forming enzyme ACSS2 (S263A) upon HFD-induced obesity led to accumulation of serum triglycerides and reduced insulin-responsive AKT phosphorylation as compared to wild type ACSS2, thus highlighting its role in obesity. Altogether, our study presents a comprehensive map of adipose tissue phosphoproteome in obesity and reveals many previously unknown candidate phosphorylation sites for future functional investigation. PMID:27180971

  6. Cloning of the VASP (Vasodilator-Stimulated Phosphoprotein) genes in human and mouse: Structure, sequence, and chromosomal localization

    SciTech Connect

    Zimmer, M.; Fischer, L.; Hauser, W.

    1996-09-01

    The genes encoding the vasodilator-stimulated phosphoprotein (VASP) in human and mouse were isolated, and major parts were sequenced. In both species the gene is composed of 13 exons with conserved exon-intron positions. The mouse VASP cDNA sequence was deduced from the genomic sequence. The predicted amino acid sequence is 89% identical to the human protein. The high nucleotide sequence homology extends not only over the coding regions but also into the 3{prime}-UTRs, indicating a possible function in mRNA targeting or regulation of translation. Prominent 5{prime} CpG islands including multiple SP1 sites indicate a housekeeping function of VASP. Using cosmid DNA as a probe for fluorescence in situ hybridization, the human VASP gene was assigned to chromosome 19q13.2-q13.3, an extended region with homology to mouse chromosome 7. A sequence overlap of the VASP 5{prime}-region with the telomeric end of a cosmid contig physically links the VASP gene with ERCC1. VASP is located about 92 kb distal to ERCC1 and about 300 kb proximal to the myotonic dystrophy protein kinase gene. 43 refs., 6 figs.

  7. [The highly expressed secreted phosphoprotein 1 gene in prostate cancer metastasis: a microarray-based bioinformatic analysis].

    PubMed

    Li, Tie-qiu; Teng, Yi-li; Zou, Ya-guang; Yang, Yu; Li, Qi; Mao, Xiang-ming

    2014-11-01

    To investigate the composition, function, and regulatory mechanisms of the secreted phosphoprotein 1 (SPP1) gene in metastatic prostate cancer. We obtained the data about the whole genomic expression profiles on prostate cancer metastasis from the GEO database, and performed data-mining and bioinformatic analysis using BRB-Array Tools and such softwares as Protparam, MotifScan, SignalP 4.0, TMHMM, NetPhos2.0, PredictProtein, GO, KEGG, and STRING. Totally, 73 co-expressed differential genes in prostate cancer metastasis were identified, 21 up-regulated and 52 down-regulated (P <0.01). Bioinformatic analysis indicated that the highly expressed SPP1 gene encoded 314 amino acids and contained 2 N-glycosylation sites, 8 casein kinase II phosphorylation sites and 3 protein kinase C phosphorylation sites, playing essential roles in extracellular matrix (ECM) binding, ossification, osteoblast differentiation, cell adhesion, PI3K-Akt signaling pathway, focal adhesion, Toll-like receptor signaling pathway, and ECM-receptor interaction. The bioinformatic method showed a high efficiency in analyzing microarray data and revealing internal biological information. SPP1 may play an important role in prostate cancer metastasis and become a novel biomarker for the diagnosis of prostate cancer metastasis and a new target for its treatment.

  8. Identification of isoforms of the exocytosis-sensitive phosphoprotein PP63/parafusin in Paramecium tetraurelia and demonstration of phosphoglucomutase activity.

    PubMed Central

    Hauser, K; Kissmehl, R; Linder, J; Schultz, J E; Lottspeich, F; Plattner, H

    1997-01-01

    PP63 (parafusin) is a 63 kDa phosphoprotein which is very rapidly (within 80 ms) dephosphorylated (to P63) during triggered trichocyst exocytosis; this occurs selectively in exocytosis-competent Paramecium tetraurelia strains. In the present work, two cDNAs coding for PP63/parafusin have been isolated, one of which is a new isoform. These isoforms are 99.6% identical and are derived from two different genes. Similarity searches revealed 43-51% identity of the deduced amino acid sequences with known phosphoglucomutases from yeast and mammals. The sequences of two proteolytic peptides obtained from PP63/parafusin isolated from Paramecium are identical to parts of the amino acid sequence deduced from the major cDNA. The major cDNA was mutated from the macronuclear ciliate genetic code into the universal genetic code and expressed in Escherichia coli. The recombinant protein shows the same biochemical and immunological characteristics as the (P)P63/parafusin originally isolated from Paramecium. It has the same specific phosphoglucomutase activity as phosphoglucomutase from chicken muscle. We also show that recombinant P63-1 parafusin 1 is a substrate of an endogenous casein kinase from Paramecium, as is the originally isolated P63/parafusin. Polyclonal antibodies against recombinant P63-1/parafusin 1 were raised which recognized phosphoglucomutases from different sources. Thus we show that PP63/parafusin and phosphoglucomutase in Paramecium are identical. PMID:9173895

  9. Characterization of P0, a ribosomal phosphoprotein of Plasmodium falciparum. Antibody against amino-terminal domain inhibits parasite growth.

    PubMed

    Goswami, A; Singh, S; Redkar, V D; Sharma, S

    1997-05-02

    A cDNA expression clone of the human malarial parasite Plasmodium falciparum, lambdaPf4, which was reactive only to the immune sera and not to the patient sera, has recently been found to be the P. falciparum homologue of the P0 ribosomal phosphoprotein gene. A Northern analysis of the P0 gene revealed the presence of two transcripts, both present in all the different intraerythrocytic stages of the parasite life cycle. A 138-base pair amino-terminal domain of this gene was expressed as a fusion protein with glutathione S-transferase in Escherichia coli. Polyclonal antibodies raised against this domain immunoprecipitated the expected 38-kDa P0 protein from the 35S-labeled as well as 32P-labeled P. falciparum cultures. Monospecific human immune sera affinity-purified using the expression clone lambdaPf4 also immunoprecipitated the same size protein from [35S]methionine-labeled P. falciparum protein extract. Purified IgG from polyclonal antibodies raised against the amino-terminal domain of P0 protein completely inhibited the growth of P. falciparum in vitro. This inhibition appears to be mainly at the step of erythrocyte invasion by the parasites.

  10. Potential of liquid-isoelectric-focusing protein fractionation to improve phosphoprotein characterization of Pseudomonas aeruginosa PA14.

    PubMed

    Ouidir, Tassadit; Jarnier, Frédérique; Cosette, Pascal; Jouenne, Thierry; Hardouin, Julie

    2014-10-01

    Protein phosphorylation on serine, threonine, and tyrosine is known to be involved in a wide variety of cellular processes and signal transduction in bacteria. Bacterial-proteome analysis is required to determine which proteins have been conditionally expressed and whether any post-translational modifications are present. One of the greatest challenges of proteome analysis is the fractionation of these complex protein mixtures to detect low-abundance phosphoproteins. Liquid-phase isoelectric focusing (IEF) is a promising analytical tool in proteomics, but as far as we are aware no work has studied the reproducibility of this approach. In this study, we investigated the phosphoproteome of Pseudomonas aeruginosa strain PA14. We first tested in-solution IEF protein fractionation, and then used this technique to fractionate the proteins in the complex mixture. Next, phosphopeptides were enriched with titanium dioxide and analyzed by high-resolution, high-accuracy liquid chromatography-mass spectrometry. With this approach, we succeeded in characterizing 73 unique phosphorylated peptides belonging to 63 proteins. Interestingly, we observed a higher percentage of modified tyrosine, revealing the importance of this phosphorylated residue in bacteria.

  11. Viral vector vaccines expressing nucleoprotein and phosphoprotein genes of avian bornaviruses ameliorate homologous challenge infections in cockatiels and common canaries

    PubMed Central

    Olbert, Marita; Römer-Oberdörfer, Angela; Herden, Christiane; Malberg, Sara; Runge, Solveig; Staeheli, Peter; Rubbenstroth, Dennis

    2016-01-01

    Avian bornaviruses are causative agents of proventricular dilatation disease (PDD), an often fatal disease of parrots and related species (order Psittaciformes) which is widely distributed in captive psittacine populations and may affect endangered species. Here, we established a vaccination strategy employing two different well described viral vectors, namely recombinant Newcastle disease virus (NDV) and modified vaccinia virus Ankara (MVA) that were engineered to express the phosphoprotein and nucleoprotein genes of two avian bornaviruses, parrot bornavirus 4 (PaBV-4) and canary bornavirus 2 (CnBV-2). When combined in a heterologous prime/boost vaccination regime, NDV and MVA vaccine viruses established self-limiting infections and induced a bornavirus-specific humoral immune response in cockatiels (Nymphicus hollandicus) and common canaries (Serinus canaria forma domestica). After challenge infection with a homologous bornavirus, shedding of bornavirus RNA and viral loads in tissue samples were significantly reduced in immunized birds, indicating that vaccination markedly delayed the course of infection. However, cockatiels still developed signs of PDD if the vaccine failed to prevent viral persistence. Our work demonstrates that avian bornavirus infections can be repressed by vaccine-induced immunity. It represents a first crucial step towards a protective vaccination strategy to combat PDD in psittacine birds. PMID:27830736

  12. Effects of thyrotropin on the phosphorylation of histones and nonhistone phosphoproteins in micrococcal nuclease-sensitive and resistant thyroid chromatin

    SciTech Connect

    Cooper, E.; Spaulding, S.W.

    1983-05-01

    Actively transcribed regions of chromatin are more susceptible than bulk chromatin to digestion by nucleases, and useful information about the composition and structure of active chromatin may be obtained by studying the chromatin fragments released from nuclei by limited nuclease digestion. In the present study, we have used micrococcal nuclease to investigate the effects of TSH on protein phosphorylation in nuclease-sensitive fractions of calf thyroid chromatin. Batches of calf thyroid slices were incubated for 2 h with /sup 32/Pi, with or without 50 mU/ml TSH. Nuclei were then prepared and the distribution of /sup 32/P-labeled histones, high mobility group (HMG) proteins, and other acid-soluble phosphoproteins between micrococcal nuclease-sensitive and resistant fractions of chromatin was examined. TSH increased the amount of /sup 32/P incorporated into HMG 14 and the histones H1 and H3. Hormone-dependent increases in the /sup 32/P-labeling of H1 and H3 were not selectively associated with micrococcal nuclease-sensitive chromatin. In contrast, (/sup 32/P) HMG-14 was preferentially solubilized from nuclei by micrococcal nuclease. This lends support to the view that TSH-induced effects on the structure and function of transcriptionally active chromatin may be mediated in part by phosphorylation of HMG 14.

  13. Viral vector vaccines expressing nucleoprotein and phosphoprotein genes of avian bornaviruses ameliorate homologous challenge infections in cockatiels and common canaries.

    PubMed

    Olbert, Marita; Römer-Oberdörfer, Angela; Herden, Christiane; Malberg, Sara; Runge, Solveig; Staeheli, Peter; Rubbenstroth, Dennis

    2016-11-10

    Avian bornaviruses are causative agents of proventricular dilatation disease (PDD), an often fatal disease of parrots and related species (order Psittaciformes) which is widely distributed in captive psittacine populations and may affect endangered species. Here, we established a vaccination strategy employing two different well described viral vectors, namely recombinant Newcastle disease virus (NDV) and modified vaccinia virus Ankara (MVA) that were engineered to express the phosphoprotein and nucleoprotein genes of two avian bornaviruses, parrot bornavirus 4 (PaBV-4) and canary bornavirus 2 (CnBV-2). When combined in a heterologous prime/boost vaccination regime, NDV and MVA vaccine viruses established self-limiting infections and induced a bornavirus-specific humoral immune response in cockatiels (Nymphicus hollandicus) and common canaries (Serinus canaria forma domestica). After challenge infection with a homologous bornavirus, shedding of bornavirus RNA and viral loads in tissue samples were significantly reduced in immunized birds, indicating that vaccination markedly delayed the course of infection. However, cockatiels still developed signs of PDD if the vaccine failed to prevent viral persistence. Our work demonstrates that avian bornavirus infections can be repressed by vaccine-induced immunity. It represents a first crucial step towards a protective vaccination strategy to combat PDD in psittacine birds.

  14. The nucleolar phosphoprotein B23 targets Newcastle disease virus matrix protein to the nucleoli and facilitates viral replication.

    PubMed

    Duan, Zhiqiang; Chen, Jian; Xu, Haixu; Zhu, Jie; Li, Qunhui; He, Liang; Liu, Huimou; Hu, Shunlin; Liu, Xiufan

    2014-03-01

    The cellular nucleolar proteins are reported to facilitate the replication cycles of some human and animal viruses by interaction with viral proteins. In this study, a nucleolar phosphoprotein B23 was identified to interact with Newcastle disease virus (NDV) matrix (M) protein. We found that NDV M protein accumulated in the nucleolus by binding B23 early in infection, but resulted in the redistribution of B23 from the nucleoli to the nucleoplasm later in infection. In vitro binding studies utilizing deletion mutants indicated that amino acids 30-60 of M and amino acids 188-245 of B23 were required for binding. Furthermore, knockdown of B23 by siRNA or overexpression of B23 or M-binding B23-derived polypeptides remarkably reduced cytopathic effect and inhibited NDV replication. Collectively, we show that B23 facilitates NDV replication by targeting M to the nucleolus, demonstrating for the first time a direct role for nucleolar protein B23 in a paramyxovirus replication process.

  15. Sequence analysis of the phosphoprotein gene of peste des petits ruminants (PPR) virus: editing of the gene transcript.

    PubMed

    Mahapatra, Madhuchhanda; Parida, Satya; Egziabher, Berhe G; Diallo, Adama; Barrett, Tom

    2003-10-01

    The gene encoding the phosphoprotein of the vaccine strain of Peste des petits ruminants (PPR) virus (Nigeria 75/1 vaccine strain) has been cloned and its nucleotide sequence been determined. This gene is 1655 nucleotides long and encodes two overlapping open reading frames (ORFs). Translation from the first AUG would produce a polypeptide of 509 amino acid residues with a predicted molecular mass of 54.9 kDa, the longest of the published morbillivirus P proteins. Translation from the second AUG would produce a protein of 177 amino acid residues with a predicted molecular mass of 20.3 kDa, analogous to the C proteins of other morbilliviruses. Evidence was found for the production of two types of P mRNA transcript, one a faithful transcript of the gene and the other with an extra G residue inserted at position 751. Translation from the first AUG of this second mRNA would produce a protein of 298 amino acids, with a predicted molecular mass 32.3 kDa, analogous to the V protein produced by other morbilliviruses. Sequences of the predicted P, C and V proteins were compared with those of the other morbillivirus sequences available to date. The P protein was found to be the most poorly conserved of the morbillivirus proteins, the amino acid identity ranging from 54% in case of Canine distemper virus (CDV) to 60% in the case of the Dolphin morbillivirus (DMV).

  16. Secreted phosphoprotein 24 kD (Spp24) inhibits growth of human pancreatic cancer cells caused by BMP-2

    SciTech Connect

    Li, Chen-Shuang; Tian, Haijun; Zou, Min; Zhao, Ke-Wei; Li, Yawei; Lao, Lifeng; Brochmann, Elsa J.; Duarte, M. Eugenia L.; Daubs, Michael D.; Zhou, Yan-Heng; Murray, Samuel S.; Wang, Jeffrey C.

    2015-10-16

    The emerging role of bone morphogenetic proteins (BMPs) in the initiation and progression of multiple cancers has drawn great attention in cancer research. In this study, we report that BMP-2 can promote the proliferation of the pancreatic tumor cell line, PANC-1. Secreted phosphoprotein 24 kD (Spp24), a BMP binding protein, did not affect the proliferation of the cells but promoted the apoptosis of the cells in vitro. In a xeneograft tumor model using PANC-1 cells, BMP-2 dramatically promoted tumor growth, while Spp24 not only abolished the effect of BMP-2, but also dramatically induced tumor shrinking when used alone. Activation of Smad1/5/8 participated in this process as demonstrated by immunohistochemical staining of phosphorylated Smad 1/5/8. We conclude that Spp24 can be developed into a therapeutic agent that could be employed in clinical situations where the inhibition of BMPs and related proteins is advantageous. - Highlights: • Spp24 effectively inhibited the in vivo tumor growth of PANC-1. • BMP-2 dramatically promoted tumor growth by promoting PANC-1 proliferation. • Spp24 abolished the tumor growth effect of BMP-2 by promoting PANC-1 apoptosis. • Spp24 may be a candidate as a therapeutic agent of pancreatic cancer.

  17. The co-chaperone Cdc37 regulates the rabies virus phosphoprotein stability by targeting to Hsp90AA1 machinery

    PubMed Central

    Xu, Yunbin; Liu, Fei; Liu, Juan; Wang, Dandan; Yan, Yan; Ji, Senlin; Zan, Jie; Zhou, Jiyong

    2016-01-01

    Cdc37, as a kinase-specific co-chaperone of the chaperone Hsp90AA1 (Hsp90), actively aids with the maturation, stabilization and activation of the cellular or viral kinase/kinase-like targets. Phosphoprotein (P) of rabies virus (RABV) is a multifunctional, non-kinase protein involved in interferon antagonism, viral transcription and replication. Here, we demonstrated that the RABV non-kinase P is chaperoned by Cdc37 and Hsp90 during infection. We found that Cdc37 and Hsp90 affect the RABV life cycle directly. Activity inhibition and knockdown of Cdc37 and Hsp90 increased the instability of the viral P protein. Overexpression of Cdc37 and Hsp90 maintained P’s stability but did not increase the yield of infectious RABV virions. We further demonstrated that the non-enzymatic polymerase cofactor P protein of all the genotypes of lyssaviruses is a target of the Cdc37/Hsp90 complex. Cdc37, phosphorylated or unphosphorylated on Ser13, aids the P protein to load onto the Hsp90 machinery, with or without Cdc37 binding to Hsp90. However, the interaction between Cdc37 and Hsp90 appears to have additional allosteric regulation of the conformational switch of Hsp90. Our study highlighted a novel mechanism in which Cdc37/Hsp90 chaperones a non-kinase target, which has significant implications for designing therapeutic targets against Rabies. PMID:27251758

  18. The non-pathogenic Henipavirus Cedar paramyxovirus phosphoprotein has a compromised ability to target STAT1 and STAT2.

    PubMed

    Lieu, Kim G; Marsh, Glenn A; Wang, Lin-Fa; Netter, Hans J

    2015-12-01

    Immune evasion by the lethal henipaviruses, Hendra (HeV) and Nipah virus, is mediated by its interferon (IFN) antagonist P gene products, phosphoprotein (P), and the related V and W proteins, which can target the signal transducer and activator of transcription 1 (STAT1) and STAT2 proteins to inhibit IFN/STAT signaling. However, it is not clear if the recently identified non-pathogenic Henipavirus, Cedar paramyxovirus (CedPV), is also able to antagonize the STAT proteins. We performed comparative studies between the HeV P gene products (P/V/W) and CedPV-P (CedPV does not encode V or W) and demonstrate that differences exist in their ability to engage the STAT proteins using immunoprecipitation and quantitative confocal microscopic analysis. In contrast to HeV-P gene encoded proteins, the ability of CedPV-P to interact with and relocalize STAT1 or STAT2 is compromised, correlating with a reduced capacity to inhibit the mRNA synthesis of IFN-inducible gene MxA. Furthermore, infection studies with HeV and CedPV demonstrate that HeV is more potent than CedPV in inhibiting the IFN-α-mediated nuclear accumulation of STAT1. These results strongly suggest that the ability of CedPV to counteract the IFN/STAT response is compromised compared to HeV.

  19. Inorganic-Organic Nanocomposite Assembly Using Collagen as Template and Sodium Tripolyphosphate as A Biomimetic Analog of Matrix Phosphoprotein

    PubMed Central

    Dai, Lin; Qi, Yi-Pin; Niu, Li-Na; Liu, Yan; Pucci, Cesar R.; Looney, Stephen W.; Ling, Jun-Qi; Pashley, David H.; Tay, Franklin R.

    2011-01-01

    Nanocomposites created with polycarboxylic acid alone as a stabilization agent for prenucleation clusters-derived amorphous calcium phosphate exhibit non-periodic apatite deposition. In the present study, we report the use of inorganic polyphosphate as a biomimetic analog of matrix phosphoprotein for directing polyacrylic acid-stabilized amorphous nanoprecursor phases to assemble into periodic apatite-collagen nanocomposites. The sorption and desorption characteristics of sodium tripolyphosphate to type I collagen was examined. Periodic nanocomposite assembly with collagen as a template was demonstrated with TEM and SEM using a Portland cement-based resin composite and a phosphate-containing simulated body fluid. Apatite was detected within the collagen at 24 hours and became more distinct at 48 hours, with prenucleation clusters attaching to the collagen fibril surface during the initial infiltration stage. Apatite-collagen nanocomposites at 72 hours were heavily mineralized with periodically-arranged intrafibrillar apatite platelets. Defect-containing nanocomposites caused by desorption of TPP from collagen fibrils were observed in regions lacking the inorganic phase. PMID:21857797

  20. Phosphoric acid esters cannot replace polyvinylphosphonic acid as phosphoprotein analogs in biomimetic remineralization of resin-bonded dentin

    PubMed Central

    Mai, Sui; Kim, Young Kyung; Toledano, Manuel; Breschi, Lorenzo; Ling, Jun Qi; Pashley, David H.; Tay, Franklin R.

    2009-01-01

    Polyvinylphosphonic acid (PVPA), a biomimetic analog of phosphoproteins, is crucial for recruiting polyacrylic acid (PAA)-stabilized amorphous calcium phosphate nanoprecursors during biomimetic remineralization of dentin collagen matrices. This study tested the null hypothesis that phosphoric acid esters of methacrylates in dentin adhesives cannot replace PVPA during bimimetic remineralization of resin-dentin interfaces. Human dentin specimens were bonded with: I) XP Bond, an etch-and-rinse adhesive using moist bonding; II) XP Bond using dry bonding; and III) Adper Prompt L-Pop, a self-etching adhesive. The control medium contained only set Portland cement and a simulated body fluid (SBF) without any biomimetic analog. Two experimental Portland cement/SBF remineralization media were evaluated: the first contained PAA as the sole biomimetic analog, the second contained PAA and PVPA as dual biomimetic analogs. No remineralization of the resin-dentin interfaces could be identified from specimens immersed in the control medium. After 2–4 months in the first experimental medium, specimens exhibited either no remineralization or large crystal formation within hybrid layers. Only specimens immersed in the second remineralization medium produced nanocrystals that accounted for intrafibrillar remineralization within hybrid layers. The null hypothesis could not be rejected; phosphoric acid esters in dentin adhesives cannot replace PVPA during biomimetic remineralization of adhesive-bonded dentin. PMID:19481792

  1. Phosphatase Specificity and Pathway Insulation in Signaling Networks

    PubMed Central

    Rowland, Michael A.; Harrison, Brian; Deeds, Eric J.

    2015-01-01

    Phosphatases play an important role in cellular signaling networks by regulating the phosphorylation state of proteins. Phosphatases are classically considered to be promiscuous, acting on tens to hundreds of different substrates. We recently demonstrated that a shared phosphatase can couple the responses of two proteins to incoming signals, even if those two substrates are from otherwise isolated areas of the network. This finding raises a potential paradox: if phosphatases are indeed highly promiscuous, how do cells insulate themselves against unwanted crosstalk? Here, we use mathematical models to explore three possible insulation mechanisms. One approach involves evolving phosphatase KM values that are large enough to prevent saturation by the phosphatase’s substrates. Although this is an effective method for generating isolation, the phosphatase becomes a highly inefficient enzyme, which prevents the system from achieving switch-like responses and can result in slow response kinetics. We also explore the idea that substrate degradation can serve as an effective phosphatase. Assuming that degradation is unsaturatable, this mechanism could insulate substrates from crosstalk, but it would also preclude ultrasensitive responses and would require very high substrate turnover to achieve rapid dephosphorylation kinetics. Finally, we show that adaptor subunits, such as those found on phosphatases like PP2A, can provide effective insulation against phosphatase crosstalk, but only if their binding to substrates is uncoupled from their binding to the catalytic core. Analysis of the interaction network of PP2A’s adaptor domains reveals that although its adaptors may isolate subsets of targets from one another, there is still a strong potential for phosphatase crosstalk within those subsets. Understanding how phosphatase crosstalk and the insulation mechanisms described here impact the function and evolution of signaling networks represents a major challenge for

  2. Violacein cytotoxicity on human blood lymphocytes and effect on phosphatases.

    PubMed

    Bromberg, N; Justo, G Z; Haun, M; Durán, N; Ferreira, C V

    2005-10-01

    Given the importance of protein phosphorylation in the context of cellular functions, abnormal protein phosphatase activity has been implicated in several diseases, including cancer. These critical roles of protein phosphatases qualify them as potential targets for the development of medicinal compounds that possess distinct modes of action such as violacein. In this work, studies with this natural indolic pigment at a concentration of 10.0 micromol L(-1) demonstrated a 20% activation of total protein phosphatase extracted from human lymphocytes. Although no alteration was observed on protein tyrosine phosphatase (CD45), 30% of inhibition was achieved in cytoplasmatic protein phosphatase activity after incubation with 10.0 micromol L(-1) violacein. Additionally, 5.0 micromol L(-1) of violacein inhibited by 50% the serum tartrate-resistant acid phosphatase activity. Violacein presented toxic effect on lymphocytes with IC50 values of 3 and 10 micromol L(-1) for protein content and protein phosphatase activity, respectively. These findings suggest an important role for protein phosphatases in the mechanisms controlling proliferation and cell death.

  3. Distinct phosphatase activity profiles in two strains of Trypanosoma cruzi.

    PubMed

    Morales-Neto, R; Hulshof, L; Ferreira, C V; Gadelha, F R

    2009-12-01

    Phosphorylation of parasite proteins plays a key role in the process of cell invasion by Trypanosoma cruzi, the etiologic agent of Chagas' disease. In this sense, characterization of parasite kinases and phosphatases could open new possibilities for the rational design of chemotherapeutic agents for the treatment of Chagas' disease. In this work, we analyzed phosphatase activities in T. cruzi homogenates from 2 strains belonging to different lineages and with different resistance to oxidative stress. Tulahuen 2 cells (Lineage I) showed higher phosphatase activities and specificity constants when compared to the Y strain (Lineage II). Tulahuen 2 had an optimum phosphatase activity at pH 4.0 and the Y strain at pH 7.0. In both cases, neutral–basic, but not acid, phosphatase activities were increased in the presence of Mg2+. Although calcium had an inhibitory effect at a pH of 7.0 and 8.0 in the Y strain, this inhibition was restricted to pH 8.0 in the other strain. Different substrates and acid phosphotyrosine and alkaline phosphatase inhibitors exhibited distinct effects on the phosphatase activity of both strains. Our results provide a better understanding of T. cruzi phosphatases and reinforce the notion of heterogeneity among T. cruzi populations.

  4. A remote CheZ orthologue retains phosphatase function.

    PubMed

    Lertsethtakarn, Paphavee; Ottemann, Karen M

    2010-07-01

    Aspartyl-phosphate phosphatases underlie the rapid responses of bacterial chemotaxis. One such phosphatase, CheZ, was originally proposed to be restricted to beta and gamma proteobacter, suggesting only a small subset of microbes relied on this protein. A putative CheZ phosphatase was identified genetically in the epsilon proteobacter Helicobacter pylori (Mol Micro 61:187). H. pylori utilizes a chemotaxis system consisting of CheAY, three CheVs, CheW, CheY(HP) and the putative CheZ to colonize the host stomach. Here we investigate whether this CheZ has phosphatase activity. We phosphorylated potential targets in vitro using either a phosphodonor or the CheAY kinase and [gamma-(32)P]-ATP, and found that H. pylori CheZ (CheZ(HP)) efficiently dephosphorylates CheY(HP) and CheAY and has additional weak activity on CheV2. We detected no phosphatase activity towards CheV1 or CheV3. Mutations corresponding to Escherichia coli CheZ active site residues or deletion of the C-terminal region inactivate CheZ(HP) phosphatase activity, suggesting the two CheZs function similarly. Bioinformatics analysis suggests that CheZ phosphatases are found in all proteobacteria classes, as well as classes Aquificae, Deferribacteres, Nitrospira and Sphingobacteria, demonstrating that CheZ phosphatases are broadly distributed within Gram-negative bacteria.

  5. Biogeochemical drivers of phosphatase activity in salt marsh sediments

    NASA Astrophysics Data System (ADS)

    Freitas, Joana; Duarte, Bernardo; Caçador, Isabel

    2014-10-01

    Although nitrogen has become a major concern for wetlands scientists dealing with eutrophication problems, phosphorous represents another key element, and consequently its biogeochemical cycling has a crucial role in eutrophication processes. Microbial communities are a central component in trophic dynamics and biogeochemical processes on coastal systems, since most of the processes in sediments are microbial-mediated due to enzymatic action, including the mineralization of organic phosphorus carried out by acid phosphatase activity. In the present work, the authors investigate the biogeochemical sediment drivers that control phosphatase activities. Authors also aim to assess biogeochemical factors' influence on the enzyme-mediated phosphorous cycling processes in salt marshes. Plant rhizosediments and bare sediments were collected and biogeochemical features, including phosphatase activities, inorganic and organic phosphorus contents, humic acids content and pH, were assessed. Acid phosphatase was found to give the highest contribution for total phosphatase activity among the three pH-isoforms present in salt marsh sediments, favored by acid pH in colonized sediments. Humic acids also appear to have an important role inhibiting phosphatase activity. A clear relation of phosphatase activity and inorganic phosphorous was also found. The data presented reinforces the role of phosphatase in phosphorous cycling.

  6. Characterization of DNA Substrate Binding to the Phosphatase Domain of the DNA Repair Enzyme Polynucleotide Kinase/Phosphatase.

    PubMed

    Havali-Shahriari, Zahra; Weinfeld, Michael; Glover, J N Mark

    2017-03-28

    Polynucleotide kinase/phosphatase (PNKP) is a DNA strand break repair enzyme that uses separate 5' kinase and 3' phosphatase active sites to convert damaged 5'-hydroxyl/3'-phosphate strand termini to ligatable 5'-phosphate/3'-hydroxyl ends. The phosphatase active site has received particular attention as a target of inhibition in cancer therapy development. The phosphatase domain dephosphorylates a range of single- and double-stranded substrates; however, structural studies have shown that the phosphatase catalytic cleft can bind only single-stranded substrates. Here we use a catalytically inactive but structurally intact phosphatase mutant to probe interactions between PNKP and a variety of single- and double-stranded DNA substrates using an electrophoretic mobility shift assay. This work indicates that the phosphatase domain binds 3'-phosphorylated single-stranded DNAs in a manner that is highly dependent on the presence of the 3'-phosphate. Double-stranded substrate binding, in contrast, is not as dependent on the 3'-phosphate. Experiments comparing blunt-end, 3'-overhanging, and frayed-end substrates indicate that the predicted loss of energy due to base pair disruption upon binding of the phosphatase active site is likely balanced by favorable interactions between the liberated complementary strand and PNKP. Comparison of the effects on substrate binding of mutations within the phosphatase active site cleft with mutations in surrounding positively charged surfaces suggests that the surrounding surfaces are important for binding to double-stranded substrates. We further show that while fluorescence polarization methods can detect specific binding of single-stranded DNAs with the phosphatase domain, this method does not detect specific interactions between the PNKP phosphatase and double-stranded substrates.

  7. Mutations responsible for 3-phosphoserine phosphatase deficiency.

    PubMed

    Veiga-da-Cunha, Maria; Collet, Jean-François; Prieur, Benoît; Jaeken, Jaak; Peeraer, Yves; Rabbijns, Anja; Van Schaftingen, Emile

    2004-02-01

    We report the identification of the mutations in the only known case of L-3-phosphoserine phosphatase deficiency, a recessively inherited condition. The two mutations correspond to the replacement of the semiconserved Asp32 residue by an asparagine and of the extremely conserved Met52 by a threonine. The effects of both mutations were studied on the human recombinant enzyme, expressed in Escherichia coli. Met52Thr almost abolished the enzymatic activity, whereas the Asp32Asn mutation caused a 50% decrease in Vmax. In addition, L-serine, which inhibits the conversion of [(14)C] phosphoserine to serine when catalysed by the wild-type enzyme, had a lesser inhibitory effect on the Asp32Asn mutant, indicating a reduction in the rate of phosphoenzyme hydrolysis. These modifications in the properties of the enzyme are consistent with the modification in the kinetic properties observed in fibroblasts from the patient.

  8. Inhibition of renal alkaline phosphatase by cimetidine.

    PubMed

    Minai-Tehrani, Dariush; Khodai, Somayeh; Aminnaseri, Somayeh; Minoui, Saeed; Sobhani-Damavadifar, Zahra; Alavi, Sana; Osmani, Raheleh; Ahmadi, Shiva

    2011-08-01

    Alkaline phosphatase (ALP) belongs to hydrolase group of enzymes. It is responsible for removing phosphate groups from many types of molecules, including nucleotides and proteins. Cimetidine (trade name Tagamet) is an antagonist of histamine H2-receptor that inhibits the production of gastric acid. Cimetidine is used for the treatment of gastrointestinal diseases. In this study the inhibitory effect of cimetidine on mouse renal ALP activity was investigated. Our results showed that cimetidine can inhibit ALP by uncompetitive inhibition. In the absence of inhibitor the V(max) and K(m) of the enzyme were found to be 13.7 mmol/mg prot.min and 0.25 mM, respectively. Both the Vmax and Km of the enzyme decreased with increasing cimetidine concentrations (0- 1.2 mM). The Ki and IC(50) of cimetidine were determined to be about 0.5 mM and 0.52 mM, respectively.

  9. Functional characterization of lysophosphatidic acid phosphatase from Arabidopsis thaliana.

    PubMed

    Reddy, Venky Sreedhar; Rao, D K Venkata; Rajasekharan, Ram

    2010-04-01

    Lysophosphatidic acid (LPA) acts as a signaling molecule that regulates diverse cellular processes and it can rapidly be metabolized by phosphatase and acyltransferase. LPA phosphatase gene has not been identified and characterized in plants so far. The BLAST search revealed that the At3g03520 is similar to phospholipase family, and distantly related to bacterial phosphatases. The conserved motif, (J)4XXXNXSFD, was identified in both At3g03520 like phospholipases and acid phosphatases. In silico expression analysis of At3g03520 revealed a high expression during phosphate starvation and abiotic stresses. This gene was overexpressed in Escherichia coli and shown to posses LPA specific phosphatase activity. These results suggest that this gene possibly plays a role in signal transduction and storage lipid synthesis.

  10. Phosphoglucan phosphatase function sheds light on starch degradation.

    PubMed

    Silver, Dylan M; Kötting, Oliver; Moorhead, Greg B G

    2014-07-01

    Phosphoglucan phosphatases are novel enzymes that remove phosphates from complex carbohydrates. In plants, these proteins are vital components in the remobilization of leaf starch at night. Breakdown of starch is initiated through reversible glucan phosphorylation to disrupt the semi-crystalline starch structure at the granule surface. The phosphoglucan phosphatases starch excess 4 (SEX4) and like-SEX4 2 (LSF2) dephosphorylate glucans to provide access for amylases that release maltose and glucose from starch. Another phosphatase, LSF1, is a putative inactive scaffold protein that may act as regulator of starch degradative enzymes at the granule surface. Absence of these phosphatases disrupts starch breakdown, resulting in plants accumulating excess starch. Here, we describe recent advances in understanding the biochemical and structural properties of each of these starch phosphatases.

  11. [Roles of phosphatases in pathogen infection: a review].

    PubMed

    Zhu, Pei; Li, Xinqiang; Li, Zhenlun

    2012-02-01

    Phosphatases play a key role not only in cell physiological functions of an organism, but also in host-pathogen interactions. Many studies demonstrated that some Gram-negative pathogenic bacteria could evade host immunity and promote pathogenicity by injecting phosphatases into host cells through type III secretion system. However, there were few reports about pathogenic fungi evading the immunity of hosts. Our researches indicated that the entomogenic fungus Metarhizium anisopliae could dephosphorylate the signal transduction substance of locust humoral immunity specifically in vitro by secreting extracellular protein tyrosine phosphatase, which implied that the fungus might interfere with the immune defense of locust. To provide reference for further studies of the functions of phosphatases, we reviewed the types of phosphatases and their roles in pathogen infection.

  12. Intestinal alkaline phosphatase to treat necrotizing enterocolitis.

    PubMed

    Biesterveld, Ben E; Koehler, Shannon M; Heinzerling, Nathan P; Rentea, Rebecca M; Fredrich, Katherine; Welak, Scott R; Gourlay, David M

    2015-06-15

    Intestinal alkaline phosphatase (IAP) activity is decreased in necrotizing enterocolitis (NEC), and IAP supplementation prevents NEC development. It is not known if IAP given after NEC onset can reverse the course of the disease. We hypothesized that enteral IAP given after NEC induction would not reverse intestinal injury. NEC was induced in Sprague-Dawley pups by delivery preterm followed by formula feedings with lipopolysaccharide (LPS) and hypoxia exposure and continued up to 4 d. IAP was added to feeds on day 2 until being sacrificed on day 4. NEC severity was scored based on hematoxylin and eosin-stained terminal ileum sections, and AP activity was measured using a colorimetric assay. IAP and interleukin-6 expression were measured using real time polymerase chain reaction. NEC pups' alkaline phosphatase (AP) activity was decreased to 0.18 U/mg compared with controls of 0.57 U/mg (P < 0.01). Discontinuation of LPS and hypoxia after 2 d increased AP activity to 0.36 U/mg (P < 0.01). IAP supplementation in matched groups did not impact total AP activity or expression. Discontinuing LPS and hypoxia after NEC onset improved intestinal injury scores to 1.14 compared with continued stressors, score 2.25 (P < 0.01). IAP supplementation decreased interleukin-6 expression two-fold (P < 0.05), though did not reverse NEC intestinal damage (P = 0.5). This is the first work to demonstrate that removing the source of NEC improves intestinal damage and increases AP activity. When used as a rescue treatment, IAP decreased intestinal inflammation though did not impact injury making it likely that IAP is best used preventatively to those neonates at risk. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Mechanism of the phosphatase component of Clostridium thermocellum polynucleotide kinase-phosphatase.

    PubMed

    Keppetipola, Niroshika; Shuman, Stewart

    2006-01-01

    Polynucleotide kinase-phosphatase (Pnkp) from Clostridium thermocellum catalyzes ATP-dependent phosphorylation of 5'-OH termini of DNA or RNA polynucleotides and Ni(2+)/Mn(2+)-dependent dephosphorylation of 2',3' cyclic phosphate, 2'-phosphate, and 3'-phosphate ribonucleotides. CthPnkp is an 870-amino-acid polypeptide composed of three domains: an N-terminal module similar to bacteriophage T4 polynucleotide kinase, a central module that resembles the dinuclear metallo-phosphoesterase superfamily, and a C-terminal ligase-like adenylyltransferase domain. Here we conducted a mutational analysis of CthPnkp that identified 11 residues required for Ni(2+)-dependent phosphatase activity with 2'-AMP and 3'-AMP. Eight of the 11 CthPnkp side chains were also required for Ni(2+)-dependent hydrolysis of p-nitrophenyl phosphate. The ensemble of essential side chains includes the conserved counterparts (Asp187, His189, Asp233, Arg237, Asn263, His264, His323, His376, and Asp392 in CthPnkp) of all of the amino acids that form the dinuclear metal-binding site and the phosphate-binding site of bacteriophage lambda phosphatase. Three residues (Asp236, His264, and Arg237) required for activity with 2'-AMP or 3'-AMP were dispensable for Ni(2+)-dependent hydrolysis of p-nitrophenyl phosphate. Our findings, together with available structural information, provide fresh insights to the metallophosphoesterase mechanism, including the roles of His264 and Asp236 in proton donation to the leaving group. Deletion analysis defined an autonomous phosphatase domain, CthPnkp-(171-424).

  14. Functional interrelationships in the alkaline phosphatase superfamily: phosphodiesterase activity of Escherichia coli alkaline phosphatase.

    PubMed

    O'Brien, P J; Herschlag, D

    2001-05-15

    Escherichia coli alkaline phosphatase (AP) is a proficient phosphomonoesterase with two Zn(2+) ions in its active site. Sequence homology suggests a distant evolutionary relationship between AP and alkaline phosphodiesterase/nucleotide pyrophosphatase, with conservation of the catalytic metal ions. Furthermore, many other phosphodiesterases, although not evolutionarily related, have a similar active site configuration of divalent metal ions in their active sites. These observations led us to test whether AP could also catalyze the hydrolysis of phosphate diesters. The results described herein demonstrate that AP does have phosphodiesterase activity: the phosphatase and phosphodiesterase activities copurify over several steps; inorganic phosphate, a strong competitive inhibitor of AP, inhibits the phosphodiesterase and phosphatase activities with the same inhibition constant; a point mutation that weakens phosphate binding to AP correspondingly weakens phosphate inhibition of the phosphodiesterase activity; and mutation of active site residues substantially reduces both the mono- and diesterase activities. AP accelerates the rate of phosphate diester hydrolysis by 10(11)-fold relative to the rate of the uncatalyzed reaction [(k(cat)/K(m))/k(w)]. Although this rate enhancement is substantial, it is at least 10(6)-fold less than the rate enhancement for AP-catalyzed phosphate monoester hydrolysis. Mutational analysis suggests that common active site features contribute to hydrolysis of both phosphate monoesters and phosphate diesters. However, mutation of the active site arginine to serine, R166S, decreases the monoesterase activity but not the diesterase activity, suggesting that the interaction of this arginine with the nonbridging oxygen(s) of the phosphate monoester substrate provides a substantial amount of the preferential hydrolysis of phosphate monoesters. The observation of phosphodiesterase activity extends the previous observation that AP has a low level of

  15. Phosphatidylinositol anchor of HeLa cell alkaline phosphatase

    SciTech Connect

    Jemmerson, R.; Low, M.G.

    1987-09-08

    Alkaline phosphatase from cancer cells, HeLa TCRC-1, was biosynthetically labeled with either /sup 3/H-fatty acids or (/sup 3/H)ethanolamine as analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and fluorography of immunoprecipitated material. Phosphatidylinositol-specific phospholipase C (PI-PLC) released a substantial proportion of the /sup 3/H-fatty acid label from immunoaffinity-purified alkaline phosphatase but had no effect on the radioactivity of (/sup 3/H)ethanolamine-labeled material. PI-PLC also liberated catalytically active alkaline phosphatase from viable cells, and this could be selectively blocked by monoclonal antibodies to alkaline phosphatase. However, the alkaline phosphatase released from /sup 3/H-fatty acid labeled cells by PI-PLC was not radioactive. By contrast, treatment with bromelain removed both the /sup 3/H-fatty acid and the (/sup 3/H)ethanolamine label from purified alkaline phosphatase. Subtilisin was also able to remove the (/sup 3/H)ethanolamine label from the purified alkaline phosphatase. The /sup 3/H radioactivity in alkaline phosphatase purified from (/sup 3/H)ethanolamine-labeled cells comigrated with authentic (/sup 3/H)ethanolamine by anion-exchange chromatography after acid hydrolysis. The data suggest that the /sup 3/H-fatty acid and (/sup 3/H)ethanolamine are covalently attached to the carboxyl-terminal segment since bromelain and subtilisin both release alkaline phosphatase from the membrane by cleavage at that end of the polypeptide chain. The data are consistent with findings for other proteins recently shown to be anchored in the membrane through a glycosylphosphatidylinositol structure and indicate that a similar structure contributes to the membrane anchoring of alkaline phosphatase.

  16. Direct determination of phosphatase activity from physiological substrates in cells.

    PubMed

    Ren, Zhongyuan; Do, Le Duy; Bechkoff, Géraldine; Mebarek, Saida; Keloglu, Nermin; Ahamada, Saandia; Meena, Saurabh; Magne, David; Pikula, Slawomir; Wu, Yuqing; Buchet, René

    2015-01-01

    A direct and continuous approach to determine simultaneously protein and phosphate concentrations in cells and kinetics of phosphate release from physiological substrates by cells without any labeling has been developed. Among the enzymes having a phosphatase activity, tissue non-specific alkaline phosphatase (TNAP) performs indispensable, multiple functions in humans. It is expressed in numerous tissues with high levels detected in bones, liver and neurons. It is absolutely required for bone mineralization and also necessary for neurotransmitter synthesis. We provided the proof of concept that infrared spectroscopy is a reliable assay to determine a phosphatase activity in the osteoblasts. For the first time, an overall specific phosphatase activity in cells was determined in a single step by measuring simultaneously protein and substrate concentrations. We found specific activities in osteoblast like cells amounting to 116 ± 13 nmol min(-1) mg(-1) for PPi, to 56 ± 11 nmol min(-1) mg(-1) for AMP, to 79 ± 23 nmol min(-1) mg(-1) for beta-glycerophosphate and to 73 ± 15 nmol min(-1) mg(-1) for 1-alpha-D glucose phosphate. The assay was also effective to monitor phosphatase activity in primary osteoblasts and in matrix vesicles. The use of levamisole--a TNAP inhibitor--served to demonstrate that a part of the phosphatase activity originated from this enzyme. An IC50 value of 1.16 ± 0.03 mM was obtained for the inhibition of phosphatase activity of levamisole in osteoblast like cells. The infrared assay could be extended to determine any type of phosphatase activity in other cells. It may serve as a metabolomic tool to monitor an overall phosphatase activity including acid phosphatases or other related enzymes.

  17. Different designs of kinase-phosphatase interactions and phosphatase sequestration shapes the robustness and signal flow in the MAPK cascade

    PubMed Central

    2012-01-01

    Background The three layer mitogen activated protein kinase (MAPK) signaling cascade exhibits different designs of interactions between its kinases and phosphatases. While the sequential interactions between the three kinases of the cascade are tightly preserved, the phosphatases of the cascade, such as MKP3 and PP2A, exhibit relatively diverse interactions with their substrate kinases. Additionally, the kinases of the MAPK cascade can also sequester their phosphatases. Thus, each topologically distinct interaction design of kinases and phosphatases could exhibit unique signal processing characteristics, and the presence of phosphatase sequestration may lead to further fine tuning of the propagated signal. Results We have built four architecturally distinct types of models of the MAPK cascade, each model with identical kinase-kinase interactions but unique kinases-phosphatases interactions. Our simulations unravelled that MAPK cascade’s robustness to external perturbations is a function of nature of interaction between its kinases and phosphatases. The cascade’s output robustness was enhanced when phosphatases were sequestrated by their target kinases. We uncovered a novel implicit/hidden negative feedback loop from the phosphatase MKP3 to its upstream kinase Raf-1, in a cascade resembling the B cell MAPK cascade. Notably, strength of the feedback loop was reciprocal to the strength of phosphatases’ sequestration and stronger sequestration abolished the feedback loop completely. An experimental method to verify the presence of the feedback loop is also proposed. We further showed, when the models were activated by transient signal, memory (total time taken by the cascade output to reach its unstimulated level after removal of signal) of a cascade was determined by the specific designs of interaction among its kinases and phosphatases. Conclusions Differences in interaction designs among the kinases and phosphatases can differentially shape the robustness and

  18. Cooperative binding of multimeric phosphoprotein (P) of vesicular stomatitis virus to polymerase (L) and template: pathways of assembly.

    PubMed Central

    Gao, Y; Lenard, J

    1995-01-01

    It was previously shown that the phosphoprotein (P) of vesicular stomatitis virus must undergo phosphorylation-dependent multimerization to become transcriptionally active. Phosphorylation at S-60 and/or T-62 by casein kinase II or substitution of these residues by D is required for multimer formation. We now find that substitution of either one of these residues by A prevents phosphorylation by casein kinase II and multimer formation. The binding of multimeric P to the other two transcriptional components of vesicular stomatitis virus (L protein and the N-RNA template) has been characterized by using P immobilized on beads through its poly(His) tag to facilitate recovery of bound complexes. Multimerization of P was absolutely required for binding to both L and template. Multimeric P combined with the polymerase enzyme (L) in a stoichiometric 1:1 complex, which bound to the N-RNA template much more strongly than multimeric P alone. Substitution of S-227 and S-233 by A residues had no effect on multimerization or binding of L to P but prevented binding of both P and L to template and abolished transcriptional activity. In contrast, substitution of these residues with D residues had no effect on template binding or activity. However, substitution at these sites by either D or A largely abolished phosphorylation by L-associated kinases, thus identifying S-227 and S-233 as the major sites targeted by these kinases and confirming that phosphorylation of P protein by L-associated kinases is without transcriptional effect. PMID:7494281

  19. Vasodilator-stimulated phosphoprotein restricts cell-to-cell spread of Shigella flexneri at the cell periphery

    PubMed Central

    Lee, Soo Young; Gertler, Frank B.

    2015-01-01

    Shigella spp. are intracellular bacterial pathogens that cause diarrhoeal disease in humans. Shigella utilize the host actin cytoskeleton to enter cells, move through the cytoplasm of cells and pass into adjacent cells. Ena/VASP family proteins are highly conserved proteins that participate in actin-dependent dynamic cellular processes. We tested whether Ena/VASP family members VASP (vasodilator-stimulated phosphoprotein), Mena (mammalian-enabled) or EVL (Ena-VASP-like) contribute to Shigella flexneri spread through cell monolayers. VASP and EVL restricted cell-to-cell spread without significantly altering actin-based motility, whereas Mena had no effect on these processes. Phosphorylation of VASP on Ser153, Ser235 and Thr274 regulated its subcellular distribution and function. VASP derivatives that lack the Ena/VASP homology 1 (EVH1) domain or contain a phosphoablative mutation of Ser153 were defective in restricting S. flexneri spread, indicating that the EVH1 domain and phosphorylation on Ser153 are required for this process. The EVH1 domain and Ser153 of VASP were required for VASP localization to focal adhesions, and localization of VASP to focal adhesions and/or the leading edge was required for restriction of spread. The contribution of the EVH1 domain was from both the donor and the recipient cell, whereas the contribution of Ser153 phosphorylation was only from the donor cell. Thus, unlike host proteins characterized in Shigella pathogenesis that promote bacterial spread, VASP and EVL function to limit it. The ability of VASP and EVL to limit spread highlights the critical role of focal adhesion complexes and/or the leading edge in bacterial passage between cells. PMID:26358985

  20. Carboxy terminus of secreted phosphoprotein-24 kDa (spp24) is essential for full inhibition of BMP-2 activity.

    PubMed

    Brochmann, Elsa J; Simon, Robert J; Jawien, Janusz; Behnam, Keyvan; Sintuu, Chananit; Wang, Jeffrey C; Murray, Samuel S

    2010-09-01

    Secreted phosphoprotein-24 kDa (spp24) is a bone morphogenetic protein (BMP)-binding protein isolated from bone. It exists in a number of size forms and is hypothesized to function as a BMP latency protein and/or a "slow release" mechanism for BMPs involved in bone turnover and repair. We have examined the hypothesis that proteolytic modification of the C-terminus of spp24 affects its BMP-2-binding properties and bioactivity in the BMP-2-stimulated ectopic bone forming bioassay. Three different size forms of recombinant spp24 that correspond to predicted 18.1 kDa, 16.0 kDa, and 14.5 kDa proteolytic products were compared to full-length (fl) spp24. One of these forms (spp18.1) we hypothesize to be the protein which Urist initially, but apparently inaccurately, called "BMP." Only full-length spp24 completely inhibited BMP-2-induced bone formation. The 18.1 kDa truncated isoform of spp24 which we hypothesize to be Urist's protein did not. The inhibitory capacity of the proteins was correlated with their kinetic constants, assessed by surface plasmon resonance. At the highest, inhibitory, dose of spp24 and its derivatives, k(d) ("stability") best predicted the extent of ectopic bone formation whereas at the lowest dose, which was not inhibitory, k(a) ("recognition") best predicted the extent of ectopic bone formation. We conclude that proteolytic processing of spp24 affects the interaction of this protein with BMP-2 and this affects the function of the protein. (c) 2010 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  1. Molecular inotropy mediated by cardiac miR-based PDE4D/PRKAR1α/phosphoprotein signaling

    PubMed Central

    Bedada, Fikru B.; Martindale, Joshua J.; Arden, Erik; Metzger, Joseph M.

    2016-01-01

    Molecular inotropy refers to cardiac contractility that can be modified to affect overall heart pump performance. Here we show evidence of a new molecular pathway for positive inotropy by a cardiac-restricted microRNA (miR). We report enhanced cardiac myocyte performance by acute titration of cardiac myosin-embedded miR-208a. The observed positive effect was independent of host gene myosin effects with evidence of negative regulation of cAMP-specific 3′,5′-cyclic phosphodiesterase 4D (PDE4D) and the regulatory subunit of PKA (PRKAR1α) content culminating in PKA-site dependent phosphorylation of cardiac troponin I (cTnI) and phospholamban (PLN). Further, acute inhibition of miR-208a in adult myocytes in vitro increased PDE4D expression causing reduced isoproterenol-mediated phosphorylation of cTnI and PLN. Next, rAAV-mediated miR-208a gene delivery enhanced heart contractility and relaxation parameters in vivo. Finally, acute inducible increases in cardiac miR-208a in vivo reduced PDE4D and PRKAR1α, with evidence of increased content of several complementary miRs harboring the PDE4D recognition sequence. Physiologically, this resulted in significant cardiac cTnI and PLN phosphorylation and improved heart performance in vivo. As phosphorylation of cTnI and PLN is critical to myocyte function, titration of miR-208a represents a potential new mechanism to enhance myocardial performance via the PDE4D/PRKAR1α/PKA phosphoprotein signaling pathway. PMID:27833092

  2. Vasodilator-stimulated phosphoprotein restricts cell-to-cell spread of Shigella flexneri at the cell periphery.

    PubMed

    Lee, Soo Young; Gertler, Frank B; Goldberg, Marcia B

    2015-11-01

    Shigella spp. are intracellular bacterial pathogens that cause diarrhoeal disease in humans. Shigella utilize the host actin cytoskeleton to enter cells, move through the cytoplasm of cells and pass into adjacent cells. Ena/VASP family proteins are highly conserved proteins that participate in actin-dependent dynamic cellular processes. We tested whether Ena/VASP family members VASP (vasodilator-stimulated phosphoprotein), Mena (mammalian-enabled) or EVL (Ena-VASP-like) contribute to Shigella flexneri spread through cell monolayers. VASP and EVL restricted cell-to-cell spread without significantly altering actin-based motility, whereas Mena had no effect on these processes. Phosphorylation of VASP on Ser153, Ser235 and Thr274 regulated its subcellular distribution and function. VASP derivatives that lack the Ena/VASP homology 1 (EVH1) domain or contain a phosphoablative mutation of Ser153 were defective in restricting S. flexneri spread, indicating that the EVH1 domain and phosphorylation on Ser153 are required for this process. The EVH1 domain and Ser153 of VASP were required for VASP localization to focal adhesions, and localization of VASP to focal adhesions and/or the leading edge was required for restriction of spread. The contribution of the EVH1 domain was from both the donor and the recipient cell, whereas the contribution of Ser153 phosphorylation was only from the donor cell. Thus, unlike host proteins characterized in Shigella pathogenesis that promote bacterial spread, VASP and EVL function to limit it. The ability of VASP and EVL to limit spread highlights the critical role of focal adhesion complexes and/or the leading edge in bacterial passage between cells.

  3. cDNA Cloning and Overexpression of Acidic Ribosomal Phosphoprotein P1 Gene (RPLP1) from the Giant Panda

    PubMed Central

    Du, Yu-Jie; Luo, Xiao-Yan; Hao, Yan-Zhe; Zhang, Tian; Hou, Wan-Ru

    2007-01-01

    RPLP1 is one of acidic ribosomal phosphoproteins encoded by RPLP1 gene, which plays an important role in the elongation step of protein synthesis. The cDNA of RPLP1 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using RT-PCR technology, which was also sequenced, analyzed preliminarily and expressed in E.coli. The cDNA fragment cloned is 449bp in size, containing an open reading frame of 344bp encoding 114 amino acids. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to other five species studied, including Homo sapiens, Mus musculus, Rattus norvegicus, Bos Taurus and Sus scrofa. The homologies for nucleotide sequences of Giant Panda PPLP1 to that of these species are 92.4%, 89.8%, 89.0%, 91.3% and 87.5%, while the homologies for amino acid sequences are 96.5%, 94.7%, 95.6%, 96.5% and 88.6%. Topology prediction showed there are three Casein kinase II phosphorylation sites and two N-myristoylation sites in the RPLP1 protein of the Giant Panda (Ailuropoda melanoleuca). The RPLP1 gene was overexpressed in E. coli and the result indicated that RPLP1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 18kDa polypeptide, which was in accordance with the predicted protein and could also be used to purify the protein and study its function. PMID:18071584

  4. Regulation of Stress-Inducible Phosphoprotein 1 Nuclear Retention by Protein Inhibitor of Activated STAT PIAS1

    PubMed Central

    Soares, Iaci N.; Caetano, Fabiana A.; Pinder, Jordan; Rodrigues, Bruna Roz; Beraldo, Flavio H.; Ostapchenko, Valeriy G.; Durette, Chantal; Pereira, Grace Schenatto; Lopes, Marilene H.; Queiroz-Hazarbassanov, Nicolle; Cunha, Isabela W.; Sanematsu, Paulo I.; Suzuki, Sergio; Bleggi-Torres, Luiz F.; Schild-Poulter, Caroline; Thibault, Pierre; Dellaire, Graham; Martins, Vilma R.; Prado, Vania F.; Prado, Marco A. M.

    2013-01-01

    Stress-inducible phosphoprotein 1 (STI1), a cochaperone for Hsp90, has been shown to regulate multiple pathways in astrocytes, but its contributions to cellular stress responses are not fully understood. We show that in response to irradiation-mediated DNA damage stress STI1 accumulates in the nucleus of astrocytes. Also, STI1 haploinsufficiency decreases astrocyte survival after irradiation. Using yeast two-hybrid screenings we identified several nuclear proteins as STI1 interactors. Overexpression of one of these interactors, PIAS1, seems to be specifically involved in STI1 nuclear retention and in directing STI1 and Hsp90 to specific sub-nuclear regions. PIAS1 and STI1 co-immunoprecipitate and PIAS1 can function as an E3 SUMO ligase for STI. Using mass spectrometry we identified five SUMOylation sites in STI1. A STI1 mutant lacking these five sites is not SUMOylated, but still accumulates in the nucleus in response to increased expression of PIAS1, suggesting the possibility that a direct interaction with PIAS1 could be responsible for STI1 nuclear retention. To test this possibility, we mapped the interaction sites between PIAS1 and STI1 using yeast-two hybrid assays and surface plasmon resonance and found that a large domain in the N-terminal region of STI1 interacts with high affinity with amino acids 450–480 of PIAS1. Knockdown of PIAS1 in astrocytes impairs the accumulation of nuclear STI1 in response to irradiation. Moreover, a PIAS1 mutant lacking the STI1 binding site is unable to increase STI1 nuclear retention. Interestingly, in human glioblastoma multiforme PIAS1 expression is increased and we found a significant correlation between increased PIAS1 expression and STI1 nuclear localization. These experiments provide evidence that direct interaction between STI1 and PIAS1 is involved in the accumulation of nuclear STI1. This retention mechanism could facilitate nuclear chaperone activity. PMID:23938469

  5. Stable binding of the eukaryotic acidic phosphoproteins to the ribosome is not an absolute requirement for in vivo protein synthesis.

    PubMed

    Remacha, M; Santos, C; Bermejo, B; Naranda, T; Ballesta, J P

    1992-06-15

    The genes encoding the four acidic ribosomal phosphoproteins have been inactivated in Saccharomyces cerevisae by recombination with truncated genes carrying different genetic markers. By crossing single haploid disruptants, strains harboring two simultaneously inactivated acidic protein genes were constructed. None of the six possible double disruptions was lethal, but the simultaneous inactivation of either YP1 alpha and YP1 beta(L44') or YP2 alpha(L44) and YP2 beta(L45) caused an important decrease in the cell growth rate. Ribosomes isolated from these slow-growing strains did not contain acidic proteins, not even the two polypeptides whose genes were still intact, although these proteins were present in the cell extracts and they seem to be able to form high-molecular weight protein complexes. Transformation of a slow-growing double transformant with a plasmid containing one of the disrupted genes restored the presence of the acidic proteins in the ribosomes and normal growth rates. The particles of the slow-growing strains were active in an in vitro amino acid polymerizing system, although their activity could be stimulated by the exogenous addition of the missing proteins. These results indicate that in the absence of either YP1 alpha and YP1 beta(L44') or YP2 alpha (L44) and YP2 beta(L45), the remaining acidic proteins are unable to interact with the ribosome in a stable manner, but that a strong interaction of these ribosomal components with the particle is not an absolute requirement for in vivo and in vitro protein synthesis.

  6. Effect of acidic ribosomal phosphoprotein mRNA 5'-untranslated region on gene expression and protein accumulation.

    PubMed

    Bermejo, B; Remacha, M; Ortiz-Reyes, B; Santos, C; Ballesta, J P

    1994-02-11

    Constructions were made from genes encoding ribosomal acidic phosphoproteins YP1 beta (L44') and YP2 beta (L45) from Saccharomyces cerevisiae in which different parts of the 5'-untranslated regions were included. The constructs were inserted into centromeric plasmids under the control of the GAL1 promoter and expressed in yeast strains in which the genes coding for each acidic protein family, P1 and P2, had been disrupted. Deletions in the 5' region of the two genes have been found to oppositely affect their expression. Deletion of most of this region strongly stimulates the expression of YP2 beta (L45), increasing the translation efficiency of the mRNA, and generating a 6-fold excess of protein in the cell. A similar deletion in the rpYP1 beta gene represses the expression of the protein, reducing drastically the amount of the mRNA in the cell. The overexpression of rpYP2 beta affects the cell growth by inhibiting protein synthesis at the level of initiation. Reduction of the YP2 beta(L45) overproduction by growing in controlled concentrations of glucose abolishes the inhibitory effect. The excess protein, probably as a high molecular weight complex, apparently interferes with the joining of the 60 S subunit to the initiation complex generating the accumulation of polysome half-mers. In addition, the results indicate the existence of a regulatory mechanism by which each one of the two acidic proteins controls the expression of the other polypeptide. YP1 beta(L44') represses the expression of YP2 beta(L45), while this protein stimulates the expression of YP1 beta(L44').

  7. Phosphoprotein Gene Contributes to the Enhanced Apoptosis Induced by Wild-Type Rabies Virus GD-SH-01 In Vitro

    PubMed Central

    Tian, Qin; Wang, Yifei; Zhang, Qiong; Luo, Jun; Jiang, He; Zhang, Boyue; Mei, Mingzhu; Wu, Fan; Wu, Yuting; Peng, Jiaojiao; Long, Teng; Luo, Yongwen; Guo, Xiaofeng

    2017-01-01

    Previous research demonstrated that the matrix protein (M) and glycoprotein (G) of attenuated rabies virus (RABV) strains are involved in the induction of host cell apoptosis. In this work, we show that wild-type (wt) RABV GD-SH-01 induces significantly greater apoptosis than the attenuated strain HEP-Flury. In order to identify the gene(s) accounting for this phenotype, five recombinant RABVs (rRABVs) were constructed by replacing each single gene of HEP-Flury with the corresponding gene of GD-SH-01. By using these rRABVs, we found that not only M and G, but also the phosphoprotein (P) plays an important role in inducing apoptosis. In order to figure out the different role of P gene in inducing apoptosis from the highly divergent background, another rRABV rGDSH-P, which carries the P gene of HEP-Flury in the background of the GD-SH-01 was generated. It was found that infection of NA cells with GD-SH-01 or the recombinant strain rHEP-shP, which carries P gene of GD-SH-01, induced significantly greater apoptosis than HEP-Flury or rGDSH-P in a caspase-dependent pathway that ultimately leads to the activation of the intrinsic apoptotic pathway, which is well characterized with the downregulation of bcl-2, the decrease of mitochondrial membrane potential, the release of mitochondrial cytochrome c, the activation of caspase-9 and caspase-3, and finally the cleavage of poly (ADP-ribose) polymerase. Our results imply that wt P from GD-SH-01 mediates this effect may partly by facilitating viral RNA synthesis but not by viral replication. In sum, we demonstrate a wt RABV strain GD-SH-01 to induce stronger apoptosis than an attenuated RABV HEP-Flury and propose that wt P from GD-SH-01 is involved in this process. PMID:28928726

  8. Phosphoprotein Gene Contributes to the Enhanced Apoptosis Induced by Wild-Type Rabies Virus GD-SH-01 In Vitro.

    PubMed

    Tian, Qin; Wang, Yifei; Zhang, Qiong; Luo, Jun; Jiang, He; Zhang, Boyue; Mei, Mingzhu; Wu, Fan; Wu, Yuting; Peng, Jiaojiao; Long, Teng; Luo, Yongwen; Guo, Xiaofeng

    2017-01-01

    Previous research demonstrated that the matrix protein (M) and glycoprotein (G) of attenuated rabies virus (RABV) strains are involved in the induction of host cell apoptosis. In this work, we show that wild-type (wt) RABV GD-SH-01 induces significantly greater apoptosis than the attenuated strain HEP-Flury. In order to identify the gene(s) accounting for this phenotype, five recombinant RABVs (rRABVs) were constructed by replacing each single gene of HEP-Flury with the corresponding gene of GD-SH-01. By using these rRABVs, we found that not only M and G, but also the phosphoprotein (P) plays an important role in inducing apoptosis. In order to figure out the different role of P gene in inducing apoptosis from the highly divergent background, another rRABV rGDSH-P, which carries the P gene of HEP-Flury in the background of the GD-SH-01 was generated. It was found that infection of NA cells with GD-SH-01 or the recombinant strain rHEP-shP, which carries P gene of GD-SH-01, induced significantly greater apoptosis than HEP-Flury or rGDSH-P in a caspase-dependent pathway that ultimately leads to the activation of the intrinsic apoptotic pathway, which is well characterized with the downregulation of bcl-2, the decrease of mitochondrial membrane potential, the release of mitochondrial cytochrome c, the activation of caspase-9 and caspase-3, and finally the cleavage of poly (ADP-ribose) polymerase. Our results imply that wt P from GD-SH-01 mediates this effect may partly by facilitating viral RNA synthesis but not by viral replication. In sum, we demonstrate a wt RABV strain GD-SH-01 to induce stronger apoptosis than an attenuated RABV HEP-Flury and propose that wt P from GD-SH-01 is involved in this process.

  9. Detecting Remote Sequence Homology in Disordered Proteins: Discovery of Conserved Motifs in the N-Termini of Mononegavirales phosphoproteins

    PubMed Central

    Karlin, David; Belshaw, Robert

    2012-01-01

    Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P) plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11–16aa), several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains) that could be detected simply by comparing orthologous proteins. PMID:22403617

  10. Differential Expression of Secreted Phosphoprotein 1 in the Motor Cortex among Primate Species and during Postnatal Development and Functional Recovery

    PubMed Central

    Yamamoto, Tatsuya; Oishi, Takao; Higo, Noriyuki; Murayama, Shigeo; Sato, Akira; Takashima, Ichiro; Sugiyama, Yoko; Nishimura, Yukio; Murata, Yumi; Yoshino-Saito, Kimika; Isa, Tadashi; Kojima, Toshio

    2013-01-01

    We previously reported that secreted phosphoprotein 1 (SPP1) mRNA is expressed in neurons whose axons form the corticospinal tract (CST) of the rhesus macaque, but not in the corresponding neurons of the marmoset and rat. This suggests that SPP1 expression is involved in the functional or structural specialization of highly developed corticospinal systems in certain primate species. To further examine this hypothesis, we evaluated the expression of SPP1 mRNA in the motor cortex from three viewpoints: species differences, postnatal development, and functional/structural changes of the CST after a lesion of the lateral CST (l-CST) at the mid-cervical level. The density of SPP1-positive neurons in layer V of the primary motor cortex (M1) was much greater in species with highly developed corticospinal systems (i.e., rhesus macaque, capuchin monkey, and humans) than in those with less developed corticospinal systems (i.e., squirrel monkey, marmoset, and rat). SPP1-positive neurons in the macaque monkey M1 increased logarithmically in layer V during postnatal development, following a time course consistent with the increase in conduction velocity of the CST. After an l-CST lesion, SPP1-positive neurons increased in layer V of the ventral premotor cortex, in which compensatory changes in CST function/structure may occur, which positively correlated with the extent of finger dexterity recovery. These results further support the concept that the expression of SPP1 may reflect functional or structural specialization of highly developed corticospinal systems in certain primate species. PMID:23741508

  11. cDNA cloning and overexpression of acidic ribosomal phosphoprotein P1 gene (RPLP1) from the giant panda.

    PubMed

    Du, Yu-Jie; Luo, Xiao-Yan; Hao, Yan-Zhe; Zhang, Tian; Hou, Wan-Ru

    2007-10-26

    RPLP1 is one of acidic ribosomal phosphoproteins encoded by RPLP1 gene, which plays an important role in the elongation step of protein synthesis. The cDNA of RPLP1 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using RT-PCR technology, which was also sequenced, analyzed preliminarily and expressed in E.coli. The cDNA fragment cloned is 449bp in size, containing an open reading frame of 344bp encoding 114 amino acids. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to other five species studied, including Homo sapiens, Mus musculus, Rattus norvegicus, Bos Taurus and Sus scrofa. The homologies for nucleotide sequences of Giant Panda PPLP1 to that of these species are 92.4%, 89.8%, 89.0%, 91.3% and 87.5%, while the homologies for amino acid sequences are 96.5%, 94.7%, 95.6%, 96.5% and 88.6%. Topology prediction showed there are three Casein kinase II phosphorylation sites and two N-myristoylation sites in the RPLP1 protein of the Giant Panda (Ailuropoda melanoleuca). The RPLP1 gene was overexpressed in E. coli and the result indicated that RPLP1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 18kDa polypeptide, which was in accordance with the predicted protein and could also be used to purify the protein and study its function.

  12. The use of sodium trimetaphosphate as a biomimetic analog of matrix phosphoproteins for remineralization of artificial caries-like dentin

    PubMed Central

    Liu, Yan; Li, Nan; Qi, Yipin; Niu, Li-na; Elshafiy, Sally; Mao, Jing; Breschi, Lorenzo; Pashley, David H.; Tay, Franklin R.

    2011-01-01

    Objectives This study examined the use of sodium trimetaphosphate (STMP) as a biomimetic analog of matrix phosphoproteins for remineralization of artificial carious-affected dentin. Methods Artificial carious lesions with lesion depths of 300±30 µm were created by pH-cycling. 2.5% hydrolyzed STMP was applied to the artificial carious lesions to phosphorylate the partially-demineralized collagen matrix. Half of the STMP-treated specimens were bonded with One-Step. The adhesive and non-adhesive infiltrated specimens were remineralized in a Portland cement-simulated body fluid system containing polyacrylic acid (PAA) to stabilize amorphous calcium phosphate as nanoprecursors. Micro-computed tomography (micro-CT) and transmission electron microscopy (TEM) were used to evaluate the results of remineralization after a 4-month period. Results In absence of PAA and STMP as biomimetic analogs (control groups), there was no remineralization irrespective of whether the lesions were infiltrated with adhesive. For the STMP-treated experimental groups immersed in PAA-containing simulated body fluid, specimens without adhesive infiltration were more heavily remineralized than those infiltrated with adhesive. Statistical analysis of the 4-month micro-CT data revealed significant differences in the lesion depth, relative mineral content along the lesion surface and changes in ΔZ between the non-adhesive and adhesive experimental groups (p<0.05 for all the three parameters). TEM examination indicated that collagen degradation occurred in both the non-adhesive and adhesive control and experimental groups after 4 months of remineralization. Significance Biomimetic remineralization using STMP is a promising method to remineralize artificial carious lesions particularly in areas devoid of seed crystallites. Future studies should consider the incorporation of MMP-inhibitors within the partially-demineralized collagen matrix to prevent collagen degradation during remineralization. PMID

  13. Structural Mechanisms of Plant Glucan Phosphatases in Starch Metabolism

    PubMed Central

    Meekins, David A.; Vander Kooi, Craig W.; Gentry, Matthew S.

    2016-01-01

    Glucan phosphatases are a recently discovered class of enzymes that dephosphorylate starch and glycogen, thereby regulating energy metabolism. Plant genomes encode for two glucan phosphatases called Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2) that regulate starch metabolism by selectively dephosphorylating glucose moieties within starch glucan chains. Recently, the structures of both SEX4 and LSF2 were determined, with and without phosphoglucan products bound, revealing the mechanism for their unique activities. This review explores the structural and enzymatic features of the plant glucan phosphatases and outlines how they are uniquely adapted for carrying out their cellular functions. We outline the physical mechanisms employed by SEX4 and LSF2 to interact with starch glucans: SEX4 binds glucan chains via a continuous glucan binding platform comprised of its Dual Specificity Phosphatase (DSP) domain and Carbohydrate Binding Module (CBM) while LSF2 utilizes Surface Binding Sites (SBSs). SEX4 and LSF2 both contain a unique network of aromatic residues in their catalytic DSP domains that serve as glucan engagement platforms and are unique to the glucan phosphatases. We also discuss the phosphoglucan substrate specificities inherent to SEX4 and LSF2 and outline structural features within the active site that govern glucan orientation. This review defines the structural mechanism of the plant glucan phosphatases with respect to phosphatases, starch metabolism, and protein-glucan interaction; thereby providing a framework for their applications in both agricultural and industrial settings. PMID:26934589

  14. Cracking the phosphatase code: docking interactions determine substrate specificity.

    PubMed

    Roy, Jagoree; Cyert, Martha S

    2009-12-08

    Phosphoserine- and phosphothreonine-directed phosphatases display remarkable substrate specificity, yet the sites that they dephosphorylate show little similarity in amino acid sequence. Studies reveal that docking interactions are key for the recognition of substrates and regulators by two conserved phosphatases, protein phosphatase 1 (PP1) and the Ca2+-calmodulin-dependent phosphatase calcineurin. In each case, a small degenerate sequence motif in the interacting protein directs low-affinity binding to a docking surface on the phosphatase that is distinct from the active site; several such interactions combine to confer overall binding specificity. Some docking surfaces are conserved, such as a hydrophobic groove on a face opposite the active site that serves as a major recognition surface for the "RVxF" motif of proteins that interact with PP1 and the "PxIxIT" motif of substrates of calcineurin. Secondary motifs combine with this primary targeting sequence to specify phosphatase binding. A comprehensive interactome for mammalian PP1 was described, analysis of which defines several PP1-binding motifs. Studies of "LxVP," a secondary calcineurin-binding sequence, establish that this motif is a conserved feature of calcineurin substrates and that the immunosuppressants FK506 and cyclosporin A inhibit the phosphatase by interfering with LxVP-mediated docking.

  15. Giardia lamblia: Characterization of ecto-phosphatase activities.

    PubMed

    Amazonas, Juliana Natal; Cosentino-Gomes, Daniela; Werneck-Lacerda, Aline; Pinheiro, Ana Acácia de Sá; Lanfredi-Rangel, Adriana; De Souza, Wanderley; Meyer-Fernandes, José R

    2009-01-01

    Ecto-phosphatase activities of Giardia lamblia were characterized in intact cells, which are able to hydrolyze the artificial substrate p-nitrophenylphosphate (p-NPP) to p-nitrophenol (p-NP) at a rate of 8.4+/-0.8 nmol p-NP/h/10(7) cells. The ecto-phosphatase activities were inhibited at high pH as well as by classical inhibitors of acid phosphatases, such as sodium fluoride and sodium molybdate and by inorganic phosphate, the final product of the reaction. Experiments using a classical inhibitor of phosphotyrosine phosphatase, sodium orthovanadate, also showed that the ecto-phosphatase activity was inhibited in a dose-dependent manner. Different phosphorylated amino acids were used as substrates for the G. lamblia ecto-phosphatase activities the highest rate of phosphate release was achieved using phosphotyrosine. Not only p-NPP hydrolysis but also phosphotyrosine hydrolysis was inhibited by sodium orthovanadate. Phosphotyrosine but not phospho-serine or phospho-threonine inhibited the p-nitrophenylphosphatase activity. We also observed a positive correlation between the ecto-phosphatase activity and the capacity to encystation of G. lamblia trophozoites.

  16. A bifunctional kinase-phosphatase in bacterial chemotaxis.

    PubMed

    Porter, Steven L; Roberts, Mark A J; Manning, Cerys S; Armitage, Judith P

    2008-11-25

    Phosphorylation-based signaling pathways employ dephosphorylation mechanisms for signal termination. Histidine to aspartate phosphosignaling in the two-component system that controls bacterial chemotaxis has been studied extensively. Rhodobacter sphaeroides has a complex chemosensory pathway with multiple homologues of the Escherichia coli chemosensory proteins, although it lacks homologues of known signal-terminating CheY-P phosphatases, such as CheZ, CheC, FliY or CheX. Here, we demonstrate that an unusual CheA homologue, CheA(3), is not only a phosphodonor for the principal CheY protein, CheY(6), but is also is a specific phosphatase for CheY(6)-P. This phosphatase activity accelerates CheY(6)-P dephosphorylation to a rate that is comparable with the measured stimulus response time of approximately 1 s. CheA(3) possesses only two of the five domains found in classical CheAs, the Hpt (P1) and regulatory (P5) domains, which are joined by a 794-amino acid sequence that is required for phosphatase activity. The P1 domain of CheA(3) is phosphorylated by CheA(4), and it subsequently acts as a phosphodonor for the response regulators. A CheA(3) mutant protein without the 794-amino acid region lacked phosphatase activity, retained phosphotransfer function, but did not support chemotaxis, suggesting that the phosphatase activity may be required for chemotaxis. Using a nested deletion approach, we showed that a 200-amino acid segment of CheA(3) is required for phosphatase activity. The phosphatase activity of previously identified nonhybrid histidine protein kinases depends on the dimerization and histidine phosphorylation (DHp) domains. However, CheA(3) lacks a DHp domain, suggesting that its phosphatase mechanism is different from that of other histidine protein kinases.

  17. Enhanced expression of the Marek's disease virus-specific phosphoproteins after stable transfection of MSB-1 cells with the Marek's disease virus homologue of ICP4.

    PubMed

    Pratt, W D; Cantello, J; Morgan, R W; Schat, K A

    1994-05-15

    Phosphoprotein pp38, coded for by the BamHI-H fragment of the Marek's disease herpesvirus (MDV) genome is expressed in tumor cells and tumor cell lines. pp38 is associated with two other phosphoproteins, pp41 and pp24, and can be detected in a small percentage of tumor cells by indirect immunofluorescence assays (IIFA). The importance of MDV ICP4 for the regulation of pp38 expression was examined in the following MSB-1-derived cell lines stably transfected with the selection plasmid pNL1 [MDCC-CU221 (CU221)], pNL1 and the BamHI-A fragment of MDV DNA containing ICP4 (CU224), MDV ICP4 inserted in antisense direction in the eukaryotic expression vector pXT1 (CU222), or ICP4 in sense direction in pXT1 (CU223) or cotransfected with pNL1 and EcoRI-linearized BamHI-A MDV DNA (CU225, -237, -243, -244). IIFA analysis showed that CU223 had a markedly increased expression of pp38, while CU224 had a slightly increased expression. No changes were noted in CU221 or CU222, while expression of pp38 was decreased in CU225, -237, -243, and -244. Radioimmunoprecipitation assays demonstrated that the expression of all three phosphoproteins was enhanced in CU223. Steady-state transcriptional analysis showed that CU223 had increased levels of pp38-specific (1.9 and 3.3 kb) and ICP4-specific (10.0 kb) transcripts.

  18. Ecto-protein kinase substrate p120 revealed as the cell-surface-expressed nucleolar phosphoprotein Nopp140: a candidate protein for extracellular Ca2+-sensing.

    PubMed Central

    Kübler, D

    2001-01-01

    A variety of cell membrane proteins become phosphorylated in their ecto-domains by cell-surface protein kinase (ecto-PK) activities, as detected in a broad spectrum of cell types. This study reports the isolation and identification of a frequent ecto-PK substrate, ecto-p120, using HeLa cells as a model. Data from MS and further biochemical and immunochemical means identified ecto-p120 as a cell-surface homologue of human nucleolar phosphoprotein p140 (hNopp140), which belongs to the family of argyrophilic (AgNOR-stainable) proteins. The superposition of (32)P-labelled ecto-nucleolar phosphoprotein p140 (ecto-Nopp140) with anti-Nopp140 immunostaining could be demonstrated in a wide range of cell lines without any exceptions, suggesting a nearly universal occurrence of cell-surface Nopp140. A previous, tentative association of ecto-p120 with the nucleoplasmic pre-mRNA-binding protein hnRNP U has thus been supplanted, since improved purification techniques have allowed unambiguous identification of this ecto-PK cell-surface substrate. Furthermore, we have shown that rapid suppression of ecto-hNopp140 phosphorylation resulted upon a rise in the free extracellular calcium, while lowering the calcium concentrations returned ecto-Nopp140 phosphorylation to the original level. It is important to note that these Ca(2+)-dependent effects on ecto-Nopp140 phosphorylation are not accompanied by alterations in the phosphorylation of other ecto-PK substrates. Our results indicate that, in addition to nucleolin, a further nucleolar protein, which was considered initially to be strictly intracellular, is identified as a cell-surface phosphoprotein. PMID:11736647

  19. Penicillin inhibitors of purple acid phosphatase.

    PubMed

    Faridoon; Hussein, Waleed M; Ul Islam, Nazar; Guddat, Luke W; Schenk, Gerhard; McGeary, Ross P

    2012-04-01

    Purple acid phosphatases (PAPs) are binuclear metallohydrolases that have a multitude of biological functions and are found in fungi, bacteria, plants and animals. In mammals, PAP activity is linked with bone resorption and over-expression can lead to bone disorders such as osteoporosis. PAP is therefore an attractive target for the development of drugs to treat this disease. A series of penicillin conjugates, in which 6-aminopenicillanic acid was acylated with aromatic acid chlorides, has been prepared and assayed against pig PAP. The binding mode of most of these conjugates is purely competitive, and some members of this class have potencies comparable to the best PAP inhibitors yet reported. The structurally related penicillin G was shown to be neither an inhibitor nor a substrate for pig PAP. Molecular modelling has been used to examine the binding modes of these compounds in the active site of the enzyme and to rationalise their activities. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  20. Universal phosphatase-coupled glycosyltransferase assay.

    PubMed

    Wu, Zhengliang L; Ethen, Cheryl M; Prather, Brittany; Machacek, Miranda; Jiang, Weiping

    2011-06-01

    A nonradioactive glycosyltransferase assay is described here. This method takes advantage of specific phosphatases that can be added into glycosyltransferase reactions to quantitatively release inorganic phosphate from the leaving groups of glycosyltransferase reactions. The released phosphate group is then detected using colorimetric malachite-based reagents. Because the amount of phosphate released is directly proportional to the sugar molecule transferred in a glycosyltransferase reaction, this method can be used to obtain accurate kinetic parameters of the glycosyltransferase. The assay can be performed in multiwell plates and quantitated by a plate reader, thus making it amenable to high-throughput screening. It has been successfully applied to all glycosyltransferases available to us, including glucosyltransferases, N-acetylglucosaminyltransferases, N-acetylgalactosyltransferases, galactosyltransferases, fucosyltransferases and sialyltransferases. As examples, we first assayed Clostridium difficile toxin B, a protein O-glucosyltransferase that specifically monoglucosylates and inactivates Rho family small GTPases; we then showed that human KTELC1, a homolog of Rumi from Drosophila, was able to hydrolyze UDP-Glc; and finally, we measured the kinetic parameters of human sialyltransferase ST6GAL1.

  1. Protein tyrosine phosphatases: structure-function relationships.

    PubMed

    Tabernero, Lydia; Aricescu, A Radu; Jones, E Yvonne; Szedlacsek, Stefan E

    2008-03-01

    Structural analysis of protein tyrosine phosphatases (PTPs) has expanded considerably in the last several years, producing more than 200 structures in this class of enzymes (from 35 different proteins and their complexes with ligands). The small-medium size of the catalytic domain of approximately 280 residues plus a very compact fold makes it amenable to cloning and overexpression in bacterial systems thus facilitating crystallographic analysis. The low molecular weight PTPs being even smaller, approximately 150 residues, are also perfect targets for NMR analysis. The availability of different structures and complexes of PTPs with substrates and inhibitors has provided a wealth of information with profound effects in the way we understand their biological functions. Developments in mammalian expression technology recently led to the first crystal structure of a receptor-like PTP extracellular region. Altogether, the PTP structural work significantly advanced our knowledge regarding the architecture, regulation and substrate specificity of these enzymes. In this review, we compile the most prominent structural traits that characterize PTPs and their complexes with ligands. We discuss how the data can be used to design further functional experiments and as a basis for drug design given that many PTPs are now considered strategic therapeutic targets for human diseases such as diabetes and cancer.

  2. Identification of human pulmonary alkaline phosphatase isoenzymes.

    PubMed

    Capelli, A; Cerutti, C G; Lusuardi, M; Donner, C F

    1997-04-01

    An increase of alkaline phosphatase (ALP) activity has been observed in the bronchoalveolar lavage fluid (BALF) of patients affected by pulmonary fibrosis in chronic interstitial lung disorders. To characterize the ALP isoenzymes in such cases, we used gel filtration, agarose gel electrophoresis, heat and amino acid inhibition assays, wheat-germ agglutinin (WGA) precipitation, and an immunoassay specific for the bone-isoform of ALP. Only one anodic band representing a high-molecular-weight isoform of ALP (Mr approximately 2,000 kDa) was observed on electrophoresis of BALF. The inhibition assay results were consistent for a tissue-nonspecific isoenzyme sensitive to a temperature of 56 degrees C (71.9 +/- 2.5% inhibition) and to homoarginine (65.7 +/- 1.9%), and resistant to L-phenylalanine and L-leucine. Less than 13% of ALP activity was heat-stable. After incubation of BALF specimens with glycosyl-phosphatidylinositol-phospholipase D plus Nonidet P-40, or with phosphatidylinositol-phospholipase C alone, an electrophoretic cathodic band (Mr approximately 220 kDa) appeared near the bone band of a standard serum. With the WGA assay, 84.4 +/- 3.3% of ALP precipitated and the band disappeared. After immunoassay for the bone isoform, a mean of less than 5% enzyme activity was measured. We conclude that the ALP found in BALF is a pulmonary isoform of a tissue nonspecific isoenzyme.

  3. Emerging Roles of Human Prostatic Acid Phosphatase

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2013-01-01

    Prostate cancer is one of the most prevalent non-skin related cancers. It is the second leading cause of cancer deaths among males in most Western countries. If prostate cancer is diagnosed in its early stages, there is a higher probability that it will be completely cured. Prostatic acid phosphatase (PAP) is a non-specific phosphomonoesterase synthesized in prostate epithelial cells and its level proportionally increases with prostate cancer progression. PAP was the biochemical diagnostic mainstay for prostate cancer until the introduction of prostate-specific antigen (PSA) which improved the detection of early-stage prostate cancer and largely displaced PAP. Recently, however, there is a renewed interest in PAP because of its usefulness in prognosticating intermediate to high-risk prostate cancers and its success in the immunotherapy of prostate cancer. Although PAP is believed to be a key regulator of prostate cell growth, its exact role in normal prostate as well as detailed molecular mechanism of PAP regulation is still unclear. Here, many different aspects of PAP in prostate cancer are revisited and its emerging roles in other environment are discussed. PMID:24009853

  4. Alkaline Phosphatase, an Unconventional Immune Protein.

    PubMed

    Rader, Bethany A

    2017-01-01

    Recent years have seen an increase in the number of studies focusing on alkaline phosphatases (APs), revealing an expanding complexity of function of these enzymes. Of the four human AP (hAP) proteins, most is known about tissue non-specific AP (TNAP) and intestinal AP (IAP). This review highlights current understanding of TNAP and IAP in relation to human health and disease. TNAP plays a role in multiple processes, including bone mineralization, vitamin B6 metabolism, and neurogenesis, is the genetic cause of hypophosphatasia, influences inflammation through regulation of purinergic signaling, and has been implicated in Alzheimer's disease. IAP regulates fatty acid absorption and has been implicated in the regulation of diet-induced obesity and metabolic syndrome. IAP and TNAP can dephosphorylate bacterial-derived lipopolysaccharide, and IAP has been identified as a potential regulator of the composition of the intestinal microbiome, an evolutionarily conserved function. Endogenous and recombinant bovine APs and recombinant hAPs are currently being explored for their potential as pharmacological agents to treat AP-associated diseases and mitigate multiple sources of inflammation. Continued research on these versatile proteins will undoubtedly provide insight into human pathophysiology, biochemistry, and the human holobiont.

  5. Alkaline Phosphatase, an Unconventional Immune Protein

    PubMed Central

    Rader, Bethany A.

    2017-01-01

    Recent years have seen an increase in the number of studies focusing on alkaline phosphatases (APs), revealing an expanding complexity of function of these enzymes. Of the four human AP (hAP) proteins, most is known about tissue non-specific AP (TNAP) and intestinal AP (IAP). This review highlights current understanding of TNAP and IAP in relation to human health and disease. TNAP plays a role in multiple processes, including bone mineralization, vitamin B6 metabolism, and neurogenesis, is the genetic cause of hypophosphatasia, influences inflammation through regulation of purinergic signaling, and has been implicated in Alzheimer’s disease. IAP regulates fatty acid absorption and has been implicated in the regulation of diet-induced obesity and metabolic syndrome. IAP and TNAP can dephosphorylate bacterial-derived lipopolysaccharide, and IAP has been identified as a potential regulator of the composition of the intestinal microbiome, an evolutionarily conserved function. Endogenous and recombinant bovine APs and recombinant hAPs are currently being explored for their potential as pharmacological agents to treat AP-associated diseases and mitigate multiple sources of inflammation. Continued research on these versatile proteins will undoubtedly provide insight into human pathophysiology, biochemistry, and the human holobiont. PMID:28824625

  6. Inositol phosphatase activity of the Escherichia coli agp-encoded acid glucose-1-phosphatase.

    PubMed

    Cottrill, Michael A; Golovan, Serguei P; Phillips, John P; Forsberg, Cecil W

    2002-09-01

    When screening an Escherichia coli gene library for myo-inositol hexakisphosphate (InsP6) phosphatases (phytases), we discovered that the agp-encoded acid glucose-1-phosphatase also possesses this activity. Purified Agp hydrolyzes glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6 with pH optima, 6.5, 3.5, and 4.5, respectively, and was stable when incubated at pH values ranging from 3 to 10. Glucose-1-phosphate was hydrolyzed most efficiently at 55 degrees C. while InsP6 and p-nitrophenyl phosphate were hydrolyzed maximally at 60 degrees C. The Agp exhibited Km values of (0.39 mM, 13 mM, and 0.54 mM for the hydrolysis of glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6, respectively. High-pressure liquid chromatography (HPLC) analysis of inositol phosphate hydrolysis products of Agp demonstrated that the enzyme catalyzes the hydrolysis of phosphate from each of InsP6, D-Ins(1,2,3,4,5)P5, Ins(1,3,4,5,6)P5, and Ins(1,2,3,4,6)P5, producing D/L-Ins(1,2,4,5,6)P5. D-Ins(1,2,4,5)P4, D/L-Ins(1,4,5,6)P4 and D/L-Ins(1,2,4,6)P4, respectively. These data support the contention that Agp is a 3-phosphatase.

  7. Lily pollen alkaline phytase is a histidine phosphatase similar to mammalian multiple inositol polyphosphate phosphatase (MINPP).

    PubMed

    Mehta, Bakul Dhagat; Jog, Sonali P; Johnson, Steven C; Murthy, Pushpalatha P N

    2006-09-01

    Phytic acid is the most abundant inositol phosphate in cells; it constitutes 1-5% of the dry weight of cereal grains and legumes. Phytases are the primary enzymes responsible for the hydrolysis of phytic acid and thus play important roles in inositol phosphate metabolism. A novel alkaline phytase in lily pollen (LlALP) was recently purified in our laboratory. In this paper, we describe the cloning and characterization of LlALP cDNA from lily pollen. Two isoforms of alkaline phytase cDNAs, LlAlp1 and LlAlp2, which are 1467 and 1533 bp long and encode proteins of 487 and 511 amino acids, respectively, were identified. The deduced amino acid sequences contains the signature heptapeptide of histidine phosphatases, -RHGXRXP-, but shares < 25% identity to fungal histidine acid phytases. Phylogenetic analysis reveals that LlALP is most closely related to multiple inositol polyphosphate phosphatase (MINPP) from humans (25%) and rats (23%). mRNA corresponding to LlAlp1 and LlAlp2 were expressed in leaves, stem, petals and pollen grains. The expression profiles of LlAlp isoforms in anthers indicated that mRNA corresponding to both isoforms were present at all stages of flower development. The expression of LlAlp2 cDNA in Escherichia coli revealed the accumulation of the active enzyme in inclusion bodies and confirmed that the cDNA encodes an alkaline phytase. In summary, plant alkaline phytase is a member of the histidine phosphatase family that includes MINPP and exhibits properties distinct from bacterial and fungal phytases.

  8. The RCN1-encoded A subunit of protein phosphatase 2A increases phosphatase activity in vivo

    NASA Technical Reports Server (NTRS)

    Deruere, J.; Jackson, K.; Garbers, C.; Soll, D.; Delong, A.; Evans, M. L. (Principal Investigator)

    1999-01-01

    Protein phosphatase 2A (PP2A), a heterotrimeric serine/threonine-specific protein phosphatase, comprises a catalytic C subunit and two distinct regulatory subunits, A and B. The RCN1 gene encodes one of three A regulatory subunits in Arabidopsis thaliana. A T-DNA insertion mutation at this locus impairs root curling, seedling organ elongation and apical hypocotyl hook formation. We have used in vivo and in vitro assays to gauge the impact of the rcn1 mutation on PP2A activity in seedlings. PP2A activity is decreased in extracts from rcn1 mutant seedlings, and this decrease is not due to a reduction in catalytic subunit expression. Roots of mutant seedlings exhibit increased sensitivity to the phosphatase inhibitors okadaic acid and cantharidin in organ elongation assays. Shoots of dark-grown, but not light-grown seedlings also show increased inhibitor sensitivity. Furthermore, cantharidin treatment of wild-type seedlings mimics the rcn1 defect in root curling, root waving and hypocotyl hook formation assays. In roots of wild-type seedlings, RCN1 mRNA is expressed at high levels in root tips, and accumulates to lower levels in the pericycle and lateral root primordia. In shoots, RCN1 is expressed in the apical hook and the basal, rapidly elongating cells in etiolated hypocotyls, and in the shoot meristem and leaf primordia of light-grown seedlings. Our results show that the wild-type RCN1-encoded A subunit functions as a positive regulator of the PP2A holoenzyme, increasing activity towards substrates involved in organ elongation and differential cell elongation responses such as root curling.

  9. The RCN1-encoded A subunit of protein phosphatase 2A increases phosphatase activity in vivo

    NASA Technical Reports Server (NTRS)

    Deruere, J.; Jackson, K.; Garbers, C.; Soll, D.; Delong, A.; Evans, M. L. (Principal Investigator)

    1999-01-01

    Protein phosphatase 2A (PP2A), a heterotrimeric serine/threonine-specific protein phosphatase, comprises a catalytic C subunit and two distinct regulatory subunits, A and B. The RCN1 gene encodes one of three A regulatory subunits in Arabidopsis thaliana. A T-DNA insertion mutation at this locus impairs root curling, seedling organ elongation and apical hypocotyl hook formation. We have used in vivo and in vitro assays to gauge the impact of the rcn1 mutation on PP2A activity in seedlings. PP2A activity is decreased in extracts from rcn1 mutant seedlings, and this decrease is not due to a reduction in catalytic subunit expression. Roots of mutant seedlings exhibit increased sensitivity to the phosphatase inhibitors okadaic acid and cantharidin in organ elongation assays. Shoots of dark-grown, but not light-grown seedlings also show increased inhibitor sensitivity. Furthermore, cantharidin treatment of wild-type seedlings mimics the rcn1 defect in root curling, root waving and hypocotyl hook formation assays. In roots of wild-type seedlings, RCN1 mRNA is expressed at high levels in root tips, and accumulates to lower levels in the pericycle and lateral root primordia. In shoots, RCN1 is expressed in the apical hook and the basal, rapidly elongating cells in etiolated hypocotyls, and in the shoot meristem and leaf primordia of light-grown seedlings. Our results show that the wild-type RCN1-encoded A subunit functions as a positive regulator of the PP2A holoenzyme, increasing activity towards substrates involved in organ elongation and differential cell elongation responses such as root curling.

  10. [Phosphatase activity of Bacillus subtilis IMV B-7023].

    PubMed

    Bulavenko, L V; Kurdysh, I K

    2005-01-01

    Phosphatase activity of two strains of bacteria - Bacillus subtilis IMV B-7023 and B. megaterium 12 is investigated. The phosphatase activity is found to reach 260 mkmol/g x hour for B. subtilis IMV B-7023 and 12-100 mkmol/g x hour for B. megaterium 12 at optimal temperature (55 degrees C) and pH (9.5-10.0). Synthesis of alkaline phosphatase is shown to reach its maximum values at the end of logarithmic phase of the culture growth. It is revealed that Mg2+, Ca2+ cations increase phosphotase activity of B. subtilis IMV B-7023, at the same time Cu2+, Mn2+, Zn2+ cations and inorganic phosphate decrease it. Dependence of the rate of phosphatase reaction of B. subtilis IMV B-7023 on substrate concentration is determined.

  11. Structure and Mechanism of the Phosphotyrosyl Phosphatase Activator

    SciTech Connect

    Chao,Y.; Xing, Y.; Chen, Y.; Xu, Y.; Lin, Z.; Li, Z.; Jeffrey, P.; Stock, J.; Shi, Y.

    2006-01-01

    Phosphotyrosyl phosphatase activator (PTPA), also known as PP2A phosphatase activator, is a conserved protein from yeast to human. Here we report the 1.9 {angstrom} crystal structure of human PTPA, which reveals a previously unreported fold consisting of three subdomains: core, lid, and linker. Structural analysis uncovers a highly conserved surface patch, which borders the three subdomains, and an associated deep pocket located between the core and the linker subdomains. The conserved surface patch and the deep pocket are responsible for binding to PP2A and ATP, respectively. PTPA and PP2A A-C dimer together constitute a composite ATPase. PTPA binding to PP2A results in a dramatic alteration of substrate specificity, with enhanced phosphotyrosine phosphatase activity and decreased phosphoserine phosphatase activity. This function of PTPA strictly depends on the composite ATPase activity. These observations reveal significant insights into the function and mechanism of PTPA and have important ramifications for understanding PP2A function.

  12. Cytoskeletal integrity in interphase cells requires protein phosphatase activity.

    PubMed Central

    Eriksson, J E; Brautigan, D L; Vallee, R; Olmsted, J; Fujiki, H; Goldman, R D

    1992-01-01

    Phosphorylation by protein kinases has been established as a key factor in the regulation of cytoskeletal structure. However, little is known about the role of protein phosphatases in cytoskeletal regulation. To assess the possible functions of protein phosphatases in this respect, we studied the effects of the phosphatase inhibitors calyculin A, okadaic acid, and dinophysistoxin 1 (35-methylokadaic acid) on BHK-21 fibroblasts. Within minutes of incubation with these inhibitors, changes are seen in the structural organization of intermediate filaments, followed by a loss of microtubules, as assayed by immunofluorescence. These changes in cytoskeletal structure are accompanied by a rapid and selective increase in vimentin phosphorylation on interphase-specific sites, and they are fully reversible after removal of calyculin A. The results indicate that there is a rapid phosphate turnover on cytoskeletal intermediate filaments and further suggest that protein phosphatases are essential for the maintenance and structural integrity of two major cytoskeletal components. Images PMID:1332069

  13. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  14. Phosphoinositide 5-phosphatases: How do they affect tumourigenesis?

    PubMed

    Miyazawa, Keiji

    2013-01-01

    The activity of biological molecules is often affected by their phosphorylation state. Regulatory phosphorylation operates as a binary switch and is usually controlled by counteracting kinases and phosphatases. However, phosphatidylinositol (PtdIns) has three phosphorylation sites on its inositol ring. The phosphorylation status of PtdIns is controlled by multiple kinases and phosphatases with distinct substrate specificities, serving as a 'lipid code' or 'phosphoinositide code'. Class I phosphoinositide 3-kinase (PI3K) converts PtdIns(4,5)P₂ to PtdIns(3,4,5)P₃, which plays a pivotal role in signals controlling glucose uptake, cytoskeletal reorganization, cell proliferation and apoptosis. PI3K is pro-oncogenic, whereas phosphoinositide phosphatases that degrade PtdIns(3,4,5)P₃ are not always anti-oncogenic. Recent studies have revealed the unique characteristics of phosphoinositide 5-phosphatases.

  15. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  16. Regulation of alkaline phosphatase expression in human choriocarcinoma cell lines.

    PubMed Central

    Hamilton, T A; Tin, A W; Sussman, H H

    1979-01-01

    The coincident expression of two structurally distinct isoenzymes of human alkaline phosphatase was demonstrated in two independently derived gestational choriocarcinoma cell lines. These proteins were shown to have enzymatic, antigenic, and physical-chemical properties resembling those of isoenzymes from term placenta and adult liver. The regulation of these isoenzymes has been studied during the exposure of both cell lines to 5-bromodeoxyuridine and dibutyryl cyclic AMP. The responses of the alkaline phosphatase isoenzymes to these agents have also been compared with the response of another protein phenotypic to placenta, the alpha subunit of chorionic gonadotropin. The results show that (i) the separate structural genes coding for placental and liver alkaline phosphatases are regulated in a noncoordinate fashion; (ii) both alkaline phosphatase genes respond independently of the alpha subunit; and (iii) the induction of the placental type isoenzyme occurs via at least two independent pathways. Images PMID:218197

  17. Type 2C Protein Phosphatases in Fungi ▿ †

    PubMed Central

    Ariño, Joaquín; Casamayor, Antonio; González, Asier

    2011-01-01

    Type 2C Ser/Thr phosphatases are a remarkable class of protein phosphatases, which are conserved in eukaryotes and involved in a large variety of functional processes. Unlike in other Ser/Thr phosphatases, the catalytic polypeptide is not usually associated with regulatory subunits, and functional specificity is achieved by encoding multiple isoforms. For fungi, most information comes from the study of type 2C protein phosphatase (PP2C) enzymes in Saccharomyces cerevisiae, where seven PP2C-encoding genes (PTC1 to -7) with diverse functions can be found. More recently, data on several Candida albicans PP2C proteins became available, suggesting that some of them can be involved in virulence. In this work we review the available literature on fungal PP2Cs and explore sequence databases to provide a comprehensive overview of these enzymes in fungi. PMID:21076010

  18. Nobiletin, a citrus flavonoid, activates vasodilator-stimulated phosphoprotein in human platelets through non-cyclic nucleotide-related mechanisms.

    PubMed

    Jayakumar, Thanasekaran; Lin, Kao-Chang; Lu, Wan-Jung; Lin, Chia-Ying; Pitchairaj, Geraldine; Li, Jiun-Yi; Sheu, Joen-Rong

    2017-01-01

    Nobiletin, a bioactive polymethoxylated flavone, has been described to possess a diversity of biological effects through its antioxidant and anti-inflammatory properties. Vasodilator-stimulated phosphoprotein (VASP) is a common substrate for cyclic AMP and cyclic GMP-regulated protein kinases [i.e., cyclic AMP-dependent protein kinase (PKA; also known as protein kinase A) and cyclic GMP-dependent protein kinase (PKG; also known as protein kinase G)] and it has been shown to be directly phosphorylated by protein kinase C (PKC). In the present study, we demonstrate that VASP is phosphorylated by nobiletin in human platelets via a non-cyclic nucleotide-related mechanism. This was confirmed by the use of inhibitors of adenylate cyclase (SQ22536) and guanylate cyclase [1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ)], since they prevented VASP phosphorylation induced by nobiletin. Furthormore, this event was also not affected by specific inhibitors of PKA (H-89), PKG (KT5823) and PKC (Ro318220), representing cyclic nucleotide-dependent pathways upon nobiletin-induced VASP phosphorylation. Similarly, inhibitors of p38 mitogen-activated protein kinase (MAPK; SB203580), extracellular signal-regulated kinase 2 (ERK2; PD98059), c-Jun N-terminal kinase 1 (JNK1; SP600125), Akt (LY294002) and nuclear factor-κB (NF-κB; Bay11-7082) did not affect nobiletin‑induced VASP phosphorylation. Moreover, electron spin resonance, dichlorofluorescein fluorescence and western blotting techniques revealed that nobiletin did not affect hydroxyl radicals (OH•), intracellular reactive oxygen species (ROS) and on protein carbonylation, respectively. Furthermore, the nobiletin‑induced VASP phosphorylation was surprisingly reversed by the intracellular antioxidant, N-acetylcysteine (NAC), but not by the inhibitor of NADPH oxidase, diphenyleneiodonium chloride (DPI). It was surprising to observe the differential effects of nobiletin and NAC on VASP

  19. iTRAQ-based quantitative proteome and phosphoprotein characterization reveals the central metabolism changes involved in wheat grain development.

    PubMed

    Ma, Chaoying; Zhou, Jianwen; Chen, Guanxing; Bian, Yanwei; Lv, Dongwen; Li, Xiaohui; Wang, Zhimin; Yan, Yueming

    2014-11-27

    Wheat (Triticum aestivum L.) is an economically important grain crop. Two-dimensional gel-based approaches are limited by the low identification rate of proteins and lack of accurate protein quantitation. The recently developed isobaric tag for relative and absolute quantitation (iTRAQ) method allows sensitive and accurate protein quantification. Here, we performed the first iTRAQ-based quantitative proteome and phosphorylated proteins analyses during wheat grain development. The proteome profiles and phosphoprotein characterization of the metabolic proteins during grain development of the elite Chinese bread wheat cultivar Yanyou 361 were studied using the iTRAQ-based quantitative proteome approach, TiO2 microcolumns, and liquid chromatography-tandem mass spectrometry (LC-MS/MS). Among 1,146 non-redundant proteins identified, 421 showed at least 2-fold differences in abundance, and they were identified as differentially expressed proteins (DEPs), including 256 upregulated and 165 downregulated proteins. Of the 421 DEPs, six protein expression patterns were identified, most of which were up, down, and up-down expression patterns. The 421 DEPs were classified into nine functional categories mainly involved in different metabolic processes and located in the membrane and cytoplasm. Hierarchical clustering analysis indicated that the DEPs involved in starch biosynthesis, storage proteins, and defense/stress-related proteins significantly accumulated at the late grain development stages, while those related to protein synthesis/assembly/degradation and photosynthesis showed an opposite expression model during grain development. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of 12 representative genes encoding different metabolic proteins showed certain transcriptional and translational expression differences during grain development. Phosphorylated proteins analyses demonstrated that 23 DEPs such as AGPase, sucrose synthase, Hsp90, and serpins were

  20. Identification, characterization, and sequence analysis of a cDNA encoding a phosphoprotein of human herpesvirus 6.

    PubMed Central

    Chang, C K; Balachandran, N

    1991-01-01

    Human herpesvirus 6 (HHV-6)-specific monoclonal antibody (Mab) 9A5D12 reacted with the nucleus of HHV-6 strain GS-infected cells and immunoprecipitated a phosphorylated polypeptide with an approximate size of 41 kDa, designated HHV-6 P41. A 110-kDa polypeptide was also immunoprecipitated by the MAb. These polypeptides were synthesized early in infection, and the synthesis was greatly reduced by phosphonoacetic acid. Polypeptides with identical sizes were recognized by the MAb from cells infected with an additional eight HHV-6 strains. A 2.1-kb cDNA insert was identified from an HHV-6(GS) cDNA library constructed in the lambda gt11 expression system by using MAb 9A5D12. This cDNA insert hybridized specifically with viral DNA from HHV-6 strains GS and Z-29 and with two predominant transcripts with approximate sizes of 2.5 and 1.2 kb from infected cells. The reactivity of the MAb with a fusion protein expressed in the prokaryotic vector suggested that the cDNA encodes a 62- to 66-kDa protein. Analysis of the nucleotide sequence of the cDNA insert revealed a 623-amino-acid-residue single open reading frame of 1,871 nucleotides, with an open 5' end. The predicted polypeptide is highly basic and contains a long stretch of highly hydrophobic residues localized to the carboxy terminus. The amino-terminal half of the predicted HHV-6 protein from the cDNA shows significant homology with the UL44 gene product of human cytomegalovirus, coding for the ICP36 family of early-late-class phosphoproteins. Two TATA boxes are located at nucleotide positions 668 and 722 of the cDNA. In vitro translation of RNA transcribed in vitro from the cDNA resulted in the synthesis of a 41-kDa polypeptide only. This polypeptide was readily immunoprecipitated by MAb 9A5D12, and its partial peptide map was identical to that of the 41-kDa polypeptide detected in infected cells. Together, these results indicate that the HHV-6 P41 is encoded within a gene coding for a larger protein. Images PMID

  1. Nobiletin, a citrus flavonoid, activates vasodilator-stimulated phosphoprotein in human platelets through non-cyclic nucleotide-related mechanisms

    PubMed Central

    Jayakumar, Thanasekaran; Lin, Kao-Chang; Lu, Wan-Jung; Lin, Chia-Ying; Pitchairaj, Geraldine; Li, Jiun-Yi; Sheu, Joen-Rong

    2017-01-01

    Nobiletin, a bioactive polymethoxylated flavone, has been described to possess a diversity of biological effects through its antioxidant and anti-inflammatory properties. Vasodilator-stimulated phosphoprotein (VASP) is a common substrate for cyclic AMP and cyclic GMP-regulated protein kinases [i.e., cyclic AMP-dependent protein kinase (PKA; also known as protein kinase A) and cyclic GMP-dependent protein kinase (PKG; also known as protein kinase G)] and it has been shown to be directly phosphorylated by protein kinase C (PKC). In the present study, we demonstrate that VASP is phosphorylated by nobiletin in human platelets via a non-cyclic nucleotide-related mechanism. This was confirmed by the use of inhibitors of adenylate cyclase (SQ22536) and guanylate cyclase [1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ)], since they prevented VASP phosphorylation induced by nobiletin. Furthormore, this event was also not affected by specific inhibitors of PKA (H-89), PKG (KT5823) and PKC (Ro318220), representing cyclic nucleotide-dependent pathways upon nobiletin-induced VASP phosphorylation. Similarly, inhibitors of p38 mitogen-activated protein kinase (MAPK; SB203580), extracellular signal-regulated kinase 2 (ERK2; PD98059), c-Jun N-terminal kinase 1 (JNK1; SP600125), Akt (LY294002) and nuclear factor-κB (NF-κB; Bay11-7082) did not affect nobiletin-induced VASP phosphorylation. Moreover, electron spin resonance, dichlorofluorescein fluorescence and western blotting techniques revealed that nobiletin did not affect hydroxyl radicals (OH•), intracellular reactive oxygen species (ROS) and on protein carbonylation, respectively. Furthermore, the nobiletin-induced VASP phosphorylation was surprisingly reversed by the intracellular antioxidant, N-acetylcysteine (NAC), but not by the inhibitor of NADPH oxidase, diphenyleneiodonium chloride (DPI). It was surprising to observe the differential effects of nobiletin and NAC on VASP phosphorylation in human platelets, since

  2. Site-specific glycosylation of the human cytomegalovirus tegument basic phosphoprotein (UL32) at serine 921 and serine 952.

    PubMed Central

    Greis, K D; Gibson, W; Hart, G W

    1994-01-01

    The virion basic phosphoprotein (BPP), UL32, of the human cytomegalovirus (HCMV) is a 149-kDa tegument protein that represents about 15% of the virion protein mass and is modified by O-linked N-acetylglucosamine (O-GlcNAc). O-GlcNAc has been postulated to mediate subunit-subunit interaction in many different types of intracellular protein complexes, while BPP may play a role in viral assembly and/or envelopment. This report describes the identification of the major O-GlcNAc attachment sites on the HCMV (AD169) BPP. Because the amount of BPP isolated from infectious virions was insufficient to determine the site(s) of glycosylation, the full-length protein has been characterized following overexpression in recombinant baculovirus-infected insect cells. The recombinant protein (rBPP) was electrophoretically (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and immunologically (by Western immunoassaying) indistinguishable from the BPP isolated from HCMV virions. In addition, the rBPP was modified by O-GlcNAc, and a comparison of the tryptic glycopeptides from the rBPP and native virion BPP indicated that their O-GlcNAc sites are the same. Furthermore, the major sites of O-GlcNAc attachment to the rBPP were mapped on high-performance liquid chromatography-purified glycopeptides by gas phase microsequencing, manual Edman degradation, and electrospray-mass spectrometry. The results demonstrate that the major sites of O-GlcNAc attachment to the BPP are Ser-921 and Ser-952. Identification of these sites will now enable mutagenesis studies to determine the influence of O-GlcNAc on the intracellular location, protein-protein interaction, and biological function of BPP. Finally, the fidelity of the addition of O-GlcNAc to rBPP in insect cells compared with native virion BPP is documented to demonstrate the possible general applicability of the baculovirus expression system to study O-GlcNAc on other low-abundance proteins. Images PMID:7966627

  3. Moraxella catarrhalis synthesizes an autotransporter that is an acid phosphatase.

    PubMed

    Hoopman, Todd C; Wang, Wei; Brautigam, Chad A; Sedillo, Jennifer L; Reilly, Thomas J; Hansen, Eric J

    2008-02-01

    Moraxella catarrhalis O35E was shown to synthesize a 105-kDa protein that has similarity to both acid phosphatases and autotransporters. The N-terminal portion of the M. catarrhalis acid phosphatase A (MapA) was most similar (the BLAST probability score was 10(-10)) to bacterial class A nonspecific acid phosphatases. The central region of the MapA protein had similarity to passenger domains of other autotransporter proteins, whereas the C-terminal portion of MapA resembled the translocation domain of conventional autotransporters. Cloning and expression of the M. catarrhalis mapA gene in Escherichia coli confirmed the presence of acid phosphatase activity in the MapA protein. The MapA protein was shown to be localized to the outer membrane of M. catarrhalis and was not detected either in the soluble cytoplasmic fraction from disrupted M. catarrhalis cells or in the spent culture supernatant fluid from M. catarrhalis. Use of the predicted MapA translocation domain in a fusion construct with the passenger domain from another predicted M. catarrhalis autotransporter confirmed the translocation ability of this MapA domain. Inactivation of the mapA gene in M. catarrhalis strain O35E reduced the acid phosphatase activity expressed by this organism, and this mutation could be complemented in trans with the wild-type mapA gene. Nucleotide sequence analysis of the mapA gene from six M. catarrhalis strains showed that this protein was highly conserved among strains of this pathogen. Site-directed mutagenesis of a critical histidine residue (H233A) in the predicted active site of the acid phosphatase domain in MapA eliminated acid phosphatase activity in the recombinant MapA protein. This is the first description of an autotransporter protein that expresses acid phosphatase activity.

  4. Leishmania amazonensis: characterization of an ecto-phosphatase activity.

    PubMed

    de Almeida-Amaral, Elmo Eduardo; Belmont-Firpo, Rodrigo; Vannier-Santos, Marcos André; Meyer-Fernandes, José Roberto

    2006-12-01

    We have characterized a phosphatase activity present on the external surface of Leishmania amazonensis, using intact living parasites. This enzyme hydrolyzes the substrate p-nitrophenylphosphate (p-NPP) at the rate of 25.70+/-1.17 nmol Pi x h(-1) x 10(-7)cells. The dependence on p-NPP concentration shows a normal Michaelis-Menten kinetics for this ecto-phosphatase activity present a V(max) of 31.93+/-3.04 nmol Pi x h(-1) x 10(-7)cells and apparent K(m) of 1.78+/-0.32 mM. Inorganic phosphate inhibited the ecto-phoshatase activity in a dose-dependent manner with the K(i) value of 2.60 mM. Experiments using classical inhibitor of acid phosphatase, such as ammonium molybdate, as well as inhibitors of phosphotyrosine phosphatase, such as sodium orthovanadate and [potassiumbisperoxo(1,10-phenanthroline)oxovanadate(V)] (bpV-PHEN), inhibited the ecto-phosphatase activity, with the K(i) values of 0.33 microM, 0.36 microM and 0.25 microM, respectively. Zinc chloride, another classical phosphotyrosine phosphatase inhibitor, also inhibited the ecto-phosphatase activity in a dose-dependent manner with K(i) 2.62 mM. Zinc inhibition was reversed by incubation with reduced glutathione (GSH) and cysteine, but not serine, showing that cysteine residues are important for enzymatic activity. Promastigote growth in a medium supplemented with 1mM sodium orthovanadate was completely inhibited as compared to the control medium. Taken together, these results suggest that L. amazonensis express a phosphohydrolase ectoenzyme with phosphotyrosine phosphatase activity.

  5. Atomic structure of DUSP26, a novel p53 phosphatase

    PubMed Central

    Lokareddy, Ravi Kumar; Bhardwaj, Anshul; Cingolani, Gino

    2013-01-01

    Regulation of p53 phosphorylation is critical to control its stability and biological activity. Dual Specificity Phosphatase 26 (DUSP26) is a brain phosphatase highly overexpressed in neuroblastoma, which has been implicated in dephosphorylating phospho-Ser20 and phospho-Ser37 in the p53 transactivation domain (TAD). In this paper, we report the 1.68Å crystal structure of a catalytically inactive mutant (Cys152Ser) of DUSP26 lacking the first N-terminal 60 residues (ΔN60-C/S-DUSP26). This structure reveals the architecture of a dual-specificity phosphatase domain related in structure to Vaccinia virus VH1. DUSP26 adopts a closed conformation of the protein tyrosine phosphatase (PTP)-binding loop, which results in an unusually shallow active site pocket and buried catalytic cysteine. A water molecule trapped inside the PTP-binding loop makes close contacts both with main chain and side chain atoms. The hydrodynamic radius (RH) of ΔN60-C/S-DUSP26 measured from velocity sedimentation analysis (RH ~22.7 Å) and gel filtration chromatography (RH ~21.0 Å) is consistent with a globular monomeric protein of ~18 kDa. Instead in crystal, ΔN60-C/S-DUSP26 is more elongated (RH ~37.9 Å), likely due to the extended conformation of C-terminal helix α9, which swings away from the phosphatase core to generate a highly basic surface. As in the case of the phosphatase MKP-4, we propose that a substrate-induced conformational change, possibly involving rearrangement of helix α9 with respect to the phosphatase core, allows DUSP26 to adopt a catalytically active conformation. The structural characterization of DUSP26 presented in this paper provides the first atomic insight into this disease-associated phosphatase. PMID:23298255

  6. The acid phosphatases of Thermoascus crustaceus, a thermophilic fungus.

    PubMed

    Arnold, W N; Garrison, R G; Mann, L C; Wallace, D P

    1988-01-01

    Thermoascus crustaceus, a filamentous, thermophilic ascomycete with pathogenic potential was cultured on Sabouraud's liquid medium at temperatures from 27 to 47 degrees C for periods up to 7 days. Growth rate and yield were optimal at 37 degrees C. Morphological changes were confined to the cell walls, the thickness being greatest at 47 degrees C, which were also more resistant to mechanical disruption. Significant amounts of acid phosphatase (EC 3.1.3.2) activity occurred in the spent media of all cultures but were greatest at 37 degrees C. The proportions of acid phosphatase activity which were operationally defined as soluble or bound were also documented; the optimum pH for acid phosphatase activity in all fractions was 5.0. Extracts were subjected to polyacrylamide gel electrophoresis under non-denaturing conditions and the gels were stained for acid phosphatase activity. This revealed four electrophoretically distinct acid phosphatases which had different susceptibilities to inhibition by fluoride, phosphate, or tartrate. Effects of growth temperature, or phosphate supplement in the culture medium, on the acid phosphatase isoenzyme pattern were judged to be minor. Cytochemistry at the electron microscope level indicated acid phosphatase activity on the surface, in the periplasmic space, and in the cytoplasm, but no trends with regard to growth conditions. A substantial temperature range can be tolerated by this species but it is concluded that neither the general shape of the cells nor the acid phosphatase isoenzyme pattern changes substantially; this contrasts with previously documented differences for this class of enzyme in dimorphic Sporotrix schenckii.

  7. Overexpression of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Karr, Laurel; Malone, Christine, C.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    The Pichiapastoris expression system was utilized to produce functionally active human bone alkaline phosphatase in gram quantities. Bone alkaline phosphatase is a key enzyme in bone formation and biomineralization, yet important questions about its structural chemistry and interactions with other cellular enzymes in mineralizing tissues remain unanswered. A soluble form of human bone alkaline phosphatase was constructed by deletion of the 25 amino acid hydrophobic C-terminal region of the encoding cDNA and inserted into the X-33 Pichiapastoris strain. An overexpression system was developed in shake flasks and converted to large-scale fermentation. Alkaline phosphatase was secreted into the medium to a level of 32mgAL when cultured in shake flasks. Enzyme activity was 12U/mg measured by a spectrophotometric assay. Fermentation yielded 880mgAL with enzymatic activity of 968U/mg. Gel electrophoresis analysis indicates that greater than 50% of the total protein in the fermentation is alkaline phosphatase. A purification scheme has been developed using ammonium sulfate precipitation followed by hydrophobic interaction chromatography. We are currently screening crystallization conditions of the purified recombinant protein for subsequent X-ray diffraction analyses. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  8. Overexpression of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Karr, Laurel; Malone, Christine, C.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    The Pichiapastoris expression system was utilized to produce functionally active human bone alkaline phosphatase in gram quantities. Bone alkaline phosphatase is a key enzyme in bone formation and biomineralization, yet important questions about its structural chemistry and interactions with other cellular enzymes in mineralizing tissues remain unanswered. A soluble form of human bone alkaline phosphatase was constructed by deletion of the 25 amino acid hydrophobic C-terminal region of the encoding cDNA and inserted into the X-33 Pichiapastoris strain. An overexpression system was developed in shake flasks and converted to large-scale fermentation. Alkaline phosphatase was secreted into the medium to a level of 32mgAL when cultured in shake flasks. Enzyme activity was 12U/mg measured by a spectrophotometric assay. Fermentation yielded 880mgAL with enzymatic activity of 968U/mg. Gel electrophoresis analysis indicates that greater than 50% of the total protein in the fermentation is alkaline phosphatase. A purification scheme has been developed using ammonium sulfate precipitation followed by hydrophobic interaction chromatography. We are currently screening crystallization conditions of the purified recombinant protein for subsequent X-ray diffraction analyses. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  9. OBSERVATIONS ON THE ACID PHOSPHATASES OF EUGLENA GRACILIS

    PubMed Central

    Blum, Jacob J.

    1965-01-01

    When a bleached strain of Euglena is maintained in a medium containing very low con centrations of phosphate, the acid phosphatase activity increases. The increase in acid phosphatase activity is prevented by Actinomycin D and by p-fluorophenylalanine (PFA), indicating that the increased activity is due to de novo synthesis of acid phosphatase. When phosphate is replenished, the acid phosphatase activity decreases to the level characteristic of uninduced cells before there is any appreciable cell division. When cell division resumes in the presence of PFA, the level of acid phosphatase activity remains approximately constant. This indicates that there are two different phosphatases: a constitutive enzyme, whose synthesis is insensitive to the presence of PFA, and an induced enzyme, whose synthesis is sensitive to PFA. These enzymes are not equally sensitive to changes in pH and in fluoride concentration, thus permitting them to be assayed individually in whole toluene-treated cells. Induced cells also acquire the ability to remove phosphate from the medium very rapidly. PMID:14326108

  10. The cytochemistry of tartrate-resistant acid phosphatase. Technical considerations.

    PubMed

    Janckila, A J; Li, C Y; Lam, K W; Yam, L T

    1978-07-01

    Cytochemical demonstration of tartrate-resistant acid phosphatase activity is essential for the diagnosis of leukemic reticuloendotheliosis. In order to perform this test correctly and to interpret the results propertly, it is necessary to understand the technical details of the cytochemical methods thoroughly. The method using naphthol--ASBI phosphoric acid--fast garnet GBC is recommended for this purpose, and factors crucial to the cytochemical study, such as fixation, substrate, coupler, pH and temperature of incubation buffer, counterstains, and mounting media are examined and discussed. Conventional methods for acid phosphatase in the presence and absence of L(+) tartaric acid are also critically examined. The naphthol--ASBI phosphoric acid--fast garnet GBC method is sensitive, technically simple and easily reproducible. Its reaction product is highly chromogenic and is most suitable for cytochemical demonstration of acid phosphatase and tartrate-resistant acid phosphatase activity in cytologic preparations. The naphthol--ASBI phosphoric acid--pararosaniline method is highly specific and is best for histochemical demonstration of acid phosphatase and tartrate-resistant acid phosphatase in tissue sections.

  11. Resolution and purification of three periplasmic phosphatases of Salmonella typhimurium.

    PubMed Central

    Kier, L D; Weppelman, R; Ames, B N

    1977-01-01

    A survey of Salmonella typhimurium enzymes possessing phosphatase or phosphodiesterase activity was made using several different growth conditions. These studies revealed the presence of three major enzymes, all of which were subsequently purified: a cyclic 2' ,3'-nucleotide phosphodiesterase (EC 3.1.4.d), an acid hexose phosphatase (EC 3.1.3.2), and a nonspecific acid phosphatase (EC 3.1.3.2). A fourth enzyme hydrolyzed bis-(p-nitrophenyl)phosphate but none of the other substrates tested. No evidence was found for the existence of an alkaline phosphatase (EC 3.1.3.1) or a specific 5'-nucleotidase (EC 3.1.3.5) in S. typhimurium LT2. All three phosphatases could be measured efficiently in intact cells, which suggested a periplasmic location; however, they were not readily released by osmotic shock procedures. The nonspecific acid phosphatase, which was purified to apparent homogeneity, yielded a single polypeptide band on both sodium dodecyl sulfate and acidic urea gel electrophoretic systems. Images PMID:192712

  12. A Malachite Green-Based Assay to Assess Glucan Phosphatase Activity

    PubMed Central

    Sherwood, Amanda R.; Paasch, Bradley C.; Worby, Carolyn A.; Gentry, Matthew S.

    2012-01-01

    With the recent discovery of a unique class of dual-specificity phosphatases that dephosphorylate glucans, we report an in vitro assay tailored for the detection of phosphatase activity against phosphorylated glucans. We demonstrate that in contrast to a general phosphatase assay utilizing a synthetic substrate, only phosphatases that possess glucan phosphatase activity liberate phosphate from the phosphorylated glucan amylopectin using the described assay. This assay is simple and cost-effective, providing reproducible results that clearly establish the presence or absence of glucan phosphatase activity. The assay described will be a useful tool in characterizing emerging members of the glucan phosphatase family. PMID:23201267

  13. Characterisation of secretory calcium-binding phosphoprotein-proline-glutamine-rich 1: a novel basal lamina component expressed at cell-tooth interfaces.

    PubMed

    Moffatt, Pierre; Wazen, Rima M; Dos Santos Neves, Juliana; Nanci, Antonio

    2014-12-01

    Functional genomic screening of the rat enamel organ (EO) has led to the identification of a number of secreted proteins expressed during the maturation stage of amelogenesis, including amelotin (AMTN) and odontogenic ameloblast-associated (ODAM). In this study, we characterise the gene, protein and pattern of expression of a related protein called secretory calcium-binding phosphoprotein-proline-glutamine-rich 1 (SCPPPQ1). The Scpppq1 gene resides within the secretory calcium-binding phosphoprotein (Scpp) cluster. SCPPPQ1 is a highly conserved, 75-residue, secreted protein rich in proline, leucine, glutamine and phenylalanine. In silico data mining has revealed no correlation to any known sequences. Northern blotting of various rat tissues suggests that the expression of Scpppq1 is restricted to tooth and associated tissues. Immunohistochemical analyses show that the protein is expressed during the late maturation stage of amelogenesis and in the junctional epithelium where it localises to an atypical basal lamina at the cell-tooth interface. This discrete localisation suggests that SCPPPQ1, together with AMTN and ODAM, participates in structuring the basal lamina and in mediating attachment of epithelia cells to mineralised tooth surfaces.

  14. [Phosphatase activity in Amoeba proteus at pH 9.0].

    PubMed

    Sopina, V A

    2007-01-01

    In the free-living amoeba Amoeba proteus (strain B), after PAAG disk-electrophoresis of the homogenate supernatant, at using 1-naphthyl phosphate as a substrate and pH 9.0, three forms of phosphatase activity were revealed; they were arbitrarily called "fast", "intermediate", and "slow" phosphatases. The fast phosphatase has been established to be a fraction of lysosomal acid phosphatase that preserves some low activity at alkaline pH. The question as to which particular class the intermediate phosphatase belongs to has remained unanswered: it can be both acid phosphatase and protein tyrosine phosphatase (PTP). Based on data of inhibitor analysis, large substrate specificity, results of experiments with reactivation by Zn ions after inactivation with EDTA, other than in the fast and intermediate phosphatases localization in the amoeba cell, it is concluded that only slow phosphatase can be classified as alkaline phosphatase (EC 3.1.3.1).

  15. Structural elucidation of the NADP(H) phosphatase activity of staphylococcal dual-specific IMPase/NADP(H) phosphatase.

    PubMed

    Bhattacharyya, Sudipta; Dutta, Anirudha; Dutta, Debajyoti; Ghosh, Ananta Kumar; Das, Amit Kumar

    2016-02-01

    NADP(H)/NAD(H) homeostasis has long been identified to play a pivotal role in the mitigation of reactive oxygen stress (ROS) in the intracellular milieu and is therefore critical for the progression and pathogenesis of many diseases. NAD(H) kinases and NADP(H) phosphatases are two key players in this pathway. Despite structural evidence demonstrating the existence and mode of action of NAD(H) kinases, the specific annotation and the mode of action of NADP(H) phosphatases remains obscure. Here, structural evidence supporting the alternative role of inositol monophosphatase (IMPase) as an NADP(H) phosphatase is reported. Crystal structures of staphylococcal dual-specific IMPase/NADP(H) phosphatase (SaIMPase-I) in complex with the substrates D-myo-inositol-1-phosphate and NADP(+) have been solved. The structure of the SaIMPase-I-Ca(2+)-NADP(+) ternary complex reveals the catalytic mode of action of NADP(H) phosphatase. Moreover, structures of SaIMPase-I-Ca(2+)-substrate complexes have reinforced the earlier proposal that the length of the active-site-distant helix α4 and its preceding loop are the predisposing factors for the promiscuous substrate specificity of SaIMPase-I. Altogether, the evidence presented suggests that IMPase-family enzymes with a shorter α4 helix could be potential candidates for previously unreported NADP(H) phosphatase activity.

  16. Prostatic acid phosphatase degrades lysophosphatidic acid in seminal plasma.

    PubMed

    Tanaka, Masayuki; Kishi, Yasuhiro; Takanezawa, Yasukazu; Kakehi, Yoshiyuki; Aoki, Junken; Arai, Hiroyuki

    2004-07-30

    Lysophosphatidic acid (LPA) is a lipid mediator with multiple biological activities and is detected in various biological fluids, including human seminal plasma. Due to its cell proliferation stimulatory and anti-apoptotic activities, LPA has been implicated in the progression of some cancers such as ovarian cancer and prostate cancer. Here, we show that prostatic acid phosphatase, which is a non-specific phosphatase and which has been implicated in the progression of prostate cancer, inactivates LPA in human seminal plasma. Human seminal plasma contains both an LPA-synthetic enzyme, lysoPLD, which converts lysophospholipids to LPA and is responsible for LPA production in serum, and its major substrate, lysophosphatidylcholine. In serum, LPA accumulated during incubation at 37 degrees C. However, in seminal plasma, LPA did not accumulate. This discrepancy is explained by the presence of a strong LPA-degrading activity. Incubation of LPA with seminal plasma resulted in the disappearance of LPA and an accompanying accumulation of monoglyceride showing that LPA is degraded by phosphatase activity present in the seminal plasma. When seminal plasma was incubated in the presence of a phosphatase inhibitor, sodium orthovanadate, LPA accumulated, indicating that LPA is produced and degraded in the fluid. Biochemical characterization of the LPA-phosphatase activity identified two phosphatase activities in human seminal plasma. By Western blotting analysis in combination with several column chromatographies, the major activity was revealed to be identical to prostatic acid phosphatase. The present study demonstrates active LPA metabolism in seminal plasma and indicates the possible role of LPA signaling in male sexual organs including prostate cancer.

  17. Human pyridoxal phosphatase. Molecular cloning, functional expression, and tissue distribution.

    PubMed

    Jang, Young Min; Kim, Dae Won; Kang, Tae-Cheon; Won, Moo Ho; Baek, Nam-In; Moon, Byung Jo; Choi, Soo Young; Kwon, Oh-Shin

    2003-12-12

    Pyridoxal phosphatase catalyzes the dephosphorylation of pyridoxal 5'-phosphate (PLP) and pyridoxine 5'-phosphate. A human brain cDNA clone was identified to the PLP phosphatase on the basis of peptide sequences obtained previously. The cDNA predicts a 296-amino acid protein with a calculated Mr of 31698. The open reading frame is encoded by two exons located on human chromosome 22q12.3, and the exon-intron junction contains the GT/AG consensus splice site. In addition, a full-length mouse PLP phosphatase cDNA of 1978 bp was also isolated. Mouse enzyme encodes a protein of 292 amino acids with Mr of 31512, and it is localized on chromosome 15.E1. Human and mouse PLP phosphatase share 93% identity in protein sequence. A BLAST search revealed the existence of putative proteins in organism ranging from bacteria to mammals. Catalytically active human PLP phosphatase was expressed in Escherichia coli, and characteristics of the recombinant enzyme were similar to those of erythrocyte enzyme. The recombinant enzyme displayed Km and kcat values for pyridoxal of 2.5 microM and 1.52 s(-1), respectively. Human PLP phosphatase mRNA is differentially expressed in a tissue-specific manner. A single mRNA transcript of 2.1 kb was detected in all human tissues examined and was highly abundant in the brain. Obtaining the molecular properties for the human PLP phosphatase may provide new direction for investigating metabolic pathway involving vitamin B6.

  18. [Phosphatase activity in Amoeba proteus at low pH].

    PubMed

    Sopina, V A

    2009-01-01

    In free-living Amoeba proteus (strain B), three forms of tartrate-sensitive phosphatase were revealed using PAGE of the supernatant of ameba homogenates obtained with 1% Triton X-100 or distilled water and subsequent staining of gels with 2-naphthyl phosphate as substrate (pH 4.0). The form with the highest mobility in the ameba supernatant was sensitive to all tested phosphatase activity modulators. Two other forms with the lower mobilities were completely or significantly inactivated not only by sodium L-(+)-tartrate, but also by L-(+)-tartaric acid, sodium orthovanadate, ammonium molybdate, EDTA, EGTA, o-phospho-L-tyrosine, DL-dithiotreitol, H2O2, 2-mercaptoethanol, and ions of heavy metals - Fe2+, Fe3+, and Cu2+. Based on results of inhibitory analysis, lysosome location in the ameba cell, and wide substrate specificity of these two forms, it has been concluded that they belong to nonspecific acid phosphomonoesterases (AcP, EC 3.1.3.2). This AcP is suggested to have both phosphomonoesterase and phosphotyrosyl-protein phosphatase activitis. Two ecto-phosphatases were revealed in the culture medium, in which amebas were cultivated. One of them was inhibited by the same reagents as the ameba tartrate-sensitive AcP and seems to be the AcP released into the culture medium in the process of exocytosis of the content of food vacuoles. In the culture medium, apart from this AcP, another phosphatase was revealed, which was not inhibited by any tested inhibitors of AcP and alkaline phosphatase. It cannot be ruled out that this phosphatase belong to the ecto-ATPases found in many protists; however, its ability to hydrolyze ATP has not yet been proven.

  19. Serum alkaline phosphatase screening for vitamin D deficiency states.

    PubMed

    Shaheen, Shehla; Noor, Syed Shahid; Barakzai, Qamaruddin

    2012-07-01

    To determine whether serum vitamin D levels are correlated with serum levels of alkaline phosphatase or not. Cross-sectional, observational study. Multi-centre study, conducted at Liaquat National Hospital and Medical College, National Medical Centre and Medicare Hospital, Karachi, from January to October 2009. Patients attending the Orthopaedic OPDs with complaints of pain in different body regions and serum vitamin D3 levels of ² 30 ng/ml were included in the study. Patients with vitamin D deficiency were further categorized into mild deficiency or insufficiency (vit. D3 = 20-29 ng/ml), moderate deficiency (vit. D3 = 5 - 19 ng/ml) and severe deficiency forms (vit. D3 < 5 ng/ml). Pearson correlation was applied to test the correlation of serum alkaline phosphatase levels with serum vitamin D3 levels. P-value < 0.05 was considered to be significant. Out of 110 samples, 26 had mild (23%), 61 had moderate (55%) and 21 had severe (19.1%) vitamin D deficiencies. All of the patients in the three groups had alkaline phosphatase with in normal limits and the total mean value of the enzyme was 135.97 ± 68.141 U/L. The inter group comparison showed highest values of alkaline phosphatase in the moderate vitamin D deficiency group. The correlation coefficient of alkaline phosphatase and serum vitamin D3 levels was r =0.05 (p =0.593). Serum vitamin D3 levels may not be correlated with increased serum alkaline phosphatase levels. Therefore, alkaline phosphatase may not be used as a screening test to rule out vitamin D deficiency.

  20. Alkaline phosphatase revisited: hydrolysis of alkyl phosphates.

    PubMed

    O'Brien, Patrick J; Herschlag, Daniel

    2002-03-05

    Escherichia coli alkaline phosphatase (AP) is the prototypical two metal ion catalyst with two divalent zinc ions bound approximately 4 A apart in the active site. Studies spanning half a century have elucidated many structural and mechanistic features of this enzyme, rendering it an attractive model for investigating the potent catalytic power of bimetallic centers. Unfortunately, fundamental mechanistic features have been obscured by limitations with the standard assays. These assays generate concentrations of inorganic phosphate (P(i)) in excess of its inhibition constant (K(i) approximately 1 muM). This tight binding by P(i) has affected the majority of published kinetic constants. Furthermore, binding limits k(cat)/K(m) for reaction of p-nitrophenyl phosphate, the most commonly employed substrate. We describe a sensitive (32)P-based assay for hydrolysis of alkyl phosphates that avoids the complication of product inhibition. We have revisited basic mechanistic features of AP with these alkyl phosphate substrates. The results suggest that the chemical step for phosphorylation of the enzyme limits k(cat)/K(m). The pH-rate profile and additional results suggest that the serine nucleophile is active in its anionic form and has a pK(a) of < or = 5.5 in the free enzyme. An inactivating pK(a) of 8.0 is observed for binding of both substrates and inhibitors, and we suggest that this corresponds to ionization of a zinc-coordinated water molecule. Counter to previous suggestions, inorganic phosphate dianion appears to bind to the highly charged AP active site at least as strongly as the trianion. The dependence of k(cat)/K(m) on the pK(a) of the leaving group follows a Brønsted correlation with a slope of beta(lg) = -0.85 +/- 0.1, differing substantially from the previously reported value of -0.2 obtained from data with a less sensitive assay. This steep leaving group dependence is consistent with a largely dissociative transition state for AP-catalyzed hydrolysis of

  1. Glycerol-3-phosphatase of Corynebacterium glutamicum.

    PubMed

    Lindner, Steffen N; Meiswinkel, Tobias M; Panhorst, Maren; Youn, Jung-Won; Wiefel, Lars; Wendisch, Volker F

    2012-06-15

    Formation of glycerol as by-product of amino acid production by Corynebacterium glutamicum has been observed under certain conditions, but the enzyme(s) involved in its synthesis from glycerol-3-phosphate were not known. It was shown here that cg1700 encodes an enzyme active as a glycerol-3-phosphatase (GPP) hydrolyzing glycerol-3-phosphate to inorganic phosphate and glycerol. GPP was found to be active as a homodimer. The enzyme preferred conditions of neutral pH and requires Mg²⁺ or Mn²⁺ for its activity. GPP dephosphorylated both L- and D-glycerol-3-phosphate with a preference for the D-enantiomer. The maximal activity of GPP was estimated to be 31.1 and 1.7 U mg⁻¹ with K(M) values of 3.8 and 2.9 mM for DL- and L-glycerol-3-phosphate, respectively. For physiological analysis a gpp deletion mutant was constructed and shown to lack the ability to produce detectable glycerol concentrations. Vice versa, gpp overexpression increased glycerol accumulation during growth in fructose minimal medium. It has been demonstrated previously that intracellular accumulation of glycerol-3-phosphate is growth inhibitory as shown for a recombinant C. glutamicum strain overproducing glycerokinase and glycerol facilitator genes from E. coli in media containing glycerol. In this strain, overexpression of gpp restored growth in the presence of glycerol as intracellular glycerol-3-phosphate concentrations were reduced to wild-type levels. In C. glutamicum wild type, GPP was shown to be involved in utilization of DL-glycerol-3-phosphate as source of phosphorus, since growth with DL-glycerol-3-phosphate as sole phosphorus source was reduced in the gpp deletion strain whereas it was accelerated upon gpp overexpression. As GPP homologues were found to be encoded in the genomes of many other bacteria, the gpp homologues of Escherichia coli (b2293) and Bacillus subtilis (BSU09240, BSU34970) as well as gpp1 from the plant Arabidosis thaliana were overexpressed in E. coli MG1655 and

  2. Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence.

    PubMed

    Keum, Dongil; Kruse, Martin; Kim, Dong-Il; Hille, Bertil; Suh, Byung-Chang

    2016-06-28

    Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation

  3. Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence

    PubMed Central

    Keum, Dongil; Kim, Dong-Il; Suh, Byung-Chang

    2016-01-01

    Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation

  4. Crystal structure of rat intestinal alkaline phosphatase--role of crown domain in mammalian alkaline phosphatases.

    PubMed

    Ghosh, Kaushik; Mazumder Tagore, Debarati; Anumula, Rushith; Lakshmaiah, Basanth; Kumar, P P B S; Singaram, Senthuran; Matan, Thangavelu; Kallipatti, Sanjith; Selvam, Sabariya; Krishnamurthy, Prasad; Ramarao, Manjunath

    2013-11-01

    Intestinal alkaline phosphatases (IAPs) are involved in the cleavage of phosphate prodrugs to liberate the drug for absorption in the intestine. To facilitate in vitro characterization of phosphate prodrugs, we have cloned, expressed, purified and characterized IAPs from rat and cynomolgus monkey (rIAP and cIAP respectively) which are important pre-clinical species for drug metabolism studies. The recombinant rat and monkey enzymes expressed in Sf9 insect cells (IAP-Ic) were found to be glycosylated and active. Expression of rat IAP in Escherichia coli (rIAP-Ec) led to ~200-fold loss of activity that was partially recovered by the addition of external Zn(2+) and Mg(2+) ions. Crystal structures of rIAP-Ec and rIAP-Ic were determined and they provide rationale for the discrepancy in enzyme activities. Rat IAP-Ic retains its activity in presence of both Zn(2+) and Mg(2+) whereas activity of most other alkaline phosphatases (APs) including the cIAP was strongly inhibited by excess Zn(2+). Based on our crystal structure, we hypothesized the residue Q317 in rIAP, present within 7 Å of the Mg(2+) at M3, to be important for this difference in activity. The Q317H rIAP and H317Q cIAP mutants showed reversal in effect of Zn(2+), corroborating the hypothesis. Further analysis of the two structures indicated a close linkage between glycosylation and crown domain stability. A triple mutant of rIAP, where all the three putative N-linked glycosylation sites were mutated showed thermal instability and reduced activity.

  5. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  6. Characterization of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Malone, Christine C.; Ciszak, Eva; Karr, Laurel J.

    1999-01-01

    A soluble form of human bone alkaline phosphatase has been expressed in a recombinant strain of the methylotrophic yeast Pichia pastoris. We constructed a plasmid containing cDNA encoding for human bone alkaline phosphatase, with the hydrophobic carboxyl terminal portion deleted. Alkaline phosphatase was secreted into the medium to a level of 32mg/L when cultured in shake flasks, and enzyme activity was 12U/mg, as measured by a spectrophotometric assay. By conversion to a fermentation system, a yield of 880mg/L has been achieved with an enzyme activity of 968U/mg. By gel electrophoresis analysis, it appears that greater than 50% of the total protein in the fermentation media is alkaline phosphatase. Although purification procedures are not yet completely optimized, they are expected to include filtration, ion exchange and affinity chromatography. Our presentation will focus on the purification and crystallization results up to the time of the conference. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  7. A conserved phosphatase cascade that regulates nuclear membrane biogenesis.

    PubMed

    Kim, Youngjun; Gentry, Matthew S; Harris, Thurl E; Wiley, Sandra E; Lawrence, John C; Dixon, Jack E

    2007-04-17

    A newly emerging family of phosphatases that are members of the haloacid dehalogenase superfamily contains the catalytic motif DXDX(T/V). A member of this DXDX(T/V) phosphatase family known as Dullard was recently shown to be a potential regulator of neural tube development in Xenopus [Satow R, Chan TC, Asashima M (2002) Biochem Biophys Res Commun 295:85-91]. Herein, we demonstrate that human Dullard and the yeast protein Nem1p perform similar functions in mammalian cells and yeast cells, respectively. In addition to similarity in primary sequence, Dullard and Nem1p possess similar domains and show similar substrate preferences, and both localize to the nuclear envelope. Additionally, we show that human Dullard can rescue the aberrant nuclear envelope morphology of nem1Delta yeast cells, functionally replacing Nem1p. Finally, Nem1p, has been shown to deposphorylate the yeast phosphatidic acid phosphatase Smp2p [Santos-Rosa H, Leung J, Grimsey N, Peak-Chew S, Siniossoglou S (2005) EMBO J 24:1931-1941], and we show that Dullard dephosphorylates the mammalian phospatidic acid phosphatase, lipin. Therefore, we propose that Dullard participates in a unique phosphatase cascade regulating nuclear membrane biogenesis, and that this cascade is conserved from yeast to mammals.

  8. Characterization of Human Bone Alkaline Phosphatase in Pichia Pastoris

    NASA Technical Reports Server (NTRS)

    Malone, Christine C.; Ciszak, Eva; Karr, Laurel J.

    1999-01-01

    A soluble form of human bone alkaline phosphatase has been expressed in a recombinant strain of the methylotrophic yeast Pichia pastoris. We constructed a plasmid containing cDNA encoding for human bone alkaline phosphatase, with the hydrophobic carboxyl terminal portion deleted. Alkaline phosphatase was secreted into the medium to a level of 32mg/L when cultured in shake flasks, and enzyme activity was 12U/mg, as measured by a spectrophotometric assay. By conversion to a fermentation system, a yield of 880mg/L has been achieved with an enzyme activity of 968U/mg. By gel electrophoresis analysis, it appears that greater than 50% of the total protein in the fermentation media is alkaline phosphatase. Although purification procedures are not yet completely optimized, they are expected to include filtration, ion exchange and affinity chromatography. Our presentation will focus on the purification and crystallization results up to the time of the conference. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

  9. Characteristics of plasmalemma alkaline phosphatase of rat mesenteric artery.

    PubMed

    Kwan, C Y

    1983-01-01

    General characteristics of alkaline phosphatase activity of the plasma membrane-enriched fraction isolated from rat mesenteric arteries were investigated. The vascular smooth muscle plasmalemma alkaline phosphatase is a metalloenzyme which is strongly inhibited by chelating agents and this inhibition can be completely overcome by addition of Mg2+ or Ca2+. Zn2+ only partially reactivates the enzyme in the presence of low concentrations of EDTA. The enzymatic hydrolysis of p-nitrophenyl phosphate, beta-glycerophosphate, alpha-glycerophosphate, or 3'-adenosine monophosphate showed an optimal activity in the alkaline region between pH 9 and 11. The alkaline phosphatase activity is distinctly different from the plasmalemma ATPase and 5'-nucleotidase activities with respect to their pH dependence, influence by added divalent metal ions and stability against heat inactivation. Vanadate ion, being structurally similar to the transition state analog of the phosphoryl group, potently inhibits alkaline phosphatase with an apparent Ki of 1.5 microM. The altered alkaline phosphatase activity of vascular smooth muscle in relation to its possible physiological function and pathophysiological manifestation associated with hypertensive disease are discussed.

  10. Domain-to-domain coupling in voltage-sensing phosphatase

    PubMed Central

    Sakata, Souhei; Matsuda, Makoto; Kawanabe, Akira; Okamura, Yasushi

    2017-01-01

    Voltage-sensing phosphatase (VSP) consists of a transmembrane voltage sensor and a cytoplasmic enzyme region. The enzyme region contains the phosphatase and C2 domains, is structurally similar to the tumor suppressor phosphatase PTEN, and catalyzes the dephosphorylation of phosphoinositides. The transmembrane voltage sensor is connected to the phosphatase through a short linker region, and phosphatase activity is induced upon membrane depolarization. Although the detailed molecular characteristics of the voltage sensor domain and the enzyme region have been revealed, little is known how these two regions are coupled. In addition, it is important to know whether mechanism for coupling between the voltage sensor domain and downstream effector function is shared among other voltage sensor domain-containing proteins. Recent studies in which specific amino acid sites were genetically labeled using a fluorescent unnatural amino acid have enabled detection of the local structural changes in the cytoplasmic region of Ciona intestinalis VSP that occur with a change in membrane potential. The results of those studies provide novel insight into how the enzyme activity of the cytoplasmic region of VSP is regulated by the voltage sensor domain. PMID:28744425

  11. Phosphotyrosine Substrate Sequence Motifs for Dual Specificity Phosphatases

    PubMed Central

    Zhao, Bryan M.; Keasey, Sarah L.; Tropea, Joseph E.; Lountos, George T.; Dyas, Beverly K.; Cherry, Scott; Raran-Kurussi, Sreejith; Waugh, David S.; Ulrich, Robert G.

    2015-01-01

    Protein tyrosine phosphatases dephosphorylate tyrosine residues of proteins, whereas, dual specificity phosphatases (DUSPs) are a subgroup of protein tyrosine phosphatases that dephosphorylate not only Tyr(P) residue, but also the Ser(P) and Thr(P) residues of proteins. The DUSPs are linked to the regulation of many cellular functions and signaling pathways. Though many cellular targets of DUSPs are known, the relationship between catalytic activity and substrate specificity is poorly defined. We investigated the interactions of peptide substrates with select DUSPs of four types: MAP kinases (DUSP1 and DUSP7), atypical (DUSP3, DUSP14, DUSP22 and DUSP27), viral (variola VH1), and Cdc25 (A-C). Phosphatase recognition sites were experimentally determined by measuring dephosphorylation of 6,218 microarrayed Tyr(P) peptides representing confirmed and theoretical phosphorylation motifs from the cellular proteome. A broad continuum of dephosphorylation was observed across the microarrayed peptide substrates for all phosphatases, suggesting a complex relationship between substrate sequence recognition and optimal activity. Further analysis of peptide dephosphorylation by hierarchical clustering indicated that DUSPs could be organized by substrate sequence motifs, and peptide-specificities by phylogenetic relationships among the catalytic domains. The most highly dephosphorylated peptides represented proteins from 29 cell-signaling pathways, greatly expanding the list of potential targets of DUSPs. These newly identified DUSP substrates will be important for examining structure-activity relationships with physiologically relevant targets. PMID:26302245

  12. New Functions of the Inositol Polyphosphate 5-Phosphatases in Cancer.

    PubMed

    Erneux, Christophe; Ghosh, Somadri; Ramos, Ana Raquel; Edimo, William's Elong

    2016-01-01

    Inositol polyphosphate 5-phosphatases act on inositol phosphates and phosphoinositides as substrates. They are 10 different isoenzymes and several splice variants in the human genome that are involved in a series of human pathologies such as the Lowe syndrome, the Joubert and MORM syndromes, breast cancer, glioblastoma, gastric cancer and several other type of cancers. Inositol 5-phosphatases can be amplified in human cancer cells, whereas the 3- and 4- phosphatase tumor suppressor PTEN and INPP4B, repectively are often repressed or deleted. The inositol 5-phosphatases are critically involved in a complex network of higly regulated phosphoinositides, affecting the lipid content of PI(3, 4, 5)P3, PI(4, 5)P2 and PI(3, 4)P2. This has an impact on the normal behavior of many intracellular target proteins e.g. protein kinase B (PKB/Akt) or actin binding proteins and final biological responses. The production of PI(3, 4P)2 by dephosphorylation of the substrate PI(3, 4, 5)P3 is particularly important as it produces a new signal messenger in the control of cell migration, invasion and endocytosis. New inhibitors/activators of inositol 5- phosphatases have recently been identified for the possible control of their activity in several human pathologies such as inflamation and cancer.

  13. Acid phosphatase activities during the germination of Glycine max seeds.

    PubMed

    dos Prazeres, Janaina Nicanuzia; Ferreira, Carmen Veríssima; Aoyama, Hiroshi

    2004-01-01

    In this paper, we describe a study concerning the determination of some characteristics of soybean seedlings and the detection of acid phosphatase activities towards different substrates during the germination. Enzyme activities with p-nitrophenylphosphate (pNPP) and inorganic pyrophosphate (PPi) as substrates were detected from the 5th and 7th days after germination, respectively. Acid phosphatase activities with tyrosine phosphate (TyrP), glucose-6-phosphate (G6P) and phosphoenol pyruvate (PEP) were also observed but to a lesser extent. Under the same conditions, no enzyme activity was detected with phytic acid (PhyAc) as substrate. The appearance of phosphatase activity was coincident with the decrease of inorganic phosphate content during germination; over the same period, the protein content increased up to the 5th day, decreased until the 8th day, and remained constant after this period. Relative to phosphatase activity in the cotyledons, the activities detected in the hypocotyl and roots were 82% and 38%, respectively. During storage the enzyme maintained about 63% of its activity for 3 months at 5 degrees C. The specificity constant (Vmax/Km) values for pNPP and PPi were 212 and 64 mu kat mM-1 mg-1, respectively. Amongst the substrates tested, PPi could be a potential physiological substrate for acid phosphatase during the germination of soybean seeds.

  14. [Granulocyte alkaline phosphatase--a biomarker of chronic benzene exposure].

    PubMed

    Khristeva, V; Meshkov, T

    1994-01-01

    In tracing the cellular population status in the peripheral blood of workers, exposed to benzene, was included and cytochemical determination of the alkaline phosphatase activity in leucocytes. This enzyme is accepted as marker of the neutrophilic granulocytes, as maturation of the cells and their antibacterial activity are parallel to the cytochemical activity of the enzyme. 78 workers from the coke-chemical production from state firm "Kremikovtsi" and 41 workers from the production "Benzene" and "Isopropylbenzene"--Oil Chemical Plant, Burgas are included. The benzene concentrations in the air of the working places in all productions are in the range of 5 to 50 mg/m3. For cytochemical determination of the alkaline phosphatase activity is used the method of L. Kaplow and phosphatase index was calculated. It was established that in 98.4% of all examined the alkaline phosphatase activity is inhibited to different rate, as from 46.5% [61 workers] it is zero. In considerably lower percentage of workers were established and other deviations: leucocytosis or leucopenia, neutropenia, increased percent of band neutrophils and toxic granules. The results of the investigation of the granulocyte population show that from all indices, the activity of granulocyte alkaline phosphatase demonstrates most convincing the early myelotoxic effect of benzene.

  15. The catalytic properties of alkaline phosphatases under various conditions

    NASA Astrophysics Data System (ADS)

    Atyaksheva, L. F.; Chukhrai, E. S.; Poltorak, O. M.

    2008-11-01

    A comparative study was performed to examine the catalytic properties of alkaline phosphatases from bacteria Escherichia coli and bovine and chicken intestines. The activity of enzyme dimers and tetramers was determined. The activity of the dimer was three or four times higher than that of the tetramer. The maximum activity and affinity for 4-nitrophenylphosphate was observed for the bacterial alkaline phosphatase ( K M = 1.7 × 10-5 M, V max = 1800 μmol/(min mg of protein) for dimers and V max = 420 μmol/(min mg of protein) for tetramers). The Michaelis constants were equal for two animal phosphatases in various buffer media (pH 8.5) ((3.5 ± 0.2) × 10-4 M). Five buffer systems were investigated: tris, carbonate, hepes, borate, and glycine buffers, and the lowest catalytic activity of alkaline phosphatases at equal pH was observed in the borate buffer (for enzyme from bovine intestine, V max = 80 μmol/(min mg of protein)). Cu2+ cations formed a complex with tris-(oxymethyl)-aminomethane ( tris-HCl buffer) and inhibited the intestine alkaline phosphatases by a noncompetitive mechanism.

  16. Thermal inactivation of alkali phosphatases under various conditions

    NASA Astrophysics Data System (ADS)

    Atyaksheva, L. F.; Tarasevich, B. N.; Chukhrai, E. S.; Poltorak, O. M.

    2009-02-01

    The thermal inactivation of alkali phosphatases from bacteria Escherichia coli (ECAP), bovine intestines (bovine IAP), and chicken intestines (chicken IAP) was studied in different buffer solutions and in the solid state. The conclusion was made that these enzymes had maximum stability in the solid state, and, in a carbonate buffer solution, their activity decreased most rapidly. It was found that the bacterial enzyme was more stable than animal phosphatases. It was noted that, for ECAP, four intermediate stages preceded the loss of enzyme activity, and, for bovine and chicken IAPs, three intermediate stages were observed. The activation energy of thermal inactivation of ECAP over the range 25-70°C was determined to be 80 kJ/mol; it corresponded to the dissociation of active dimers into inactive monomers. Higher activation energies (˜200 kJ/mol) observed at the initial stage of thermal inactivation of animal phosphatases resulted from the simultaneous loss of enzyme activity caused by dimer dissociation and denaturation. It was shown that the activation energy of denaturation of monomeric animal alkali phosphatases ranged from 330 to 380 kJ/mol depending on buffer media. It was concluded that the inactivation of solid samples of alkali phosphatases at 95°C was accompanied by an about twofold decrease in the content of β structures in protein molecules.

  17. A Novel Inositol Pyrophosphate Phosphatase in Saccharomyces cerevisiae

    PubMed Central

    Steidle, Elizabeth A.; Chong, Lucy S.; Wu, Mingxuan; Crooke, Elliott; Fiedler, Dorothea; Resnick, Adam C.; Rolfes, Ronda J.

    2016-01-01

    Inositol pyrophosphates are high energy signaling molecules involved in cellular processes, such as energetic metabolism, telomere maintenance, stress responses, and vesicle trafficking, and can mediate protein phosphorylation. Although the inositol kinases underlying inositol pyrophosphate biosynthesis are well characterized, the phosphatases that selectively regulate their cellular pools are not fully described. The diphosphoinositol phosphate phosphohydrolase enzymes of the Nudix protein family have been demonstrated to dephosphorylate inositol pyrophosphates; however, the Saccharomyces cerevisiae homolog Ddp1 prefers inorganic polyphosphate over inositol pyrophosphates. We identified a novel phosphatase of the recently discovered atypical dual specificity phosphatase family as a physiological inositol pyrophosphate phosphatase. Purified recombinant Siw14 hydrolyzes the β-phosphate from 5-diphosphoinositol pentakisphosphate (5PP-IP5 or IP7) in vitro. In vivo, siw14Δ yeast mutants possess increased IP7 levels, whereas heterologous SIW14 overexpression eliminates IP7 from cells. IP7 levels increased proportionately when siw14Δ was combined with ddp1Δ or vip1Δ, indicating independent activity by the enzymes encoded by these genes. We conclude that Siw14 is a physiological phosphatase that modulates inositol pyrophosphate metabolism by dephosphorylating the IP7 isoform 5PP-IP5 to IP6. PMID:26828065

  18. Acid phosphatase and lipid peroxidation in human cataractous lens epithelium.

    PubMed

    Vasavada, A R; Thampi, P; Yadav, S; Rawal, U M

    1993-12-01

    The anterior lens epithelial cells undergo a variety of degenerative and proliferative changes during cataract formation. Acid phosphatase is primarily responsible for tissue regeneration and tissue repair. The lipid hydroperoxides that are obtained by lipid peroxidation of polysaturated or unsaturated fatty acids bring about deterioration of biological membranes at cellular and tissue levels. Acid phosphatase and lipid peroxidation activities were studied on the lens epithelial cells of nuclear cataract, posterior subcapsular cataract, mature cataract, and mixed cataract. Of these, mature cataractous lens epithelium showed maximum activity for acid phosphatase (516.83 moles of p-nitrophenol released/g lens epithelium) and maximum levels of lipid peroxidation (86.29 O.D./min/g lens epithelium). In contrast, mixed cataractous lens epithelium showed minimum activity of acid phosphatase (222.61 moles of p-nitrophenol released/g lens epithelium) and minimum levels of lipid peroxidation (54.23 O.D./min/g lens epithelium). From our study, we correlated the maximum activity of acid phosphatase in mature cataractous lens epithelium with the increased areas of superimposed cells associated with the formation of mature cataract. Likewise, the maximum levels of lipid peroxidation in mature cataractous lens epithelium was correlated with increased permeability of the plasma membrane. Conversely, the minimum levels of lipid peroxidation in mixed cataractous lens epithelium makes us presume that factors other than lipid peroxidation may also account for the formation of mixed type of cataract.

  19. Studies on the catalytic mechanism of pig purple acid phosphatase.

    PubMed

    Wynne, C J; Hamilton, S E; Dionysius, D A; Beck, J L; de Jersey, J

    1995-05-10

    Several independent experiments failed to reveal any evidence in support of the involvement of a phosphoryl-enzyme intermediate in the catalytic mechanism of pig allantoic fluid purple acid phosphatase: (i) attempts to label enzyme with phosphate derived from [32P]p-nitrophenyl phosphate were unsuccessful; (ii) values of kcat for a series of phosphate derivative varied over a wide range, with the enzyme showing a marked preference for activated ester and anhydride substrates over those with a stable leaving group; (iii) burst titrations revealed a "burst" of p-nitrophenol from p-nitrophenyl phosphate only when the enzyme was added after the substrate, suggesting that this result was an artifact of the order of addition of reagents; (iv) transphosphorylation from p-nitrophenyl phosphate to acceptor alcohols could not be detected, even under conditions where a transphosphorylation to hydrolysis ratio as low as 0.015 could have been measured; (v) enzyme-catalyzed exchange of 180 between phosphate and water was demonstrated, although at a rate much slower than that observed for other phosphatases where the involvement of a phosphoryl-enzyme intermediate in the mechanism has been clearly established. The present results are compared with those obtained in similar studies on other phosphatases, particularly the highly homologous beef spleen purple acid phosphatase, and their implications for the catalytic mechanism of the purple acid phosphatases are discussed.

  20. Escherichia coli alkaline phosphatase. Kinetic studies with the tetrameric enzyme.

    PubMed

    Halford, S E; Schlesinger, M J; Gutfreund, H

    1972-03-01

    1. The stability of the tetrameric form of Escherichia coli alkaline phosphatase was examined by analytical ultracentrifugation. 2. The stopped-flow technique was used to study the hydrolysis of nitrophenyl phosphates by the alkaline phosphatase tetramer at pH7.5 and 8.3. In both cases transient product formation was observed before the steady state was attained. Both transients consisted of the liberation of 1mol of nitrophenol/2mol of enzyme subunits within the dead-time of the apparatus. The steady-state rates were identical with those observed with the dimer under the same conditions. 3. The binding of 2-hydroxy-5-nitrobenzyl phosphonate to the alkaline phosphatase tetramer was studied by the temperature-jump technique. The self-association of two dimers to form the tetramer is linked to a conformation change within the dimer. This accounts for the differences between the transient phases in the reactions of the dimer and the tetramer with substrate. 4. Addition of P(i) to the alkaline phosphatase tetramer caused it to dissociate into dimers. The tetramer is unable to bind this ligand. It is suggested that the tetramer undergoes a compulsory dissociation before the completion of its first turnover with substrate. 5. On the basis of these findings a mechanism is proposed for the involvement of the alkaline phosphatase tetramer in the physiology of E. coli.

  1. Elevated serum level of human alkaline phosphatase in obesity.

    PubMed

    Khan, Abdul Rehman; Awan, Fazli Rabbi; Najam, Syeda Sadia; Islam, Mehboob; Siddique, Tehmina; Zain, Maryam

    2015-11-01

    To investigate a correlation between serum alkaline phosphatase level and body mass index in human subjects. The comparative cross-sectional study was carried out at the National Institute for Biotechnology and Genetic Engineering, Faisalabad, Pakistan, from April 2012 to June 2013. Blood serum alkaline phosphatase levels were estimated and the subjects were divided into three sub-groups on the basis of their body mass. normal weight (<25kg/m2), overweight (25-27kg/m2) and obese (>27kg/m2) subjects. The serum samples were used for the estimation of clinically important biochemical parameters, using commercial kits on clinical chemistry analyser. Of the 197 subjects, 97(49%) were obese and 100(51%) were non-obese. The serum alkaline phosphatase level increased in obese (214±6.4 IU/L) compared to the non-obese subjects (184.5±5 IU/L). Furthermore, a significant linear relationship (r=0.3;p-0.0001) was found between serum alkaline phosphatase and body mass index. Other biochemical variables were not correlated to the body mass index. Over activity and higher amounts of alkaline phosphatase were linked to the development of obesity.

  2. Isonicotinohydrazones as inhibitors of alkaline phosphatase and ecto-5'-nucleotidase.

    PubMed

    Channar, Pervaiz Ali; Shah, Syed Jawad Ali; Hassan, Sidra; Nisa, Zaib Un; Lecka, Joanna; Sévigny, Jean; Bajorath, Jürgen; Saeed, Aamer; Iqbal, Jamshed

    2017-03-01

    A series of isonicotinohydrazide derivatives was synthesized and tested against recombinant human and rat ecto-5'-nucleotidases (h-e5'NT and r-e5'NT) and alkaline phosphatase isozymes including both bovine tissue-non-specific alkaline phosphatase (b-TNAP) and tissue-specific calf intestinal alkaline phosphatase (c-IAP). These enzymes are implicated in vascular calcifications, hypophosphatasia, solid tumors, and cancers, such as colon, lung, breast, pancreas, and ovary. All tested compounds were active against both enzymes. The most potent inhibitor of h-e5'NT was derivative (E)-N'-(1-(3-(4-fluorophenyl)-5-phenyl-4,5-dihydro-1H-pyrazol-1-yl)ethylidene)isonicotinohydrazide (3j), whereas derivative (E)-N'-(4-hydroxy-3-methoxybenzylidene)isonicotinohydrazide (3g) exhibited significant inhibitory activity against r-e5'NT. In addition, the derivative (E)-N'-(4'-chlorobenzylidene)isonicotinohydrazide (3a) was most potent inhibitor against calf intestinal alkaline phosphatase and the derivative (E)-N'-(4-hydroxy-3-methoxybenzylidene)isonicotinohydrazide (3g) was found to be most potent inhibitor of bovine tissue-non-specific alkaline phosphatase. Furthermore, putative binding modes of potent compounds against e5'NT (human and rat e5'NT) and AP (including b-TNAP and c-IAP) were determined computationally. © 2016 John Wiley & Sons A/S.

  3. Development of pre-implantation porcine embryos cultured within a three-dimensional alginate hydrogel system either conjugated with Arg-Gly-Asp (RGD) peptide or supplemented with secreted phosphoprotein 1 (SPP1)

    USDA-ARS?s Scientific Manuscript database

    Many uterine specific factors have been shown to be increased within the uterine milieu as the porcine embryo initiates elongation. Secreted phosphoprotein 1 (SPP1) is increased during this time and contains an Arg-Gly-Asp (RGD) peptide sequence that has been shown to bind to cell surface integrins ...

  4. A glutamate switch controls voltage-sensitive phosphatase function

    PubMed Central

    Liu, Lijun; Kohout, Susy C.; Xu, Qiang; Müller, Simone; Kimberlin, Christopher R.; Isacoff, Ehud Y.; Minor, Daniel L.

    2012-01-01

    Ciona intestinalis voltage sensing phosphatase Ci-VSP couples a voltage-sensing domain (VSD) to a lipid phosphatase similar to the tumor suppressor PTEN. How the VSD controls enzyme function has been unclear. Here, we present high-resolution crystal structures of the Ci-VSP enzymatic domain that reveal conformational changes in a key loop, termed the “gating loop”, that controls access to the active site by a mechanism in which residue Glu411 directly competes with substrate. Structure-based mutations that restrict gating loop conformation impair catalytic function and demonstrate that Glu411 also contributes to substrate selectivity. Structure-guided mutations further define an interaction between the gating loop and linker that connects the phosphatase to the VSD for voltage control of enzyme activity. Together, the data suggest that functional coupling between the gating loop and the linker forms the heart of the regulatory mechanism that controls voltage-dependent enzyme activation. PMID:22562138

  5. Purple acid phosphatase in the walls of tobacco cells.

    PubMed

    Kaida, Rumi; Hayashi, Takahisa; Kaneko, Takako S

    2008-10-01

    Purple acid phosphatase isolated from the walls of tobacco cells appears to be a 220kDa homotetramer composed of 60kDa subunits, which is purple in color and which contains iron as its only metal ion. Although the phosphatase did not require dithiothreitol for activity and was not inhibited by phenylarsine oxide, the enzyme showed a higher catalytic efficiency (k(cat)/K(m)) for phosphotyrosine-containing peptides than for other substrates including p-nitrophenyl-phosphate and ATP. The phosphatase formed as a 120kDa dimer in the cytoplasm and as a 220kDa tetramer in the walls, where Brefeldin A blocked its secretion during wall regeneration. According to our double-immunofluorescence labeling results, the enzyme might be translocated through the Golgi apparatus to the walls at the interphase and to the cell plate during cytokinesis.

  6. Phosphatase Wip1 in Immunity: An Overview and Update

    PubMed Central

    Shen, Xiao-Fei; Zhao, Yang; Jiang, Jin-Peng; Guan, Wen-Xian; Du, Jun-Feng

    2017-01-01

    Wild-type p53-induced phosphatase 1 (Wip1) is a newly identified serine/threonine phosphatase, which belongs to the PP2C family. Due to its involvement in stress-induced networks and overexpression in human tumors, primary studies have mainly focused on the role of Wip1 in tumorigenesis. It now has also been implicated in regulating several other physiological processes such as organism aging and neurogenesis. Recent evidence highlights a new role of Wip1 in controlling immune response through regulating immune cell development and function, as well as through the interplay with inflammatory signaling pathways such NF-κB and p38 mitogen-activated protein kinase. In this short review, we will give an overview of Wip1 in immunity to better understand this important phosphatase. PMID:28144241

  7. A glutamate switch controls voltage-sensitive phosphatase function.

    PubMed

    Liu, Lijun; Kohout, Susy C; Xu, Qiang; Müller, Simone; Kimberlin, Christopher R; Isacoff, Ehud Y; Minor, Daniel L

    2012-05-06

    The Ciona intestinalis voltage-sensing phosphatase (Ci-VSP) couples a voltage-sensing domain (VSD) to a lipid phosphatase that is similar to the tumor suppressor PTEN. How the VSD controls enzyme function has been unclear. Here, we present high-resolution crystal structures of the Ci-VSP enzymatic domain that reveal conformational changes in a crucial loop, termed the 'gating loop', that controls access to the active site by a mechanism in which residue Glu411 directly competes with substrate. Structure-based mutations that restrict gating loop conformation impair catalytic function and demonstrate that Glu411 also contributes to substrate selectivity. Structure-guided mutations further define an interaction between the gating loop and linker that connects the phosphatase to the VSD for voltage control of enzyme activity. Together, the data suggest that functional coupling between the gating loop and the linker forms the heart of the regulatory mechanism that controls voltage-dependent enzyme activation.

  8. Phosphoserine phosphatase deficiency in a patient with Williams syndrome.

    PubMed Central

    Jaeken, J; Detheux, M; Fryns, J P; Collet, J F; Alliet, P; Van Schaftingen, E

    1997-01-01

    Decreased serine levels were found in plasma and cerebrospinal fluid (CSF) of a boy with pre- and postnatal growth retardation, moderate psychomotor retardation, and facial dysmorphism suggestive of Williams syndrome. Fluorescence in situ hybridisation with an elastin gene probe indicated the presence of a submicroscopic 7q11.23 deletion, confirming this diagnosis. Further investigation showed that the phosphoserine phosphatase (EC 3.1.3.3.) activity in lymphoblasts and fibroblasts amounted to about 25% of normal values. Oral serine normalised the plasma and CSF levels of this amino acid and seemed to have some clinical effect. These data suggest that the elastin gene and the phosphoserine phosphatase gene might be closely linked. This seems to be the first report of phosphoserine phosphatase deficiency. PMID:9222972

  9. Inositol 5-phosphatases: insights from the Lowe syndrome protein OCRL.

    PubMed

    Pirruccello, Michelle; De Camilli, Pietro

    2012-04-01

    The precise regulation of phosphoinositide lipids in cellular membranes is crucial for cellular survival and function. Inositol 5-phosphatases have been implicated in a variety of disorders, including various cancers, obesity, type 2 diabetes, neurodegenerative diseases and rare genetic conditions. Despite the obvious impact on human health, relatively little structural and biochemical information is available for this family. Here, we review recent structural and mechanistic work on the 5-phosphatases with a focus on OCRL, whose loss of function results in oculocerebrorenal syndrome of Lowe and Dent 2 disease. Studies of OCRL emphasize how the actions of 5-phosphatases rely on both intrinsic and extrinsic membrane recognition properties for full catalytic function. Additionally, structural analysis of missense mutations in the catalytic domain of OCRL provides insight into the phenotypic heterogeneity observed in Lowe syndrome and Dent disease.

  10. [Interaction of two tumor suppressors: Phosphatase CTDSPL and Rb protein].

    PubMed

    Beniaminov, A D; Krasnov, G S; Dmitriev, A A; Puzanov, G A; Snopok, B A; Senchenko, V N; Kashuba, V I

    2016-01-01

    Earlier we established that CTDSPL gene encoding small carboxy-terminal domain serine phosphatase can be considered a classical tumor suppressor gene. Besides, transfection of tumor cell line MCF-7 with CTDSPL led to the content decrease of inactive phosphorylated form of another tumor suppressor, retinoblastoma protein (Rb), and subsequently to cell cycle arrest at the G1/S boundary. This result implied that small phosphatase CTDSPL is able to specifically dephosphorylate and activate Rb protein. In order to add some fuel to this hypothesis, in the present work we studied the interaction of two tumor suppressors CTDSPL and Rb in vitro. GST pool-down assay revealed that CTDSPL is able to precipitate Rb protein from MCF-7 cell extracts, while surface plasmon resonance technique showed that interaction of the two proteins is direct. Results of this study reassert that phosphatase CTDSPL and Rb could be involved in the common mechanism of cell cycle regulation.

  11. Structural Basis of Response Regulator Dephosphorylation by Rap Phosphatases

    SciTech Connect

    V Parashar; N Mirouze; D Dubnau; M Neiditch

    2011-12-31

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic 'switch' residue to an internal position when the {beta}4-{alpha}4 loop adopts an active-site proximal conformation.

  12. Structural Basis of Response Regulator Dephosphorylation by Rap Phosphatases

    PubMed Central

    Parashar, Vijay; Mirouze, Nicolas; Dubnau, David A.; Neiditch, Matthew B.

    2011-01-01

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic “switch” residue to an internal position when the β4-α4 loop adopts an active-site proximal conformation. PMID:21346797

  13. Structural basis of response regulator dephosphorylation by Rap phosphatases.

    PubMed

    Parashar, Vijay; Mirouze, Nicolas; Dubnau, David A; Neiditch, Matthew B

    2011-02-08

    Bacterial Rap family proteins have been most extensively studied in Bacillus subtilis, where they regulate activities including sporulation, genetic competence, antibiotic expression, and the movement of the ICEBs1 transposon. One subset of Rap proteins consists of phosphatases that control B. subtilis and B. anthracis sporulation by dephosphorylating the response regulator Spo0F. The mechanistic basis of Rap phosphatase activity was unknown. Here we present the RapH-Spo0F X-ray crystal structure, which shows that Rap proteins consist of a 3-helix bundle and a tetratricopeptide repeat domain. Extensive biochemical and genetic functional studies reveal the importance of the observed RapH-Spo0F interactions, including the catalytic role of a glutamine in the RapH 3-helix bundle that inserts into the Spo0F active site. We show that in addition to dephosphorylating Spo0F, RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from Spo0F. Our structure-function analysis of the RapH-Spo0F interaction identified Rap protein residues critical for Spo0F phosphatase activity. This information enabled us to assign Spo0F phosphatase activity to a Rap protein based on sequence alone, which was not previously possible. Finally, as the ultimate test of our newfound understanding of the structural requirements for Rap phosphatase function, a non-phosphatase Rap protein that inhibits the binding of the response regulator ComA to DNA was rationally engineered to dephosphorylate Spo0F. In addition to revealing the mechanistic basis of response regulator dephosphorylation by Rap proteins, our studies support the previously proposed T-loop-Y allostery model of receiver domain regulation that restricts the aromatic "switch" residue to an internal position when the β4-α4 loop adopts an active-site proximal conformation.

  14. MDP-1: A novel eukaryotic magnesium-dependent phosphatase.

    PubMed

    Selengut, J D; Levine, R L

    2000-07-18

    We report here the purification, cloning, expression, and characterization of a novel phosphatase, MDP-1. In the course of investigating the reported acid phosphatase activity of carbonic anhydrase III preparations, several discrete phosphatases were discerned. One of these, a magnesium-dependent species of 18.6 kDa, was purified to homogeneity and yielded several peptide sequences from which the parent gene was identified by database searching. Although orthologous genes were identified in fungi and plants as well as mammalian species, there was no apparent homology to any known family of phosphatases. The enzyme was expressed in Escherichia coli with a fusion tag and purified by affinity methods. The recombinant enzyme showed magnesium-dependent acid phosphatase activity comparable to the originally isolated rabbit protein. The enzyme catalyzes the rapid hydrolysis of p-nitrophenyl phosphate, ribose-5-phosphate, and phosphotyrosine. The selectivity for phosphotyrosine over phosphoserine or phosphothreonine is considerable, but the enzyme did not show activity toward five phosphotyrosine-containing peptides. None of the various substrates assayed (including various nucleotide, sugar, amino acid and peptide phosphates, phosphoinositides, and phosphodiesters) exhibited K(M) values lower than 1 mM, and many showed negligible rates of hydrolysis. The enzyme is inhibited by vanadate and fluoride but not by azide, cyanide, calcium, lithium, or tartaric acid. Chemical labeling, refolding, dialysis, and mutagenesis experiments suggest that the enzymatic mechanism is not dependent on cysteine, histidine, or nonmagnesium metal ions. In recognition of these observations, the enzyme has been given the name magnesium-dependent phosphatase-1 (MDP-1).

  15. Phosphatase inhibitors with anti-angiogenic effect in vitro.

    PubMed

    Sylvest, Lene; Bendiksen, Christine Dam; Houen, Gunnar

    2010-01-01

    Levamisole has previously been identified as an inhibitor of angiogenesis in vitro and in vivo, but the mechanism behind the anti-angiogenic behavior has not yet been established. However, one known effect of levamisole is the inhibition of alkaline phosphatase, and this fact encouraged us to test other phosphatase inhibitors for their anti-angiogenic effects by using the same method as used to identify levamisole: an ELISA-based co-culture angiogenesis assay giving quantitative and qualitative results. Historically, intracellular phosphatases have been associated with the downregulation of signaling pathways, and kinases with their upregulation, but lately, the phospatases have also been coupled to positive signaling, which is why inhibition of phosphatases has become associated with anti-tumorigenic and anti-angiogenic effects. The results obtained in this work reveal several agents with anti-angiogenic potential and give a strong indication that phosphatase inhibition is linked to anti-angiogenic activity. An apparent disruption of endothelial tube formation was seen for seven of eight phosphatase inhibitors tested in the angiogenesis assay. By looking at the morphological results, it was seen that most of the inhibitors impaired proliferation and elongation of the endothelial cells, which still had a differentiated appearance. One inhibitor, PTP inhibitor IV, seemed to impair endothelial cell differentiation and induced the same morphology as when cells were treated with levamisole, although at a 200 times lower concentration than that of levamisole. Hence, our work points out compounds with a potential that may be of use in the search for new medical products for the treatment of malignant tumors, or other conditions where angiogenesis plays a central role.

  16. Phosphatase activity on the cell wall of Fonsecaea pedrosoi.

    PubMed

    Kneipp, L F; Palmeira, V F; Pinheiro, A A S; Alviano, C S; Rozental, S; Travassos, L R; Meyer-Fernandes, J R

    2003-12-01

    The activity of a phosphatase was characterized in intact mycelial forms of Fonsecaea pedrosoi, a pathogenic fungus that causes chromoblastomycosis. At pH 5.5, this fungus hydrolyzed p-nitrophenylphosphate (p-NPP) to p-nitrophenol (p-NP) at a rate of 12.78 +/- 0.53 nmol p-NP per h per mg hyphal dry weight. The values of Vmax and apparent Km for p-NPP hydrolyses were measured as 17.89 +/- 0.92 nmol p-NP per h per mg hyphal dry weight and 1.57 +/- 0.26 mmol/l, respectively. This activity was inhibited at increased pH, a finding compatible with an acid phosphatase. The enzymatic activity was strongly inhibited by classical inhibitors of acid phosphatases such as sodium orthovanadate (Ki = 4.23 micromol/l), sodium molybdate (Ki = 7.53 micromol/l) and sodium fluoride (Ki = 126.78 micromol/l) in a dose-dependent manner. Levamizole (1 mmol/l) and sodium tartrate (10 mmol/l), had no effect on the enzyme activity. Cytochemical localization of the acid phosphatase showed electrondense cerium phosphate deposits on the cell wall, as visualized by transmission electron microscopy. Phosphatase activity in F. pedrosoi seems to be associated with parasitism, as sclerotic cells, which are the fungal forms mainly detected in chromoblastomycosis lesions, showed much higher activities than conidia and mycelia did. A strain of F. pedrosoi recently isolated from a human case of chromoblastomycosis also showed increased enzyme activity, suggesting that the expression of surface phosphatases may be stimulated by interaction with the host.

  17. PTP-ε HAS A CRITICAL ROLE IN SIGNALING TRANSDUCTION PATHWAYS AND PHOSPHOPROTEIN NETWORK TOPOLOGY IN RED CELLS

    PubMed Central

    De Franceschi, Lucia; Biondani, Andrea; Carta, Franco; Turrini, Franco; Laudanna, Carlo; Deana, Renzo; Brunati, Anna Maria; Turretta, Loris; Iolascon, Achille; Perrotta, Silverio; Elson, Ari; Bulato, Cristina; Brugnara, Carlo

    2010-01-01

    Protein tyrosine phosphatases (PTPs) are crucial components of cellular signal transduction pathways. We report here that red blood cells (RBCs) from mice lacking PTPε (Ptpre−/−) exhibit abnormal morphology and increased Ca2+-activated-K+ channel activity, which was partially blocked by the Src-Family-Kinases (SFKs) inhibitor PP1. In Ptpre−/− mouse RBCs, the activity of Fyn and Yes, two SFKs, were increased, suggesting a functional relationship between SFKs, PTPε and Ca2+-activated-K+-channel. The absence of PTPε markedly affected the RBC membrane tyrosine (Tyr-) phosphoproteome, indicating a perturbation of RBCs signal transduction pathways. Using signaling network computational analysis of the Tyr-phosphoproteomic data, we identified 7 topological clusters. We studied cluster 1, containing Syk-Tyr-kinase: Syk-kinase activity was higher in wild-type than in Ptpre−/− RBCs, validating the network computational analysis and indicating a novel signaling pathway, which involves Fyn and Syk in regulation of red cell morphology. PMID:18924107

  18. Phosphotyrosine as a substrate of acid and alkaline phosphatases.

    PubMed

    Apostoł, I; Kuciel, R; Wasylewska, E; Ostrowski, W S

    1985-01-01

    A new spectrophotometric method for following dephosphorylation of phosphotyrosine has been described. The absorption spectra of phosphotyrosine and tyrosine were plotted over the pH range from 3 to 9. The change in absorbance accompanying the conversion of phosphotyrosine to tyrosine was the greatest at 286 nm. The difference absorption coefficients were calculated for several pH values. Dephosphorylation of phosphotyrosine by acid phosphatases from human prostate gland, from wheat germ and potatoes obeys the Michaelis-Menten equation, whereas alkaline phosphatases calf intestine and E. coli are inhibited by excess of substrate.

  19. Effect of vanadium compounds on acid phosphatase activity.

    PubMed

    Vescina, C M; Sálice, V C; Cortizo, A M; Etcheverry, S B

    1996-01-01

    The direct effect of different vanadium compounds on acid phosphatase (ACP) activity was investigated. Vanadate and vanadyl but not pervanadate inhibited the wheat germ ACP activity. These vanadium derivatives did not alter the fibroblast Swiss 3T3 soluble fraction ACP activity. Using inhibitors of tyrosine phosphatases (PTPases), the wheat germ ACP was partially characterized as a PTPase. This study suggests that the inhibitory ability of different vanadium derivatives to modulate ACP activity seems to depend on the geometry around the vanadium atom more than on the oxidation state. Our results indicate a correlation between the PTPase activity and the sensitivity to vanadate and vanadyl cation.

  20. Colorimetric Determination of Pure Mg2+-dependent Phosphatidate Phosphatase Activity

    PubMed Central

    Havriluk, Tara; Lozy, Fred; Siniossoglou, Symeon; Carman, George M.

    2008-01-01

    The malachite green-molybdate reagent was used for a colorimetric assay of pure Mg2+-dependent phosphatidate phosphatase activity. This enzyme plays a major role in fat metabolism. Enzyme activity was linear with time and protein concentration, and with the concentration of water-soluble dioctanoyl phosphatidate. The colorimetric assay was used to examine enzyme inhibition by phenylglyoxal, propranolol, and dimethyl sulfoxide. Pure enzyme and a water-soluble phosphatidate substrate were required for the assay, which should be applicable to a well-defined large-scale screen of Mg2+-dependent phosphatidate phosphatase inhibitors (or activators). PMID:17910939

  1. Reduced expression of CD45 Protein-Tyrosine Phosphatase Pr

    DTIC Science & Technology

    2009-05-08

    complex ( MHC ) I (28-14-8), MHC II (M5/114.15.2), CD44 (IM7), and Ly6G (1A8). Cells (1 106) were resuspended in Fc block (anti CD16/CD32 antibody diluted...enzyme (supplemental Fig. 3). Themajority of the phosphatases tested in this panel belong to the class of protein-tyrosine phosphatases (SHP-1, SHP- 2 ...and Sina Bavari‡ 2 From the ‡United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland 21702-5011, §Target Structure

  2. Determination of the henipavirus phosphoprotein gene mRNA editing frequencies and detection of the C, V and W proteins of Nipah virus in virus-infected cells.

    PubMed

    Lo, Michael K; Harcourt, Brian H; Mungall, Bruce A; Tamin, Azaibi; Peeples, Mark E; Bellini, William J; Rota, Paul A

    2009-02-01

    The henipaviruses, Nipah virus (NiV) and Hendra virus (HeV), are highly pathogenic zoonotic paramyxoviruses. Like many other paramyxoviruses, henipaviruses employ a process of co-transcriptional mRNA editing during transcription of the phosphoprotein (P) gene to generate additional mRNAs encoding the V and W proteins. The C protein is translated from the P mRNA, but in an alternate reading frame. Sequence analysis of multiple, cloned mRNAs showed that the mRNA editing frequencies of the P genes of the henipaviruses are higher than those reported for other paramyxoviruses. Antisera to synthetic peptides from the P, V, W and C proteins of NiV were generated to study their expression in infected cells. All proteins were detected in both infected cells and purified virions. In infected cells, the W protein was detected in the nucleus while P, V and C were found in the cytoplasm.

  3. Phosphoprotein profiles of candidate markers for early cellular responses to low-dose γ-radiation in normal human fibroblast cells.

    PubMed

    Yim, Ji-Hye; Yun, Jung Mi; Kim, Ji Young; Lee, In Kyung; Nam, Seon Young; Kim, Cha Soon

    2017-01-24

    Ionizing radiation causes biological damage that leads to severe health effects. However, the effects and subsequent health implications caused by exposure to low-dose radiation are unclear. The objective of this study was to determine phosphoprotein profiles in normal human fibroblast cell lines in response to low-dose and high-dose γ-radiation. We examined the cellular response in MRC-5 cells 0.5 h after exposure to 0.05 or 2 Gy. Using 1318 antibodies by antibody array, we observed ≥1.3-fold increases in a number of identified phosphoproteins in cells subjected to low-dose (0.05 Gy) and high-dose (2 Gy) radiation, suggesting that both radiation levels stimulate distinct signaling pathways. Low-dose radiation induced nucleic acid-binding transcription factor activity, developmental processes, and multicellular organismal processes. By contrast, high-dose radiation stimulated apoptotic processes, cell adhesion and regulation, and cellular organization and biogenesis. We found that phospho-BTK (Tyr550) and phospho-Gab2 (Tyr643) protein levels at 0.5 h after treatment were higher in cells subjected to low-dose radiation than in cells treated with high-dose radiation. We also determined that the phosphorylation of BTK and Gab2 in response to ionizing radiation was regulated in a dose-dependent manner in MRC-5 and NHDF cells. Our study provides new insights into the biological responses to low-dose γ-radiation and identifies potential candidate markers for monitoring exposure to low-dose ionizing radiation.

  4. The Mediation of Platelet Quiescence by NO-Releasing Polymers via cGMP-Induced Serine 239 Phosphorylation of Vasodilator-Stimulated Phosphoprotein

    PubMed Central

    Major, Terry C; Handa, Hitesh; Brisbois, Elizabeth J; Reynolds, Melissa M; Annich, Gail M; Meyerhoff, Mark E; Bartlett, Robert H

    2013-01-01

    Nitric oxide (NO) releasing (NORel) materials have been shown to create localized increases in NO concentration by the release of NO from a diazeniumdiaolate-containing or S-nitrosothiol-containing polymer coating and the improvement of extracorporeal circulation (ECC) hemocompatibility. However, the mechanism and, in particular, the platelet upregulation of the NO/cGMP signaling protein, vasodilator-stimulated phosphoprotein phosphorylated at serine 239 (P-VASP (ser 239), for the improved ECC hemocompatibility via NO release still needs elucidation. In this work, two NORel polymeric coatings were evaluated in a 4 h rabbit thrombogenicity (RT) model and the anti-thrombotic mechanism investigated for rabbit platelet P-VASP upregulation. Polymer films containing 25 wt% diazeniumdiolated dibutylhexansdiamine (DBHD) or 5 wt% S-nitroso-N-acetylpenicillamine (SNAP) coated on the inner walls of ECC circuits yielded significantly reduced ECC thrombus formation and maintained normal platelet aggregation compared to polymer controls after 4 h of blood exposure. Platelet P-VASP (ser 239), a useful tool to monitor NO/cGMP signaling, was upregulated after 4 h on ECC and markedly increased after ex vivo sodium nitroprusside (SNP) stimulation. Interestingly, in the rabbit platelet, NO did not upregulate the cAMP P-VASP phosphoprotein P-VASP (ser 157) as previously shown in human platelets. These results suggest that NORel polymers preserve rabbit platelet quiescence by sustainng a level of cGMP signaling as monitored by P-VASP (ser 239) upregulation. The upregulation of this NO-mediated platelet signaling mechanism in this RT model indicates the potential for improved thromboresistance of any NORel-coated medical device. PMID:23906514

  5. Trypsin functionalization and zirconia coating of mesoporous silica nanotubes for matrix-assisted laser desorption/ionization mass spectrometry analysis of phosphoprotein.

    PubMed

    Zhang, Xiaoli; Wang, Fei; Xia, Yan

    2013-09-06

    Trypsin functionalized mesoporous silica nanotubes bioreactor (TEMSN) and zirconia layer coated mesoporous silica nanotubes (ZrO2-MSN) were developed to deal with the long in-solution digestion time of phosphoprotein and detection difficulty of phosphorylated peptides, respectively. Trypsin was immobilized on the mesoporous silica nanotubes via epoxy group and TEMSN were used as a bioreactor for digestion of α-casein within 3min. ZrO2-MSN were performed to enrich phosphopeptides selectively from in-solution digested peptide mixture of β-casein to demonstrate that ZrO2-MSN possessed remarkable selectivity for phosphorylated peptides even at 100/1 molar ratio of BSA/β-casein. The selective ability of ZrO2-MSN was also investigated in comparison to ZrO2 nanoparticles (ZrO2 NP). Moreover, phosphorylated peptides at the femtomole (2.5fmol) level can also be detected with high S/N (signal-to-noise) ratio. Phosphopeptides enriched from TEMSN-bioreactor digested peptide mixture of α-casein was also performed to evaluate the cooperative performance of TEMSN and ZrO2-MSN platform. The experimental results indicated that TEMSN-bioreactor digestion changed the distribution of relative abundance of phosphopeptides and improved the relative intensity of partial phosphopeptides. This analytical strategy has also been applied to the identification of phosphopeptides isolated from non-fat bovine milk and got a comparable results compared with other materials cited from the literature. By matrix-assisted laser desorption/ionization mass spectrometry (MALDI-TOF MS), TEMSN and ZrO2-MSN were combined together for the rapid and comprehensive analysis of phosphoprotein.

  6. Purinergic Receptor-mediated Rapid Depletion of Nuclear Phosphorylated Akt Depends on Pleckstrin Homology Domain Leucine-rich Repeat Phosphatase, Calcineurin, Protein Phosphatase 2A, and PTEN Phosphatases*

    PubMed Central

    Mistafa, Oras; Ghalali, Aram; Kadekar, Sandeep; Högberg, Johan; Stenius, Ulla

    2010-01-01

    Akt is an important oncoprotein, and data suggest a critical role for nuclear Akt in cancer development. We have previously described a rapid (3–5 min) and P2X7-dependent depletion of nuclear phosphorylated Akt (pAkt) and effects on downstream targets, and here we studied mechanisms behind the pAkt depletion. We show that cholesterol-lowering drugs, statins, or extracellular ATP, induced a complex and coordinated response in insulin-stimulated A549 cells leading to depletion of nuclear pAkt. It involved protein/lipid phosphatases PTEN, pleckstrin homology domain leucine-rich repeat phosphatase (PHLPP1 and -2), protein phosphatase 2A (PP2A), and calcineurin. We employed immunocytology, immunoprecipitation, and proximity ligation assay techniques and show that PHLPP and calcineurin translocated to the nucleus and formed complexes with Akt within 3 min. Also PTEN translocated to the nucleus and then co-localized with pAkt close to the nuclear membrane. An inhibitor of the scaffolding immunophilin FK506-binding protein 51 (FKBP51) and calcineurin, FK506, prevented depletion of nuclear pAkt. Furthermore, okadaic acid, an inhibitor of PP2A, prevented the nuclear pAkt depletion. Chemical inhibition and siRNA indicated that PHLPP, PP2A, and PTEN were required for a robust depletion of nuclear pAkt, and in prostate cancer cells lacking PTEN, transfection of PTEN restored the statin-induced pAkt depletion. The activation of protein and lipid phosphatases was paralleled by a rapid proliferating cell nuclear antigen (PCNA) translocation to the nucleus, a PCNA-p21cip1 complex formation, and cyclin D1 degradation. We conclude that these effects reflect a signaling pathway for rapid depletion of pAkt that may stop the cell cycle. PMID:20605778

  7. Purinergic receptor-mediated rapid depletion of nuclear phosphorylated Akt depends on pleckstrin homology domain leucine-rich repeat phosphatase, calcineurin, protein phosphatase 2A, and PTEN phosphatases.

    PubMed

    Mistafa, Oras; Ghalali, Aram; Kadekar, Sandeep; Högberg, Johan; Stenius, Ulla

    2010-09-03

    Akt is an important oncoprotein, and data suggest a critical role for nuclear Akt in cancer development. We have previously described a rapid (3-5 min) and P2X7-dependent depletion of nuclear phosphorylated Akt (pAkt) and effects on downstream targets, and here we studied mechanisms behind the pAkt depletion. We show that cholesterol-lowering drugs, statins, or extracellular ATP, induced a complex and coordinated response in insulin-stimulated A549 cells leading to depletion of nuclear pAkt. It involved protein/lipid phosphatases PTEN, pleckstrin homology domain leucine-rich repeat phosphatase (PHLPP1 and -2), protein phosphatase 2A (PP2A), and calcineurin. We employed immunocytology, immunoprecipitation, and proximity ligation assay techniques and show that PHLPP and calcineurin translocated to the nucleus and formed complexes with Akt within 3 min. Also PTEN translocated to the nucleus and then co-localized with pAkt close to the nuclear membrane. An inhibitor of the scaffolding immunophilin FK506-binding protein 51 (FKBP51) and calcineurin, FK506, prevented depletion of nuclear pAkt. Furthermore, okadaic acid, an inhibitor of PP2A, prevented the nuclear pAkt depletion. Chemical inhibition and siRNA indicated that PHLPP, PP2A, and PTEN were required for a robust depletion of nuclear pAkt, and in prostate cancer cells lacking PTEN, transfection of PTEN restored the statin-induced pAkt depletion. The activation of protein and lipid phosphatases was paralleled by a rapid proliferating cell nuclear antigen (PCNA) translocation to the nucleus, a PCNA-p21(cip1) complex formation, and cyclin D1 degradation. We conclude that these effects reflect a signaling pathway for rapid depletion of pAkt that may stop the cell cycle.

  8. The Escherichia coli pgpB gene encodes for a diacylglycerol pyrophosphate phosphatase activity.

    PubMed

    Dillon, D A; Wu, W I; Riedel, B; Wissing, J B; Dowhan, W; Carman, G M

    1996-11-29

    We provided genetic and biochemical evidence that supported the conclusion that the product of pgpB gene of Escherichia coli exhibited diacylglycerol pyrophosphate (DGPP) phosphatase activity. DGPP phosphatase activity was absent in pgpB mutant cells and was expressed at high levels in cells carrying the wild-type pgpB gene on a runaway replication plasmid. The pgpB mutant has been primarily characterized by a defect in phosphatidate (PA) phosphatase activity and also exhibits defects in lyso-PA phosphatase and phosphatidylglycerophosphate phosphatase activities. The defective PA phosphatase in the pgpB mutant was shown to be a Mg2+-independent PA phosphatase activity of the DGPP phosphatase enzyme. We characterized DGPP phosphatase activity in membranes from cells overproducing the pgpB gene product. DGPP phosphatase catalyzed the dephosphorylation of the beta phosphate of DGPP to form PA followed by the dephosphorylation of PA to form diacylglycerol. The specificity constant (Vmax/Km) for DGPP was 9.3-fold greater than that for PA. The pH optimum for the DGPP phosphatase reaction was 6. 5. Activity was independent of a divalent cation requirement, was potently inhibited by Mn2+ ions, and was insensitive to inhibition by N-ethylmaleimide. Pure DGPP phosphatase from Saccharomyces cerevisiae was shown to be similar to the E. coli DGPP phosphatase in its ability to utilize lyso-PA and phosphatidylglycerophosphate as substrates in vitro.

  9. Characterization of Arabidopsis Acid Phosphatase Promoter and Regulation of Acid Phosphatase Expression

    PubMed Central

    Haran, Shoshan; Logendra, Sithes; Seskar, Mirjana; Bratanova, Margarita; Raskin, Ilya

    2000-01-01

    The expression and secretion of acid phosphatase (APase) was investigated in Indian mustard (Brassica juncea L. Czern.) plants using sensitive in vitro and activity gel assays. Phosphorus (P) starvation induced two APases in Indian mustard roots, only one of which was secreted. Northern-blot analysis indicated transcriptional regulation of APase expression. Polymerase chain reaction and Southern-blot analyses revealed two APase homologs in Indian mustard, whereas in Arabidopsis, only one APase homolog was detected. The Arabidopsis APase promoter region was cloned and fused to the β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes. GUS expression was first evident in leaves of the P-starved Arabidopsis plants. In P-starved roots, the expression of GUS initiated in lateral root meristems followed by generalized expression throughout the root. GUS expression diminished with the addition of P to the medium. Expression of GFP in P-starved roots also initiated in the lateral root meristems and the recombinant GFP with the APase signal peptide was secreted by the roots into the medium. The APase promoter was specifically activated by low P levels. The removal of other essential elements or the addition of salicylic or jasmonic acids, known inducers of gene expression, did not activate the APase promoter. This novel APase promoter may be used as a plant-inducible gene expression system for the production of recombinant proteins and as a tool to study P metabolism in plants. PMID:11027712

  10. A human phospholipid phosphatase activated by a transmembrane control module.

    PubMed

    Halaszovich, Christian R; Leitner, Michael G; Mavrantoni, Angeliki; Le, Audrey; Frezza, Ludivine; Feuer, Anja; Schreiber, Daniela N; Villalba-Galea, Carlos A; Oliver, Dominik

    2012-11-01

    In voltage-sensitive phosphatases (VSPs), a transmembrane voltage sensor domain (VSD) controls an intracellular phosphoinositide phosphatase domain, thereby enabling immediate initiation of intracellular signals by membrane depolarization. The existence of such a mechanism in mammals has remained elusive, despite the presence of VSP-homologous proteins in mammalian cells, in particular in sperm precursor cells. Here we demonstrate activation of a human VSP (hVSP1/TPIP) by an intramolecular switch. By engineering a chimeric hVSP1 with enhanced plasma membrane targeting containing the VSD of a prototypic invertebrate VSP, we show that hVSP1 is a phosphoinositide-5-phosphatase whose predominant substrate is PI(4,5)P(2). In the chimera, enzymatic activity is controlled by membrane potential via hVSP1's endogenous phosphoinositide binding motif. These findings suggest that the endogenous VSD of hVSP1 is a control module that initiates signaling through the phosphatase domain and indicate a role for VSP-mediated phosphoinositide signaling in mammals.

  11. Effects of organic dairy manure amendment on soil phosphatase activities

    USDA-ARS?s Scientific Manuscript database

    Organic dairy production is increasing in the U.S. due to concerns over environmental, human, and animal health. It is well known that the application of livestock manure to soil can influence enzyme activities involved in nutrient cycling and soil fertility, such as soil phosphatases; however, orga...

  12. Okadaic acid: the archetypal serine/threonine protein phosphatase inhibitor.

    PubMed

    Dounay, A B; Forsyth, C J

    2002-11-01

    As the first recognized member of the "okadaic acid class" of phosphatase inhibitors, the marine natural product okadaic acid is perhaps the most well-known member of a diverse array of secondary metabolites that have emerged as valuable probes for studying the roles of various cellular protein serine/threonine phosphatases. This review provides a historical perspective on the role that okadaic acid has played in stimulating a broad spectrum of modern scientific research as a result of the natural product's ability to bind to and inhibit important classes of protein serine / threonine phosphatases. The relationships between the structure and biological activities of okadaic acid are briefly reviewed, as well as the structural information regarding the particular cellular receptors protein phosphatases 1 (PP1) and 2A. Laboratory syntheses of okadaic acid and its analogs are thoroughly reviewed. Finally, an interpretation of the critical contacts observed between okadaic acid and PP1 by X-ray crystallography is provided, and specific molecular recognition hypotheses that are testable via the synthesis and assay of non-natural analogs of okadaic acid are suggested.

  13. Purification and characterization of two wheat-embryo protein phosphatases.

    PubMed

    Polya, G M; Haritou, M

    1988-04-15

    Two protein phosphatases (enzymes I and II) were extensively purified from wheat embryo by a procedure involving chromatography on DEAE-cellulose, phenyl-Sepharose CL-4B, DEAE-Sephacel and Ultrogel AcA 44. Preparations of enzyme I (Mr 197,000) are heterogeneous. Preparations of enzyme II (Mr 35,000) contain only one major polypeptide (Mr 17,500), which exactly co-purifies with protein phosphatase II on gel filtration and is not present in preparations of enzyme I. However, this major polypeptide has been identified as calmodulin. Calmodulin and protein phosphatase II can be separated by further chromatography on phenyl-Sepharose CL-4B. Protein phosphatases I and II do not require Mg2+ or Ca2+ for activity. Both enzymes catalyse the dephosphorylation of phosphohistone H1 (phosphorylated by wheat-germ Ca2+-dependent protein kinase) and of phosphocasein (phosphorylated by wheat-germ Ca2+-independent casein kinase), but neither enzyme dephosphorylates a range of non-protein phosphomonoesters tested. Both enzymes are inhibited by Zn2+, Hg2+, vanadate, molybdate, F-, pyrophosphate and ATP.