Science.gov

Sample records for phylogeny-guided interaction mapping

  1. Phylogeny-guided (meta)genome mining approach for the targeted discovery of new microbial natural products.

    PubMed

    Kang, Hahk-Soo

    2017-02-01

    Genomics-based methods are now commonplace in natural products research. A phylogeny-guided mining approach provides a means to quickly screen a large number of microbial genomes or metagenomes in search of new biosynthetic gene clusters of interest. In this approach, biosynthetic genes serve as molecular markers, and phylogenetic trees built with known and unknown marker gene sequences are used to quickly prioritize biosynthetic gene clusters for their metabolites characterization. An increase in the use of this approach has been observed for the last couple of years along with the emergence of low cost sequencing technologies. The aim of this review is to discuss the basic concept of a phylogeny-guided mining approach, and also to provide examples in which this approach was successfully applied to discover new natural products from microbial genomes and metagenomes. I believe that the phylogeny-guided mining approach will continue to play an important role in genomics-based natural products research.

  2. Tafuketide, a phylogeny-guided discovery of a new polyketide from Talaromyces funiculosus Salicorn 58.

    PubMed

    Guo, Jia; Ran, Huomiao; Zeng, Jie; Liu, Dong; Xin, Zhihong

    2016-06-01

    A phylogeny-guided approach was applied to screen endophytic fungi containing type I polyketide synthase (PKS I) biosynthetic gene sequences and aimed to correlate genotype to chemotype for the discovery of novel bioactive polyketides. Salicorn 58, which was identified as Talaromyces funiculosus based on its internal transcribed spacer (ITS) and ribosomal large-subunit (LSU) DNA sequences, showed significant target bands. A chemical investigation of the culture of Salicorn 58 was allowed for the isolation of a new polyketide, Talafun (1), and a new natural product, N-(2'-hydroxy-3'-octadecenoyl)-9-methyl-4,8-sphingadienin (2), together with six known compounds, including chrodrimanin A (3), chrodrimanin B (4), N-(4-hydroxy-2-methoxyphenyl) acetamide (5), butyl β-glucose (6), 3β,15β-dihydroxyl-(22E, 24R)-ergosta-5,8(14),22-trien-7-dione (7), and (3β,5a,8a,22E)-5,8-epidioxyergosta-6,22-dien-3-ol (8). Their chemical structures were elucidated by extensive spectroscopic analysis and electro circular dichroism (ECD) spectrum calculations. Antioxidant experiments revealed that compound 5 showed strong ABTS(+) radical scavenging activity with an IC50 value of 11.43 ± 1.61 μM and potent ferric reducing activity (FRAP assay) with FRAP value of 187.52 ± 2.97. Antimicrobial assays revealed that compounds 1 and 4 showed high levels of selectivity toward Escherichia coli with MIC values of 18 ± 0.40 and 43 ± 0.52 μM, respectively. Compounds 2 and 3 exhibited broad-spectrum antimicrobial activity against Staphylococcus aureus, Mycobacterium smegmatis, Micrococcus tetragenus, Mycobacterium phlei, and E. coli, respectively. The results from the current research highlight the advantage of phylogeny-guided pipeline for the screening of new polyketides from endophytic fungi containing PKS I genes.

  3. Golgi: Interactive Online Brain Mapping

    PubMed Central

    Brown, Ramsay A.; Swanson, Larry W.

    2015-01-01

    Golgi (http://www.usegolgi.com) is a prototype interactive brain map of the rat brain that helps researchers intuitively interact with neuroanatomy, connectomics, and cellular and chemical architecture. The flood of “-omic” data urges new ways to help researchers connect discrete findings to the larger context of the nervous system. Here we explore Golgi’s underlying reasoning and techniques and how our design decisions balance the constraints of building both a scientifically useful and usable tool. We demonstrate how Golgi can enhance connectomic literature searches with a case study investigating a thalamocortical circuit involving the Nucleus Accumbens and we explore Golgi’s potential and future directions for growth in systems neuroscience and connectomics. PMID:26635596

  4. Creating an Interactive Videodisc on Mapping.

    ERIC Educational Resources Information Center

    Andrews, Sona Karentz; Grozik, John

    1994-01-01

    Provides an overview of the University of Wisconsin-Milwaukee's Interactive Multimedia Cartography Project to create an interactive videodisc that would illustrate the topic of mapping and provide access to examples of cartography from the American Geographical Society Collection. (JLB)

  5. Spatially Pressure-Mapped Thermochromic Interactive Sensor.

    PubMed

    Kim, Gwangmook; Cho, Sungjun; Chang, Kiseok; Kim, Wook Sung; Kang, Hansaem; Ryu, Sung-Pil; Myoung, Jaemin; Park, Jinwoo; Park, Cheolmin; Shim, Wooyoung

    2017-01-24

    A thermochromic-based interactive sensor that can generate local color switching and pressure mapping is developed using a 2D array of resistive pressure sensor switch. This thermochromic-based interactive sensor will enable the visualization of localized information in arbitrary shapes with dynamic responses in the context of serial/parallel pressure mapping and quantifying capability without optoelectronic arrays.

  6. Interactive Maps for Community in Online Learning

    ERIC Educational Resources Information Center

    Cavanaugh, Terence W.; Cavanaugh, Cathy

    2008-01-01

    The online courses studied here used the visual medium of the interactive geographic map as a form of dialogue to reduce students' sense of transactional distance during the course, build their skills with Web 2.0 media, and increase their motivation. Using the dynamic map and the related online spreadsheet, the course participants created digital…

  7. Interactive mapping on 3-D terrain models

    NASA Astrophysics Data System (ADS)

    Bernardin, T.; Cowgill, E.; Gold, R.; Hamann, B.; Kreylos, O.; Schmitt, A.

    2006-10-01

    We present an interactive, real-time mapping system for use with digital elevation models and remotely sensed multispectral imagery that aids geoscientists in the creation and interpretation of geologic/neotectonic maps at length scales of 10 m to 1000 km. Our system provides a terrain visualization of the surface of the Earth or other terrestrial planets by displaying a virtual terrain model generated from a digital elevation model overlain by a color texture generated from orthophotos or satellite imagery. We use a quadtree-based, multiresolution display method to render in real time high-resolution virtual terrain models that span large spatial regions. The system allows users to measure the orientations of geologic surfaces and record their observations by drawing lines directly on the virtual terrain model. In addition, interpretive surfaces can be generated from these drawings and displayed to facilitate understanding of the three-dimensional geometry of geologic surfaces. The main strength of our system is the combination of real-time rendering and interactive mapping performed directly on the virtual terrain model with the ability to navigate the scene while changing viewpoints arbitrarily during mapping. User studies and comparisons with commercially available mapping software show that our system improves mapping accuracy and efficiency and also yields observations that cannot be made with existing systems.

  8. Interactive map of refugee movement in Europe

    NASA Astrophysics Data System (ADS)

    Calka, Beata; Cahan, Bruce

    2016-12-01

    Considering the recent mass movement of people fleeing war and oppression, an analysis of changes in migration, in particular an analysis of the final destination refugees choose, seems to be of utmost importance. Many international organisations like UNHCR (the United Nations High Commissioner for Refugees) or EuroStat gather and provide information on the number of refugees and the routes they follow. What is also needed to study the state of affairs closely is a visual form presenting the rapidly changing situation. An analysis of the problem together with up-to-date statistical data presented in the visual form of a map is essential. This article describes methods of preparing such interactive maps displaying movement of refugees in European Union countries. Those maps would show changes taking place throughout recent years but also the dynamics of the development of the refugee crisis in Europe. The ArcGIS software was applied to make the map accessible on the Internet. Additionally, online sources and newspaper articles were used to present the movement of migrants. The interactive map makes it possible to watch spatial data with an opportunity to navigate within the map window. Because of that it is a clear and convenient tool to visualise such processes as refugee migration in Europe.

  9. Dynamic Map: Representation of interactions between robots

    SciTech Connect

    Zanardi, C.

    1996-12-31

    As robotics applications become more complex, the need for tools to analyze and explain interactions between robots has become more acute. We introduce the concept of Dynamic Map (DM), which can serve as a generic tool to analyze interactions between robots or with their environment. We show that this concept can be applied to different kinds of applications, like a predator-prey situation, or collision avoidance.

  10. LANDSAT data and interactive computer mapping

    NASA Technical Reports Server (NTRS)

    Grady, R. K.

    1984-01-01

    The integration of image processing capabilities with interactive computer mapping systems is discussed. It is noted that the accomplishment of this integration will result in powerful geographic information systems which will enhance the applicatons of LANDSAT and other types of remotely sensed data in solving problems in the resource planning and management domain.

  11. Quantitative Genetic Interaction Mapping Using the E-MAP Approach

    PubMed Central

    Collins, Sean R.; Roguev, Assen; Krogan, Nevan J.

    2010-01-01

    Genetic interactions represent the degree to which the presence of one mutation modulates the phenotype of a second mutation. In recent years, approaches for measuring genetic interactions systematically and quantitatively have proven to be effective tools for unbiased characterization of gene function and have provided valuable data for analyses of evolution. Here, we present protocols for systematic measurement of genetic interactions with respect to organismal growth rate for two yeast species. PMID:20946812

  12. Genetic interaction mapping with microfluidic-based single cell sequencing

    PubMed Central

    Haliburton, John R.; Shao, Wenjun; Deutschbauer, Adam; Arkin, Adam; Abate, Adam R.

    2017-01-01

    Genetic interaction mapping is useful for understanding the molecular basis of cellular decision making, but elucidating interactions genome-wide is challenging due to the massive number of gene combinations that must be tested. Here, we demonstrate a simple approach to thoroughly map genetic interactions in bacteria using microfluidic-based single cell sequencing. Using single cell PCR in droplets, we link distinct genetic information into single DNA sequences that can be decoded by next generation sequencing. Our approach is scalable and theoretically enables the pooling of entire interaction libraries to interrogate multiple pairwise genetic interactions in a single culture. The speed, ease, and low-cost of our approach makes genetic interaction mapping viable for routine characterization, allowing the interaction network to be used as a universal read out for a variety of biology experiments, and for the elucidation of interaction networks in non-model organisms. PMID:28170417

  13. Genetic interaction mapping with microfluidic-based single cell sequencing.

    PubMed

    Haliburton, John R; Shao, Wenjun; Deutschbauer, Adam; Arkin, Adam; Abate, Adam R

    2017-01-01

    Genetic interaction mapping is useful for understanding the molecular basis of cellular decision making, but elucidating interactions genome-wide is challenging due to the massive number of gene combinations that must be tested. Here, we demonstrate a simple approach to thoroughly map genetic interactions in bacteria using microfluidic-based single cell sequencing. Using single cell PCR in droplets, we link distinct genetic information into single DNA sequences that can be decoded by next generation sequencing. Our approach is scalable and theoretically enables the pooling of entire interaction libraries to interrogate multiple pairwise genetic interactions in a single culture. The speed, ease, and low-cost of our approach makes genetic interaction mapping viable for routine characterization, allowing the interaction network to be used as a universal read out for a variety of biology experiments, and for the elucidation of interaction networks in non-model organisms.

  14. Protein-surface interaction maps for ion-exchange chromatography.

    PubMed

    Freed, Alexander S; Cramer, Steven M

    2011-04-05

    In this paper, protein-surface interaction maps were generated by performing coarse-grained protein-surface calculations. This approach allowed for the rapid determination of the protein-surface interaction energies at a range of orientations and distances. Interaction maps of lysozyme indicated that there was a contiguous series of orientations corresponding to several adjacent preferred binding regions on the protein surface. Examination of these orientations provided insight into the residues involved in surface interactions, which qualitatively agreed with the retention data for single-site mutants. Interaction maps of lysozyme single-site mutants were also generated and provided significant insight into why these variants exhibited significant differences in their chromatographic behavior. This approach was also employed to study the binding behavior of CspB and related mutants. The results indicated that, in addition to describing general trends in the data, these maps provided significant insight into retention data of the single-site mutants. In particular, subtle retention trends observed with the K12 and K13 mutants were well-described using this interaction map approach. Finally, the number of interaction points with energies stronger than -2 kcal/mol was shown to be able to semi-quantitatively predict the behavior of most of the mutants. This rapid approach for calculating protein-surface interaction maps is expected to facilitate future method development for separating closely related protein variants in ion-exchange systems.

  15. Visualising interactive flood risk maps in a dynamic Geobrowser

    NASA Astrophysics Data System (ADS)

    Yaw Manful, Desmond; He, Yi; Cloke, Hannah; Pappenberger, Florian; Li, Zhijia; Wetterhall, Fredrik; Huang, Yingchun; Hu, Yuzhong

    2010-05-01

    Communicating flood forecast products effectively to end-users is the final step in the flood event simulation process. A prototype of the Novel Flood Early Warning System (NEWS) based on the TIGGE (THORPEX Interactive Grand Global Ensemble) database explores new avenues to visualise flood forecast products in a dynamic and interactive manner. One of the possibilities NEWS is currently assessing is Google Maps. Google Maps is a basic web mapping service application and technology provided by Google, free (for non-commercial use). It powers many map-based services including maps embedded on third-party websites via the Google Maps API. Creating a customized map interface requires adding the Google JavaScript code to a page, and then using Javascript functions to add points to the map. Flood maps allow end-users to visualise and navigate a world that is too large and complex to be seen directly. The NEWS software will attempt to deal with the following issues: • Uncertainty visualization in hazards maps • Visualizing uncertainty for sector specific risk managers • Uncertainty representation of point and linear data The objective is improve the information content of flood risk maps making them more useful to specific end-users.

  16. Mapping interactions of Chikungunya virus nonstructural proteins.

    PubMed

    Sreejith, R; Rana, Jyoti; Dudha, Namrata; Kumar, Kapila; Gabrani, Reema; Sharma, Sanjeev K; Gupta, Amita; Vrati, Sudhanshu; Chaudhary, Vijay K; Gupta, Sanjay

    2012-10-01

    The four nonstructural proteins (nsPs1-4) of Chikungunya virus (CHIKV) play important roles involving enzymatic activities and specific interactions with both viral and host components, during different stages of viral pathogenesis. Elucidation of the presence and/or absence of interactions among nsPs in a systematic manner is thus of scientific interest. In the current study, each pair-wise combination among the four nonstructural proteins of CHIKV was systematically analyzed for possible interactions. Six novel protein interactions were identified for CHIKV, using systems such as yeast two-hybrid, GST pull down and ELISA, three of which have not been previously reported for the genus Alphavirus. These interactions form a network of organized associations that suggest the spatial arrangement of nonstructural proteins in the late replicase complex. The study identified novel interactions as well as concurred with previously described associations in related alphaviruses.

  17. Quantitative genetic-interaction mapping in mammalian cells.

    PubMed

    Roguev, Assen; Talbot, Dale; Negri, Gian Luca; Shales, Michael; Cagney, Gerard; Bandyopadhyay, Sourav; Panning, Barbara; Krogan, Nevan J

    2013-05-01

    Mapping genetic interactions (GIs) by simultaneously perturbing pairs of genes is a powerful tool for understanding complex biological phenomena. Here we describe an experimental platform for generating quantitative GI maps in mammalian cells using a combinatorial RNA interference strategy. We performed ∼11,000 pairwise knockdowns in mouse fibroblasts, focusing on 130 factors involved in chromatin regulation to create a GI map. Comparison of the GI and protein-protein interaction (PPI) data revealed that pairs of genes exhibiting positive GIs and/or similar genetic profiles were predictive of the corresponding proteins being physically associated. The mammalian GI map identified pathways and complexes but also resolved functionally distinct submodules within larger protein complexes. By integrating GI and PPI data, we created a functional map of chromatin complexes in mouse fibroblasts, revealing that the PAF complex is a central player in the mammalian chromatin landscape.

  18. Mapping Social Interactions: The Science of Proxemics.

    PubMed

    McCall, Cade

    2017-01-01

    Interpersonal distance and gaze provide a wealth of information during face-to-face social interactions. These "proxemic" behaviors offer a window into everyday social cognition by revealing interactants' affective states (e.g., interpersonal attitudes) and cognitive responses (e.g., social attention). Here we provide a brief overview of the social psychological literature in this domain. We focus on new techniques for experimentally manipulating and measuring proxemics, including the use of immersive virtual environments and digital motion capture. We also discuss ways in which these approaches can be integrated with psychophysiological and neuroimaging techniques. Throughout, we argue that contemporary proxemics research provides psychology and neuroscience with a means to study social cognition and behavior as they naturally emerge and unfold in vivo.

  19. Interactive computer methods for generating mineral-resource maps

    USGS Publications Warehouse

    Calkins, James Alfred; Crosby, A.S.; Huffman, T.E.; Clark, A.L.; Mason, G.T.; Bascle, R.J.

    1980-01-01

    Inasmuch as maps are a basic tool of geologists, the U.S. Geological Survey's CRIB (Computerized Resources Information Bank) was constructed so that the data it contains can be used to generate mineral-resource maps. However, by the standard methods used-batch processing and off-line plotting-the production of a finished map commonly takes 2-3 weeks. To produce computer-generated maps more rapidly, cheaply, and easily, and also to provide an effective demonstration tool, we have devised two related methods for plotting maps as alternatives to conventional batch methods. These methods are: 1. Quick-Plot, an interactive program whose output appears on a CRT (cathode-ray-tube) device, and 2. The Interactive CAM (Cartographic Automatic Mapping system), which combines batch and interactive runs. The output of the Interactive CAM system is final compilation (not camera-ready) paper copy. Both methods are designed to use data from the CRIB file in conjunction with a map-plotting program. Quick-Plot retrieves a user-selected subset of data from the CRIB file, immediately produces an image of the desired area on a CRT device, and plots data points according to a limited set of user-selected symbols. This method is useful for immediate evaluation of the map and for demonstrating how trial maps can be made quickly. The Interactive CAM system links the output of an interactive CRIB retrieval to a modified version of the CAM program, which runs in the batch mode and stores plotting instructions on a disk, rather than on a tape. The disk can be accessed by a CRT, and, thus, the user can view and evaluate the map output on a CRT immediately after a batch run, without waiting 1-3 days for an off-line plot. The user can, therefore, do most of the layout and design work in a relatively short time by use of the CRT, before generating a plot tape and having the map plotted on an off-line plotter.

  20. Galaxy Interactions with FIRE: Mapping Star Formation

    NASA Astrophysics Data System (ADS)

    Moreno, Jorge

    2016-01-01

    We utilize a suite of 75 simulations of galaxies in idealised major mergers (stellar mass ratio ~2.5:1), with a wide range of orbital parameters, to investigate the spatial extent of interaction-induced star formation. Two versions are used, one based on a Kennicult-like subgrid model (Gadget, Springel & Hernquist 2003); the other based on the new Feedback In Realistic Environments model (FIRE, Hopkins et al. 2014). Although the total star formation in galaxy encounters is generally elevated relative to isolated galaxies, we find that this elevation is a combination of intense enhancements within the central kpc and moderately suppressed activity at large galacto-centric radii. This effect appears to be stronger in the older Gadget model. Suppression is the disk is also found in the FIRE runs, but at larger scales. This is because tidal torques are weaker in the newer FIRE model, leading to a more extended nuclear starburt. Our predictions of the radial dependence of triggered star formation, and specifically the suppression of star formation beyond kpc-scales, will be testable with the next generation of integral-field spectroscopic surveys.

  1. Interactive Web Interface to the Global Strain Rate Map Project

    NASA Astrophysics Data System (ADS)

    Meertens, C. M.; Estey, L.; Kreemer, C.; Holt, W.

    2004-05-01

    An interactive web interface allows users to explore the results of a global strain rate and velocity model and to compare them to other geophysical observations. The most recent model, an updated version of Kreemer et al., 2003, has 25 independent rigid plate-like regions separated by deformable boundaries covered by about 25,000 grid areas. A least-squares fit was made to 4900 geodetic velocities from 79 different geodetic studies. In addition, Quaternary fault slip rate data are used to infer geologic strain rate estimates (currently only for central Asia). Information about the style and direction of expected strain rate is inferred from the principal axes of the seismic strain rate field. The current model, as well as source data, references and an interactive map tool, are located at the International Lithosphere Program (ILP) "A Global Strain Rate Map (ILP II-8)" project website: http://www-world-strain-map.org. The purpose of the ILP GSRM project is to provide new information from this, and other investigations, that will contribute to a better understanding of continental dynamics and to the quantification of seismic hazards. A unique aspect of the GSRM interactive Java map tool is that the user can zoom in and make custom views of the model grid and results for any area of the globe selecting strain rate and style contour plots and principal axes, observed and model velocity fields in specified frames of reference, and geologic fault data. The results can be displayed with other data sets such Harvard CMT earthquake focal mechanisms, stress directions from the ILP World Stress Map Project, and topography. With the GSRM Java map tool, the user views custom maps generated by a Generic Mapping Tool (GMT) server. These interactive capabilities greatly extend what is possible to present in a published paper. A JavaScript version, using pre-constructed maps, as well as a related information site have also been created for broader education and outreach access

  2. Interactive Maps from the Great Basin Center for Geothermal Energy

    DOE Data Explorer

    The Great Basin Center for Geothermal Energy, part of the University of Nevada, Reno, conducts research towards the establishment of geothermal energy as an economically viable energy source within the Great Basin. The Center specializes in collecting and synthesizing geologic, geochemical, geodetic, geophysical, and tectonic data, and using Geographic Information System (GIS) technology to view and analyze this data and to produce favorability maps of geothermal potential. The interactive maps are built with layers of spatial data that are also available as direct file downloads (see DDE00299). The maps allow analysis of these many layers, with various data sets turned on or off, for determining potential areas that would be favorable for geothermal drilling or other activity. They provide information on current exploration projects and leases, Bureau of Land Management land status, and map presentation of each type of scientific spatial data: geothermal, geophysical, geologic, geodetic, groundwater, and geochemical.

  3. Tangent map analysis of the beam-beam interaction

    SciTech Connect

    Lee, S.Y.; Tepikian, S.

    1989-01-01

    We studied the tangent map of the beam-beam interaction and found no evidence of beam-beam instability for /epsilon/ = 0.04. Tracking study with tune modulation shows however large emittance growth due to the sum resonances. The emittance growth is due to the multiple crossing of the sum resonances. 12 refs., 7 figs.

  4. A Protein Interaction Map of the Kalimantacin Biosynthesis Assembly Line

    PubMed Central

    Uytterhoeven, Birgit; Lathouwers, Thomas; Voet, Marleen; Michiels, Chris W.; Lavigne, Rob

    2016-01-01

    The antimicrobial secondary metabolite kalimantacin (also called batumin) is produced by a hybrid polyketide/non-ribosomal peptide system in Pseudomonas fluorescens BCCM_ID9359. In this study, the kalimantacin biosynthesis gene cluster is analyzed by yeast two-hybrid analysis, creating a protein–protein interaction map of the entire assembly line. In total, 28 potential interactions were identified, of which 13 could be confirmed further. These interactions include the dimerization of ketosynthase domains, a link between assembly line modules 9 and 10, and a specific interaction between the trans-acting enoyl reductase BatK and the carrier proteins of modules 8 and 10. These interactions reveal fundamental insight into the biosynthesis of secondary metabolites. This study is the first to reveal interactions in a complete biosynthetic pathway. Similar future studies could build a strong basis for engineering strategies in such clusters. PMID:27853452

  5. Patterns of agent interaction scenarios as use case maps.

    PubMed

    Billard, Edward A

    2004-08-01

    A use case map (UCM) presents, in general, an abstract description of a complex system and, as such, is a good candidate for representing scenarios of autonomous agents interacting with other autonomous agents. The "gang of four" design patterns are intended for object-oriented software development but at least eight of the patterns illustrate structure, or architecture, that is appropriate for interacting agents, independent of software development. This study presents these particular patterns in the form of UCMs to describe abstract scenarios of agent interaction. Seven of the patterns attempt to balance the decentralized nature of interacting agents with an organized structure that makes for better, cleaner interactions. An example performance analysis is provided for one of the patterns, illustrating the benefit of an early abstraction of complex agent behavior. The original contribution here is a UCM presentation of the causal paths in agent behavior as suggested by software design patterns.

  6. Finding protein-protein interaction patterns by contact map matching.

    PubMed

    Melo, R C; Ribeiro, C; Murray, C S; Veloso, C J M; da Silveira, C H; Neshich, G; Meira, W; Carceroni, R L; Santoro, M M

    2007-10-05

    We propose a novel method for defining patterns of contacts present in protein-protein complexes. A new use of the traditional contact maps (more frequently used for representation of the intra-chain contacts) is presented for analysis of inter-chain contacts. Using an algorithm based on image processing techniques, we can compare protein-protein interaction maps and also obtain a dissimilarity score between them. The same algorithm used to compare the maps can align the contacts of all the complexes and be helpful in the determination of a pattern of conserved interactions at the interfaces. We present an example for the application of this method by analyzing the pattern of interaction of bovine pancreatic trypsin inhibitors and trypsins, chymotrypsins, a thrombin, a matriptase, and a kallikrein - all classified as serine proteases. We found 20 contacts conserved in trypsins and chymotrypsins and 3 specific ones are present in all the serine protease complexes studied. The method was able to identify important contacts for the protein family studied and the results are in agreement with the literature.

  7. Flow mapping and multivariate visualization of large spatial interaction data.

    PubMed

    Guo, Diansheng

    2009-01-01

    Spatial interactions (or flows), such as population migration and disease spread, naturally form a weighted location-to-location network (graph). Such geographically embedded networks (graphs) are usually very large. For example, the county-to-county migration data in the U.S. has thousands of counties and about a million migration paths. Moreover, many variables are associated with each flow, such as the number of migrants for different age groups, income levels, and occupations. It is a challenging task to visualize such data and discover network structures, multivariate relations, and their geographic patterns simultaneously. This paper addresses these challenges by developing an integrated interactive visualization framework that consists three coupled components: (1) a spatially constrained graph partitioning method that can construct a hierarchy of geographical regions (communities), where there are more flows or connections within regions than across regions; (2) a multivariate clustering and visualization method to detect and present multivariate patterns in the aggregated region-to-region flows; and (3) a highly interactive flow mapping component to map both flow and multivariate patterns in the geographic space, at different hierarchical levels. The proposed approach can process relatively large data sets and effectively discover and visualize major flow structures and multivariate relations at the same time. User interactions are supported to facilitate the understanding of both an overview and detailed patterns.

  8. Similarity interaction in information-theoretic self-organizing maps

    NASA Astrophysics Data System (ADS)

    Kamimura, Ryotaro

    2013-04-01

    In this paper, we propose a new information-theoretic computational method called 'similarity interaction' for improving visualization. Due to the fixed arrangement of neurons in the self-organizing maps, similarity between neurons is not necessarily a faithful representation of the actual similarity between neurons. To relax the fixed arrangement, we introduce a method called 'similarity interaction', because we integrate the information of connection weights into that of neurons. We applied our method to three problems, namely teaching assistant evaluation, automobile data, and dermatology data. In all three problems, we succeeded in demonstrating the better performance of our method through visual inspection and quantitative evaluation. Our method is the first step towards the interaction of multiple components in a neural network for finer representations of input patterns.

  9. Global Mapping of Human RNA-RNA Interactions.

    PubMed

    Sharma, Eesha; Sterne-Weiler, Tim; O'Hanlon, Dave; Blencowe, Benjamin J

    2016-05-19

    The majority of the human genome is transcribed into non-coding (nc)RNAs that lack known biological functions or else are only partially characterized. Numerous characterized ncRNAs function via base pairing with target RNA sequences to direct their biological activities, which include critical roles in RNA processing, modification, turnover, and translation. To define roles for ncRNAs, we have developed a method enabling the global-scale mapping of RNA-RNA duplexes crosslinked in vivo, "LIGation of interacting RNA followed by high-throughput sequencing" (LIGR-seq). Applying this method in human cells reveals a remarkable landscape of RNA-RNA interactions involving all major classes of ncRNA and mRNA. LIGR-seq data reveal unexpected interactions between small nucleolar (sno)RNAs and mRNAs, including those involving the orphan C/D box snoRNA, SNORD83B, that control steady-state levels of its target mRNAs. LIGR-seq thus represents a powerful approach for illuminating the functions of the myriad of uncharacterized RNAs that act via base-pairing interactions.

  10. Active Interaction Mapping Reveals the Hierarchical Organization of Autophagy.

    PubMed

    Kramer, Michael H; Farré, Jean-Claude; Mitra, Koyel; Yu, Michael Ku; Ono, Keiichiro; Demchak, Barry; Licon, Katherine; Flagg, Mitchell; Balakrishnan, Rama; Cherry, J Michael; Subramani, Suresh; Ideker, Trey

    2017-02-16

    We have developed a general progressive procedure, Active Interaction Mapping, to guide assembly of the hierarchy of functions encoding any biological system. Using this process, we assemble an ontology of functions comprising autophagy, a central recycling process implicated in numerous diseases. A first-generation model, built from existing gene networks in Saccharomyces, captures most known autophagy components in broad relation to vesicle transport, cell cycle, and stress response. Systematic analysis identifies synthetic-lethal interactions as most informative for further experiments; consequently, we saturate the model with 156,364 such measurements across autophagy-activating conditions. These targeted interactions provide more information about autophagy than all previous datasets, producing a second-generation ontology of 220 functions. Approximately half are previously unknown; we confirm roles for Gyp1 at the phagophore-assembly site, Atg24 in cargo engulfment, Atg26 in cytoplasm-to-vacuole targeting, and Ssd1, Did4, and others in selective and non-selective autophagy. The procedure and autophagy hierarchy are at http://atgo.ucsd.edu/.

  11. A genetic interaction map of cell cycle regulators

    PubMed Central

    Billmann, Maximilian; Horn, Thomas; Fischer, Bernd; Sandmann, Thomas; Huber, Wolfgang; Boutros, Michael

    2016-01-01

    Cell-based RNA interference (RNAi) is a powerful approach to screen for modulators of many cellular processes. However, resulting candidate gene lists from cell-based assays comprise diverse effectors, both direct and indirect, and further dissecting their functions can be challenging. Here we screened a genome-wide RNAi library for modulators of mitosis and cytokinesis in Drosophila S2 cells. The screen identified many previously known genes as well as modulators that have previously not been connected to cell cycle control. We then characterized ∼300 candidate modifiers further by genetic interaction analysis using double RNAi and a multiparametric, imaging-based assay. We found that analyzing cell cycle–relevant phenotypes increased the sensitivity for associating novel gene function. Genetic interaction maps based on mitotic index and nuclear size grouped candidates into known regulatory complexes of mitosis or cytokinesis, respectively, and predicted previously uncharacterized components of known processes. For example, we confirmed a role for the Drosophila CCR4 mRNA processing complex component l(2)NC136 during the mitotic exit. Our results show that the combination of genome-scale RNAi screening and genetic interaction analysis using process-directed phenotypes provides a powerful two-step approach to assigning components to specific pathways and complexes. PMID:26912791

  12. A Web-Based Interactive Mapping System of State Wide School Performance: Integrating Google Maps API Technology into Educational Achievement Data

    ERIC Educational Resources Information Center

    Wang, Kening; Mulvenon, Sean W.; Stegman, Charles; Anderson, Travis

    2008-01-01

    Google Maps API (Application Programming Interface), released in late June 2005 by Google, is an amazing technology that allows users to embed Google Maps in their own Web pages with JavaScript. Google Maps API has accelerated the development of new Google Maps based applications. This article reports a Web-based interactive mapping system…

  13. Targeting chk2 kinase: molecular interaction maps and therapeutic rationale.

    PubMed

    Pommier, Yves; Sordet, Olivier; Rao, V Ashutosh; Zhang, Hongliang; Kohn, Kurt W

    2005-01-01

    Most anticancer drugs presently used clinically target genomic DNA. The selectivity of these anticancer drugs for tumor tissues is probably due to tumor-specific defects suppressing cell cycle checkpoints and DNA repair, and enhancing apoptotic response in the tumor. We will review the molecular interactions within the ATM-Chk2 pathway implicating the DNA damage sensor kinases (ATM, ATR and DNA-PK), the adaptor BRCT proteins (Nbs1, Brca1, 53BP1, MDC1) and the effector kinases (Chk2, Chk1, Plk3, JNK, p38). The molecular interaction map convention (MIM) will be used for presenting this molecular network (http://discover.nci.nih.gov/mim/). A characteristic of the ATM-Chk2 pathway is its redundancy. First, ATM and Chk2 phosphorylate common substrates including p53, E2F1, BRCA1, and Chk2 itself, which suggests that Chk2 (also known as CHECK2, Cds1 in fission yeast, and Dmchk2 or Dmnk or Loki in the fruit fly) acts as a relay for ATM and/or as a salvage pathway when ATM is inactivated. Secondly, redundancy is apparent for the substrates, which can be phosphorylated/activated at similar residues by Chk2, Chk1, and the polo kinases (Plk's). Functionally, Chk2 can activate both apoptosis (via p53, E2F1 and PML) and cell cycle checkpoint (via Cdc25A and Cdc25C, p53, and BRCA1). We will review the short list of published Chk2 inhibitors. We will also propose a novel paradigm for screening interfacial inhibitors of Chk2. Chk2 inhibitors might be used to enhance the tumor selectivity of DNA targeted agents in p53-deficient tumors, and for the treatment of tumors whose growth depends on enhanced Chk2 activity.

  14. A global genetic interaction network maps a wiring diagram of cellular function.

    PubMed

    Costanzo, Michael; VanderSluis, Benjamin; Koch, Elizabeth N; Baryshnikova, Anastasia; Pons, Carles; Tan, Guihong; Wang, Wen; Usaj, Matej; Hanchard, Julia; Lee, Susan D; Pelechano, Vicent; Styles, Erin B; Billmann, Maximilian; van Leeuwen, Jolanda; van Dyk, Nydia; Lin, Zhen-Yuan; Kuzmin, Elena; Nelson, Justin; Piotrowski, Jeff S; Srikumar, Tharan; Bahr, Sondra; Chen, Yiqun; Deshpande, Raamesh; Kurat, Christoph F; Li, Sheena C; Li, Zhijian; Usaj, Mojca Mattiazzi; Okada, Hiroki; Pascoe, Natasha; San Luis, Bryan-Joseph; Sharifpoor, Sara; Shuteriqi, Emira; Simpkins, Scott W; Snider, Jamie; Suresh, Harsha Garadi; Tan, Yizhao; Zhu, Hongwei; Malod-Dognin, Noel; Janjic, Vuk; Przulj, Natasa; Troyanskaya, Olga G; Stagljar, Igor; Xia, Tian; Ohya, Yoshikazu; Gingras, Anne-Claude; Raught, Brian; Boutros, Michael; Steinmetz, Lars M; Moore, Claire L; Rosebrock, Adam P; Caudy, Amy A; Myers, Chad L; Andrews, Brenda; Boone, Charles

    2016-09-23

    We generated a global genetic interaction network for Saccharomyces cerevisiae, constructing more than 23 million double mutants, identifying about 550,000 negative and about 350,000 positive genetic interactions. This comprehensive network maps genetic interactions for essential gene pairs, highlighting essential genes as densely connected hubs. Genetic interaction profiles enabled assembly of a hierarchical model of cell function, including modules corresponding to protein complexes and pathways, biological processes, and cellular compartments. Negative interactions connected functionally related genes, mapped core bioprocesses, and identified pleiotropic genes, whereas positive interactions often mapped general regulatory connections among gene pairs, rather than shared functionality. The global network illustrates how coherent sets of genetic interactions connect protein complex and pathway modules to map a functional wiring diagram of the cell.

  15. Design Considerations for Computer-Based Interactive Map Display Systems

    DTIC Science & Technology

    1979-02-01

    REFERENCES 1. Lawrence, G.R.P. (ed.), Cartographic Methods, Methuen & Co., 1971. 2. Raisz , Erwin (ed.), Principles of Cartography, McGraw-Hill Book...classical cartography for map display designers are presented in Lawrence [lJ and Raisz [2]. A recent hook on maps which we found interesting, stimulating

  16. Chaotic scattering in solitary wave interactions: A singular iterated-map description

    SciTech Connect

    Goodman, Roy H.

    2008-06-15

    We derive a family of singular iterated maps--closely related to Poincare maps--that describe chaotic interactions between colliding solitary waves. The chaotic behavior of such solitary-wave collisions depends on the transfer of energy to a secondary mode of oscillation, often an internal mode of the pulse. This map allows us to go beyond previous analyses and to understand the interactions in the case when this mode is excited prior to the first collision. The map is derived using Melnikov integrals and matched asymptotic expansions and generalizes a ''multipulse'' Melnikov integral. It allows one to find not only multipulse heteroclinic orbits, but exotic periodic orbits. The maps exhibit singular behavior, including regions of infinite winding. These maps are shown to be singular versions of the conservative Ikeda map from laser physics and connections are made with problems from celestial mechanics and fluid mechanics.

  17. Chaotic scattering in solitary wave interactions: a singular iterated-map description.

    PubMed

    Goodman, Roy H

    2008-06-01

    We derive a family of singular iterated maps--closely related to Poincare maps--that describe chaotic interactions between colliding solitary waves. The chaotic behavior of such solitary-wave collisions depends on the transfer of energy to a secondary mode of oscillation, often an internal mode of the pulse. This map allows us to go beyond previous analyses and to understand the interactions in the case when this mode is excited prior to the first collision. The map is derived using Melnikov integrals and matched asymptotic expansions and generalizes a "multipulse" Melnikov integral. It allows one to find not only multipulse heteroclinic orbits, but exotic periodic orbits. The maps exhibit singular behavior, including regions of infinite winding. These maps are shown to be singular versions of the conservative Ikeda map from laser physics and connections are made with problems from celestial mechanics and fluid mechanics.

  18. Matrix model maps and reconstruction of AdS supergravity interactions

    SciTech Connect

    Cremonini, Sera; Mello Koch, Robert de; Jevicki, Antal

    2008-05-15

    We consider the question of reconstructing (cubic) SUGRA interactions in AdS/CFT. The method we introduce is based on the matrix model maps (MMP) which were previously successfully employed at the linearized level. The strategy is to start with the map for 1/2 BPS configurations, which is exactly known (to all orders) in the Hamiltonian framework. We then use the extension of the matrix model map with the corresponding Ward identities to completely specify the interaction. A central point in this construction is the nonvanishing of off-shell interactions (even for highest-weight states)

  19. Mapping Control and Affiliation in Teacher-Student Interaction with State Space Grids

    ERIC Educational Resources Information Center

    Mainhard, M. Tim; Pennings, Helena J. M.; Wubbels, Theo; Brekelmans, Mieke

    2012-01-01

    This paper explores how State Space Grids (SSG), a dynamic systems research method, can be used to map teacher-student interactions from moment-to-moment and thereby to incorporate temporal aspects of interaction. Interactions in two secondary school classrooms are described in terms of level of interpersonal control and affiliation, and of…

  20. CapsidMaps: protein-protein interaction pattern discovery platform for the structural analysis of virus capsids using Google Maps.

    PubMed

    Carrillo-Tripp, Mauricio; Montiel-García, Daniel Jorge; Brooks, Charles L; Reddy, Vijay S

    2015-04-01

    Structural analysis and visualization of protein-protein interactions is a challenging task since it is difficult to appreciate easily the extent of all contacts made by the residues forming the interfaces. In the case of viruses, structural analysis becomes even more demanding because several interfaces coexist and, in most cases, these are formed by hundreds of contacting residues that belong to multiple interacting coat proteins. CapsidMaps is an interactive analysis and visualization tool that is designed to benefit the structural virology community. Developed as an improved extension of the φ-ψ Explorer, here we describe the details of its design and implementation. We present results of analysis of a spherical virus to showcase the features and utility of the new tool. CapsidMaps also facilitates the comparison of quaternary interactions between two spherical virus particles by computing a similarity (S)-score. The tool can also be used to identify residues that are solvent exposed and in the process of locating antigenic epitope regions as well as residues forming the inside surface of the capsid that interact with the nucleic acid genome. CapsidMaps is part of the VIPERdb Science Gateway, and is freely available as a web-based and cross-browser compliant application at http://viperdb.scripps.edu.

  1. Shared-Screen Interaction: Engaging Groups in Map-Mediated Nonverbal Communication

    NASA Astrophysics Data System (ADS)

    Chorianopoulos, Konstantinos; Rieniets, Tim

    This chapter describes the design and development of an interactive video installation that allows participants to explore a map narrative, and engage in group interactions through a shared screen. For this purpose, several layers of cartographic information were employed in a computer application, which was programmed with motion-tracking libraries in the open source tool processing. The interactive video installation has been chosen as a medium to achieve the following aims: (1) The visualization of urban-conflict as an interactive map narrative, and (2) the encouragement of social encounters through a shared screen. The development process begins with the design of interaction between the system and the participants, as well as between the participants themselves. Then we map the interaction design concepts into multimedia and architectural design. Finally, we provide a discussion on the creative process and the collaboration between different disciplines, such as architecture, urban planning, cartography, computer engineering, and media studies.

  2. Interactive NCORP Map Details Community Research Sites | Division of Cancer Prevention

    Cancer.gov

    An interactive map of the NCI Community Oncology Research Program (NCORP) with detailed information on hundreds of community sites that take part in clinical trials is available on the NCORP website. NCORP Map NCORP Community Sites, Minority/Underserved Community Sites, and Research Bases |

  3. EPA Updates Flint Response Website with Interactive Map, Chlorine Sampling Results

    EPA Pesticide Factsheets

    FLINT, MICH. -- The U.S. Environmental Protection Agency is releasing preliminary water quality data about chlorine levels in Flint's drinking water, as well as an interactive map of sampling results in Flint. The map includes data from initial chlorine te

  4. A double-mutant collection targeting MAP kinase related genes in Arabidopsis for studying genetic interactions.

    PubMed

    Su, Shih-Heng; Krysan, Patrick J

    2016-12-01

    Mitogen-activated protein kinase cascades are conserved in all eukaryotes. In Arabidopsis thaliana there are approximately 80 genes encoding MAP kinase kinase kinases (MAP3K), 10 genes encoding MAP kinase kinases (MAP2K), and 20 genes encoding MAP kinases (MAPK). Reverse genetic analysis has failed to reveal abnormal phenotypes for a majority of these genes. One strategy for uncovering gene function when single-mutant lines do not produce an informative phenotype is to perform a systematic genetic interaction screen whereby double-mutants are created from a large library of single-mutant lines. Here we describe a new collection of 275 double-mutant lines derived from a library of single-mutants targeting genes related to MAP kinase signaling. To facilitate this study, we developed a high-throughput double-mutant generating pipeline using a system for growing Arabidopsis seedlings in 96-well plates. A quantitative root growth assay was used to screen for evidence of genetic interactions in this double-mutant collection. Our screen revealed four genetic interactions, all of which caused synthetic enhancement of the root growth defects observed in a MAP kinase 4 (MPK4) single-mutant line. Seeds for this double-mutant collection are publicly available through the Arabidopsis Biological Resource Center. Scientists interested in diverse biological processes can now screen this double-mutant collection under a wide range of growth conditions in order to search for additional genetic interactions that may provide new insights into MAP kinase signaling.

  5. Methods for Mapping of Interaction Networks Involving Membrane Proteins

    SciTech Connect

    Hooker, Brian S.; Bigelow, Diana J.; Lin, Chiann Tso

    2007-11-23

    Numerous approaches have been taken to study protein interactions, such as tagged protein complex isolation followed by mass spectrometry, yeast two-hybrid methods, fluorescence resonance energy transfer, surface plasmon resonance, site-directed mutagenesis, and crystallography. Membrane protein interactions pose significant challenges due to the need to solubilize membranes without disrupting protein-protein interactions. Traditionally, analysis of isolated protein complexes by high-resolution 2D gel electrophoresis has been the main method used to obtain an overall picture of proteome constituents and interactions. However, this method is time consuming, labor intensive, detects only abundant proteins and is not suitable for the coverage required to elucidate large interaction networks. In this review, we discuss the application of various methods to elucidate interactions involving membrane proteins. These techniques include methods for the direct isolation of single complexes or interactors as well as methods for characterization of entire subcellular and cellular interactomes.

  6. NATCARB Interactive Maps and the National Carbon Explorer: a National Look at Carbon Sequestration

    DOE Data Explorer

    NATCARB is a national look at carbon sequestration. The NATCARB home page, National Carbon Explorer (http://www.natcarb.org/) provides access to information and interactive maps on a national scale about climate change, DOE's carbon sequestration program and its partnerships, CO2 emissions, and sinks. This portal provides access to interactive maps based on the Carbon Sequestration Atlas of the United States and Canada.

  7. Mapping out atom-wall interaction with atomic clocks.

    PubMed

    Derevianko, A; Obreshkov, B; Dzuba, V A

    2009-09-25

    We explore the feasibility of probing atom-wall interaction with atomic clocks based on atoms trapped in engineered optical lattices. Optical lattice is normal to the wall. By monitoring the wall-induced clock shift at individual wells of the lattice, one would measure the dependence of the atom-wall interaction on the atom-wall separation. We find that the induced clock shifts are large and observable at already experimentally demonstrated levels of accuracy. We show that this scheme may uniquely probe the long-range atom-wall interaction in all three qualitatively distinct regimes of the interaction: van der Waals (image-charge interaction), Casimir-Polder (QED vacuum fluctuations), and Lifshitz (thermal-bath fluctuations) regimes.

  8. Mapping Out Atom-Wall Interaction with Atomic Clocks

    SciTech Connect

    Derevianko, A.; Obreshkov, B.; Dzuba, V. A.

    2009-09-25

    We explore the feasibility of probing atom-wall interaction with atomic clocks based on atoms trapped in engineered optical lattices. Optical lattice is normal to the wall. By monitoring the wall-induced clock shift at individual wells of the lattice, one would measure the dependence of the atom-wall interaction on the atom-wall separation. We find that the induced clock shifts are large and observable at already experimentally demonstrated levels of accuracy. We show that this scheme may uniquely probe the long-range atom-wall interaction in all three qualitatively distinct regimes of the interaction: van der Waals (image-charge interaction), Casimir-Polder (QED vacuum fluctuations), and Lifshitz (thermal-bath fluctuations) regimes.

  9. Interactive applications for sketch-based editable polycube map.

    PubMed

    Garcia, Ismael; Xia, Jiazhi; He, Ying; Xin, Shi-Qing; Patow, Gustavo

    2013-07-01

    In this paper, we propose a sketch-based editable polycube mapping method that, given a general mesh and a simple polycube that coarsely resembles the shape of the object, plus sketched features indicating relevant correspondences between the two, provides a uniform, regular, and user-controllable quads-only mesh that can be used as a basis structure for subdivision. Large scale models with complex geometry and topology can be processed efficiently with simple, intuitive operations. We show that the simple, intuitive nature of the polycube map is a substantial advantage from the point of view of the interface by demonstrating a series of applications, including kit-basing, shape morphing, painting over the parameterization domain, and GPU-friendly tessellated subdivision displacement, where the user is also able to control the number of patches in the base mesh by the construction of the base polycube.

  10. Reference Map Technique for Incompressible Fluid-Structure Interaction Problems

    NASA Astrophysics Data System (ADS)

    Rycroft, Chris; Wu, Chen-Hung; Yu, Yue; Kamrin, Ken

    2016-11-01

    We present a fully Eulerian approach to simulate soft structures immersed in an incompressible fluid. The flow is simulated on a fixed grid using a second order projection method to solve the incompressible Navier-Stokes equations, and the fluid-structure interfaces are modeled using the level set method. By introducing a reference map variable to model finite-deformation constitutive relations in the structure on the same grid as the fluid, the interfacial coupling is highly simplified. This fully Eulerian approach provides a computationally efficient alternative to moving mesh approaches. Example simulations featuring many-body contacts and flexible swimmers will be presented.

  11. Comparative mapping of host–pathogen protein–protein interactions

    PubMed Central

    Shah, Priya S.; Wojcechowskyj, Jason A.; Eckhardt, Manon; Krogan, Nevan J.

    2015-01-01

    Pathogens usurp a variety of host pathways via protein–protein interactions to ensure efficient pathogen replication. Despite the existence of an impressive toolkit of systematic and unbiased approaches, we still lack a comprehensive list of these PPIs and an understanding of their functional implications. Here, we highlight the importance of harnessing genetic diversity of hosts and pathogens for uncovering the biochemical basis of pathogen restriction, virulence, fitness, and pathogenesis. We further suggest that integrating physical interaction data with orthogonal types of data will allow researchers to draw meaningful conclusions both for basic and translational science. PMID:26275922

  12. Network Physiology: Mapping Interactions Between Networks of Physiologic Networks

    NASA Astrophysics Data System (ADS)

    Ivanov, Plamen Ch.; Bartsch, Ronny P.

    The human organism is an integrated network of interconnected and interacting organ systems, each representing a separate regulatory network. The behavior of one physiological system (network) may affect the dynamics of all other systems in the network of physiologic networks. Due to these interactions, failure of one system can trigger a cascade of failures throughout the entire network. We introduce a systematic method to identify a network of interactions between diverse physiologic organ systems, to quantify the hierarchical structure and dynamics of this network, and to track its evolution under different physiologic states. We find a robust relation between network structure and physiologic states: every state is characterized by specific network topology, node connectivity and links strength. Further, we find that transitions from one physiologic state to another trigger a markedly fast reorganization in the network of physiologic interactions on time scales of just a few minutes, indicating high network flexibility in response to perturbations. This reorganization in network topology occurs simultaneously and globally in the entire network as well as at the level of individual physiological systems, while preserving a hierarchical order in the strength of network links. Our findings highlight the need of an integrated network approach to understand physiologic function, since the framework we develop provides new information which can not be obtained by studying individual systems. The proposed system-wide integrative approach may facilitate the development of a new field, Network Physiology.

  13. Understanding Urban Watersheds through Digital Interactive Maps, San Francisco Bay Area, California

    NASA Astrophysics Data System (ADS)

    Sowers, J. M.; Ticci, M. G.; Mulvey, P.

    2014-12-01

    Dense urbanization has resulted in the "disappearance" of many local creeks in urbanized areas surrounding the San Francisco Bay. Long reaches of creeks now flow in underground pipes. Municipalities and water agencies trying to reduce non-point-source pollution are faced with a public that cannot see and therefore does not understand the interconnected nature of the drainage system or its ultimate discharge to the bay. Since 1993, we have collaborated with the Oakland Museum, the San Francisco Estuary Institute, public agencies, and municipalities to create creek and watershed maps to address the need for public understanding of watershed concepts. Fifteen paper maps are now published (www.museumca.org/creeks), which have become a standard reference for educators and anyone working on local creek-related issues. We now present digital interactive creek and watershed maps in Google Earth. Four maps are completed covering urbanized areas of Santa Clara and Alameda Counties. The maps provide a 3D visualization of the watersheds, with cartography draped over the landscape in transparent colors. Each mapped area includes both Present and Past (circa 1800s) layers which can be clicked on or off by the user. The Present layers include the modern drainage network, watershed boundaries, and reservoirs. The Past layers include the 1800s-era creek systems, tidal marshes, lagoons, and other habitats. All data are developed in ArcGIS software and converted to Google Earth format. To ensure the maps are interesting and engaging, clickable icons pop-up provide information on places to visit, restoration projects, history, plants, and animals. Maps of Santa Clara Valley are available at http://www.valleywater.org/WOW.aspx. Maps of western Alameda County will soon be available at http://acfloodcontrol.org/. Digital interactive maps provide several advantages over paper maps. They are seamless within each map area, and the user can zoom in or out, and tilt, and fly over to explore

  14. Stochastic interaction between neural activity and molecular cues in the formation of topographic maps

    PubMed Central

    Owens, Melinda T.; Feldheim, David A.; Stryker, Michael P.; Triplett, Jason W.

    2015-01-01

    SUMMARY Topographic maps in visual processing areas maintain the spatial order of the visual world. Molecular cues and neuronal activity both play critical roles in map formation, but their interaction remains unclear. Here, we demonstrate that when molecular- and activity-dependent cues are rendered nearly equal in force, they drive topographic mapping stochastically. The functional and anatomical representation of azimuth in the superior colliculus of heterozygous Islet2-EphA3 knock-in (Isl2EphA3/+) mice is variable: maps may be single, duplicated, or a combination of the two. This heterogeneity is not due to genetic differences, since map organizations in individual mutant animals often differ between colliculi. Disruption of spontaneous waves of retinal activity resulted in uniform map organization in Isl2EphA3/+ mice, demonstrating that correlated spontaneous activity is required for map heterogeneity. Computational modeling replicates this heterogeneity, revealing that molecular- and activity-dependent forces interact simultaneously and stochastically during topographic map formation. PMID:26402608

  15. Interacting damage models mapped onto ising and percolation models

    SciTech Connect

    Toussaint, Renaud; Pride, Steven R.

    2004-03-23

    The authors introduce a class of damage models on regular lattices with isotropic interactions between the broken cells of the lattice. Quasistatic fiber bundles are an example. The interactions are assumed to be weak, in the sense that the stress perturbation from a broken cell is much smaller than the mean stress in the system. The system starts intact with a surface-energy threshold required to break any cell sampled from an uncorrelated quenched-disorder distribution. The evolution of this heterogeneous system is ruled by Griffith's principle which states that a cell breaks when the release in potential (elastic) energy in the system exceeds the surface-energy barrier necessary to break the cell. By direct integration over all possible realizations of the quenched disorder, they obtain the probability distribution of each damage configuration at any level of the imposed external deformation. They demonstrate an isomorphism between the distributions so obtained and standard generalized Ising models, in which the coupling constants and effective temperature in the Ising model are functions of the nature of the quenched-disorder distribution and the extent of accumulated damage. In particular, they show that damage models with global load sharing are isomorphic to standard percolation theory, that damage models with local load sharing rule are isomorphic to the standard ising model, and draw consequences thereof for the universality class and behavior of the autocorrelation length of the breakdown transitions corresponding to these models. they also treat damage models having more general power-law interactions, and classify the breakdown process as a function of the power-law interaction exponent. Last, they also show that the probability distribution over configurations is a maximum of Shannon's entropy under some specific constraints related to the energetic balance of the fracture process, which firmly relates this type of quenched-disorder based damage model

  16. Interactive Web-based Access and Analysis Tools for the Western Climate Mapping Initiative (WestMap)

    NASA Astrophysics Data System (ADS)

    Comrie, A. C.; Redmond, K.; Glueck, M. F.; Reinbold, H.

    2006-12-01

    The Western Climate Mapping Consortium (WestMap) has developed a prototype web-based interactive access and resource interface to optimize public dissemination and usage of fine-scale spatial climate time series for the western United States. The western U.S. focus reflects the complex climate interactions and diverse geography that make resource management, policy considerations, and climate research challenging in this region. WestMap was conceived by a consortium comprised of the University of Arizona/CLIMAS, the Western Regional Climate Center (WRCC)/Desert Research Institute, and the PRISM group at Oregon State University, along with collaborators at Scripps Institute of Oceanography/California Applications Project, NOAA Climate Diagnostics Center, and the USDA Natural Resource Conservation Service. WestMap evolved in direct response to a multitude of requests to the WRCC and the RISAs from public and private stakeholder communities for lengthy time series of fine-scale spatial climate aggregated to user-specified domains, and related user-friendly web-based access and analysis tools. The WestMap interface is designed to link three stakeholder-driven components, 1) climate data development and operations (access, maintenance); 2) error assessment, data analysis, diagnostics, and related tools; and (3) data access, visualization, and educational resources. The 100-year PRISM 4km monthly temperature and precipitation series serve as the initial data archive, updating automatically once in operational mode. Operational user components are being designed to allow direct stakeholder access to user-specified data and resources most relevant to current needs in a timely manner. Requested resources currently in development and limited testing stages include clickable maps, regional aggregate capabilities, basic statistical analysis, time series visualization, error assessment, and download/print capability. Phased prototype testing, currently underway internally, will

  17. An Interactive Cluster Heat Map to Visualize and Explore Multidimensional Metabolomic Data

    PubMed Central

    Rinehart, Duane; Epstein, Adrian; Kurczy, Michael E.; Boska, Michael D.; Gendelman, Howard E.

    2014-01-01

    Heat maps are a commonly used visualization tool for metabolomic data where the relative abundance of ions detected in each sample is represented with color intensity. A limitation of applying heat maps to global metabolomic data, however, is the large number of ions that have to be displayed and the lack of information provided about important metabolomic parameters such as m/z and retention time. Here we address these challenges by introducing the interactive cluster heat map in the data-processing software XCMS Online. XCMS Online (xcmsonline.scripps.edu) is a cloud-based informatic platform designed to process, statistically evaluate, and visualize mass-spectrometry based metabolomic data. An interactive heat map is provided for all data processed by XCMS Online. The heat map is clickable, allowing users to zoom and explore specific metabolite metadata (EICs, Box-and-whisker plots, mass spectra) that are linked to the METLIN metabolite database. The utility of the XCMS interactive heat map is demonstrated on metabolomic data set generated from different anatomical regions of the mouse brain. PMID:26195918

  18. The FIRST experiment: interaction region and MAPS vertex detector

    NASA Astrophysics Data System (ADS)

    Spiriti, E.; de Napoli, M.; Romano, F.; FIRST Collaboration

    2011-06-01

    The improvement of the precision of the measurement of the nuclear cross-section, in order to fulfill the requirements of the actual Monte Carlo simulations for hadrontherapy and space radioprotection, is the main goal of the FIRST experiment. After a brief introduction on the treatment planning in hadrontherapy, this paper describes main characteristics and components of the experiment. The features of the interaction region detectors and their main needs (low material budget, high angular coverage, two tracks resolution and large trigger rate) are discussed. Special emphasis is devoted in discussing the new silicon pixel vertex detector, in particular its new developed data acquisition and its characterization with the first test results obtained with a prototype of the detector.

  19. Jules Verne Voyager, Jr: An Interactive Map Tool for Teaching Plate Tectonics

    NASA Astrophysics Data System (ADS)

    Hamburger, M. W.; Meertens, C. M.

    2010-12-01

    We present an interactive, web-based map utility that can make new geological and geophysical results accessible to a large number and variety of users. The tool provides a user-friendly interface that allows users to access a variety of maps, satellite images, and geophysical data at a range of spatial scales. The map tool, dubbed 'Jules Verne Voyager, Jr.', allows users to interactively create maps of a variety of study areas around the world. The utility was developed in collaboration with the UNAVCO Consortium for study of global-scale tectonic processes. Users can choose from a variety of base maps (including "Face of the Earth" and "Earth at Night" satellite imagery mosaics, global topography, geoid, sea-floor age, strain rate and seismic hazard maps, and others), add a number of geographic and geophysical overlays (coastlines, political boundaries, rivers and lakes, earthquake and volcano locations, stress axes, etc.), and then superimpose both observed and model velocity vectors representing a compilation of 2933 GPS geodetic measurements from around the world. A remarkable characteristic of the geodetic compilation is that users can select from some 21 plates' frames of reference, allowing a visual representation of both 'absolute' plate motion (in a no-net rotation reference frame) and relative motion along all of the world's plate boundaries. The tool allows users to zoom among at least three map scales. The map tool can be viewed at http://jules.unavco.org/VoyagerJr/Earth. A more detailed version of the map utility, developed in conjunction with the EarthScope initiative, focuses on North America geodynamics, and provides more detailed geophysical and geographic information for the United States, Canada, and Mexico. The ‘EarthScope Voyager’ can be accessed at http://jules.unavco.org/VoyagerJr/EarthScope. Because the system uses pre-constructed gif images and overlays, the system can rapidly create and display maps to a large number of users

  20. Interactome mapping for analysis of complex phenotypes: insights from benchmarking binary interaction assays.

    PubMed

    Braun, Pascal

    2012-05-01

    Protein interactions mediate essentially all biological processes and analysis of protein-protein interactions using both large-scale and small-scale approaches has contributed fundamental insights to the understanding of biological systems. In recent years, interactome network maps have emerged as an important tool for analyzing and interpreting genetic data of complex phenotypes. Complementary experimental approaches to test for binary, direct interactions, and for membership in protein complexes are used to explore the interactome. The two approaches are not redundant but yield orthogonal perspectives onto the complex network of physical interactions by which proteins mediate biological processes. In recent years, several publications have demonstrated that interactions from high-throughput experiments can be equally reliable as the high quality subset of interactions identified in small-scale studies. Critical for this insight was the introduction of standardized experimental benchmarking of interaction and validation assays using reference sets. The data obtained in these benchmarking experiments have resulted in greater appreciation of the limitations and the complementary strengths of different assays. Moreover, benchmarking is a central element of a conceptual framework to estimate interactome sizes and thereby measure progress toward near complete network maps. These estimates have revealed that current large-scale data sets, although often of high quality, cover only a small fraction of a given interactome. Here, I review the findings of assay benchmarking and discuss implications for quality control, and for strategies toward obtaining a near-complete map of the interactome of an organism.

  1. Perceived usefulness, perceived ease of use, and perceived enjoyment as drivers for the user acceptance of interactive mobile maps

    NASA Astrophysics Data System (ADS)

    Hussain, Azham; Mkpojiogu, Emmanuel O. C.; Yusof, Muhammad Mat

    2016-08-01

    This study examines the user perception of usefulness, ease of use and enjoyment as drivers for the users' complex interaction with map on mobile devices. TAM model was used to evaluate users' intention to use and their acceptance of interactive mobile map using the above three beliefs as antecedents. Quantitative research (survey) methodology was employed and the analysis and findings showed that all the three explanatory variables used in this study, explain the variability in the user acceptance of interactive mobile map technology. Perceived usefulness, perceived ease of use, and perceived enjoyment each have significant positive influence on user acceptance of interactive mobile maps. This study further validates the TAM model.

  2. An Interactive Immersive Serious Game Application for Kunyu Quantu World Map

    NASA Astrophysics Data System (ADS)

    Peng, S.-T.; Hsu, S.-Y.; Hsieh, K.-C.

    2015-08-01

    In recent years, more and more digital technologies and innovative concepts are applied on museum education. One of the concepts applied is "Serious game." Serious game is not designed for entertainment purpose but allows users to learn real world's cultural and educational knowledge in the virtual world through game-experiencing. Technologies applied on serious game are identical to those applied on entertainment game. Nowadays, the interactive technology applications considering users' movement and gestures in physical spaces are developing rapidly, which are extensively used in entertainment games, such as Kinect-based games. The ability to explore space via Kinect-based games can be incorporated into the design of serious game. The ancient world map, Kunyu Quantu, from the collection of the National Palace Museum is therefore applied in serious game development. In general, the ancient world map does not only provide geological information, but also contains museum knowledge. This particular ancient world map is an excellent content applied in games as teaching material. In the 17th century, it was first used by a missionary as a medium to teach the Kangxi Emperor of the latest geologic and scientific spirits from the West. On this map, it also includes written biological knowledge and climate knowledge. Therefore, this research aims to present the design of the interactive and immersive serious game based installation that developed from the rich content of the Kunyu Quantu World Map, and to analyse visitor's experience in terms of real world's cultural knowledge learning and interactive responses.

  3. Inclusive Composite Interval Mapping of QTL by Environment Interactions in Biparental Populations.

    PubMed

    Li, Shanshan; Wang, Jiankang; Zhang, Luyan

    2015-01-01

    Identification of environment-specific QTL and stable QTL having consistent genetic effects across a wide range of environments is of great importance in plant breeding. Inclusive Composite Interval Mapping (ICIM) has been proposed for additive, dominant and epistatic QTL mapping in biparental populations for single environment. In this study, ICIM was extended to QTL by environment interaction (QEI) mapping for multi-environmental trials, where the QTL average effect and QEI effects could be properly estimated. Stepwise regression was firstly applied in each environment to identify the most significant marker variables which were then used to adjust the phenotypic values. One-dimensional scanning was then conducted on the adjusted phenotypic values across the environments in order to detect QTL with either average effect or QEI effects, or both average effect and QEI effects. In this way, the genetic background could be well controlled while the conventional interval mapping was applied. An empirical method to determine the threshold of logarithm of odds was developed, and the efficiency of the ICIM QEI mapping was demonstrated in simulated populations under different genetic models. One actual recombinant inbred line population was used to compare mapping results between QEI mapping and single-environment analysis.

  4. High Quality Binary Protein Interaction Map of the Yeast Interactome Network

    PubMed Central

    Yu, Haiyuan; Braun, Pascal; Yildirim, Muhammed A.; Lemmens, Irma; Venkatesan, Kavitha; Sahalie, Julie; Hirozane-Kishikawa, Tomoko; Gebreab, Fana; Li, Na; Simonis, Nicolas; Hao, Tong; Rual, Jean-Franćois; Dricot, Amélie; Vazquez, Alexei; Murray, Ryan R.; Simon, Christophe; Tardivo, Leah; Tam, Stanley; Svrzikapa, Nenad; Fan, Changyu; de Smet, Anne-Sophie; Motyl, Adriana; Hudson, Michael E.; Park, Juyong; Xin, Xiaofeng; Cusick, Michael E.; Moore, Troy; Boone, Charlie; Snyder, Michael; Roth, Frederick P.; Barabási, Albert-László; Tavernier, Jan; Hill, David E.; Vidal, Marc

    2009-01-01

    Current yeast interactome network maps contain several hundred molecular complexes with limited and somewhat controversial representation of direct binary interactions. We carried out a comparative quality assessment of current yeast interactome datasets, demonstrating that high-throughput yeast two-hybrid (Y2H) provides high-quality binary interaction information. As a large fraction of the yeast binary interactome remains to be mapped, we developed an empirically-controlled mapping framework to produce a “second-generation” high-quality high-throughput Y2H dataset covering ~20% of all yeast binary interactions. Both Y2H and affinity-purification followed by mass spectrometry (AP/MS) data are of equally high quality but of a fundamentally different and complementary nature resulting in networks with different topological and biological properties. Compared to co-complex interactome models, this binary map is enriched for transient signaling interactions and inter-complex connections with a highly significant clustering between essential proteins. Rather than correlating with essentiality, protein connectivity correlates with genetic pleiotropy. PMID:18719252

  5. RE Atlas: The U.S. Atlas of Renewable Resources (Interactive Map, GIS Data)

    DOE Data Explorer

    This interactive data map allows a user to explore the locations across the U.S. of many different basic, renewable energy resources. The many layers can be activated one at a time or in multiple combinations and the GIS display draws from a rich combination of data collections.

  6. Teacher Use of the Interactive Whiteboards in Flemish Secondary Education--Mapping against a Transition Framework

    ERIC Educational Resources Information Center

    Van Laer, Stijn; Beauchamp, Gary; Colpaert, Jozef

    2014-01-01

    Interactive Whiteboards (IWBs) are a relatively new, but increasingly more common, tool in the classrooms of Flemish Secondary schools. This paper reports on research which attempted to map not only the amount of IWB use in Flemish secondary schools but, perhaps more importantly, to assess how they are used and the progress of teachers in…

  7. On the Mapping of Epistatic Genetic Interactions in Natural Isolates: Combining Classical Genetics and Genomics.

    PubMed

    Hou, Jing; Schacherer, Joseph

    2016-01-01

    Genetic variation within species is the substrate of evolution. Epistasis, which designates the non-additive interaction between loci affecting a specific phenotype, could be one of the possible outcomes of genetic diversity. Dissecting the basis of such interactions is of current interest in different fields of biology, from exploring the gene regulatory network, to complex disease genetics, to the onset of reproductive isolation and speciation. We present here a general workflow to identify epistatic interactions between independently evolving loci in natural populations of the yeast Saccharomyces cerevisiae. The idea is to exploit the genetic diversity present in the species by evaluating a large number of crosses and analyzing the phenotypic distribution in the offspring. For a cross of interest, both parental strains would have a similar phenotypic value, whereas the resulting offspring would have a bimodal distribution of the phenotype, possibly indicating the presence of epistasis. Classical segregation analysis of the tetrads uncovers the penetrance and complexity of the interaction. In addition, this segregation could serve as the guidelines for choosing appropriate mapping strategies to narrow down the genomic regions involved. Depending on the segregation patterns observed, we propose different mapping strategies based on bulk segregant analysis or consecutive backcrosses followed by high-throughput genome sequencing. Our method is generally applicable to all systems with a haplodiplobiontic life cycle and allows high resolution mapping of interacting loci that govern various DNA polymorphisms from single nucleotide mutations to large-scale structural variations.

  8. Web Mapping for Promoting Interaction and Collaboration in Community Land Planning

    NASA Astrophysics Data System (ADS)

    Veenendaal, B.; Dhliwayo, M.

    2013-10-01

    There is an inherent advantage of geographic information Systems (GIS) and mapping in facilitating dialogue between experts and non-experts during land use plan development. Combining visual mapping information and effective user interaction can result in considerable benefits for developing countries like Botswana. Although the adoption of information and communication technologies has lagged behind that for developed countries, initiatives by the Botswana government in providing suitable information infrastructures, including internet and web based communications, are enabling multiple users to interact and collaborate in community land planning. A web mapping application was developed for the Maun Development Plan (MDP) in the Okavango Delta region in Botswana. It was designed according to requirements of land planners and managers and implemented using ArcGIS Viewer for Flex. Land planners and managers from two organisations in Maun involved in the development of the MDP were asked to evaluate the web mapping tools. This paper describes the results of implementation and some preliminary results of the web mapping evaluation.

  9. A Prototype Interactive Mapping Tool to Target Low Health Literacy in Missouri.

    PubMed

    Martin, Laurie T; Fremont, Allen; Felton, Alexandria; Ruder, Teague; Bird, Chloe E; Miyashiro, Lisa; Hanson, Mark; Lurie, Nicole

    2011-01-01

    An estimated 36 percent of American adults have health literacy levels rated at "basic or below," indicating that they have difficulty obtaining, processing, and understanding basic health information and services. To help healthcare decisionmakers in Missouri identify neighborhood-level "hotspots" of suboptimal health or healthcare that may be due to low health literacy, RAND developed a prototype interactive web-based mapping tool. This builds on earlier RAND work to develop a predictive model of health literacy and estimate levels of health literacy in small geographic areas (e.g., census tracts). The interactive mapping tool allows stakeholders to select the level of geography (e.g., census tract, county), obtain information for and map specific regions of interest, select the characteristics to be mapped (i.e., estimates of community-level health literacy, health outcomes and care quality, neighborhood sociodemographic characteristics, and neighborhood health services data), and generate tables and reports on the regions and characteristics of interest. Housed on a dedicated RAND website (http://www.rand.org/health/projects/missouri-health-literacy.html), the mapping tool makes it possible for a range of stakeholders, from health plans to community organizations, to access and use the tool to help address healthcare disparities in their communities.

  10. GIS-based interactive tool to map the advent of world conquerors

    NASA Astrophysics Data System (ADS)

    Lakkaraju, Mahesh

    The objective of this thesis is to show the scale and extent of some of the greatest empires the world has ever seen. This is a hybrid project between the GIS based interactive tool and the web-based JavaScript tool. This approach lets the students learn effectively about the emperors themselves while understanding how long and far their empires spread. In the GIS based tool, a map is displayed with various points on it, and when a user clicks on one point, the relevant information of what happened at that particular place is displayed. Apart from this information, users can also select the interactive animation button and can walk through a set of battles in chronological order. As mentioned, this uses Java as the main programming language, and MOJO (Map Objects Java Objects) provided by ESRI. MOJO is very effective as its GIS related features can be included in the application itself. This app. is a simple tool and has been developed for university or high school level students. D3.js is an interactive animation and visualization platform built on the Javascript framework. Though HTML5, CSS3, Javascript and SVG animations can be used to derive custom animations, this tool can help bring out results with less effort and more ease of use. Hence, it has become the most sought after visualization tool for multiple applications. D3.js has provided a map-based visualization feature so that we can easily display text-based data in a map-based interface. To draw the map and the points on it, D3.js uses data rendered in TOPO JSON format. The latitudes and longitudes can be provided, which are interpolated into the Map svg. One of the main advantages of doing it this way is that more information is retained when we use a visual medium.

  11. Capturing nonlocal interaction effects in the Hubbard model: Optimal mappings and limits of applicability

    NASA Astrophysics Data System (ADS)

    van Loon, E. G. C. P.; Schüler, M.; Katsnelson, M. I.; Wehling, T. O.

    2016-10-01

    We investigate the Peierls-Feynman-Bogoliubov variational principle to map Hubbard models with nonlocal interactions to effective models with only local interactions. We study the renormalization of the local interaction induced by nearest-neighbor interaction and assess the quality of the effective Hubbard models in reproducing observables of the corresponding extended Hubbard models. We compare the renormalization of the local interactions as obtained from numerically exact determinant quantum Monte Carlo to approximate but more generally applicable calculations using dual boson, dynamical mean field theory, and the random phase approximation. These more approximate approaches are crucial for any application with real materials in mind. Furthermore, we use the dual boson method to calculate observables of the extended Hubbard models directly and benchmark these against determinant quantum Monte Carlo simulations of the effective Hubbard model.

  12. Mapping of the regions involved in self-interaction of rice stripe virus P3 protein.

    PubMed

    Zhao, S L; Hao, J H; Xue, Y N; Liang, C Y

    2016-03-01

    Rice stripe virus (RSV) protein P3 is a suppressor of RNA silencing in plants. P3 has been shown by biomolecular fluorescence complementation assay to self-interact in planta but the regions responsible for homotypic interaction have not been determined. Here we analyzed the domains for the self-interaction of P3 by using yeast two-hybrid, co-immunoprecipitation and fluorescence experiments. The results showed that P3 was also able to interact with itself in yeast and insect cells. The domain responsible for P3-P3 interaction was mapped to amino acids 15-30 at the N-terminal region of P3. Furthermore, subcellular localization suggested that the homo-oligomerization was the prerequisite for P3 to form larger protein aggregates in the nucleus of insect cell.

  13. Genome-wide maps of nuclear lamina interactions in single human cells

    PubMed Central

    Kind, Jop; Pagie, Ludo; de Vries, Sandra S.; Nahidiazar, Leila; Dey, Siddharth S.; Bienko, Magda; Zhan, Ye; Lajoie, Bryan; de Graaf, Carolyn A.; Amendola, Mario; Fudenberg, Geoffrey; Imakaev, Maxim; Mirny, Leonid A.; Jalink, Kees; Dekker, Job; van Oudenaarden, Alexander; van Steensel, Bas

    2015-01-01

    Summary Mammalian interphase chromosomes interact with the nuclear lamina (NL) through hundreds of large Lamina Associated Domains (LADs). We report a method to map NL contacts genome-wide in single human cells. Analysis of nearly 400 maps reveals a core architecture of gene-poor LADs that contact the NL with high cell-to-cell consistency, interspersed by LADs with more variable NL interactions. The variable contacts tend to be cell-type specific and are more sensitive to changes in genome ploidy than the consistent contacts. Single-cell maps indicate that NL contacts involve multivalent interactions over hundreds of kilobases. Moreover, we observe extensive intra-chromosomal coordination of NL contacts, even over tens of megabases. Such coordinated loci exhibit preferential interactions as detected by Hi-C. Finally, consistency of NL contacts is inversely linked to gene activity in single cells, and correlates positively with the heterochromatic histone modification H3K9me3. These results highlight fundamental principles of single cell chromatin organization. PMID:26365489

  14. Genome-wide map of regulatory interactions in the human genome

    PubMed Central

    Heidari, Nastaran; Phanstiel, Douglas H.; He, Chao; Grubert, Fabian; Jahanbani, Fereshteh; Kasowski, Maya; Zhang, Michael Q.

    2014-01-01

    Increasing evidence suggests that interactions between regulatory genomic elements play an important role in regulating gene expression. We generated a genome-wide interaction map of regulatory elements in human cells (ENCODE tier 1 cells, K562, GM12878) using Chromatin Interaction Analysis by Paired-End Tag sequencing (ChIA-PET) experiments targeting six broadly distributed factors. Bound regions covered 80% of DNase I hypersensitive sites including 99.7% of TSS and 98% of enhancers. Correlating this map with ChIP-seq and RNA-seq data sets revealed cohesin, CTCF, and ZNF143 as key components of three-dimensional chromatin structure and revealed how the distal chromatin state affects gene transcription. Comparison of interactions between cell types revealed that enhancer–promoter interactions were highly cell-type-specific. Construction and comparison of distal and proximal regulatory networks revealed stark differences in structure and biological function. Proximal binding events are enriched at genes with housekeeping functions, while distal binding events interact with genes involved in dynamic biological processes including response to stimulus. This study reveals new mechanistic and functional insights into regulatory region organization in the nucleus. PMID:25228660

  15. Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map.

    PubMed

    Collins, Sean R; Miller, Kyle M; Maas, Nancy L; Roguev, Assen; Fillingham, Jeffrey; Chu, Clement S; Schuldiner, Maya; Gebbia, Marinella; Recht, Judith; Shales, Michael; Ding, Huiming; Xu, Hong; Han, Junhong; Ingvarsdottir, Kristin; Cheng, Benjamin; Andrews, Brenda; Boone, Charles; Berger, Shelley L; Hieter, Phil; Zhang, Zhiguo; Brown, Grant W; Ingles, C James; Emili, Andrew; Allis, C David; Toczyski, David P; Weissman, Jonathan S; Greenblatt, Jack F; Krogan, Nevan J

    2007-04-12

    Defining the functional relationships between proteins is critical for understanding virtually all aspects of cell biology. Large-scale identification of protein complexes has provided one important step towards this goal; however, even knowledge of the stoichiometry, affinity and lifetime of every protein-protein interaction would not reveal the functional relationships between and within such complexes. Genetic interactions can provide functional information that is largely invisible to protein-protein interaction data sets. Here we present an epistatic miniarray profile (E-MAP) consisting of quantitative pairwise measurements of the genetic interactions between 743 Saccharomyces cerevisiae genes involved in various aspects of chromosome biology (including DNA replication/repair, chromatid segregation and transcriptional regulation). This E-MAP reveals that physical interactions fall into two well-represented classes distinguished by whether or not the individual proteins act coherently to carry out a common function. Thus, genetic interaction data make it possible to dissect functionally multi-protein complexes, including Mediator, and to organize distinct protein complexes into pathways. In one pathway defined here, we show that Rtt109 is the founding member of a novel class of histone acetyltransferases responsible for Asf1-dependent acetylation of histone H3 on lysine 56. This modification, in turn, enables a ubiquitin ligase complex containing the cullin Rtt101 to ensure genomic integrity during DNA replication.

  16. Web GIS in practice VIII: HTML5 and the canvas element for interactive online mapping

    PubMed Central

    2010-01-01

    HTML5 is being developed as the next major revision of HTML (Hypertext Markup Language), the core markup language of the World Wide Web. It aims at reducing the need for proprietary, plug-in-based rich Internet application (RIA) technologies such as Adobe Flash. The canvas element is part of HTML5 and is used to draw graphics using scripting (e.g., JavaScript). This paper introduces Cartagen, an open-source, vector-based, client-side framework for rendering plug-in-free, offline-capable, interactive maps in native HTML5 on a wide range of Web browsers and mobile phones. Cartagen was developed at MIT Media Lab's Design Ecology group. Potential applications of the technology as an enabler for participatory online mapping include mapping real-time air pollution, citizen reporting, and disaster response, among many other possibilities. PMID:20199681

  17. Web GIS in practice VIII: HTML5 and the canvas element for interactive online mapping.

    PubMed

    Boulos, Maged N Kamel; Warren, Jeffrey; Gong, Jianya; Yue, Peng

    2010-03-03

    HTML5 is being developed as the next major revision of HTML (Hypertext Markup Language), the core markup language of the World Wide Web. It aims at reducing the need for proprietary, plug-in-based rich Internet application (RIA) technologies such as Adobe Flash. The canvas element is part of HTML5 and is used to draw graphics using scripting (e.g., JavaScript). This paper introduces Cartagen, an open-source, vector-based, client-side framework for rendering plug-in-free, offline-capable, interactive maps in native HTML5 on a wide range of Web browsers and mobile phones. Cartagen was developed at MIT Media Lab's Design Ecology group. Potential applications of the technology as an enabler for participatory online mapping include mapping real-time air pollution, citizen reporting, and disaster response, among many other possibilities.

  18. Development of a novel 2D color map for interactive segmentation of histological images

    PubMed Central

    Chaudry, Qaiser; Sharma, Yachna; Raza, Syed H.; Wang, May D.

    2016-01-01

    We present a color segmentation approach based on a two-dimensional color map derived from the input image. Pathologists stain tissue biopsies with various colored dyes to see the expression of biomarkers. In these images, because of color variation due to inconsistencies in experimental procedures and lighting conditions, the segmentation used to analyze biological features is usually ad-hoc. Many algorithms like K-means use a single metric to segment the image into different color classes and rarely provide users with powerful color control. Our 2D color map interactive segmentation technique based on human color perception information and the color distribution of the input image, enables user control without noticeable delay. Our methodology works for different staining types and different types of cancer tissue images. Our proposed method’s results show good accuracy with low response and computational time making it a feasible method for user interactive applications involving segmentation of histological images.

  19. Carbene footprinting accurately maps binding sites in protein–ligand and protein–protein interactions

    PubMed Central

    Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

    2016-01-01

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation. PMID:27848959

  20. Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions.

    PubMed

    Manzi, Lucio; Barrow, Andrew S; Scott, Daniel; Layfield, Robert; Wright, Timothy G; Moses, John E; Oldham, Neil J

    2016-11-16

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

  1. Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions

    NASA Astrophysics Data System (ADS)

    Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

    2016-11-01

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

  2. Quantitative Chemical-Genetic Interaction Map Connects Gene Alterations to Drug Responses | Office of Cancer Genomics

    Cancer.gov

    In a recent Cancer Discovery report, CTD2 researchers at the University of California in San Francisco developed a new quantitative chemical-genetic interaction mapping approach to evaluate drug sensitivity or resistance in isogenic cell lines. Performing a high-throughput screen with isogenic cell lines allowed the researchers to explore the impact of a panel of emerging and established drugs on cells overexpressing a single cancer-associated gene in isolation.

  3. A Rice Kinase-Protein Interaction Map1[W][OA

    PubMed Central

    Ding, Xiaodong; Richter, Todd; Chen, Mei; Fujii, Hiroaki; Seo, Young Su; Xie, Mingtang; Zheng, Xianwu; Kanrar, Siddhartha; Stevenson, Rebecca A.; Dardick, Christopher; Li, Ying; Jiang, Hao; Zhang, Yan; Yu, Fahong; Bartley, Laura E.; Chern, Mawsheng; Bart, Rebecca; Chen, Xiuhua; Zhu, Lihuang; Farmerie, William G.; Gribskov, Michael; Zhu, Jian-Kang; Fromm, Michael E.; Ronald, Pamela C.; Song, Wen-Yuan

    2009-01-01

    Plants uniquely contain large numbers of protein kinases, and for the vast majority of the 1,429 kinases predicted in the rice (Oryza sativa) genome, little is known of their functions. Genetic approaches often fail to produce observable phenotypes; thus, new strategies are needed to delineate kinase function. We previously developed a cost-effective high-throughput yeast two-hybrid system. Using this system, we have generated a protein interaction map of 116 representative rice kinases and 254 of their interacting proteins. Overall, the resulting interaction map supports a large number of known or predicted kinase-protein interactions from both plants and animals and reveals many new functional insights. Notably, we found a potential widespread role for E3 ubiquitin ligases in pathogen defense signaling mediated by receptor-like kinases, particularly by the kinases that may have evolved from recently expanded kinase subfamilies in rice. We anticipate that the data provided here will serve as a foundation for targeted functional studies in rice and other plants. The application of yeast two-hybrid and TAPtag analyses for large-scale plant protein interaction studies is also discussed. PMID:19109415

  4. Mapping of Protein–Protein Interaction Sites by the ‘Absence of Interference’ Approach

    PubMed Central

    Dhayalan, Arunkumar; Jurkowski, Tomasz P.; Laser, Heike; Reinhardt, Richard; Jia, Da; Cheng, Xiaodong; Jeltsch, Albert

    2008-01-01

    Protein–protein interactions are critical to most biological processes, and locating protein–protein interfaces on protein structures is an important task in molecular biology. We developed a new experimental strategy called the ‘absence of interference’ approach to determine surface residues involved in protein–protein interaction of established yeast two-hybrid pairs of interacting proteins. One of the proteins is subjected to high-level randomization by error-prone PCR. The resulting library is selected by yeast two-hybrid system for interacting clones that are isolated and sequenced. The interaction region can be identified by an absence or depletion of mutations. For data analysis and presentation, we developed a Web interface that analyzes the mutational spectrum and displays the mutational frequency on the surface of the structure (or a structural model) of the randomized protein†. Additionally, this interface might be of use for the display of mutational distributions determined by other types of random mutagenesis experiments. We applied the approach to map the interface of the catalytic domain of the DNA methyltransferase Dnmt3a with its regulatory factor Dnmt3L. Dnmt3a was randomized with high mutational load. A total of 76 interacting clones were isolated and sequenced, and 648 mutations were identified. The mutational pattern allowed to identify a unique interaction region on the surface of Dnmt3a, which comprises about 500−600 Å2. The results were confirmed by site-directed mutagenesis and structural analysis. The absence-of-interference approach will allow high-throughput mapping of protein interaction sites suitable for functional studies and protein docking. PMID:18191145

  5. Systematic Mapping of RNA-Chromatin Interactions In Vivo.

    PubMed

    Sridhar, Bharat; Rivas-Astroza, Marcelo; Nguyen, Tri C; Chen, Weizhong; Yan, Zhangming; Cao, Xiaoyi; Hebert, Lucie; Zhong, Sheng

    2017-02-20

    RNA molecules can attach to chromatin. It remains difficult to know what RNAs are associated with chromatin and where the genomic target loci of these RNAs are. Here, we present MARGI (mapping RNA-genome interactions), a technology to massively reveal native RNA-chromatin interactions from unperturbed cells. The gist of this technology is to ligate chromatin-associated RNAs (caRNAs) with their target genomic sequences by proximity ligation, forming RNA-DNA chimeric sequences, which are converted to a sequencing library for paired-end sequencing. Using MARGI, we produced RNA-genome interaction maps for human embryonic stem cells (ESCs) and human embryonic kidney (HEK) cells. MARGI revealed hundreds of caRNAs, including previously known XIST, SNHG1, NEAT1, and MALAT1, as well as each caRNA's genomic interaction loci. Using a cross-species experiment, we estimated that approximately 2.2% of MARGI-identified interactions were false positives. In ESCs and HEK cells, the RNA ends of more than 5% of MARGI read pairs were mapped to distal or inter-chromosomal locations as compared to the locations of their corresponding DNA ends. The majority of transcription start sites are associated with distal or inter-chromosomal caRNAs. Chromatin-immunoprecipitation-sequencing (ChIP-seq)-reported H3K27ac and H3K4me3 levels are positively correlated, while H3K9me3 is negatively correlated, with MARGI-reported RNA attachment levels. The MARGI technology should facilitate revealing novel RNA functions and their genomic target regions.

  6. iMAR: An Interactive Web-Based Application for Mapping Herbicide Resistant Weeds.

    PubMed

    Panozzo, Silvia; Colauzzi, Michele; Scarabel, Laura; Collavo, Alberto; Rosan, Valentina; Sattin, Maurizio

    2015-01-01

    Herbicides are the major weed control tool in most cropping systems worldwide. However, the high reliance on herbicides has led to environmental issues as well as to the evolution of herbicide-resistant biotypes. Resistance is a major concern in modern agriculture and early detection of resistant biotypes is therefore crucial for its management and prevention. In this context, a timely update of resistance biotypes distribution is fundamental to devise and implement efficient resistance management strategies. Here we present an innovative web-based application called iMAR (interactive MApping of Resistance) for the mapping of herbicide resistant biotypes. It is based on open source software tools and translates into maps the data reported in the GIRE (Italian herbicide resistance working group) database of herbicide resistance at national level. iMAR allows an automatic, easy and cost-effective updating of the maps a nd provides two different systems, "static" and "dynamic". In the first one, the user choices are guided by a hierarchical tree menu, whereas the latter is more flexible and includes a multiple choice criteria (type of resistance, weed species, region, cropping systems) that permits customized maps to be created. The generated information can be useful to various stakeholders who are involved in weed resistance management: farmers, advisors, national and local decision makers as well as the agrochemical industry. iMAR is freely available, and the system has the potential to handle large datasets and to be used for other purposes with geographical implications, such as the mapping of invasive plants or pests.

  7. iMAR: An Interactive Web-Based Application for Mapping Herbicide Resistant Weeds

    PubMed Central

    Panozzo, Silvia; Colauzzi, Michele; Scarabel, Laura; Collavo, Alberto; Rosan, Valentina; Sattin, Maurizio

    2015-01-01

    Herbicides are the major weed control tool in most cropping systems worldwide. However, the high reliance on herbicides has led to environmental issues as well as to the evolution of herbicide-resistant biotypes. Resistance is a major concern in modern agriculture and early detection of resistant biotypes is therefore crucial for its management and prevention. In this context, a timely update of resistance biotypes distribution is fundamental to devise and implement efficient resistance management strategies. Here we present an innovative web-based application called iMAR (interactive MApping of Resistance) for the mapping of herbicide resistant biotypes. It is based on open source software tools and translates into maps the data reported in the GIRE (Italian herbicide resistance working group) database of herbicide resistance at national level. iMAR allows an automatic, easy and cost-effective updating of the maps a nd provides two different systems, “static” and “dynamic”. In the first one, the user choices are guided by a hierarchical tree menu, whereas the latter is more flexible and includes a multiple choice criteria (type of resistance, weed species, region, cropping systems) that permits customized maps to be created. The generated information can be useful to various stakeholders who are involved in weed resistance management: farmers, advisors, national and local decision makers as well as the agrochemical industry. iMAR is freely available, and the system has the potential to handle large datasets and to be used for other purposes with geographical implications, such as the mapping of invasive plants or pests. PMID:26266545

  8. Construction and application of a protein interaction map for white spot syndrome virus (WSSV).

    PubMed

    Sangsuriya, Pakkakul; Huang, Jiun-Yan; Chu, Yu-Fei; Phiwsaiya, Kornsunee; Leekitcharoenphon, Pimlapas; Meemetta, Watcharachai; Senapin, Saengchan; Huang, Wei-Pang; Withyachumnarnkul, Boonsirm; Flegel, Timothy W; Lo, Chu-Fang

    2014-01-01

    White spot syndrome virus (WSSV) is currently the most serious global threat for cultured shrimp production. Although its large, double-stranded DNA genome has been completely characterized, most putative protein functions remain obscure. To provide more informative knowledge about this virus, a proteomic-scale network of WSSV-WSSV protein interactions was carried out using a comprehensive yeast two-hybrid analysis. An array of yeast transformants containing each WSSV open reading frame fused with GAL4 DNA binding domain and GAL4 activation domain was constructed yielding 187 bait and 182 prey constructs, respectively. On screening of ∼28,000 pairwise combinations, 710 interactions were obtained from 143 baits. An independent coimmunoprecipitation assay (co-IP) was performed to validate the selected protein interaction pairs identified from the yeast two-hybrid approach. The program Cytoscape was employed to create a WSSV protein-protein interaction (PPI) network. The topology of the WSSV PPI network was based on the Barabási-Albert model and consisted of a scale-free network that resembled other established viral protein interaction networks. Using the RNA interference approach, knocking down either of two candidate hub proteins gave shrimp more protection against WSSV than knocking down a nonhub gene. The WSSV protein interaction map established in this study provides novel guidance for further studies on shrimp viral pathogenesis, host-viral protein interaction and potential targets for therapeutic and preventative antiviral strategies in shrimp aquaculture.

  9. Mapping the genetic basis of symbiotic variation in legume-rhizobium interactions in Medicago truncatula.

    PubMed

    Gorton, Amanda J; Heath, Katy D; Pilet-Nayel, Marie-Laure; Baranger, Alain; Stinchcombe, John R

    2012-11-01

    Mutualisms are known to be genetically variable, where the genotypes differ in the fitness benefits they gain from the interaction. To date, little is known about the loci that underlie such genetic variation in fitness or whether the loci influencing fitness are partner specific, and depend on the genotype of the interaction partner. In the legume-rhizobium mutualism, one set of potential candidate genes that may influence the fitness benefits of the symbiosis are the plant genes involved in the initiation of the signaling pathway between the two partners. Here we performed quantitative trait loci (QTL) mapping in Medicago truncatula in two different rhizobium strain treatments to locate regions of the genome influencing plant traits, assess whether such regions are dependent on the genotype of the rhizobial mutualist (QTL × rhizobium strain), and evaluate the contribution of sequence variation at known symbiosis signaling genes. Two of the symbiotic signaling genes, NFP and DMI3, colocalized with two QTL affecting average fruit weight and leaf number, suggesting that natural variation in nodulation genes may potentially influence plant fitness. In both rhizobium strain treatments, there were QTL that influenced multiple traits, indicative of either tight linkage between loci or pleiotropy, including one QTL with opposing effects on growth and reproduction. There was no evidence for QTL × rhizobium strain or genotype × genotype interactions, suggesting either that such interactions are due to small-effect loci or that more genotype-genotype combinations need to be tested in future mapping studies.

  10. Interactive Maps on War and Peace: A WebGIS Application for Civic Education

    NASA Astrophysics Data System (ADS)

    Wirkus, Lars; Strunck, Alexander

    2013-04-01

    War and violent conflict are omnipresent-be it war in the Middle East, violent conflicts in failed states or increasing military expenditures and exports/ imports of military goods. To understand certain conflicts or peace processes and their possible interrelation, to conduct a well-founded political discussion and to support or influence decision-making, one matter is of special importance: easily accessible and, in particular, reliable data and information. Against this background, the Bonn International Center for Conversion (BICC) in close cooperation with the German Federal Agency for Civic Education (bpb) has been developing a map-based information portal on war and peace with various thematic modules for the latter's online service (http://sicherheitspolitik.bpb.de). The portal will eventually offer nine of such modules that are intended to give various target groups, such as interested members of the public, teachers and learners, policymakers and representatives of the media access to the required information in form of an interactive and country-based global overview or a comparison of different issues. Five thematic modules have been completed so far: War and conflict, peace and demobilization, military capacities, resources and conflict, conventional weapons. The portal offers a broad spectrum of different data processing and visualization tools. Its central feature is an interactive mapping component based on WebGIS and a relational database. Content and data provided through thematic maps in the form of WebGIS layers are generally supplemented by info graphics, data tables and short articles providing deeper knowledge on the respective issue. All modules and their sub-chapters are introduced by background texts. They put all interactive maps of a module into an appropriate context and help the users to also understand the interrelation between various layers. If a layer is selected, all corresponding texts and graphics are shown automatically below

  11. Mapping texts through dimensionality reduction and visualization techniques for interactive exploration of document collections

    NASA Astrophysics Data System (ADS)

    de Andrade Lopes, Alneu; Minghim, Rosane; Melo, Vinícius; Paulovich, Fernando V.

    2006-01-01

    The current availability of information many times impair the tasks of searching, browsing and analyzing information pertinent to a topic of interest. This paper presents a methodology to create a meaningful graphical representation of documents corpora targeted at supporting exploration of correlated documents. The purpose of such an approach is to produce a map from a document body on a research topic or field based on the analysis of their contents, and similarities amongst articles. The document map is generated, after text pre-processing, by projecting the data in two dimensions using Latent Semantic Indexing. The projection is followed by hierarchical clustering to support sub-area identification. The map can be interactively explored, helping to narrow down the search for relevant articles. Tests were performed using a collection of documents pre-classified into three research subject classes: Case-Based Reasoning, Information Retrieval, and Inductive Logic Programming. The map produced was capable of separating the main areas and approaching documents by their similarity, revealing possible topics, and identifying boundaries between them. The tool can deal with the exploration of inter-topics and intra-topic relationship and is useful in many contexts that need deciding on relevant articles to read, such as scientific research, education, and training.

  12. Interactive web-based mapping: bridging technology and data for health

    PubMed Central

    2011-01-01

    Background The Community Health Information System (CHIS) online mapping system was first launched in 1998. Its overarching goal was to provide researchers, residents and organizations access to health related data reflecting the overall health and well-being of their communities within the Greater Houston area. In September 2009, initial planning and development began for the next generation of CHIS. The overarching goal for the new version remained to make health data easily accessible for a wide variety of research audiences. However, in the new version we specifically sought to make the CHIS truly interactive and give the user more control over data selection and reporting. Results In July 2011, a beta version of the next-generation of the application was launched. This next-generation is also a web based interactive mapping tool comprised of two distinct portals: the Breast Health Portal and Project Safety Net. Both are accessed via a Google mapping interface. Geographic coverage for the portals is currently an 8 county region centered on Harris County, Texas. Data accessed by the application include Census 2000, Census 2010 (underway), cancer incidence from the Texas Cancer Registry (TX Dept. of State Health Services), death data from Texas Vital Statistics, clinic locations for free and low-cost health services, along with service lists, hours of operation, payment options and languages spoken, uninsured and poverty data. Conclusions The system features query on the fly technology, which means the data is not generated until the query is provided to the system. This allows users to interact in real-time with the databases and generate customized reports and maps. To the author's knowledge, the Breast Health Portal and Project Safety Net are the first local-scale interactive online mapping interfaces for public health data which allow users to control the data generated. For example, users may generate breast cancer incidence rates by Census tract, in real

  13. Maps of context-dependent putative regulatory regions and genomic signal interactions.

    PubMed

    Diamanti, Klev; Umer, Husen M; Kruczyk, Marcin; Dąbrowski, Michał J; Cavalli, Marco; Wadelius, Claes; Komorowski, Jan

    2016-11-02

    Gene transcription is regulated mainly by transcription factors (TFs). ENCODE and Roadmap Epigenomics provide global binding profiles of TFs, which can be used to identify regulatory regions. To this end we implemented a method to systematically construct cell-type and species-specific maps of regulatory regions and TF-TF interactions. We illustrated the approach by developing maps for five human cell-lines and two other species. We detected ∼144k putative regulatory regions among the human cell-lines, with the majority of them being ∼300 bp. We found ∼20k putative regulatory elements in the ENCODE heterochromatic domains suggesting a large regulatory potential in the regions presumed transcriptionally silent. Among the most significant TF interactions identified in the heterochromatic regions were CTCF and the cohesin complex, which is in agreement with previous reports. Finally, we investigated the enrichment of the obtained putative regulatory regions in the 3D chromatin domains. More than 90% of the regions were discovered in the 3D contacting domains. We found a significant enrichment of GWAS SNPs in the putative regulatory regions. These significant enrichments provide evidence that the regulatory regions play a crucial role in the genomic structural stability. Additionally, we generated maps of putative regulatory regions for prostate and colorectal cancer human cell-lines.

  14. Mapping the Interactions between the NS4B and NS3 Proteins of Dengue Virus

    PubMed Central

    Zou, Jing; Lee, Le Tian; Wang, Qing Yin; Xie, Xuping; Lu, Siyan; Yau, Yin Hoe; Yuan, Zhiming; Geifman Shochat, Susana; Kang, Congbao

    2015-01-01

    ABSTRACT Flavivirus RNA synthesis is mediated by a multiprotein complex associated with the endoplasmic reticulum membrane, named the replication complex (RC). Within the flavivirus RC, NS4B, an integral membrane protein with a role in virulence and regulation of the innate immune response, binds to the NS3 protease-helicase. NS4B modulates the RNA helicase activity of NS3, but the molecular details of their interaction remain elusive. Here, we used dengue virus (DENV) to map the determinants for the NS3-NS4B interaction. Coimmunoprecipitation and an in situ proximity ligation assay confirmed that NS3 colocalizes with NS4B in both DENV-infected cells and cells coexpressing both proteins. Surface plasmon resonance demonstrated that subdomains 2 and 3 of the NS3 helicase region and the cytoplasmic loop of NS4B are required for binding. Using nuclear magnetic resonance (NMR), we found that the isolated cytoplasmic loop of NS4B is flexible, with a tendency to form a three-turn α-helix and two short β-strands. Upon binding to the NS3 helicase, 12 amino acids within the cytoplasmic loop of NS4B exhibited line broadening, suggesting a participation in the interaction. Sequence alignment showed that 4 of these 12 residues are strictly conserved across different flaviviruses. Mutagenesis analysis showed that three (Q134, G140, and N144) of the four evolutionarily conserved NS4B residues are essential for DENV replication. The mapping of the NS3/NS4B-interacting regions described here can assist the design of inhibitors that disrupt their interface for antiviral therapy. IMPORTANCE NS3 and NS4B are essential components of the flavivirus RC. Using DENV as a model, we mapped the interaction between the viral NS3 and NS4B proteins. The subdomains 2 and 3 of NS3 helicase as well as the cytoplasmic loop of NS4B are critical for the interaction. Functional analysis delineated residues within the NS4B cytoplasmic loop that are crucial for DENV replication. Our findings reveal

  15. Analyzing Interactions by an IIS-Map-Based Method in Face-to-Face Collaborative Learning: An Empirical Study

    ERIC Educational Resources Information Center

    Zheng, Lanqin; Yang, Kaicheng; Huang, Ronghuai

    2012-01-01

    This study proposes a new method named the IIS-map-based method for analyzing interactions in face-to-face collaborative learning settings. This analysis method is conducted in three steps: firstly, drawing an initial IIS-map according to collaborative tasks; secondly, coding and segmenting information flows into information items of IIS; thirdly,…

  16. Genome-wide mapping of in vivo protein-DNA interactions.

    PubMed

    Johnson, David S; Mortazavi, Ali; Myers, Richard M; Wold, Barbara

    2007-06-08

    In vivo protein-DNA interactions connect each transcription factor with its direct targets to form a gene network scaffold. To map these protein-DNA interactions comprehensively across entire mammalian genomes, we developed a large-scale chromatin immunoprecipitation assay (ChIPSeq) based on direct ultrahigh-throughput DNA sequencing. This sequence census method was then used to map in vivo binding of the neuron-restrictive silencer factor (NRSF; also known as REST, for repressor element-1 silencing transcription factor) to 1946 locations in the human genome. The data display sharp resolution of binding position [+/-50 base pairs (bp)], which facilitated our finding motifs and allowed us to identify noncanonical NRSF-binding motifs. These ChIPSeq data also have high sensitivity and specificity [ROC (receiver operator characteristic) area >/= 0.96] and statistical confidence (P <10(-4)), properties that were important for inferring new candidate interactions. These include key transcription factors in the gene network that regulates pancreatic islet cell development.

  17. Bayesian Mapping of Genomewide Interacting Quantitative Trait Loci for Ordinal Traits

    PubMed Central

    Yi, Nengjun; Banerjee, Samprit; Pomp, Daniel; Yandell, Brian S.

    2007-01-01

    Development of statistical methods and software for mapping interacting QTL has been the focus of much recent research. We previously developed a Bayesian model selection framework, based on the composite model space approach, for mapping multiple epistatic QTL affecting continuous traits. In this study we extend the composite model space approach to complex ordinal traits in experimental crosses. We jointly model main and epistatic effects of QTL and environmental factors on the basis of the ordinal probit model (also called threshold model) that assumes a latent continuous trait underlies the generation of the ordinal phenotypes through a set of unknown thresholds. A data augmentation approach is developed to jointly generate the latent data and the thresholds. The proposed ordinal probit model, combined with the composite model space framework for continuous traits, offers a convenient way for genomewide interacting QTL analysis of ordinal traits. We illustrate the proposed method by detecting new QTL and epistatic effects for an ordinal trait, dead fetuses, in a F2 intercross of mice. Utility and flexibility of the method are also demonstrated using a simulated data set. Our method has been implemented in the freely available package R/qtlbim, which greatly facilitates the general usage of the Bayesian methodology for genomewide interacting QTL analysis for continuous, binary, and ordinal traits in experimental crosses. PMID:17507680

  18. Multi-Modal, Multi-Touch Interaction with Maps in Disaster Management Applications

    NASA Astrophysics Data System (ADS)

    Paelke, V.; Nebe, K.; Geiger, C.; Klompmaker, F.; Fischer, H.

    2012-07-01

    Multi-touch interaction has become popular in recent years and impressive advances in technology have been demonstrated, with the presentation of digital maps as a common presentation scenario. However, most existing systems are really technology demonstrators and have not been designed with real applications in mind. A critical factor in the management of disaster situations is the access to current and reliable data. New sensors and data acquisition platforms (e.g. satellites, UAVs, mobile sensor networks) have improved the supply of spatial data tremendously. However, in many cases this data is not well integrated into current crisis management systems and the capabilities to analyze and use it lag behind sensor capabilities. Therefore, it is essential to develop techniques that allow the effective organization, use and management of heterogeneous data from a wide variety of data sources. Standard user interfaces are not well suited to provide this information to crisis managers. Especially in dynamic situations conventional cartographic displays and mouse based interaction techniques fail to address the need to review a situation rapidly and act on it as a team. The development of novel interaction techniques like multi-touch and tangible interaction in combination with large displays provides a promising base technology to provide crisis managers with an adequate overview of the situation and to share relevant information with other stakeholders in a collaborative setting. However, design expertise on the use of such techniques in interfaces for real-world applications is still very sparse. In this paper we report on interdisciplinary research with a user and application centric focus to establish real-world requirements, to design new multi-modal mapping interfaces, and to validate them in disaster management applications. Initial results show that tangible and pen-based interaction are well suited to provide an intuitive and visible way to control who is

  19. The interaction of high-resolution electrophoresis and computational analysis in genome mapping

    SciTech Connect

    Carrano, A.V.; Branscomb, E.W.; de Jong, P.J.; Mohrenweiser, H.; Olsen, A.; Slezak, T.

    1990-07-26

    The construction of physical maps and the determination of the DNA sequence of chromosome-size segments of the human genome is a complex, multidisciplinary undertaking. The approach we have taken to construct a physical map and sequence of human chromosome 19 typifies these interactions. We exploit the power of both acrylamide and agarose gel electrophoresis to provide a simple and versatile method for DNA fingerprinting and the creation of contigs or sets of overlapping genomic clones. Cosmid libraries are constructed from Yeast Artificial Chromosomes (YAC) clones or from flow-sorted chromosomes. Cosmid DNA isolated from the screened library array is cut with a combination of five restriction enzymes and the fragment ends labeled with one of four different fluorochromes. Our approach to contig construction uses a robotic system to label restriction fragments from cosmids with fluorochromes, use of an automated DNA sequencer to capture fragment mobility data in a high resolution multiplex mode processes the mobility data to determine fragment length and provide a statistical measure of overlap among cosmids; and display the contigs and underlying cosmids for operator interaction and access to a database. Data analyses and interactions are conducted over a network of SUN workstations using a set of software tools that we developed and coupled to a commercially available database. Applying these methods, we have analyzed 5154 cosmid clones and assembled 515 contigs for chromosome 19. Some of these contigs have been identified with known genes and many have been mapped to the chromosome by fluorescence in situ hybridization. Existing contigs are being extended by a combination of walking and fingerprinting. 21 refs., 2 figs.

  20. Mapping the bound conformation and protein interactions of microtubule destabilizing peptides by STD-NMR spectroscopy.

    PubMed

    Milton, Mark J; Thomas Williamson, R; Koehn, Frank E

    2006-08-15

    Using the hemiasterlin analogs taltobulin (I, HTI-286), II, and III as model compounds, we demonstrate that relaxation-compensated STD-NMR can be used as an effective tool to efficiently provide a qualitative epitope map for microtubule destabilizing peptides. Due to the disparate relaxation behavior of the protons in these model compounds, it was essential to collect STD with very short saturation times to render an accurate picture of the binding interaction. The conformation of HTI-286 (I) in complex with the protein was determined from TRNOESY/ROESY experiments and is similar to the X-ray crystal structure conformation observed for hemiasterlin methyl ester in the absence of protein.

  1. RefSOFI for Mapping Nanoscale Organization of Protein-protein Interactions in Living cells

    PubMed Central

    Hertel, Fabian; Mo, Gary C. H.; Duwé, Sam; Dedecker, Peter; Zhang, Jin

    2015-01-01

    Summary It has become increasingly clear that protein-protein interactions (PPIs) are compartmentalized in nanoscale domains that define the biochemical architecture of the cell. Despite tremendous advances in super-resolution imaging, strategies to observe PPIs at sufficient resolution to discern their organization are just emerging. Here we describe a strategy in which PPIs induce reconstitution of fluorescent proteins (FPs) that are capable of exhibiting single-molecule fluctuations suitable for Stochastic Optical Fluctuation Imaging (SOFI). Subsequently, spatial maps of these interactions can be resolved in super-resolution in living cells. Using this strategy, termed reconstituted fluorescence-based SOFI (refSOFI), we investigated the interaction between the endoplasmic reticulum Ca2+ sensor STIM1 and the pore-forming channel subunit ORAI1, a crucial process in store-operated Ca2+ entry (SOCE). Stimulating SOCE does not appear to change the size of existing STIM1/ORAI1 interaction puncta at the ER-plasma membrane junctions, but results in an apparent increase in the number of interaction puncta. PMID:26748717

  2. Mapping the distribution of specific antibody interaction forces on individual red blood cells

    PubMed Central

    Yeow, Natasha; Tabor, Rico F.; Garnier, Gil

    2017-01-01

    Current blood typing methods rely on the agglutination of red blood cells (RBCs) to macroscopically indicate a positive result. An indirect agglutination mechanism is required when blood typing with IgG forms of antibodies. To date, the interaction forces between anti-IgG and IgG antibodies have been poorly quantified, and blood group related antigens have never been quantified with the atomic force microscope (AFM). Instead, the total intensity resulting from fluorescent-tagged antibodies adsorbed on RBC has been measured to calculate an average antigen density on a series of RBCs. In this study we mapped specific antibody interaction forces on the RBC surface. AFM cantilever tips functionalized with anti-IgG were used to probe RBCs incubated with specific IgG antibodies. This work provides unique insight into antibody-antigen interactions in their native cell-bound location, and crucially, on a per-cell basis rather than an ensemble average set of properties. Force profiles obtained from the AFM directly provide not only the anti-IgG – IgG antibody interaction force, but also the spatial distribution and density of antigens over a single cell. This new understanding might be translated into the development of very selective and quantitative interactions that underpin the action of drugs in the treatment of frontier illnesses. PMID:28157207

  3. Mapping the distribution of specific antibody interaction forces on individual red blood cells

    NASA Astrophysics Data System (ADS)

    Yeow, Natasha; Tabor, Rico F.; Garnier, Gil

    2017-02-01

    Current blood typing methods rely on the agglutination of red blood cells (RBCs) to macroscopically indicate a positive result. An indirect agglutination mechanism is required when blood typing with IgG forms of antibodies. To date, the interaction forces between anti-IgG and IgG antibodies have been poorly quantified, and blood group related antigens have never been quantified with the atomic force microscope (AFM). Instead, the total intensity resulting from fluorescent-tagged antibodies adsorbed on RBC has been measured to calculate an average antigen density on a series of RBCs. In this study we mapped specific antibody interaction forces on the RBC surface. AFM cantilever tips functionalized with anti-IgG were used to probe RBCs incubated with specific IgG antibodies. This work provides unique insight into antibody-antigen interactions in their native cell-bound location, and crucially, on a per-cell basis rather than an ensemble average set of properties. Force profiles obtained from the AFM directly provide not only the anti-IgG – IgG antibody interaction force, but also the spatial distribution and density of antigens over a single cell. This new understanding might be translated into the development of very selective and quantitative interactions that underpin the action of drugs in the treatment of frontier illnesses.

  4. Topological and functional analysis of nonalcoholic steatohepatitis through protein interaction mapping

    PubMed Central

    Asadzadeh-Aghdaee, Hamid; Mansouri, Vahid; Peyvandi, Ali Asghar; Moztarzadeh, Fathollah; Okhovatian, Farshad; Lahmi, Farhad; Vafaee, Reza; Zali, Mohammad Reza

    2016-01-01

    Aim: The corresponding proteins are important for network mapping since the interaction analysis can provide a new interpretation about disease underlying mechanisms as the aim of this study. Backgroud: Nonalcoholic steatohepatitis (NASH) is one of the main causes of liver disease in the world. It has been known with many susceptible proteins that play essential role in its pathogenesis. Methods: In this paper, protein-protein interaction (PPI) network analysis of fatty liver disease retrieved from STRING db by the application of Cytoscape Software. ClueGO analyzed the associated pathways for the selected top proteins. Results: INS, PPARA, LEP, SREBF1, and ALB are the introduced biomarker panel for fatty liver disease. Conclusion: It seems that pathways related to insulin have a prominent role in fatty liver disease. Therefore, investigation in this case is required to confirm the possible linkage of introduced panel and involvement of insulin pathway in the disease. PMID:28224024

  5. The Potential for Signal Integration and Processing in Interacting Map Kinase Cascades

    PubMed Central

    Schwacke, John H.; Voit, Eberhard O.

    2009-01-01

    The cellular response to environmental stimuli requires biochemical information processing through which sensory inputs and cellular status are integrated and translated into appropriate responses by way of interacting networks of enzymes. One such network, the Mitogen Activated Protein (MAP) kinase cascade is a highly conserved signal transduction module that propagates signals from cell surface receptors to various cytosolic and nuclear targets by way of a phosphorylation cascade. We have investigated the potential for signal processing within a network of interacting feed-forward kinase cascades typified by the MAP kinase cascade. A genetic algorithm was used to search for sets of kinetic parameters demonstrating representative key input-output patterns of interest. We discuss two of the networks identified in our study, one implementing the exclusive-or function (XOR) and another implementing what we refer to as an in-band detector (IBD) or two-sided threshold. These examples confirm the potential for logic and amplitude-dependent signal processing in interacting MAP kinase cascades demonstrating limited cross-talk. Specifically, the XOR function allows the network to respond to either one, but not both signals simultaneously, while the IBD permits the network to respond exclusively to signals within a given range of strength, and to suppress signals below as well as above this range. The solution to the XOR problem is interesting in that it requires only two interacting pathways, crosstalk at only one layer, and no feedback or explicit inhibition. These types of responses are not only biologically relevant but constitute signal processing modules that can be combined to create other logical functions and that, in contrast to amplification, cannot be achieved with a single cascade or with two non-interacting cascades. Our computational results revealed surprising similarities between experimental data describing the JNK/MKK4/MKK7 pathway and the solution for

  6. Mapping QTL main and interaction influences on milling quality in elite US rice germplasm.

    PubMed

    Nelson, J C; McClung, A M; Fjellstrom, R G; Moldenhauer, K A K; Boza, E; Jodari, F; Oard, J H; Linscombe, S; Scheffler, B E; Yeater, K M

    2011-02-01

    Rice (Oryza sativa L.) head-rice yield (HR) is a key export and domestic quality trait whose genetic control is poorly understood. With the goal of identifying genomic regions influencing HR, quantitative-trait-locus (QTL) mapping was carried out for quality-related traits in recombinant inbred lines (RILs) derived from crosses of common parent Cypress, a high-HR US japonica cultivar, with RT0034, a low-HR indica line (129 RILs) and LaGrue, a low-HR japonica cultivar (298 RILs), grown in two US locations in 2005-2007. Early heading increased HR in the Louisiana (LA) but not the Arkansas (AR) location. Fitting QTL-mapping models to separate QTL main and QTL × environment interaction (QEI) effects and identify epistatic interactions revealed six main-effect HR QTLs in the two crosses, at four of which Cypress contributed the increasing allele. Multi-QTL models accounted for 0.36 of genetic and 0.21 of genetic × environment interaction of HR in MY1, and corresponding proportions of 0.25 and 0.37 in MY2. The greater HR advantage of Cypress in LA than in AR corresponded to a genomewide pattern of opposition of HR-increasing QTL effects by AR-specific effects, suggesting a selection strategy for improving this cultivar for AR. Treating year-location combinations as independent environments resulted in underestimation of QEI effects, evidently owing to lower variation among years within location than between location. Identification of robust HR QTLs in elite long-grain germplasm is suggested to require more detailed attention to the interaction of plant and grain development parameters with environmental conditions than has been given to date.

  7. Mapping burn severity, pine beetle infestation, and their interaction at the High Park Fire

    NASA Astrophysics Data System (ADS)

    Stone, Brandon

    North America's western forests are experiencing wildfire and mountain pine beetle (MPB) disturbances that are unprecedented in the historic record, but it remains unclear whether and how MPB infestation influences post-infestation fire behavior. The 2012 High Park Fire burned in an area that's estimated to have begun a MPB outbreak cycle within five years before the wildfire, resulting in a landscape in which disturbance interactions can be studied. A first step in studying these interactions is mapping regions of beetle infestation and post-fire disturbance. We implemented an approach for mapping beetle infestation and burn severity using as source data three 5 m resolution RapidEye satellite images (two pre-fire, one post-fire). A two-tiered methodology was developed to overcome the spatial limitations of many classification approaches through explicit analyses at both pixel and plot level. Major land cover classes were photo-interpreted at the plot-level and their spectral signature used to classify 5 m images. A new image was generated at 25 m resolution by tabulating the fraction of coincident 5 m pixels in each cover class. The original photo interpretation was then used to train a second classification using as its source image the new 25 m image. Maps were validated using k-fold analysis of the original photo interpretation, field data collected immediately post-fire, and publicly available classifications. To investigate the influence of pre-fire beetle infestation on burn severity within the High Park Fire, we fit a log-linear model of conditional independence to our thematic maps after controlling for forest cover class and slope aspect. Our analysis revealed a high co-occurrence of severe burning and beetle infestation within high elevation lodgepole pine stands, but did not find statistically significant evidence that infected stands were more likely to burn severely than similar uninfected stands. Through an inspection of the year-to-year changes in

  8. Neurophysiological and simulation studies of striate cortex receptive field maps: the role of intracortical interneuronal interactions.

    PubMed

    Lazareva, N A; Saltykov, K A; Shevelev, I A; Tikhomirov, A S; Novikova, R V; Tsutskiridze, D Yu

    2007-07-01

    Acute experiments on 27 adult anesthetized and immobilized cats investigated 101 on and off receptive fields in 67 neurons in visual cortex field 17 by mapping using single local stimuli presented sequentially at different parts of the visual field, as well as in combination with additional stimulation of the center of the receptive field. Both classical and combined mapping identified receptive fields with single receptive zones (63.4% and 29.3% respectively), along with fields consisting of several (2-5) excitatory and/or inhibitory zones (36.6% and 70.7%). We provide the first report of receptive fields with horseshoe, cross, and T shapes. Simulations of horizontal interneuronal interactions in the visual cortex responsible for the multiplicity of excitatory and inhibitory zones of receptive fields were performed. A role for cooperative interactions of neurons in this effect was demonstrated. The possible functional role of receptive fields of different types in extracting the features of visual images is discussed.

  9. A protein-protein interaction map of yeast RNA polymerase III.

    PubMed

    Flores, A; Briand, J F; Gadal, O; Andrau, J C; Rubbi, L; Van Mullem, V; Boschiero, C; Goussot, M; Marck, C; Carles, C; Thuriaux, P; Sentenac, A; Werner, M

    1999-07-06

    The structure of the yeast RNA polymerase (pol) III was investigated by exhaustive two-hybrid screening using a library of random genomic fragments fused to the Gal4 activation domain. This procedure allowed us to identify contacts between individual polypeptides, localize the contact domains, and deduce a protein-protein interaction map of the multisubunit enzyme. In all but one case, pol III subunits were able to interact in vivo with one or sometimes two partner subunits of the enzyme or with subunits of TFIIIC. Four subunits that are common to pol I, II, and III (ABC27, ABC14.5, ABC10alpha, and ABC10beta), two that are common to pol I and III (AC40 and AC19), and one pol III-specific subunit (C11) can associate with defined regions of the two large subunits. These regions overlapped with highly conserved domains. C53, a pol III-specific subunit, interacted with a 37-kDa polypeptide that copurifies with the enzyme and therefore appears to be a unique pol III subunit (C37). Together with parallel interaction studies based on dosage-dependent suppression of conditional mutants, our data suggest a model of the pol III preinitiation complex.

  10. AxiSketcher: Interactive Nonlinear Axis Mapping of Visualizations through User Drawings.

    PubMed

    Kwon, Bum Chul; Kim, Hannah; Wall, Emily; Choo, Jaegul; Park, Haesun; Endert, Alex

    2017-01-01

    Visual analytics techniques help users explore high-dimensional data. However, it is often challenging for users to express their domain knowledge in order to steer the underlying data model, especially when they have little attribute-level knowledge. Furthermore, users' complex, high-level domain knowledge, compared to low-level attributes, posits even greater challenges. To overcome these challenges, we introduce a technique to interpret a user's drawings with an interactive, nonlinear axis mapping approach called AxiSketcher. This technique enables users to impose their domain knowledge on a visualization by allowing interaction with data entries rather than with data attributes. The proposed interaction is performed through directly sketching lines over the visualization. Using this technique, users can draw lines over selected data points, and the system forms the axes that represent a nonlinear, weighted combination of multidimensional attributes. In this paper, we describe our techniques in three areas: 1) the design space of sketching methods for eliciting users' nonlinear domain knowledge; 2) the underlying model that translates users' input, extracts patterns behind the selected data points, and results in nonlinear axes reflecting users' complex intent; and 3) the interactive visualization for viewing, assessing, and reconstructing the newly formed, nonlinear axes.

  11. An Overview of Plume Tracker: Mapping Volcanic Emissions with Interactive Radiative Transfer Modeling

    NASA Astrophysics Data System (ADS)

    Realmuto, V. J.; Berk, A.; Guiang, C.

    2014-12-01

    Infrared remote sensing is a vital tool for the study of volcanic plumes, and radiative transfer (RT) modeling is required to derive quantitative estimation of the sulfur dioxide (SO2), sulfate aerosol (SO4), and silicate ash (pulverized rock) content of these plumes. In the thermal infrared, we must account for the temperature, emissivity, and elevation of the surface beneath the plume, plume altitude and thickness, and local atmospheric temperature and humidity. Our knowledge of these parameters is never perfect, and interactive mapping allows us to evaluate the impact of these uncertainties on our estimates of plume composition. To enable interactive mapping, the Jet Propulsion Laboratory is collaborating with Spectral Sciences, Inc., (SSI) to develop the Plume Tracker toolkit. This project is funded by a NASA AIST Program Grant (AIST-11-0053) to SSI. Plume Tracker integrates (1) retrieval procedures for surface temperature and emissivity, SO2, NH3, or CH4 column abundance, and scaling factors for H2O vapor and O3 profiles, (2) a RT modeling engine based on MODTRAN, and (3) interactive visualization and analysis utilities under a single graphics user interface. The principal obstacle to interactive mapping is the computational overhead of the RT modeling engine. Under AIST-11-0053 we have achieved a 300-fold increase in the performance of the retrieval procedures through the use of indexed caches of model spectra, optimization of the minimization procedures, and scaling of the effects of surface temperature and emissivity on model radiance spectra. In the final year of AIST-11-0053 we will implement parallel processing to exploit multi-core CPUs and cluster computing, and optimize the RT engine to eliminate redundant calculations when iterating over a range of gas concentrations. These enhancements will result in an additional 8 - 12X increase in performance. In addition to the improvements in performance, we have improved the accuracy of the Plume Tracker

  12. WHERE MULTIFUNCTIONAL DNA REPAIR PROTEINS MEET: MAPPING THE INTERACTION DOMAINS BETWEEN XPG AND WRN

    SciTech Connect

    Rangaraj, K.; Cooper, P.K.; Trego, K.S.

    2009-01-01

    The rapid recognition and repair of DNA damage is essential for the maintenance of genomic integrity and cellular survival. Multiple complex and interconnected DNA damage responses exist within cells to preserve the human genome, and these repair pathways are carried out by a specifi c interplay of protein-protein interactions. Thus a failure in the coordination of these processes, perhaps brought about by a breakdown in any one multifunctional repair protein, can lead to genomic instability, developmental and immunological abnormalities, cancer and premature aging. This study demonstrates a novel interaction between two such repair proteins, Xeroderma pigmentosum group G protein (XPG) and Werner syndrome helicase (WRN), that are both highly pleiotropic and associated with inherited genetic disorders when mutated. XPG is a structure-specifi c endonuclease required for the repair of UV-damaged DNA by nucleotide excision repair (NER), and mutations in XPG result in the diseases Xeroderma pigmentosum (XP) and Cockayne syndrome (CS). A loss of XPG incision activity results in XP, whereas a loss of non-enzymatic function(s) of XPG causes CS. WRN is a multifunctional protein involved in double-strand break repair (DSBR), and consists of 3’–5’ DNA-dependent helicase, 3’–5’ exonuclease, and single-strand DNA annealing activities. Nonfunctional WRN protein leads to Werner syndrome, a premature aging disorder with increased cancer incidence. Far Western analysis was used to map the interacting domains between XPG and WRN by denaturing gel electrophoresis, which separated purifi ed full length and recombinant XPG and WRN deletion constructs, based primarily upon the length of each polypeptide. Specifi c interacting domains were visualized when probed with the secondary protein of interest which was then detected by traditional Western analysis using the antibody of the secondary protein. The interaction between XPG and WRN was mapped to the C-terminal region of

  13. TheCellMap.org: A Web-Accessible Database for Visualizing and Mining the Global Yeast Genetic Interaction Network.

    PubMed

    Usaj, Matej; Tan, Yizhao; Wang, Wen; VanderSluis, Benjamin; Zou, Albert; Myers, Chad L; Costanzo, Michael; Andrews, Brenda; Boone, Charles

    2017-03-21

    Providing access to quantitative genomic data is key to ensure large-scale data validation and promote new discoveries. TheCellMap.org serves as a central repository for storing and analyzing quantitative genetic interaction data produced by genome-scale Synthetic Genetic Array (SGA) experiments with the budding yeast Saccharomyces cerevisiae In particular, TheCellMap.org allows users to easily access, visualize, explore and functionally annotate genetic interactions, or to extract and reorganize sub-networks, using data-driven network layouts in an intuitive and interactive manner.

  14. Interaction maps of the Saccharomyces cerevisiae ESCRT-III protein Snf7.

    PubMed

    Sciskala, Barbara; Kölling, Ralf

    2013-11-01

    The Saccharomyces cerevisiae ESCRT-III protein Snf7 is part of an intricate interaction network at the endosomal membrane. Interaction maps of Snf7 were established by measuring the degree of binding of individual binding partners to putative binding motifs along the Snf7 sequence by glutathione S-transferase (GST) pulldown. For each interaction partner, distinct binding profiles were obtained. The following observations were made. The ESCRT-III subunits Vps20 and Vps24 showed a complementary binding pattern, suggesting a model for the series of events in the ESCRT-III functional cycle. Vps4 bound to individual Snf7 motifs but not to full-length Snf7. This suggests that Vps4 does not bind to the closed conformation of Snf7. We also demonstrate for the first time that the ALIX/Bro1 homologue Rim20 binds to the α6 helix of Snf7. Analysis of a Snf7 α6 deletion mutant showed that the α6 helix is crucial for binding of Bro1 and Rim20 in vivo and is indispensable for the multivesicular body (MVB)-sorting and Rim-signaling functions of Snf7. The Snf7Δα6 protein still appeared to be incorporated into ESCRT-III complexes at the endosomal membrane, but disassembly of the complex seemed to be defective. In summary, our study argues against the view that the ESCRT cycle is governed by single one-to-one interactions between individual components and emphasizes the network character of the ESCRT interactions.

  15. Association mapping and gene-gene interaction for stem rust resistance in CIMMYT spring wheat germplasm.

    PubMed

    Yu, Long-Xi; Lorenz, Aaron; Rutkoski, Jessica; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2011-12-01

    The recent emergence of wheat stem rust Ug99 and evolution of new races within the lineage threatens global wheat production because they overcome widely deployed stem rust resistance (Sr) genes that had been effective for many years. To identify loci conferring adult plant resistance to races of Ug99 in wheat, we employed an association mapping approach for 276 current spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT). Breeding lines were genotyped with Diversity Array Technology (DArT) and microsatellite markers. Phenotypic data was collected on these lines for stem rust race Ug99 resistance at the adult plant stage in the stem rust resistance screening nursery in Njoro, Kenya in seasons 2008, 2009 and 2010. Fifteen marker loci were found to be significantly associated with stem rust resistance. Several markers appeared to be linked to known Sr genes, while other significant markers were located in chromosome regions where no Sr genes have been previously reported. Most of these new loci colocalized with QTLs identified recently in different biparental populations. Using the same data and Q + K covariate matrices, we investigated the interactions among marker loci using linear regression models to calculate P values for pairwise marker interactions. Resistance marker loci including the Sr2 locus on 3BS and the wPt1859 locus on 7DL had significant interaction effects with other loci in the same chromosome arm and with markers on chromosome 6B. Other resistance marker loci had significant pairwise interactions with markers on different chromosomes. Based on these results, we propose that a complex network of gene-gene interactions is, in part, responsible for resistance to Ug99. Further investigation may provide insight for understanding mechanisms that contribute to this resistance gene network.

  16. Mapping Interaction Energies in Chorismate Mutase with the Fragment Molecular Orbital Method.

    PubMed

    Pruitt, Spencer R; Steinmann, Casper

    2017-03-02

    The Claisen rearrangement of chorismate to prephenate is mapped across the entire reaction pathway using the fragment molecular orbital (FMO) method. Three basis sets (6-31G(d), cc-pVDZ, and pcseg-1) are studied to provide guidance toward obtaining high accuracy with the FMO method on such systems. Using a fragmentation scheme of one residue per fragment, the FMO method using the 6-31G(d) basis set and second-order Møller-Plesset perturbation theory (MP2) with the hybrid orbital projection fragmentation scheme provides the most reliable results across the entire reaction pathway. Calculations using the multilayer FMO method are performed and shown to be in agreement with single-layer calculations in all cases with differences of less than one kilocalorie per mole for all tested basis set combinations along the entire reaction path. The use of restricted Hartree-Fock for the lower-level layer and MP2 for the higher-level layer gives the most consistent results when using the same basis set for both layers. Pair interaction energy decomposition analysis calculations confirm that electrostatic interactions are the predominant force between three key arginine residues and chorismate and that dispersion and charge transfer interactions in the binding pocket also play a role in the local chemistry of the reaction.

  17. Quantitative interaction mapping reveals an extended UBX domain in ASPL that disrupts functional p97 hexamers

    PubMed Central

    Arumughan, Anup; Roske, Yvette; Barth, Carolin; Forero, Laura Lleras; Bravo-Rodriguez, Kenny; Redel, Alexandra; Kostova, Simona; McShane, Erik; Opitz, Robert; Faelber, Katja; Rau, Kirstin; Mielke, Thorsten; Daumke, Oliver; Selbach, Matthias; Sanchez-Garcia, Elsa; Rocks, Oliver; Panáková, Daniela; Heinemann, Udo; Wanker, Erich E.

    2016-01-01

    Interaction mapping is a powerful strategy to elucidate the biological function of protein assemblies and their regulators. Here, we report the generation of a quantitative interaction network, directly linking 14 human proteins to the AAA+ ATPase p97, an essential hexameric protein with multiple cellular functions. We show that the high-affinity interacting protein ASPL efficiently promotes p97 hexamer disassembly, resulting in the formation of stable p97:ASPL heterotetramers. High-resolution structural and biochemical studies indicate that an extended UBX domain (eUBX) in ASPL is critical for p97 hexamer disassembly and facilitates the assembly of p97:ASPL heterotetramers. This spontaneous process is accompanied by a reorientation of the D2 ATPase domain in p97 and a loss of its activity. Finally, we demonstrate that overproduction of ASPL disrupts p97 hexamer function in ERAD and that engineered eUBX polypeptides can induce cell death, providing a rationale for developing anti-cancer polypeptide inhibitors that may target p97 activity. PMID:27762274

  18. Systematic protein-protein interaction mapping for clinically relevant human GPCRs.

    PubMed

    Sokolina, Kate; Kittanakom, Saranya; Snider, Jamie; Kotlyar, Max; Maurice, Pascal; Gandía, Jorge; Benleulmi-Chaachoua, Abla; Tadagaki, Kenjiro; Oishi, Atsuro; Wong, Victoria; Malty, Ramy H; Deineko, Viktor; Aoki, Hiroyuki; Amin, Shahreen; Yao, Zhong; Morató, Xavier; Otasek, David; Kobayashi, Hiroyuki; Menendez, Javier; Auerbach, Daniel; Angers, Stephane; Pržulj, Natasa; Bouvier, Michel; Babu, Mohan; Ciruela, Francisco; Jockers, Ralf; Jurisica, Igor; Stagljar, Igor

    2017-03-15

    G-protein-coupled receptors (GPCRs) are the largest family of integral membrane receptors with key roles in regulating signaling pathways targeted by therapeutics, but are difficult to study using existing proteomics technologies due to their complex biochemical features. To obtain a global view of GPCR-mediated signaling and to identify novel components of their pathways, we used a modified membrane yeast two-hybrid (MYTH) approach and identified interacting partners for 48 selected full-length human ligand-unoccupied GPCRs in their native membrane environment. The resulting GPCR interactome connects 686 proteins by 987 unique interactions, including 299 membrane proteins involved in a diverse range of cellular functions. To demonstrate the biological relevance of the GPCR interactome, we validated novel interactions of the GPR37, serotonin 5-HT4d, and adenosine ADORA2A receptors. Our data represent the first large-scale interactome mapping for human GPCRs and provide a valuable resource for the analysis of signaling pathways involving this druggable family of integral membrane proteins.

  19. Interactive segmentation of tongue contours in ultrasound video sequences using quality maps

    NASA Astrophysics Data System (ADS)

    Ghrenassia, Sarah; Ménard, Lucie; Laporte, Catherine

    2014-03-01

    Ultrasound (US) imaging is an effective and non invasive way of studying the tongue motions involved in normal and pathological speech, and the results of US studies are of interest for the development of new strategies in speech therapy. State-of-the-art tongue shape analysis techniques based on US images depend on semi-automated tongue segmentation and tracking techniques. Recent work has mostly focused on improving the accuracy of the tracking techniques themselves. However, occasional errors remain inevitable, regardless of the technique used, and the tongue tracking process must thus be supervised by a speech scientist who will correct these errors manually or semi-automatically. This paper proposes an interactive framework to facilitate this process. In this framework, the user is guided towards potentially problematic portions of the US image sequence by a segmentation quality map that is based on the normalized energy of an active contour model and automatically produced during tracking. When a problematic segmentation is identified, corrections to the segmented contour can be made on one image and propagated both forward and backward in the problematic subsequence, thereby improving the user experience. The interactive tools were tested in combination with two different tracking algorithms. Preliminary results illustrate the potential of the proposed framework, suggesting that the proposed framework generally improves user interaction time, with little change in segmentation repeatability.

  20. An interactive program for computer-aided map design, display, and query: EMAPKGS2

    USGS Publications Warehouse

    Pouch, G.W.

    1997-01-01

    EMAPKGS2 is a user-friendly, PC-based electronic mapping tool for use in hydrogeologic exploration and appraisal. EMAPKGS2 allows the analyst to construct maps interactively from data stored in a relational database, perform point-oriented spatial queries such as locating all wells within a specified radius, perform geographic overlays, and export the data to other programs for further analysis. EMAPKGS2 runs under Microsoft?? Windows??? 3.1 and compatible operating systems. EMAPKGS2 is a public domain program available from the Kansas Geological Survey. EMAPKGS2 is the centerpiece of WHEAT, the Windows-based Hydrogeologic Exploration and Appraisal Toolkit, a suite of user-friendly Microsoft?? Windows??? programs for natural resource exploration and management. The principal goals in development of WHEAT have been ease of use, hardware independence, low cost, and end-user extensibility. WHEAT'S native data format is a Microsoft?? Access?? database. WHEAT stores a feature's geographic coordinates as attributes so they can be accessed easily by the user. The WHEAT programs are designed to be used in conjunction with other Microsoft?? Windows??? software to allow the natural resource scientist to perform work easily and effectively. WHEAT and EMAPKGS have been used at several of Kansas' Groundwater Management Districts and the Kansas Geological Survey on groundwater management operations, groundwater modeling projects, and geologic exploration projects. ?? 1997 Elsevier Science Ltd.

  1. Global mapping of protein-DNA interactions in vivo by digital genomic footprinting.

    PubMed

    Hesselberth, Jay R; Chen, Xiaoyu; Zhang, Zhihong; Sabo, Peter J; Sandstrom, Richard; Reynolds, Alex P; Thurman, Robert E; Neph, Shane; Kuehn, Michael S; Noble, William S; Fields, Stanley; Stamatoyannopoulos, John A

    2009-04-01

    The orchestrated binding of transcriptional activators and repressors to specific DNA sequences in the context of chromatin defines the regulatory program of eukaryotic genomes. We developed a digital approach to assay regulatory protein occupancy on genomic DNA in vivo by dense mapping of individual DNase I cleavages from intact nuclei using massively parallel DNA sequencing. Analysis of >23 million cleavages across the Saccharomyces cerevisiae genome revealed thousands of protected regulatory protein footprints, enabling de novo derivation of factor binding motifs and the identification of hundreds of new binding sites for major regulators. We observed striking correspondence between single-nucleotide resolution DNase I cleavage patterns and protein-DNA interactions determined by crystallography. The data also yielded a detailed view of larger chromatin features including positioned nucleosomes flanking factor binding regions. Digital genomic footprinting should be a powerful approach to delineate the cis-regulatory framework of any organism with an available genome sequence.

  2. An interactive Barnes objective map analysis scheme for use with satellite and conventional data

    NASA Technical Reports Server (NTRS)

    Koch, S. E.; Desjardins, M.; Kocin, P. J.

    1983-01-01

    The Barnes (1973) objective map analysis scheme is employed to develop an interactive analysis package for assessing the impact of satellite-derived data on analyses of conventional meteorological data sets. The method permits modification of the values of input parameters in the objective analysis within objectively determined, internally set limits. The effects of the manipulations are rapidly displayed, and methods are included for assimilating the spatially clustered characteristics of satellite data and the various horizontal resolutions of the data types. Data sets from the SESAME rawinsonde wind data with uniform spatial distribution, with the same data set plus satellite cloud motion data, and a data set from the atmospheric sounder radiometer on the GOES satellite were analyzed as examples. The scheme is demonstrated to recover details after two iterations through the data.

  3. Reference map technique for finite-strain elasticity and fluid-solid interaction

    NASA Astrophysics Data System (ADS)

    Kamrin, Ken; Rycroft, Chris H.; Nave, Jean-Christophe

    2012-11-01

    The reference map, defined as the inverse motion function, is utilized in an Eulerian-frame representation of continuum solid mechanics, leading to a simple, explicit finite-difference method for solids undergoing finite deformations. We investigate the accuracy and applicability of the technique for a range of finite-strain elasticity laws under various geometries and loadings. Capacity to model dynamic, static, and quasi-static conditions is shown. Specifications of the approach are demonstrated for handling irregularly shaped and/or moving boundaries, as well as shock solutions. The technique is also integrated within a fluid-solid framework using a level-set to discern phases and using a standard explicit fluid solver for the fluid phases. We employ a sharp-interface method to institute the interfacial conditions, and the resulting scheme is shown to efficiently capture fluid-solid interaction solutions in several examples.

  4. BrainMaps.org - Interactive High-Resolution Digital Brain Atlases and Virtual Microscopy.

    PubMed

    Mikula, Shawn; Stone, James M; Jones, Edward G

    2008-01-01

    BrainMaps.org is an interactive high-resolution digital brain atlas and virtual microscope that is based on over 20 million megapixels of scanned images of serial sections of both primate and non-primate brains and that is integrated with a high-speed database for querying and retrieving data about brain structure and function over the internet. Complete brain datasets for various species, including Homo sapiens, Macaca mulatta, Chlorocebus aethiops, Felis catus, Mus musculus, Rattus norvegicus, and Tyto alba, are accessible online. The methods and tools we describe are useful for both research and teaching, and can be replicated by labs seeking to increase accessibility and sharing of neuroanatomical data. These tools offer the possibility of visualizing and exploring completely digitized sections of brains at a sub-neuronal level, and can facilitate large-scale connectional tracing, histochemical and stereological analyses.

  5. Protein-Protein Interactions in the Yeast Pheromone Response Pathway: Ste5p Interacts with All Members of the Map Kinase Cascade

    PubMed Central

    Printen, J. A.; Sprague-Jr., G. F.

    1994-01-01

    We have used the two-hybrid system of Fields and Song to identify protein-protein interactions that occur in the pheromone response pathway of the yeast Saccharomyces cerevisiae. Pathway components Ste4p, Ste5p, Ste7p, Ste11p, Ste12p, Ste20p, Fus3p and Kss1p were tested in all pairwise combinations. All of the interactions we detected involved at least one member of the MAP kinase cascade that is a central element of the response pathway. Ste5p, a protein of unknown biochemical function, interacted with protein kinases that operate at each step of the MAP kinase cascade, specifically with Ste11p (an MEKK), Ste7p (an MEK), and Fus3p (a MAP kinase). This finding suggests that one role of Ste5p is to serve as a scaffold to facilitate interactions among members of the kinase cascade. In this role as facilitator, Ste5p may make both signal propagation and signal attenuation more efficient. Ste5p may also help minimize cross-talk with other MAP kinase cascades and thus ensure the integrity of the pheromone response pathway. We also found that both Ste11p and Ste7p interact with Fus3p and Kss1p. Finally, we detected an interaction between one of the MAP kinases, Kss1p, and a presumptive target, the transcription factor Ste12p. We failed to detect interactions of Ste4p or Ste20p with any other component of the response pathway. PMID:7851759

  6. Genetic mapping of social interaction behavior in B6/MSM consomic mouse strains.

    PubMed

    Takahashi, Aki; Tomihara, Kazuya; Shiroishi, Toshihiko; Koide, Tsuyoshi

    2010-05-01

    Genetic studies are indispensable for understanding the mechanisms by which individuals develop differences in social behavior. We report genetic mapping of social interaction behavior using inter-subspecific consomic strains established from MSM/Ms (MSM) and C57BL/6J (B6) mice. Two animals of the same strain and sex, aged 10 weeks, were introduced into a novel open-field for 10 min. Social contact was detected by an automated system when the distance between the centers of the two animals became less than approximately 12 cm. In addition, detailed behavioral observations were made of the males. The wild-derived mouse strain MSM showed significantly longer social contact as compared to B6. Analysis of the consomic panel identified two chromosomes (Chr 6 and Chr 17) with quantitative trait loci (QTL) responsible for lengthened social contact in MSM mice and two chromosomes (Chr 9 and Chr X) with QTL that inhibited social contact. Detailed behavioral analysis of males identified four additional chromosomes associated with social interaction behavior. B6 mice that contained Chr 13 from MSM showed more genital grooming and following than the parental B6 strain, whereas the presence of Chr 8 and Chr 12 from MSM resulted in a reduction of those behaviors. Longer social sniffing was observed in Chr 4 consomic strain than in B6 mice. Although the frequency was low, aggressive behavior was observed in a few pairs from consomic strains for Chrs 4, 13, 15 and 17, as well as from MSM. The social interaction test has been used as a model to measure anxiety, but genetic correlation analysis suggested that social interaction involves different aspects of anxiety than are measured by open-field test.

  7. Forest Types in the Lower Suwannee River Floodplain, Florida?-A Report and Interactive Map

    USGS Publications Warehouse

    Darst, M.R.; Light, H.M.; Lewis, L.J.; Sepulveda, A.A.

    2003-01-01

    A map of forest types in the lower Suwannee River floodplain, Florida, was created during a study conducted from 1996 to 2000 by the U.S. Geological Survey in cooperation with the Suwannee River Water Management District. The map is presented with this report on a compact disc with interactive viewing software. The forest map can be used by scientists for ecological studies in the floodplain based on land cover types and by landowners and management personnel making land use decisions. The study area is the 10-year floodplain of the lower Suwannee River from its confluence with the Santa Fe River to the lower limit of forests near the Gulf of Mexico. The floodplain is divided into three reaches: riverine (non-tidal), upper tidal, and lower tidal, due to changes in hydrology, vegetation, and soils with proximity to the coast. The 10-year floodplain covers about 21,170 hectares; nearly 88 percent of this area (18,580 hectares) is mapped as 14 major forest types. Approximately 29 percent (5,319 hectares) of these forests have been altered by agriculture or development. About 75 percent of the area of major forest types (13,994 hectares) is wetland forests and about 25 percent (4,586 hectares) is upland forests. Tidal wetland forests (8,955 hectares) cover a much greater area than riverine wetland forests (5,039 hectares). Oak/pine upland forests are present in the riverine and upper tidal reaches of the floodplain on elevations that are inundated only briefly during the highest floods. High bottomland hardwoods are present on the higher levees, ridges, and flats of the riverine reach where soils are usually sandy. Low bottomland hardwood forests are present in the riverine reach on swamp margins and low levees and flats that are flooded continuously for several weeks or longer every 1 to 3 years. Riverine swamps are present in the lowest and wettest areas of the non-tidal floodplain that are either inundated or saturated most of the time. Upper tidal bottomland

  8. An interactive mapping tool for visualizing lacunarity of laser scanned point clouds

    NASA Astrophysics Data System (ADS)

    Kania, Adam; Székely, Balázs

    2016-04-01

    Lacunarity, a measure of the spatial distribution of the empty space in a certain model or real space over large spatial scales, is found to be a useful descriptive quantity in many fields using imagery, including, among others, geology, dentistry, neurology. Its application in ecology was suggested more than 20 years ago. The main problem of its application was the lack of appropriate high resolution data. Nowadays, full-waveform laser scanning, also known as FWF LiDAR, provides the tool for mapping the vegetation in unprecedented details and accuracy. Consequently, the lacunarity concept can be revitalized, in order to study the structure of the vegetation in this sense as well. Calculation of lacunarity, even if it is done in two dimensions (2D), is still has its problems: on one hand it is a number-crunching procedure, on the other hand, it produces 4D results: at each 3D point it returns a set of data that are function of scale. These data sets are difficult to visualize, to evaluate, and to compare. In order to solve this problem, an interactive mapping tool has been conceptualized that is designed to manipulate and visualize the data, lets the user set parameters for best visualization or comparison results. The system is able to load large amounts of data, visualize them as lacunarity curves, or map view as horizontal slices or in 3D point clouds coloured according to the user's choice. Lacunarity maps are presented as a series of (usually) horizontal profiles, e.g. rasters, which cells contain color-mapped values of selected lacunarity of the point cloud. As lacunarity is usually analysed in a series of successive windows sizes, the tool can show a series of rasters with sequentially animated lacunarity maps calculated for various window sizes. A very fast switching of colour schemes is possible to facilitate rapid visual feedback to better understand underlying data patterns exposed by lacunarity functions. In the comparison mode, two sites (or two areas

  9. Bayesian model choice and search strategies for mapping interacting quantitative trait Loci.

    PubMed Central

    Yi, Nengjun; Xu, Shizhong; Allison, David B

    2003-01-01

    Most complex traits of animals, plants, and humans are influenced by multiple genetic and environmental factors. Interactions among multiple genes play fundamental roles in the genetic control and evolution of complex traits. Statistical modeling of interaction effects in quantitative trait loci (QTL) analysis must accommodate a very large number of potential genetic effects, which presents a major challenge to determining the genetic model with respect to the number of QTL, their positions, and their genetic effects. In this study, we use the methodology of Bayesian model and variable selection to develop strategies for identifying multiple QTL with complex epistatic patterns in experimental designs with two segregating genotypes. Specifically, we develop a reversible jump Markov chain Monte Carlo algorithm to determine the number of QTL and to select main and epistatic effects. With the proposed method, we can jointly infer the genetic model of a complex trait and the associated genetic parameters, including the number, positions, and main and epistatic effects of the identified QTL. Our method can map a large number of QTL with any combination of main and epistatic effects. Utility and flexibility of the method are demonstrated using both simulated data and a real data set. Sensitivity of posterior inference to prior specifications of the number and genetic effects of QTL is investigated. PMID:14573494

  10. Process maps for plasma spray: Part 1: Plasma-particle interactions

    SciTech Connect

    GILMORE,DELWYN L.; NEISER JR.,RICHARD A.; WAN,YUEPENG; SAMPATH,SANJAY

    2000-01-26

    This is the first paper of a two part series based on an integrated study carried out at Sandia National Laboratories and the State University of New York at Stony Brook. The aim of the study is to develop a more fundamental understanding of plasma-particle interactions, droplet-substrate interactions, deposit formation dynamics and microstructural development as well as final deposit properties. The purpose is to create models that can be used to link processing to performance. Process maps have been developed for air plasma spray of molybdenum. Experimental work was done to investigate the importance of such spray parameters as gun current, auxiliary gas flow, and powder carrier gas flow. In-flight particle diameters, temperatures, and velocities were measured in various areas of the spray plume. Samples were produced for analysis of microstructures and properties. An empirical model was developed, relating the input parameters to the in-flight particle characteristics. Multi-dimensional numerical simulations of the plasma gas flow field and in-flight particles under different operating conditions were also performed. In addition to the parameters which were experimentally investigated, the effect of particle injection velocity was also considered. The simulation results were found to be in good general agreement with the experimental data.

  11. Mapping Strain-rate Dependent Dislocation-Defect Interactions by Atomistic Simulations

    SciTech Connect

    Fan, Yue; Osetskiy, Yury N; Yip, Sidney; Yildiz-Botterud, Bilge

    2013-01-01

    Probing the mechanisms of defect-defect interactions at strain rates lower than 106 s-1 is an unresolved challenge to date to molecular dynamics (MD) techniques. Here we propose a novel atomistic approach based on transition state theory and the concept of a strain-dependent effective activation barrier that is capable of simulating the kinetics of dislocation-defect interactions at virtually any strain rate, exemplified within 10-7 to 107 s-1. We apply this approach to the problem of an edge dislocation colliding with a cluster of self-interstitial atoms (SIA) under shear deformation. Using an activation-relaxation algorithm (1), we uncover a unique strain-rate dependent trigger mechanism that allows the SIA cluster to be absorbed during the process leading to dislocation climb. Guided by this finding, we determine the activation barrier of the trigger mechanism as a function of shear strain, and use that in a coarse-graining rate equation formulation for constructing a mechanism map in the phase space of strain-rate and temperature. Our predictions of a crossover from a defect recovery at the low strain rate regime to defect absorption behavior in the high strain-rate regime are validated against our own independent, direct MD simulations at 105 to 107 s-1. Implications of the present approach for probing molecular-level mechanisms in strain-rate regimes previously considered inaccessible to atomistic simulations are discussed.

  12. Mapping strain rate dependence of dislocation-defect interactions by atomistic simulations

    PubMed Central

    Fan, Yue; Osetskiy, Yuri N.; Yip, Sidney; Yildiz, Bilge

    2013-01-01

    Probing the mechanisms of defect–defect interactions at strain rates lower than 106 s−1 is an unresolved challenge to date to molecular dynamics (MD) techniques. Here we propose an original atomistic approach based on transition state theory and the concept of a strain-dependent effective activation barrier that is capable of simulating the kinetics of dislocation–defect interactions at virtually any strain rate, exemplified within 10−7 to 107 s−1. We apply this approach to the problem of an edge dislocation colliding with a cluster of self-interstitial atoms (SIAs) under shear deformation. Using an activation–relaxation algorithm [Kushima A, et al. (2009) J Chem Phys 130:224504], we uncover a unique strain-rate–dependent trigger mechanism that allows the SIA cluster to be absorbed during the process, leading to dislocation climb. Guided by this finding, we determine the activation barrier of the trigger mechanism as a function of shear strain, and use that in a coarse-graining rate equation formulation for constructing a mechanism map in the phase space of strain rate and temperature. Our predictions of a crossover from a defect recovery at the low strain-rate regime to defect absorption behavior in the high strain-rate regime are validated against our own independent, direct MD simulations at 105 to 107 s−1. Implications of the present approach for probing molecular-level mechanisms in strain-rate regimes previously considered inaccessible to atomistic simulations are discussed. PMID:24114271

  13. The use of interactive graphical maps for browsing medical/health Internet information resources.

    PubMed

    Boulos, Maged N Kamel

    2003-01-10

    As online information portals accumulate metadata descriptions of Web resources, it becomes necessary to develop effective ways for visualising and navigating the resultant huge metadata repositories as well as the different semantic relationships and attributes of described Web resources. Graphical maps provide a good method to visualise, understand and navigate a world that is too large and complex to be seen directly like the Web. Several examples of maps designed as a navigational aid for Web resources are presented in this review with an emphasis on maps of medical and health-related resources. The latter include HealthCyberMap maps http://healthcybermap.semanticweb.org/, which can be classified as conceptual information space maps, and the very abstract and geometric Visual Net maps of PubMed http://pubmed.antarcti.ca/start. Information resources can be also organised and navigated based on their geographic attributes. Some of the maps presented in this review use a Kohonen Self-Organising Map algorithm, and only HealthCyberMap uses a Geographic Information System to classify Web resource data and render the maps. Maps based on familiar metaphors taken from users' everyday life are much easier to understand. Associative and pictorial map icons that enable instant recognition and comprehension are preferred to geometric ones and are key to successful maps for browsing medical/health Internet information resources.

  14. COREMAP: Graphical user interface for displaying reactor core data in an interactive hexagon map

    SciTech Connect

    Muscat, F.L.; Derstine, K.L.

    1995-06-01

    COREMAP is a Graphical User Interface (GUI) designed to assist users read and check reactor core data from multidimensional neutronic simulation models in color and/or as text in an interactive 2D planar grid of hexagonal subassemblies. COREMAP is a complete GEODST/RUNDESC viewing tool which enables the user to access multi data set files (e.g. planes, moments, energy groups ,... ) and display up to two data sets simultaneously, one as color and the other as text. The user (1) controls color scale characteristics such as type (linear or logarithmic) and range limits, (2) controls the text display based upon conditional statements on data spelling, and value. (3) chooses zoom features such as core map size, number of rings and surrounding subassemblies, and (4) specifies the data selection for supplied popup subwindows which display a selection of data currently off-screen for a selected cell, as a list of data and/or as a graph. COREMAP includes a RUNDESC file editing tool which creates ``proposed`` Run-description files by point and click revisions to subassembly assignments in an existing EBRII Run-description file. COREMAP includes a fully automated printing option which creates high quality PostScript color or greyscale images of the core map independent of the monitor used, e.g. color prints can be generated with a session from a color or monochrome monitor. The automated PostScript output is an alternative to the xgrabsc based printing option. COREMAP includes a plotting option which creates graphs related to a selected cell. The user specifies the X and Y coordinates types (planes, moment, group, flux ,... ) and a parameter, P, when displaying several curves for the specified (X, Y) pair COREMAP supports hexagonal geometry reactor core configurations specified by: the GEODST file and binary Standard Interface Files and the RUNDESC ordering.

  15. Plume Tracker: Interactive mapping of volcanic sulfur dioxide emissions with high-performance radiative transfer modeling

    NASA Astrophysics Data System (ADS)

    Realmuto, Vincent J.; Berk, Alexander

    2016-11-01

    We describe the development of Plume Tracker, an interactive toolkit for the analysis of multispectral thermal infrared observations of volcanic plumes and clouds. Plume Tracker is the successor to MAP_SO2, and together these flexible and comprehensive tools have enabled investigators to map sulfur dioxide (SO2) emissions from a number of volcanoes with TIR data from a variety of airborne and satellite instruments. Our objective for the development of Plume Tracker was to improve the computational performance of the retrieval procedures while retaining the accuracy of the retrievals. We have achieved a 300 × improvement in the benchmark performance of the retrieval procedures through the introduction of innovative data binning and signal reconstruction strategies, and improved the accuracy of the retrievals with a new method for evaluating the misfit between model and observed radiance spectra. We evaluated the accuracy of Plume Tracker retrievals with case studies based on MODIS and AIRS data acquired over Sarychev Peak Volcano, and ASTER data acquired over Kilauea and Turrialba Volcanoes. In the Sarychev Peak study, the AIRS-based estimate of total SO2 mass was 40% lower than the MODIS-based estimate. This result was consistent with a 45% reduction in the AIRS-based estimate of plume area relative to the corresponding MODIS-based estimate. In addition, we found that our AIRS-based estimate agreed with an independent estimate, based on a competing retrieval technique, within a margin of ± 20%. In the Kilauea study, the ASTER-based concentration estimates from 21 May 2012 were within ± 50% of concurrent ground-level concentration measurements. In the Turrialba study, the ASTER-based concentration estimates on 21 January 2012 were in exact agreement with SO2 concentrations measured at plume altitude on 1 February 2012.

  16. Interaction between Solar Wind and Lunar Magnetic Anomalies observed by Kaguya MAP-PACE

    NASA Astrophysics Data System (ADS)

    Saito, Yoshifumi; Yokota, Shoichiro; Tanaka, Takaaki; Asamura, Kazushi; Nishino, Masaki; Yamamoto, Tadateru; Uemura, Kota; Tsunakawa, Hideo

    2010-05-01

    It is known that Moon has neither global intrinsic magnetic field nor thick atmosphere. Different from the Earth's case where the intrinsic global magnetic field prevents the solar wind from penetrating into the magnetosphere, solar wind directly impacts the lunar surface. Since the discovery of the lunar crustal magnetic field in 1960s, several papers have been published concerning the interaction between the solar wind and the lunar magnetic anomalies. MAG/ER on Lunar Prospector found heating of the solar wind electrons presumably due to the interaction between the solar wind and the lunar magnetic anomalies and the existence of the mini-magnetosphere was suggested. However, the detailed mechanism of the interaction has been unclear mainly due to the lack of the in-situ observed data of low energy ions. MAgnetic field and Plasma experiment - Plasma energy Angle and Composition Experiment (MAP-PACE) on Kaguya (SELENE) completed its ˜1.5-year observation of the low energy charged particles around the Moon on 10 June, 2009. Kaguya was launched on 14 September 2007 by H2A launch vehicle from Tanegashima Space Center in Japan. Kaguya was inserted into a circular lunar polar orbit of 100km altitude and continued observation for nearly 1.5 years till it impacted the Moon on 10 June 2009. During the last 5 months, the orbit was lowered to ˜50km-altitude between January 2009 and April 2009, and some orbits had further lower perilune altitude of ˜10km after April 2009. MAP-PACE consisted of 4 sensors: ESA (Electron Spectrum Analyzer)-S1, ESA-S2, IMA (Ion Mass Analyzer), and IEA (Ion Energy Analyzer). All the sensors performed quite well as expected from the laboratory experiment carried out before launch. Since each sensor had hemispherical field of view, two electron sensors and two ion sensors that were installed on the spacecraft panels opposite to each other could cover full 3-dimensional phase space of low energy electrons and ions. One of the ion sensors IMA was

  17. Phosphorylation of the Kinase Interaction Motif in Mitogen-activated Protein (MAP) Kinase Phosphatase-4 Mediates Cross-talk between Protein Kinase A and MAP Kinase Signaling Pathways*

    PubMed Central

    Dickinson, Robin J.; Delavaine, Laurent; Cejudo-Marín, Rocío; Stewart, Graeme; Staples, Christopher J.; Didmon, Mark P.; Trinidad, Antonio Garcia; Alonso, Andrés; Pulido, Rafael; Keyse, Stephen M.

    2011-01-01

    MAP kinase phosphatase 4 (DUSP9/MKP-4) plays an essential role during placental development and is one of a subfamily of three closely related cytoplasmic dual-specificity MAPK phosphatases, which includes the ERK-specific enzymes DUSP6/MKP-3 and DUSP7/MKP-X. However, unlike DUSP6/MKP-3, DUSP9/MKP-4 also inactivates the p38α MAP kinase both in vitro and in vivo. Here we demonstrate that inactivation of both ERK1/2 and p38α by DUSP9/MKP-4 is mediated by a conserved arginine-rich kinase interaction motif located within the amino-terminal non-catalytic domain of the protein. Furthermore, DUSP9/MKP-4 is unique among these cytoplasmic MKPs in containing a conserved PKA consensus phosphorylation site 55RRXSer-58 immediately adjacent to the kinase interaction motif. DUSP9/MKP-4 is phosphorylated on Ser-58 by PKA in vitro, and phosphorylation abrogates the binding of DUSP9/MKP-4 to both ERK2 and p38α MAP kinases. In addition, although mutation of Ser-58 to either alanine or glutamic acid does not affect the intrinsic catalytic activity of DUSP9/MKP-4, phospho-mimetic (Ser-58 to Glu) substitution inhibits both the interaction of DUSP9/MKP-4 with ERK2 and p38α in vivo and its ability to dephosphorylate and inactivate these MAP kinases. Finally, the use of a phospho-specific antibody demonstrates that endogenous DUSP9/MKP-4 is phosphorylated on Ser-58 in response to the PKA agonist forskolin and is also modified in placental tissue. We conclude that DUSP9/MKP-4 is a bona fide target of PKA signaling and that attenuation of DUSP9/MKP-4 function can mediate cross-talk between the PKA pathway and MAPK signaling through both ERK1/2 and p38α in vivo. PMID:21908610

  18. Reconstructing Genome-Wide Protein–Protein Interaction Networks Using Multiple Strategies with Homologous Mapping

    PubMed Central

    Lo, Yu-Shu; Huang, Sing-Han; Luo, Yong-Chun; Lin, Chun-Yu; Yang, Jinn-Moon

    2015-01-01

    Background One of the crucial steps toward understanding the biological functions of a cellular system is to investigate protein–protein interaction (PPI) networks. As an increasing number of reliable PPIs become available, there is a growing need for discovering PPIs to reconstruct PPI networks of interesting organisms. Some interolog-based methods and homologous PPI families have been proposed for predicting PPIs from the known PPIs of source organisms. Results Here, we propose a multiple-strategy scoring method to identify reliable PPIs for reconstructing the mouse PPI network from two well-known organisms: human and fly. We firstly identified the PPI candidates of target organisms based on homologous PPIs, sharing significant sequence similarities (joint E-value ≤ 1 × 10−40), from source organisms using generalized interolog mapping. These PPI candidates were evaluated by our multiple-strategy scoring method, combining sequence similarities, normalized ranks, and conservation scores across multiple organisms. According to 106,825 PPI candidates in yeast derived from human and fly, our scoring method can achieve high prediction accuracy and outperform generalized interolog mapping. Experiment results show that our multiple-strategy score can avoid the influence of the protein family size and length to significantly improve PPI prediction accuracy and reflect the biological functions. In addition, the top-ranked and conserved PPIs are often orthologous/essential interactions and share the functional similarity. Based on these reliable predicted PPIs, we reconstructed a comprehensive mouse PPI network, which is a scale-free network and can reflect the biological functions and high connectivity of 292 KEGG modules, including 216 pathways and 76 structural complexes. Conclusions Experimental results show that our scoring method can improve the predicting accuracy based on the normalized rank and evolutionary conservation from multiple organisms. Our predicted

  19. Using Student Interactions to Foster Rule-Diagram Mapping during Problem Solving in an Intelligent Tutoring System

    ERIC Educational Resources Information Center

    Butcher, Kirsten R.; Aleven, Vincent

    2013-01-01

    In many domains, problem solving involves the application of general domain principles to specific problem representations. In 3 classroom studies with an intelligent tutoring system, we examined the impact of (learner-generated) interactions and (tutor-provided) visual cues designed to facilitate rule-diagram mapping (where students connect…

  20. Using Concept Maps as Instructional Materials to Foster the Understanding of the Atomic Model and Matter-Energy Interaction

    ERIC Educational Resources Information Center

    Aguiar, Joana G.; Correia, Paulo R. M.

    2016-01-01

    In this paper, we explore the use of concept maps (Cmaps) as instructional materials prepared by teachers, to foster the understanding of chemistry. We choose fireworks as a macroscopic event to teach basic chemical principles related to the Bohr atomic model and matter-energy interaction. During teachers' Cmap navigation, students can experience…

  1. Building disease-specific drug-protein connectivity maps from molecular interaction networks and PubMed abstracts.

    PubMed

    Li, Jiao; Zhu, Xiaoyan; Chen, Jake Yue

    2009-07-01

    The recently proposed concept of molecular connectivity maps enables researchers to integrate experimental measurements of genes, proteins, metabolites, and drug compounds under similar biological conditions. The study of these maps provides opportunities for future toxicogenomics and drug discovery applications. We developed a computational framework to build disease-specific drug-protein connectivity maps. We integrated gene/protein and drug connectivity information based on protein interaction networks and literature mining, without requiring gene expression profile information derived from drug perturbation experiments on disease samples. We described the development and application of this computational framework using Alzheimer's Disease (AD) as a primary example in three steps. First, molecular interaction networks were incorporated to reduce bias and improve relevance of AD seed proteins. Second, PubMed abstracts were used to retrieve enriched drug terms that are indirectly associated with AD through molecular mechanistic studies. Third and lastly, a comprehensive AD connectivity map was created by relating enriched drugs and related proteins in literature. We showed that this molecular connectivity map development approach outperformed both curated drug target databases and conventional information retrieval systems. Our initial explorations of the AD connectivity map yielded a new hypothesis that diltiazem and quinidine may be investigated as candidate drugs for AD treatment. Molecular connectivity maps derived computationally can help study molecular signature differences between different classes of drugs in specific disease contexts. To achieve overall good data coverage and quality, a series of statistical methods have been developed to overcome high levels of data noise in biological networks and literature mining results. Further development of computational molecular connectivity maps to cover major disease areas will likely set up a new model for

  2. Mapping Region of Human Restriction Factor APOBEC3H Critical for Interaction with HIV-1 Vif.

    PubMed

    Nakashima, Masaaki; Tsuzuki, Shinya; Awazu, Hiroaki; Hamano, Akiko; Okada, Ayaka; Ode, Hirotaka; Maejima, Masami; Hachiya, Atsuko; Yokomaku, Yoshiyuki; Watanabe, Nobuhisa; Akari, Hirofumi; Iwatani, Yasumasa

    2017-03-21

    The APOBEC3 (A3) family of cellular cytidine deaminases comprises seven members (A, B, C, D, F, G, and H) that potently inhibit retroviral replication. Human immunodeficiency virus type 1 (HIV-1) Vif is a small pleiotropic protein that specifically inactivates these enzymes, targeting them for ubiquitin-mediated proteasomal degradation. A3 Vif-interaction sites are presumed to fall into three distinct types: A3C/D/F, A3G, and A3H. To date, two types of A3G and A3C/D/F sites have been well characterized, whereas the A3H Vif-binding site remains poorly defined. Here, we explore the residues critical for the A3H-type Vif interaction. To avoid technical difficulties in performing experiments with human A3H haplotype II (hapII), which is relatively resistant to HIV-1 Vif, we employed its ortholog chimpanzee A3H (cA3H), which displays high Vif sensitivity, for a comparison of sensitivity with that of A3H hapII. The Vif susceptibility of A3H hapII-cA3H chimeras and their substitution mutants revealed a single residue at position 97 as a major determinant for the difference in their Vif sensitivities. We further surveyed critical residues by structure-guided mutagenesis using an A3H structural model and thus identified eight additional residues important for Vif sensitivity, which mapped to the α3 and α4 helices of A3H. Interestingly, this area is located on a surface adjacent to the A3G and A3C/D/F interfaces and is composed of negatively charged and hydrophobic patches. These findings suggest that HIV-1 Vif has evolved to utilize three dispersed surfaces for recognizing three types of interfaces on A3 proteins under certain structural constraints.

  3. MC EMiNEM maps the interaction landscape of the Mediator.

    PubMed

    Niederberger, Theresa; Etzold, Stefanie; Lidschreiber, Michael; Maier, Kerstin C; Martin, Dietmar E; Fröhlich, Holger; Cramer, Patrick; Tresch, Achim

    2012-01-01

    The Mediator is a highly conserved, large multiprotein complex that is involved essentially in the regulation of eukaryotic mRNA transcription. It acts as a general transcription factor by integrating regulatory signals from gene-specific activators or repressors to the RNA Polymerase II. The internal network of interactions between Mediator subunits that conveys these signals is largely unknown. Here, we introduce MC EMiNEM, a novel method for the retrieval of functional dependencies between proteins that have pleiotropic effects on mRNA transcription. MC EMiNEM is based on Nested Effects Models (NEMs), a class of probabilistic graphical models that extends the idea of hierarchical clustering. It combines mode-hopping Monte Carlo (MC) sampling with an Expectation-Maximization (EM) algorithm for NEMs to increase sensitivity compared to existing methods. A meta-analysis of four Mediator perturbation studies in Saccharomyces cerevisiae, three of which are unpublished, provides new insight into the Mediator signaling network. In addition to the known modular organization of the Mediator subunits, MC EMiNEM reveals a hierarchical ordering of its internal information flow, which is putatively transmitted through structural changes within the complex. We identify the N-terminus of Med7 as a peripheral entity, entailing only local structural changes upon perturbation, while the C-terminus of Med7 and Med19 appear to play a central role. MC EMiNEM associates Mediator subunits to most directly affected genes, which, in conjunction with gene set enrichment analysis, allows us to construct an interaction map of Mediator subunits and transcription factors.

  4. Geochemical mapping of magmatic gas water rock interactions in the aquifer of Mount Etna volcano

    NASA Astrophysics Data System (ADS)

    Brusca, L.; Aiuppa, A.; D'Alessandro, W.; Parello, F.; Allard, P.; Michel, A.

    2001-08-01

    Systematic analysis of major and minor elements in groundwaters from springs and wells on the slopes of Mt. Etna in 1995-1998 provides a detailed geochemical mapping of the aquifer of the volcano and of the interactions between magmatic gas, water bodies and their host rocks. Strong spatial correlations between the largest anomalies in pCO 2 (pH and alkalinity) K, Rb, Mg, Ca and Sr suggest a dominating control by magmatic gas (CO 2) and consequent basalt leaching by acidified waters of the shallow (meteoric) Etnean aquifer. Most groundwaters displaying this magmatic-type interaction discharge within active faulted zones on the S-SW and E lower flanks of the volcanic pile, but also in a newly recognised area on the northern flank, possibly tracking a main N-S volcano-tectonic structure. In the same time, the spatial distribution of T°C, TDS, Na, Li, Cl and B allows us to identify the existence of a deeper thermal brine with high salinity, high content of B, Cl and gases (CO 2, H 2S, CH 4) and low K/Na ratio, which is likely hosted in the sedimentary basement. This hot brine reaches the surface only at the periphery of the volcano near the Village of Paternò, where it gives rise to mud volcanoes called "Salinelle di Paternò". However, the contribution of similar brines to shallower groundwaters is also detected in other sectors to the W (Bronte, Maletto), SW (Adrano) and SE (Acireale), suggesting its possible widespread occurrence beneath Etna. This thermal brine is also closely associated with hydrocarbon fields all around the volcano and its rise, generally masked by the high outflow of the shallow aquifer, may be driven by the ascent of mixed sedimentary-magmatic gases through the main faults cutting the sedimentary basement.

  5. An interactive mapping tool to assess individual mobility patterns in neighborhood studies.

    PubMed

    Chaix, Basile; Kestens, Yan; Perchoux, Camille; Karusisi, Noëlla; Merlo, Juan; Labadi, Karima

    2012-10-01

    As their most critical limitation, neighborhood and health studies published to date have not taken into account nonresidential activity places where individuals travel in their daily lives. However, identifying low-mobility populations residing in low-resource environments, assessing cumulative environmental exposures over multiple activity places, and identifying specific activity locations for targeting interventions are important for health promotion. Daily mobility has not been given due consideration in part because of a lack of tools to collect locational information on activity spaces. Thus, the first aim of the current article is to describe VERITAS (Visualization and Evaluation of Route Itineraries, Travel Destinations, and Activity Spaces), an interactive web mapping application that can geolocate individuals' activity places, routes between locations, and relevant areas such as experienced or perceived neighborhoods. The second aim is to formalize the theoretic grounds of a contextual expology as a subdiscipline to better assess the spatiotemporal configuration of environmental exposures. Based on activity place data, various indicators of individual patterns of movement in space (spatial behavior) are described. Successive steps are outlined for elaborating variables of multiplace environmental exposure (collection of raw locational information, selection/exclusion of locational data, defining an exposure area for measurement, and calculation). Travel and activity place network areas are discussed as a relevant construct for environmental exposure assessment. Finally, a note of caution is provided that these measures require careful handling to avoid increasing the magnitude of confounding (selective daily mobility bias).

  6. HAZPAC; an interactive map of Pacific Rim natural hazards, population, and infrastructure

    USGS Publications Warehouse

    Bemis, B.L.; Goss, H.V.; Yurkovich, E.S.; Perron, T.J.; Howell, D.G.

    2002-01-01

    This is an online version of a CD-ROM publication. The text files that describe using this publication make reference to software provided on the disc. For this online version the software can be downloaded for free from Adobe Systems and Environmental Systems Research Institute, Inc. (ESRI). Welcome to HAZPAC! HAZPAC is an interactive map about natural hazard risk in the Pacific Rim region. It is intended to communicate to a broad audience the ideas of 'Crowding the Rim,' which is an international, public-private partnership that fosters collaborative solutions for regional risks. HAZPAC, which stands for 'HAZards of the PACific,' uses Geographic Information System (GIS) technology to help people visualize the socioeconomic connections and shared hazard vulnerabilities among Pacific Rim countries, as well as to explore the general nature of risk. Please refer to the 'INTRODUCTION TO HAZPAC' section of the readme file below to determine which HAZPAC project will be right for you. Once you have decided which HAZPAC project is suitable for you, please refer to the 'GETTING STARTED' sections in the readme file for some basic information that will help you begin using HAZPAC. Also, we highly recommend that you follow the Tutorial exercises in the project-specific HAZPAC User Guides. The User Guides are PDF (Portable Document Format) files that must be read with Adobe Acrobat Reader (a free copy of Acrobat Reader is available using the link near the bottom of this page).

  7. An interactive image segmentation method for lithological boundary detection: A rapid mapping tool for geologists

    NASA Astrophysics Data System (ADS)

    Vasuki, Yathunanthan; Holden, Eun-Jung; Kovesi, Peter; Micklethwaite, Steven

    2017-03-01

    Large volumes of images are collected by geoscientists using remote sensing platforms. Manual analysis of these images is a time consuming task and there is a need for fast and robust image interpretation tools. In particular the reliable mapping of lithological boundaries is a critical step for geological interpretation. In this contribution we developed an interactive image segmentation algorithm that harnesses the geologist's input and exploits automated image analysis to provide a practical tool for lithology boundary detection, using photographic images of rock surfaces. In the proposed method, the user is expected to draw rough markings to indicate the locations of different geological units in the image. Image segmentation is performed by segmenting regions based on their homogeneity in colour. This results in a high density of segmented regions which are then iteratively merged based on the colour of different geological units and the user input. Finally, a post-processing step allows the user to edit the boundaries. An experiment was conducted using photographic rock surface images collected by a UAV and a handheld digital camera. The proposed technique was applied to detect lithology boundaries. It was found that the proposed method reduced the interpretation time by a factor of four relative to manual segmentation, while achieving more than 96% similarity in boundary detection. As a result the proposed method has the potential to provide practical support for interpreting large volume of complex geological images.

  8. Carbon Sequestration Atlas and Interactive Maps from the Southwest Regional Partnership on Carbon Sequestration

    DOE Data Explorer

    McPherson, Brian

    In November of 2002, DOE announced a global climate change initiative involving joint government-industry partnerships working together to find sensible, low cost solutions for reducing GHG emissions. As a result, seven regional partnerships were formed; the Southwest Regional Partnership on Carbon Sequestration (SWP) is one of those. These groups are utilizing their expertise to assess sequestration technologies to capture carbon emissions, identify and evaluate appropriate storage locations, and engage a variety of stakeholders in order to increase awareness of carbon sequestration. Stakeholders in this project are made up of private industry, NGOs, the general public, and government entities. There are a total of 44 current organizations represented in the partnership including electric utilities, oil and gas companies, state governments, universities, NGOs, and tribal nations. The SWP is coordinated by New Mexico Tech and encompasses New Mexico, Arizona, Colorado, Oklahoma, Utah, and portions of Kansas, Nevada, Texas, and Wyoming. Field test sites for the region are located in New Mexico (San Juan Basin), Utah (Paradox Basin), and Texas (Permian Basin).[Taken from the SWP C02 Sequestration Atlas] The SWP makes available at this website their CO2 Sequestration Atlas and an interactive data map.

  9. Interactive Web-Based Map: Applications to Large Data Sets in the Geosciences. Interactive Web-Based Map: Applications to Large Data Sets in the Geosciences.

    NASA Astrophysics Data System (ADS)

    Garbow, Z. A.; Olson, N. R.; Yuen, D. A.; Boggs, J. M.

    2001-12-01

    Current advances in computer hardware, information technology and data collection techniques have produced very large data sets, sometimes more than terabytes,in a wide variety of scientific and engineering disciplines. We must harness this opportunity to visualize and extract useful information from geophysical and geological data. We have taken the task of data-mining by using a map-like approach over the web for interrogating the humongous data, using a client-server paradigm. The spatial-data is mapped onto a two-dimensional grid from which the user ( client ) can quiz the data with the map-interface as a user extension . The data is stored on high-end compute server. The computational gateway separating the client and the server can be the front-end of an electronic publication , electronic classroom , a Grid system device or e-business. We have used a combination of JAVA, JAVA-3D and Perl for processing the data and communicating them between the client and the server. The user can interrogate the geospatial data over any particular region with arbitrary length scales and pose relevant statistical questions, such as the histogram plots and local statistics. We have applied this method for the following data sets (1.) distribution of prime numbers (2.) two-dimensional mantle convection (3.) three-dimensional mantle convection (4) high-resolution satellite reflectance data over the Upper Midwest for multiple wavelengths (5) molecular dynamics describing the flow of blood in narrow vessels. Using this map-interface concept, the user can actually interrogate these data over the web. This strategy for dissecting large data-sets can be easily applied to other areas, such as satellite geodesy and earthquake data. This mode of data-query may function in an adequately covered wireless web environment with a transfer rate of around 10 Mbit/sec .

  10. Gene-Environment Interactions Target Mitogen-activated Protein 3 Kinase 1 (MAP3K1) Signaling in Eyelid Morphogenesis*

    PubMed Central

    Mongan, Maureen; Meng, Qinghang; Wang, Jingjing; Kao, Winston W.-Y.; Puga, Alvaro; Xia, Ying

    2015-01-01

    Gene-environment interactions determine the biological outcomes through mechanisms that are poorly understood. Mouse embryonic eyelid closure is a well defined model to study the genetic control of developmental programs. Using this model, we investigated how exposure to dioxin-like environmental pollutants modifies the genetic risk of developmental abnormalities. Our studies reveal that mitogen-activated protein 3 kinase 1 (MAP3K1) signaling is a focal point of gene-environment cross-talk. Dioxin exposure, acting through the aryl hydrocarbon receptor (AHR), blocked eyelid closure in genetic mutants in which MAP3K1 signaling was attenuated but did not disturb this developmental program in either wild type or mutant mice with attenuated epidermal growth factor receptor or WNT signaling. Exposure also markedly inhibited c-Jun phosphorylation in Map3k1+/− embryonic eyelid epithelium, suggesting that dioxin-induced AHR pathways can synergize with gene mutations to inhibit MAP3K1 signaling. Our studies uncover a novel mechanism through which the dioxin-AHR axis interacts with the MAP3K1 signaling pathways during fetal development and provide strong empirical evidence that specific gene alterations can increase the risk of developmental abnormalities driven by environmental pollutant exposure. PMID:26109068

  11. NeuroMap: A Spline-Based Interactive Open-Source Software for Spatiotemporal Mapping of 2D and 3D MEA Data.

    PubMed

    Abdoun, Oussama; Joucla, Sébastien; Mazzocco, Claire; Yvert, Blaise

    2011-01-01

    A major characteristic of neural networks is the complexity of their organization at various spatial scales, from microscopic local circuits to macroscopic brain-scale areas. Understanding how neural information is processed thus entails the ability to study them at multiple scales simultaneously. This is made possible using microelectrodes array (MEA) technology. Indeed, high-density MEAs provide large-scale coverage (several square millimeters) of whole neural structures combined with microscopic resolution (about 50 μm) of unit activity. Yet, current options for spatiotemporal representation of MEA-collected data remain limited. Here we present NeuroMap, a new interactive Matlab-based software for spatiotemporal mapping of MEA data. NeuroMap uses thin plate spline interpolation, which provides several assets with respect to conventional mapping methods used currently. First, any MEA design can be considered, including 2D or 3D, regular or irregular, arrangements of electrodes. Second, spline interpolation allows the estimation of activity across the tissue with local extrema not necessarily at recording sites. Finally, this interpolation approach provides a straightforward analytical estimation of the spatial Laplacian for better current sources localization. In this software, coregistration of 2D MEA data on the anatomy of the neural tissue is made possible by fine matching of anatomical data with electrode positions using rigid-deformation-based correction of anatomical pictures. Overall, NeuroMap provides substantial material for detailed spatiotemporal analysis of MEA data. The package is distributed under GNU General Public License and available at http://sites.google.com/site/neuromapsoftware.

  12. MARs Tools for Interactive ANalysis (MARTIAN): Google Maps Tools for Visual Exploration of Geophysical Modeling on Mars

    NASA Astrophysics Data System (ADS)

    Dimitrova, L. L.; Haines, M.; Holt, W. E.; Schultz, R. A.; Richard, G.; Haines, A. J.

    2006-12-01

    Interactive maps of surface-breaking faults and stress models on Mars provide important tools to engage undergraduate students, educators, and scientists with current geological and geophysical research. We have developed a map based on the Google Maps API -- an Internet based tool combining DHTML and AJAX, -- which allows very large maps to be viewed over the World Wide Web. Typically, small portions of the maps are downloaded as needed, rather than the entire image at once. This set-up enables relatively fast access for users with low bandwidth. Furthermore, Google Maps provides an extensible interactive interface making it ideal for visualizing multiple data sets at the user's choice. The Google Maps API works primarily with data referenced to latitudes and longitudes, which is then mapped in Mercator projection only. We have developed utilities for general cylindrical coordinate systems by converting these coordinates into equivalent Mercator projection before including them on the map. The MARTIAN project is available at http://rock.geo.sunysb.edu/~holt/Mars/MARTIAN/. We begin with an introduction to the Martian surface using a topography model. Faults from several datasets are classified by type (extension vs. compression) and by time epoch. Deviatoric stresses due to gravitational potential energy differences, calculated from the topography and crustal thickness, can be overlain. Several quantitative measures for the fit of the stress field to the faults are also included. We provide introductory text and exercises spanning a range of topics: how are faults identified, what stress is and how it relates to faults, what gravitational potential energy is and how variations in it produce stress, how the models are created, and how these models can be evaluated and interpreted. The MARTIAN tool is used at Stony Brook University in GEO 310: Introduction to Geophysics, a class geared towards junior and senior geosciences majors. Although this project is in its

  13. Interaction between solar wind and lunar magnetic anomalies observed by MAP-PACE on Kaguya

    NASA Astrophysics Data System (ADS)

    Saito, Yoshifumi; Yokota, Shoichiro; Tanaka, Takaaki; Asamura, Kazushi; Nishino, Masaki N.; Yamamoto, Tadateru I.; Tsunakawa, Hideo

    It is well known that the Moon has neither global intrinsic magnetic field nor thick atmosphere. Different from the Earth's case where the intrinsic global magnetic field prevents the solar wind from penetrating into the magnetosphere, solar wind directly impacts the lunar surface. MAgnetic field and Plasma experiment -Plasma energy Angle and Composition Experiment (MAP-PACE) on Kaguya (SELENE) completed its 1.5-year observation of the low energy charged particles around the Moon on 10 June 2009. Kaguya was launched on 14 September 2007 by H2A launch vehicle from Tanegashima Space Center in Japan. Kaguya was inserted into a circular lunar polar orbit of 100km altitude and continued observation for nearly 1.5 years till it impacted the Moon on 10 June 2009. During the last 5 months, the orbit was lowered to 50km-altitude between January 2009 and April 2009, and some orbits had further lower perilune altitude of 10km after April 2009. MAP-PACE consisted of 4 sensors: ESA (Electron Spectrum Analyzer)-S1, ESA-S2, IMA (Ion Mass Analyzer), and IEA (Ion Energy Analyzer). Since each sensor had hemispherical field of view, two electron sensors and two ion sensors that were installed on the spacecraft panels opposite to each other could cover full 3-dimensional phase space of low energy electrons and ions. One of the ion sensors IMA was an energy mass spectrometer. IMA measured mass identified ion energy spectra that had never been obtained at 100km altitude polar orbit around the Moon. When Kaguya flew over South Pole Aitken region, where strong magnetic anomalies exist, solar wind ions reflected by magnetic anomalies were observed. These ions had much higher flux than the solar wind protons scattered at the lunar surface. The magnetically reflected ions had nearly the same energy as the incident solar wind ions while the solar wind protons scattered at the lunar surface had slightly lower energy than the incident solar wind ions. At 100km altitude, when the reflected ions

  14. Genome-wide mapping in a house mouse hybrid zone reveals hybrid sterility loci and Dobzhansky-Muller interactions.

    PubMed

    Turner, Leslie M; Harr, Bettina

    2014-12-09

    Mapping hybrid defects in contact zones between incipient species can identify genomic regions contributing to reproductive isolation and reveal genetic mechanisms of speciation. The house mouse features a rare combination of sophisticated genetic tools and natural hybrid zones between subspecies. Male hybrids often show reduced fertility, a common reproductive barrier between incipient species. Laboratory crosses have identified sterility loci, but each encompasses hundreds of genes. We map genetic determinants of testis weight and testis gene expression using offspring of mice captured in a hybrid zone between M. musculus musculus and M. m. domesticus. Many generations of admixture enables high-resolution mapping of loci contributing to these sterility-related phenotypes. We identify complex interactions among sterility loci, suggesting multiple, non-independent genetic incompatibilities contribute to barriers to gene flow in the hybrid zone.

  15. Genome-wide mapping in a house mouse hybrid zone reveals hybrid sterility loci and Dobzhansky-Muller interactions

    PubMed Central

    Turner, Leslie M; Harr, Bettina

    2014-01-01

    Mapping hybrid defects in contact zones between incipient species can identify genomic regions contributing to reproductive isolation and reveal genetic mechanisms of speciation. The house mouse features a rare combination of sophisticated genetic tools and natural hybrid zones between subspecies. Male hybrids often show reduced fertility, a common reproductive barrier between incipient species. Laboratory crosses have identified sterility loci, but each encompasses hundreds of genes. We map genetic determinants of testis weight and testis gene expression using offspring of mice captured in a hybrid zone between M. musculus musculus and M. m. domesticus. Many generations of admixture enables high-resolution mapping of loci contributing to these sterility-related phenotypes. We identify complex interactions among sterility loci, suggesting multiple, non-independent genetic incompatibilities contribute to barriers to gene flow in the hybrid zone. DOI: http://dx.doi.org/10.7554/eLife.02504.001 PMID:25487987

  16. RICH MAPS

    EPA Science Inventory

    Michael Goodchild recently gave eight reasons why traditional maps are limited as communication devices, and how interactive internet mapping can overcome these limitations. In the past, many authorities in cartography, from Jenks to Bertin, have emphasized the importance of sim...

  17. Protein-protein interaction and gene co-expression maps of ARFs and Aux/IAAs in Arabidopsis

    PubMed Central

    Piya, Sarbottam; Shrestha, Sandesh K.; Binder, Brad; Stewart, C. Neal; Hewezi, Tarek

    2014-01-01

    The phytohormone auxin regulates nearly all aspects of plant growth and development. Based on the current model in Arabidopsis thaliana, Auxin/indole-3-acetic acid (Aux/IAA) proteins repress auxin-inducible genes by inhibiting auxin response transcription factors (ARFs). Experimental evidence suggests that heterodimerization between Aux/IAA and ARF proteins are related to their unique biological functions. The objective of this study was to generate the Aux/IAA-ARF protein-protein interaction map using full length sequences and locate the interacting protein pairs to specific gene co-expression networks in order to define tissue-specific responses of the Aux/IAA-ARF interactome. Pairwise interactions between 19 ARFs and 29 Aux/IAAs resulted in the identification of 213 specific interactions of which 79 interactions were previously unknown. The incorporation of co-expression profiles with protein-protein interaction data revealed a strong correlation of gene co-expression for 70% of the ARF-Aux/IAA interacting pairs in at least one tissue/organ, indicative of the biological significance of these interactions. Importantly, ARF4-8 and 19, which were found to interact with almost all Aux-Aux/IAA showed broad co-expression relationships with Aux/IAA genes, thus, formed the central hubs of the co-expression network. Our analyses provide new insights into the biological significance of ARF-Aux/IAA associations in the morphogenesis and development of various plant tissues and organs. PMID:25566309

  18. A mitochondrial-focused genetic interaction map reveals a scaffold-like complex required for inner membrane organization in mitochondria.

    PubMed

    Hoppins, Suzanne; Collins, Sean R; Cassidy-Stone, Ann; Hummel, Eric; Devay, Rachel M; Lackner, Laura L; Westermann, Benedikt; Schuldiner, Maya; Weissman, Jonathan S; Nunnari, Jodi

    2011-10-17

    To broadly explore mitochondrial structure and function as well as the communication of mitochondria with other cellular pathways, we constructed a quantitative, high-density genetic interaction map (the MITO-MAP) in Saccharomyces cerevisiae. The MITO-MAP provides a comprehensive view of mitochondrial function including insights into the activity of uncharacterized mitochondrial proteins and the functional connection between mitochondria and the ER. The MITO-MAP also reveals a large inner membrane-associated complex, which we term MitOS for mitochondrial organizing structure, comprised of Fcj1/Mitofilin, a conserved inner membrane protein, and five additional components. MitOS physically and functionally interacts with both outer and inner membrane components and localizes to extended structures that wrap around the inner membrane. We show that MitOS acts in concert with ATP synthase dimers to organize the inner membrane and promote normal mitochondrial morphology. We propose that MitOS acts as a conserved mitochondrial skeletal structure that differentiates regions of the inner membrane to establish the normal internal architecture of mitochondria.

  19. Basaltic Magma-Water Interaction on Earth: Recognition Criteria To Aid Planetary Mapping on Mars (Invited)

    NASA Astrophysics Data System (ADS)

    Skilling, I. P.; Graettinger, A. H.; Mercurio, E.; McGarvie, D.; Edwards, B. R.

    2013-12-01

    The interaction of basaltic magma with frozen/liquid water or wet sediment is a very common process on Earth, resulting in a wide array of explosively and non-explosively generated products at the micron to kilometre scale. A variety of products and edifices on Mars have also been interpreted as having formed by such interaction, but with the exception of rootless cones, such interpretations are rarely unequivocal. This talk focuses on terrestrial process recognition criteria at a scale, orientation (vertical) and erosion level that is relevant to Mars geological mapping. In this context, we emphasise intrusions with peperite margins and wide hydrothermal haloes, steep margins of ice-contact lava flows, subaerial-subaqueous lava delta transitions, lava domains with distinctive water-cooled jointing, edifices that are dominated by slumped and rotated beds, and the presence of surrounding fluvial deposits and erosion. The most common products of magma-water interaction on Earth are subaqueously emplaced lava flows, which are dominated by pillow lavas. Though pillows are not easy to distinguish from subaerial pahoehoe toes at the resolution of most remote imagery, they are commonly associated with distinctively jointed lava domains, which are usually on a larger scale, including areas of water-cooled jointing (curvicolumnar, blocky etc), lava-filled tubes, which often display radial jointing, and steep talus deposits of joint-block breccia. Subaqueous basaltic lavas emplaced in an ice-confined environment may also display near-vertical ice-contact margins, draped by curtains of elongate pillows or cavities formed from melting of included ice-blocks. Subaerial lava flows that transition into water also develop large-scale foreset-bedding close to the angle of repose, which should be easily visible, at least in oblique imagery. As the majority of the Martian surface is more deeply eroded than most areas of terrestrial basaltic volcanism, it is important to discuss

  20. A qualitative tool combining an interaction matrix and a GIS to map vulnerability to traffic induced air pollution.

    PubMed

    Mavroulidou, Maria; Hughes, Susan J; Hellawell, Emma E

    2004-04-01

    Local authorities and transport planners need fast and straightforward tools to perform their preliminary air quality assessments. Such tools are required to provide an initial impression of the local air quality and to highlight areas requiring a more rigorous investigation. This paper presents a technique to develop such a tool, for performing an initial assessment of air quality due to traffic in an urban area. The technique combines an interaction matrix methodology as developed for rock engineering systems, with Geographical Information System (GIS) map overlaying. This interaction matrix methodology incorporates a total system approach, which identifies the main parameters and quantifies the interactions between them. Weighting values for these parameters are obtained either through parametric studies, using numerical modelling, or from engineering judgement. These weightings are applied to spatial datasets for a study area using a GIS. The GIS results are presented in the form of a vulnerability map, which highlights the areas susceptible to poor air quality. This visual interpretation of the results is ideal for local authorities, who have to report to a wide range of non-specialists in the field, for example, planners, councillors and the public. The vulnerability map compares favourably with pollutant concentration patterns, obtained from an advanced dispersion model.

  1. Incorporating constraint-based shape models into an interactive system for functional brain mapping.

    PubMed

    Hinshaw, K P; Brinkley, J F

    1998-01-01

    Through intraoperative electrical stimulation mapping, it is possible to identify sites on the surface of the brain that are essential for language function. Interesting correlations have been found between the distribution of these sites and behavioral traits such as verbal IQ. In previous work, tools were developed for building a reconstruction of a patient's cortical surface and using it to recover coordinates of essential language sites. However, considerable expertise was required to produce good reconstructions. This paper describes an improved version of the mapping procedure, in which segmentation is driven by a 3-D shape model. The model-based approach provides more intuitive control over the system, allowing a trained user to complete a surface reconstruction and mapping in about two hours. This level of performance makes it feasible to gather language maps for a large number of patients, which hopefully will lead to significant new findings about language organization in the brain.

  2. Interactive Query Processing in Big Data Systems: A Cross Industry Study of MapReduce Workloads

    DTIC Science & Technology

    2012-04-02

    information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and...MapReduce behavior using existing mental models. We then describe the MapReduce work- load traces (§ 3). The next few sections present empirical evidence...system: − How uniformly or skewed are the data accesses? − How much temporal locality exists ? 2. For workload-level provisioning and load shaping: − How

  3. An Online Interactive Map Service for Displaying Ground-Water Conditions in Arizona

    USGS Publications Warehouse

    Tillman, Fred D; Leake, Stanley A.; Flynn, Marilyn E.; Cordova, Jeffrey T.; Schonauer, Kurt T.

    2007-01-01

    Monitoring the availability of the nation's ground-water supplies is of critical importance to planners and water managers. The general public also has an interest in understanding the status of ground-water conditions, especially in the semi-arid Southwestern United States where much of the water used by municipalities and agriculture comes from the subsurface. Unlike surface-water indicators such as stage or discharge, ground-water conditions may be more difficult to assess and present. Individual well observations may only represent conditions in a limited area surrounding the well and wells may be screened over single or multiple aquifers, further complicating single-well measurement interpretations. Additionally, changes in ground-water conditions may involve time scales ranging from days to many years, depending on recharge, soil properties and depth to the water table. This lack of an easily identifiable ground-water property indicative of current conditions combined with differing time scales of water-level changes makes the presentation of ground-water conditions a difficult task, particularly on a regional basis. One approach is to spatially present several indicators of ground-water conditions that address different time scales and attributes of the aquifer systems. In this report, we describe a publicly-available online interactive map service that presents several different layers of ground-water-conditions information for the alluvial basins in the Lower Colorado River Basin in Arizona (http://montezuma.wr.usgs.gov/website/azgwconditions/). These data layers include wells experiencing water-level decline, wells experiencing water-level rise, recent trends in ground-water levels, change in water level since predevelopment and change in storage since predevelopment. Recent pumpage totals and projected population numbers are also provided for ground-water basins and counties in the region of the Lower Colorado River in Arizona along with a bibliography

  4. Interactive Mapping of the Planets: An Online Activity Using the Google Earth Platform

    NASA Astrophysics Data System (ADS)

    Osinski, G. R.; Gilbert, A.; Harrison, T. N.; Mader, M. M.; Shankar, B.; Tornabene, L. L.

    2013-12-01

    With funding from the Natural Sciences and Engineering Research Council of Canada's PromoScience program and support from the Department of Earth Sciences at The University of Western Ontario, the Centre for Planetary Science and Exploration (CPSX) has developed a new web-based initiative called Interactive Mapping of the Planets (IMAPS). Additional components include in person school visits to deliver inquiry-based workshops, week-long summer camps, and pre-prepared impact rock lending kits, all framed around the IMAPS activity. IMAPS will is now in beta testing mode and will be demonstrated in this session. The general objective of the online activity is for participants to plan and design a rover mission to Mars based on a given mission goal - e.g., to find evidence for past water flow. The activity begins with participants receiving image-analysis training to learn about the different landforms on Mars and which ones are potentially caused by water flow. They then need to pass a short test to show they can consistently identify Martian landforms. From there, the participants choose a landing site and plan a traverse - utilizing the free Google Earth plug-in - and taking into account factors such as hazards and their sites of interest. A mission control blog will provide updates on the status of their mission and a 'choose your rover' option provides the opportunity to unlock more advanced rovers by collaborating with other scientists and rating their missions. Indeed, evaluation of missions will be done using a crowd-sourcing method. In addition to being fully accessible online, CPSX will also target primary- and secondary-school grades in which astronomy and space science is taught. Teachers in K-12 classrooms will be able to sign-up for the activity ahead of time in order to receive a workshop package, which will guide them on how to use the IMAPS online activity with their class. Teachers will be able to set up groups for their classroom so that they can

  5. A Mobile, Map-Based Tasking Interface for Human-Robot Interaction

    DTIC Science & Technology

    2010-12-01

    the one of the fastest but least accurate methods of interaction (Muratore, 1987; Ahlström and Lenman, 1987; Karat et al., 1986) . However, these...claims of Muratore (1987); Ahlström and Lenman (1987); and Karat et al. (1986) which state that touch-based interaction is faster, but less accurate...interaction versus mouse-based interaction were also compared. Once again, the claimes of Muratore (1987); Ahlström and Lenman (1987); and Karat et al

  6. Comprehensive mapping of long-range interactions reveals folding principles of the human genome.

    PubMed

    Lieberman-Aiden, Erez; van Berkum, Nynke L; Williams, Louise; Imakaev, Maxim; Ragoczy, Tobias; Telling, Agnes; Amit, Ido; Lajoie, Bryan R; Sabo, Peter J; Dorschner, Michael O; Sandstrom, Richard; Bernstein, Bradley; Bender, M A; Groudine, Mark; Gnirke, Andreas; Stamatoyannopoulos, John; Mirny, Leonid A; Lander, Eric S; Dekker, Job

    2009-10-09

    We describe Hi-C, a method that probes the three-dimensional architecture of whole genomes by coupling proximity-based ligation with massively parallel sequencing. We constructed spatial proximity maps of the human genome with Hi-C at a resolution of 1 megabase. These maps confirm the presence of chromosome territories and the spatial proximity of small, gene-rich chromosomes. We identified an additional level of genome organization that is characterized by the spatial segregation of open and closed chromatin to form two genome-wide compartments. At the megabase scale, the chromatin conformation is consistent with a fractal globule, a knot-free, polymer conformation that enables maximally dense packing while preserving the ability to easily fold and unfold any genomic locus. The fractal globule is distinct from the more commonly used globular equilibrium model. Our results demonstrate the power of Hi-C to map the dynamic conformations of whole genomes.

  7. Mapping DNA-Lac repressor interaction with ultra-fast optical tweezers

    NASA Astrophysics Data System (ADS)

    Monico, Carina; Tempestini, Alessia; Vanzi, Francesco; Pavone, Francesco S.; Capitanio, Marco

    2015-03-01

    The lac operon is a well-known example of gene expression regulation, based on the specific interaction of Lac repressor protein (LacI) with its target DNA sequence (operator). We recently developed an ultrafast force-clamp laser trap technique capable of probing molecular interactions with sub-ms temporal resolution, under controlled pN-range forces. With this technique, we tested the interaction of LacI with different DNA constructs. Based on position along the DNA sequence, the observed interactions can be interpreted as specific binding to operator sequences and transient interactions with nonspecific sequences.

  8. Double-bottom chaotic map particle swarm optimization based on chi-square test to determine gene-gene interactions.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2014-01-01

    Gene-gene interaction studies focus on the investigation of the association between the single nucleotide polymorphisms (SNPs) of genes for disease susceptibility. Statistical methods are widely used to search for a good model of gene-gene interaction for disease analysis, and the previously determined models have successfully explained the effects between SNPs and diseases. However, the huge numbers of potential combinations of SNP genotypes limit the use of statistical methods for analysing high-order interaction, and finding an available high-order model of gene-gene interaction remains a challenge. In this study, an improved particle swarm optimization with double-bottom chaotic maps (DBM-PSO) was applied to assist statistical methods in the analysis of associated variations to disease susceptibility. A big data set was simulated using the published genotype frequencies of 26 SNPs amongst eight genes for breast cancer. Results showed that the proposed DBM-PSO successfully determined two- to six-order models of gene-gene interaction for the risk association with breast cancer (odds ratio > 1.0; P value <0.05). Analysis results supported that the proposed DBM-PSO can identify good models and provide higher chi-square values than conventional PSO. This study indicates that DBM-PSO is a robust and precise algorithm for determination of gene-gene interaction models for breast cancer.

  9. Double-Bottom Chaotic Map Particle Swarm Optimization Based on Chi-Square Test to Determine Gene-Gene Interactions

    PubMed Central

    Yang, Cheng-Hong; Chang, Hsueh-Wei

    2014-01-01

    Gene-gene interaction studies focus on the investigation of the association between the single nucleotide polymorphisms (SNPs) of genes for disease susceptibility. Statistical methods are widely used to search for a good model of gene-gene interaction for disease analysis, and the previously determined models have successfully explained the effects between SNPs and diseases. However, the huge numbers of potential combinations of SNP genotypes limit the use of statistical methods for analysing high-order interaction, and finding an available high-order model of gene-gene interaction remains a challenge. In this study, an improved particle swarm optimization with double-bottom chaotic maps (DBM-PSO) was applied to assist statistical methods in the analysis of associated variations to disease susceptibility. A big data set was simulated using the published genotype frequencies of 26 SNPs amongst eight genes for breast cancer. Results showed that the proposed DBM-PSO successfully determined two- to six-order models of gene-gene interaction for the risk association with breast cancer (odds ratio > 1.0; P value <0.05). Analysis results supported that the proposed DBM-PSO can identify good models and provide higher chi-square values than conventional PSO. This study indicates that DBM-PSO is a robust and precise algorithm for determination of gene-gene interaction models for breast cancer. PMID:24895547

  10. Mapping Classroom Interactions: A Spatial Approach to Analyzing Patterns of Student Participation

    ERIC Educational Resources Information Center

    Abbot, Sophia; Cook-Sather, Alison; Hein, Carola

    2014-01-01

    This article explores how mapping patterns of student participation in classroom discussion can both illuminate and complicate the dynamic relationships among identity, physical position in the classroom, student engagement, and course content. It draws on the perspectives of an undergraduate in the role of pedagogical consultant, a faculty member…

  11. Interactive remote data processing using Pixelize Wavelet Filtration (PWF-method) and PeriodMap analysis

    NASA Astrophysics Data System (ADS)

    Sych, Robert; Nakariakov, Valery; Anfinogentov, Sergey

    Wavelet analysis is suitable for investigating waves and oscillating in solar atmosphere, which are limited in both time and frequency. We have developed an algorithms to detect this waves by use the Pixelize Wavelet Filtration (PWF-method). This method allows to obtain information about the presence of propagating and non-propagating waves in the data observation (cube images), and localize them precisely in time as well in space. We tested the algorithm and found that the results of coronal waves detection are consistent with those obtained by visual inspection. For fast exploration of the data cube, in addition, we applied early-developed Period- Map analysis. This method based on the Fast Fourier Transform and allows on initial stage quickly to look for "hot" regions with the peak harmonic oscillations and determine spatial distribution at the significant harmonics. We propose the detection procedure of coronal waves separate on two parts: at the first part, we apply the PeriodMap analysis (fast preparation) and than, at the second part, use information about spatial distribution of oscillation sources to apply the PWF-method (slow preparation). There are two possible algorithms working with the data: in automatic and hands-on operation mode. Firstly we use multiply PWF analysis as a preparation narrowband maps at frequency subbands multiply two and/or harmonic PWF analysis for separate harmonics in a spectrum. Secondly we manually select necessary spectral subband and temporal interval and than construct narrowband maps. For practical implementation of the proposed methods, we have developed the remote data processing system at Institute of Solar-Terrestrial Physics, Irkutsk. The system based on the data processing server - http://pwf.iszf.irk.ru. The main aim of this resource is calculation in remote access through the local and/or global network (Internet) narrowband maps of wave's sources both in whole spectral band and at significant harmonics. In addition

  12. Quantitative trait loci mapping of phenotypic plasticity and genotype-environment interactions in plant and insect performance.

    PubMed

    Tétard-Jones, C; Kertesz, M A; Preziosi, R F

    2011-05-12

    Community genetic studies generally ignore the plasticity of the functional traits through which the effect is passed from individuals to the associated community. However, the ability of organisms to be phenotypically plastic allows them to rapidly adapt to changing environments and plasticity is commonly observed across all taxa. Owing to the fitness benefits of phenotypic plasticity, evolutionary biologists are interested in its genetic basis, which could explain how phenotypic plasticity is involved in the evolution of species interactions. Two current ideas exist: (i) phenotypic plasticity is caused by environmentally sensitive loci associated with a phenotype; (ii) phenotypic plasticity is caused by regulatory genes that simply influence the plasticity of a phenotype. Here, we designed a quantitative trait loci (QTL) mapping experiment to locate QTL on the barley genome associated with barley performance when the environment varies in the presence of aphids, and the composition of the rhizosphere. We simultaneously mapped aphid performance across variable rhizosphere environments. We mapped main effects, QTL × environment interaction (QTL×E), and phenotypic plasticity (measured as the difference in mean trait values) for barley and aphid performance onto the barley genome using an interval mapping procedure. We found that QTL associated with phenotypic plasticity were co-located with main effect QTL and QTL×E. We also located phenotypic plasticity QTL that were located separately from main effect QTL. These results support both of the current ideas of how phenotypic plasticity is genetically based and provide an initial insight into the functional genetic basis of how phenotypically plastic traits may still be important sources of community genetic effects.

  13. Interaction of Bacillus subtilis Polynucleotide Phosphorylase and RNase Y: STRUCTURAL MAPPING AND EFFECT ON mRNA TURNOVER.

    PubMed

    Salvo, Elizabeth; Alabi, Shanique; Liu, Bo; Schlessinger, Avner; Bechhofer, David H

    2016-03-25

    Polynucleotide phosphorylase (PNPase), a 3'-to-5' phosphorolytic exoribonuclease, is thought to be the primary enzyme responsible for turnover ofBacillus subtilismRNA. The role of PNPase inB. subtilismRNA decay has been analyzed previously by comparison of mRNA profiles in a wild-type strainversusa strain that is deleted forpnpA, the gene encoding PNPase. Recent studies have provided evidence for a degradosome-like complex inB. subtilisthat is built around the major decay-initiating endonuclease, RNase Y, and there is ample evidence for a strong interaction between PNPase and RNase Y. The role of the PNPase-RNase Y interaction in the exonucleolytic function of PNPase needs to be clarified. We sought to construct aB. subtilisstrain containing a catalytically active PNPase that could not interact with RNase Y. Mapping studies of the PNPase-RNase Y interaction were guided by a homology model ofB. subtilisPNPase based on the known structure of theEscherichia coliPNPase in complex with an RNase E peptide. Mutations inB. subtilisresidues predicted to be involved in RNase Y binding showed a loss of PNPase-RNase Y interaction. Two mRNAs whose decay is dependent on RNase Y and PNPase were examined in strains containing full-length PNPase that was either catalytically active but unable to interact with RNase Y, or catalytically inactive but able to interact with RNase Y. At least for these two mRNAs, disruption of the PNPase-RNase Y interaction did not appear to affect mRNA turnover.

  14. University of California San Francisco (UCSF-1): Chemical-Genetic Interaction Mapping Strategy | Office of Cancer Genomics

    Cancer.gov

    The CTD2 Center at University of California San Francisco (UCSF-1) developed a chemical-genetic interaction mapping strategy to uncover the impact of cancer gene expression on responses to a panel of emerging therapeutics. To study the impact of aberrant gene activity in isolation, they developed an isogenic model of triple-negative breast cancer (TNBC) using the hormone receptor negative MCF10A non-tumorigenic cell line derived from healthy breast tissue which is diploid and largely devoid of somatic alterations.

  15. Human Interactive Analysis Using Video: Mapping the Dynamics of Complex Work Environments.

    ERIC Educational Resources Information Center

    Terrell, William R.; And Others

    1992-01-01

    Explains human interactive analysis as an architecture for using computer interactive technologies in the analysis of complex work environments. A project at the Naval Training Systems Center that used video-audio data to develop a multimedia database is described; the analysis and management of data are discussed; and decision processes are…

  16. Systematic identification and correction of annotation errors in the genetic interaction map of Saccharomyces cerevisiae

    PubMed Central

    Atias, Nir; Kupiec, Martin; Sharan, Roded

    2016-01-01

    The yeast mutant collections are a fundamental tool in deciphering genomic organization and function. Over the last decade, they have been used for the systematic exploration of ∼6 000 000 double gene mutants, identifying and cataloging genetic interactions among them. Here we studied the extent to which these data are prone to neighboring gene effects (NGEs), a phenomenon by which the deletion of a gene affects the expression of adjacent genes along the genome. Analyzing ∼90,000 negative genetic interactions observed to date, we found that more than 10% of them are incorrectly annotated due to NGEs. We developed a novel algorithm, GINGER, to identify and correct erroneous interaction annotations. We validated the algorithm using a comparative analysis of interactions from Schizosaccharomyces pombe. We further showed that our predictions are significantly more concordant with diverse biological data compared to their mis-annotated counterparts. Our work uncovered about 9500 new genetic interactions in yeast. PMID:26602688

  17. MANORAA (Mapping Analogous Nuclei Onto Residue And Affinity) for identifying protein–ligand fragment interaction, pathways and SNPs

    PubMed Central

    Tanramluk, Duangrudee; Narupiyakul, Lalita; Akavipat, Ruj; Gong, Sungsam; Charoensawan, Varodom

    2016-01-01

    Protein–ligand interaction analysis is an important step of drug design and protein engineering in order to predict the binding affinity and selectivity between ligands to the target proteins. To date, there are more than 100 000 structures available in the Protein Data Bank (PDB), of which ∼30% are protein–ligand (MW below 1000 Da) complexes. We have developed the integrative web server MANORAA (Mapping Analogous Nuclei Onto Residue And Affinity) with the aim of providing a user-friendly web interface to assist structural study and design of protein–ligand interactions. In brief, the server allows the users to input the chemical fragments and present all the unique molecular interactions to the target proteins with available three-dimensional structures in the PDB. The users can also link the ligands of interest to assess possible off-target proteins, human variants and pathway information using our all-in-one integrated tools. Taken together, we envisage that the server will facilitate and improve the study of protein–ligand interactions by allowing observation and comparison of ligand interactions with multiple proteins at the same time. (http://manoraa.org). PMID:27131358

  18. Deciphering the stepwise binding mode of HRG1β to HER3 by surface plasmon resonance and interaction map.

    PubMed

    Peess, Carmen; von Proff, Leopold; Goller, Sabine; Andersson, Karl; Gerg, Michael; Malmqvist, Magnus; Bossenmaier, Birgit; Schräml, Michael

    2015-01-01

    For the development of efficient anti-cancer therapeutics against the HER receptor family it is indispensable to understand the mechanistic model of the HER receptor activation upon ligand binding. Due to its high complexity the binding mode of Heregulin 1 beta (HRG1β) with its receptor HER3 is so far not understood. Analysis of the interaction of HRG1β with surface immobilized HER3 extracellular domain by time-resolved Surface Plasmon Resonance (SPR) was so far not interpretable using any regular analysis method as the interaction was highly complex. Here, we show that Interaction Map (IM) made it possible to shed light on this interaction. IM allowed deciphering the rate limiting kinetic contributions from complex SPR sensorgrams and thereby enabling the extraction of discrete kinetic rate components from the apparently heterogeneous interactions. We could resolve details from the complex avidity-driven binding mode of HRG1β with HER3 by using a combination of SPR and IM data. Our findings contribute to the general understanding that a major conformational change of HER3 during its activation is induced by a complex sequential HRG1β docking mode.

  19. Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

    PubMed Central

    Poh, Huay Mei; Peh, Su Qin; Ong, Chin Thing; Zhang, Jingyao; Ruan, Xiaoan; Ruan, Yijun

    2012-01-01

    Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video. PMID:22564980

  20. An autoradiographic map of (3H)diprenorphine binding in rat brain: effects of social interaction

    SciTech Connect

    Panksepp, J.; Bishop, P.

    1981-10-01

    (3H)Diprenorphine binding was analyzed autoradiographically in the brains of 33 day old rat pups. A photographic atlas of diprenorphine binding in the coronal plane is provided to highlight the dispersion of opioid receptor systems through the brain. To determine whether brain opioid release may be induced by social interactions, half the animals were sacrificed following a 30 min period of social interaction while the other half were sacrificed following 30 min of social isolation. Opioid binding was higher in isolate-tested animals than socially-tested ones, suggesting that social interaction may promote endogenous brain opioid release.

  1. Exploring Students' Mapping Behaviors and Interactive Discourses in a Case Diagnosis Problem: Sequential Analysis of Collaborative Causal Map Drawing Processes

    ERIC Educational Resources Information Center

    Lee, Woon Jee

    2012-01-01

    The purpose of this study was to explore the nature of students' mapping and discourse behaviors while constructing causal maps to articulate their understanding of a complex, ill-structured problem. In this study, six graduate-level students were assigned to one of three pair groups, and each pair used the causal mapping software program,…

  2. Novel Genes Affecting the Interaction between the Cabbage Whitefly and Arabidopsis Uncovered by Genome-Wide Association Mapping.

    PubMed

    Broekgaarden, Colette; Bucher, Johan; Bac-Molenaar, Johanna; Keurentjes, Joost J B; Kruijer, Willem; Voorrips, Roeland E; Vosman, Ben

    2015-01-01

    Plants have evolved a variety of ways to defend themselves against biotic attackers. This has resulted in the presence of substantial variation in defense mechanisms among plants, even within a species. Genome-wide association (GWA) mapping is a useful tool to study the genetic architecture of traits, but has so far only had limited exploitation in studies of plant defense. Here, we study the genetic architecture of defense against the phloem-feeding insect cabbage whitefly (Aleyrodes proletella) in Arabidopsis thaliana. We determined whitefly performance, i.e. the survival and reproduction of whitefly females, on 360 worldwide selected natural accessions and subsequently performed GWA mapping using 214,051 SNPs. Substantial variation for whitefly adult survival and oviposition rate (number of eggs laid per female per day) was observed between the accessions. We identified 39 candidate SNPs for either whitefly adult survival or oviposition rate, all with relatively small effects, underpinning the complex architecture of defense traits. Among the corresponding candidate genes, i.e. genes in linkage disequilibrium (LD) with candidate SNPs, none have previously been identified as a gene playing a role in the interaction between plants and phloem-feeding insects. Whitefly performance on knock-out mutants of a number of candidate genes was significantly affected, validating the potential of GWA mapping for novel gene discovery in plant-insect interactions. Our results show that GWA analysis is a very useful tool to gain insight into the genetic architecture of plant defense against herbivorous insects, i.e. we identified and validated several genes affecting whitefly performance that have not previously been related to plant defense against herbivorous insects.

  3. Novel Genes Affecting the Interaction between the Cabbage Whitefly and Arabidopsis Uncovered by Genome-Wide Association Mapping

    PubMed Central

    Broekgaarden, Colette; Bucher, Johan; Bac-Molenaar, Johanna; Keurentjes, Joost J. B.; Kruijer, Willem; Voorrips, Roeland E.; Vosman, Ben

    2015-01-01

    Plants have evolved a variety of ways to defend themselves against biotic attackers. This has resulted in the presence of substantial variation in defense mechanisms among plants, even within a species. Genome-wide association (GWA) mapping is a useful tool to study the genetic architecture of traits, but has so far only had limited exploitation in studies of plant defense. Here, we study the genetic architecture of defense against the phloem-feeding insect cabbage whitefly (Aleyrodes proletella) in Arabidopsis thaliana. We determined whitefly performance, i.e. the survival and reproduction of whitefly females, on 360 worldwide selected natural accessions and subsequently performed GWA mapping using 214,051 SNPs. Substantial variation for whitefly adult survival and oviposition rate (number of eggs laid per female per day) was observed between the accessions. We identified 39 candidate SNPs for either whitefly adult survival or oviposition rate, all with relatively small effects, underpinning the complex architecture of defense traits. Among the corresponding candidate genes, i.e. genes in linkage disequilibrium (LD) with candidate SNPs, none have previously been identified as a gene playing a role in the interaction between plants and phloem-feeding insects. Whitefly performance on knock-out mutants of a number of candidate genes was significantly affected, validating the potential of GWA mapping for novel gene discovery in plant-insect interactions. Our results show that GWA analysis is a very useful tool to gain insight into the genetic architecture of plant defense against herbivorous insects, i.e. we identified and validated several genes affecting whitefly performance that have not previously been related to plant defense against herbivorous insects. PMID:26699853

  4. Cross-interactions of two p38 mitogen-activated protein (MAP) kinase inhibitors and two cholecystokinin (CCK) receptor antagonists with the CCK1 receptor and p38 MAP kinase.

    PubMed

    Morel, Caroline; Ibarz, Géraldine; Oiry, Catherine; Carnazzi, Eric; Bergé, Gilbert; Gagne, Didier; Galleyrand, Jean-Claude; Martinez, Jean

    2005-06-03

    Although SB202190 and SB203580 are described as specific p38 MAP kinase inhibitors, several reports have indicated that other enzymes are also sensitive to SB203580. Using a pharmacological approach, we report for the first time that compounds SB202190 and SB203580 were able to directly and selectively interact with a G-protein-coupled receptor, namely the cholecystokinin receptor subtype CCK1, but not with the CCK2 receptor. We demonstrated that these compounds were non-competitive antagonists of the CCK1 receptor at concentrations typically used to inhibit protein kinases. By chimeric construction of the CCK2 receptor, we determined the involvement of two CCK1 receptor intracellular loops in the binding of SB202190 and SB203580. We also showed that two CCK antagonists, L364,718 and L365,260, were able to regulate p38 mitogen-activated protein (MAP) kinase activity. Using a reporter gene strategy and immunoblotting experiments, we demonstrated that both CCK antagonists inhibited selectively the enzymatic activity of p38 MAP kinase. Kinase assays suggested that this inhibition resulted from a direct interaction with both CCK antagonists. Molecular modeling simulations suggested that this interaction occurs in the ATP binding pocket of p38 MAP kinase. These results suggest that SB202190 and SB203580 bind to the CCK1 receptor and, as such, these compounds should be used with caution in models that express this receptor. We also found that L364,718 and L365,260, two CCK receptor antagonists, directly interacted with p38 MAP kinase and inhibited its activity. These findings suggest that the CCK1 receptor shares structural analogies with the p38 MAP kinase ATP binding site. They open the way to potential design of either a new family of MAP kinase inhibitors from CCK1 receptor ligand structures or new CCK1 receptor ligands based on p38 MAP kinase inhibitor structures.

  5. Towards a map of the Populus biomass protein-protein interaction network

    SciTech Connect

    Beers, Eric; Brunner, Amy; Helm, Richard; Dickerman, Allan

    2015-07-31

    Biofuels can be produced from a variety of plant feedstocks. The value of a particular feedstock for biofuels production depends in part on the degree of difficulty associated with the extraction of fermentable sugars from the plant biomass. The wood of trees is potentially a rich source fermentable sugars. However, the sugars in wood exist in a tightly cross-linked matrix of cellulose, hemicellulose, and lignin, making them largely recalcitrant to release and fermentation for biofuels production. Before breeders and genetic engineers can effectively develop plants with reduced recalcitrance to fermentation, it is necessary to gain a better understanding of the fundamental biology of the mechanisms responsible for wood formation. Regulatory, structural, and enzymatic proteins are required for the complicated process of wood formation. To function properly, proteins must interact with other proteins. Yet, very few of the protein-protein interactions necessary for wood formation are known. The main objectives of this project were to 1) identify new protein-protein interactions relevant to wood formation, and 2) perform in-depth characterizations of selected protein-protein interactions. To identify relevant protein-protein interactions, we cloned a set of approximately 400 genes that were highly expressed in the wood-forming tissue (known as secondary xylem) of poplar (Populus trichocarpa). We tested whether the proteins encoded by these biomass genes interacted with each other in a binary matrix design using the yeast two-hybrid (Y2H) method for protein-protein interaction discovery. We also tested a subset of the 400 biomass proteins for interactions with all proteins present in wood-forming tissue of poplar in a biomass library screen design using Y2H. Together, these two Y2H screens yielded over 270 interactions involving over 75 biomass proteins. For the second main objective we selected several interacting pairs or groups of interacting proteins for in

  6. Mapping and Functional Characterization of the TAF11 Interaction with TFIIA

    PubMed Central

    Robinson, M. M.; Yatherajam, G.; Ranallo, R. T.; Bric, A.; Paule, M. R.; Stargell, L. A.

    2005-01-01

    TFIIA interacts with TFIID via association with TATA binding protein (TBP) and TBP-associated factor 11 (TAF11). We previously identified a mutation in the small subunit of TFIIA (toa2-I27K) that is defective for interaction with TAF11. To further explore the functional link between TFIIA and TAF11, the toa2-I27K allele was utilized in a genetic screen to isolate compensatory mutants in TAF11. Analysis of these compensatory mutants revealed that the interaction between TAF11 and TFIIA involves two distinct regions of TAF11: the highly conserved histone fold domain and the N-terminal region. Cells expressing a TAF11 allele defective for interaction with TFIIA exhibit conditional growth phenotypes and defects in transcription. Moreover, TAF11 imparts changes to both TFIIA-DNA and TBP-DNA contacts in the context of promoter DNA. These alterations appear to enhance the formation and stabilization of the TFIIA-TBP-DNA complex. Taken together, these studies provide essential information regarding the molecular organization of the TAF11-TFIIA interaction and define a mechanistic role for this association in the regulation of gene expression in vivo. PMID:15657423

  7. Genetic interactions affecting human gene expression identified by variance association mapping

    PubMed Central

    Brown, Andrew Anand; Buil, Alfonso; Viñuela, Ana; Lappalainen, Tuuli; Zheng, Hou-Feng; Richards, J Brent; Small, Kerrin S; Spector, Timothy D; Dermitzakis, Emmanouil T; Durbin, Richard

    2014-01-01

    Non-additive interaction between genetic variants, or epistasis, is a possible explanation for the gap between heritability of complex traits and the variation explained by identified genetic loci. Interactions give rise to genotype dependent variance, and therefore the identification of variance quantitative trait loci can be an intermediate step to discover both epistasis and gene by environment effects (GxE). Using RNA-sequence data from lymphoblastoid cell lines (LCLs) from the TwinsUK cohort, we identify a candidate set of 508 variance associated SNPs. Exploiting the twin design we show that GxE plays a role in ∼70% of these associations. Further investigation of these loci reveals 57 epistatic interactions that replicated in a smaller dataset, explaining on average 4.3% of phenotypic variance. In 24 cases, more variance is explained by the interaction than their additive contributions. Using molecular phenotypes in this way may provide a route to uncovering genetic interactions underlying more complex traits. DOI: http://dx.doi.org/10.7554/eLife.01381.001 PMID:24771767

  8. Inventory and mapping of flood inundation using interactive digital image analysis techniques

    USGS Publications Warehouse

    Rohde, Wayne G.; Nelson, Charles A.; Taranik, J.V.

    1979-01-01

    LANDSAT digital data and color infra-red photographs were used in a multiphase sampling scheme to estimate the area of agricultural land affected by a flood. The LANDSAT data were classified with a maximum likelihood algorithm. Stratification of the LANDSAT data, prior to classification, greatly reduced misclassification errors. The classification results were used to prepare a map overlay showing the areal extent of flooding. These data also provided statistics required to estimate sample size in a two phase sampling scheme, and provided quick, accurate estimates of areas flooded for the first phase. The measurements made in the second phase, based on ground data and photo-interpretation, were used with two phase sampling statistics to estimate the area of agricultural land affected by flooding These results show that LANDSAT digital data can be used to prepare map overlays showing the extent of flooding on agricultural land and, with two phase sampling procedures, can provide acreage estimates with sampling errors of about 5 percent. This procedure provides a technique for rapidly assessing the areal extent of flood conditions on agricultural land and would provide a basis for designing a sampling framework to estimate the impact of flooding on crop production.

  9. Mapping of Chikungunya Virus Interactions with Host Proteins Identified nsP2 as a Highly Connected Viral Component

    PubMed Central

    Bouraï, Mehdi; Lucas-Hourani, Marianne; Gad, Hans Henrik; Drosten, Christian; Jacob, Yves; Tafforeau, Lionel; Cassonnet, Patricia; Jones, Louis M.; Judith, Delphine; Couderc, Thérèse; Lecuit, Marc; André, Patrice; Kümmerer, Beate Mareike; Lotteau, Vincent; Desprès, Philippe; Vidalain, Pierre-Olivier

    2012-01-01

    Chikungunya virus (CHIKV) is a mosquito-transmitted alphavirus that has been responsible for an epidemic outbreak of unprecedented magnitude in recent years. Since then, significant efforts have been made to better understand the biology of this virus, but we still have poor knowledge of CHIKV interactions with host cell components at the molecular level. Here we describe the extensive use of high-throughput yeast two-hybrid (HT-Y2H) assays to characterize interactions between CHIKV and human proteins. A total of 22 high-confidence interactions, which essentially involved the viral nonstructural protein nsP2, were identified and further validated in protein complementation assay (PCA). These results were integrated to a larger network obtained by extensive mining of the literature for reports on alphavirus-host interactions. To investigate the role of cellular proteins interacting with nsP2, gene silencing experiments were performed in cells infected by a recombinant CHIKV expressing Renilla luciferase as a reporter. Collected data showed that heterogeneous nuclear ribonucleoprotein K (hnRNP-K) and ubiquilin 4 (UBQLN4) participate in CHIKV replication in vitro. In addition, we showed that CHIKV nsP2 induces a cellular shutoff, as previously reported for other Old World alphaviruses, and determined that among binding partners identified by yeast two-hybrid methods, the tetratricopeptide repeat protein 7B (TTC7B) plays a significant role in this activity. Altogether, this report provides the first interaction map between CHIKV and human proteins and describes new host cell proteins involved in the replication cycle of this virus. PMID:22258240

  10. Mapping of Chikungunya virus interactions with host proteins identified nsP2 as a highly connected viral component.

    PubMed

    Bouraï, Mehdi; Lucas-Hourani, Marianne; Gad, Hans Henrik; Drosten, Christian; Jacob, Yves; Tafforeau, Lionel; Cassonnet, Patricia; Jones, Louis M; Judith, Delphine; Couderc, Thérèse; Lecuit, Marc; André, Patrice; Kümmerer, Beate Mareike; Lotteau, Vincent; Desprès, Philippe; Tangy, Frédéric; Vidalain, Pierre-Olivier

    2012-03-01

    Chikungunya virus (CHIKV) is a mosquito-transmitted alphavirus that has been responsible for an epidemic outbreak of unprecedented magnitude in recent years. Since then, significant efforts have been made to better understand the biology of this virus, but we still have poor knowledge of CHIKV interactions with host cell components at the molecular level. Here we describe the extensive use of high-throughput yeast two-hybrid (HT-Y2H) assays to characterize interactions between CHIKV and human proteins. A total of 22 high-confidence interactions, which essentially involved the viral nonstructural protein nsP2, were identified and further validated in protein complementation assay (PCA). These results were integrated to a larger network obtained by extensive mining of the literature for reports on alphavirus-host interactions. To investigate the role of cellular proteins interacting with nsP2, gene silencing experiments were performed in cells infected by a recombinant CHIKV expressing Renilla luciferase as a reporter. Collected data showed that heterogeneous nuclear ribonucleoprotein K (hnRNP-K) and ubiquilin 4 (UBQLN4) participate in CHIKV replication in vitro. In addition, we showed that CHIKV nsP2 induces a cellular shutoff, as previously reported for other Old World alphaviruses, and determined that among binding partners identified by yeast two-hybrid methods, the tetratricopeptide repeat protein 7B (TTC7B) plays a significant role in this activity. Altogether, this report provides the first interaction map between CHIKV and human proteins and describes new host cell proteins involved in the replication cycle of this virus.

  11. Mapping Proteome-Wide Interactions of Reactive Chemicals Using Chemoproteomic Platforms

    PubMed Central

    Counihan, Jessica L.; Ford, Breanna; Nomura, Daniel K.

    2015-01-01

    A large number of pharmaceuticals, endogenous metabolites, and environmental chemicals act through covalent mechanisms with protein targets. Yet, their specific interactions with the proteome still remain poorly defined for most of these reactive chemicals. Deciphering direct protein targets of reactive small-molecules is critical in understanding their biological action, off-target effects, potential toxicological liabilities, and development of safer and more selective agents. Chemoproteomic technologies have arisen as a powerful strategy that enable the assessment of proteome-wide interactions of these irreversible agents directly in complex biological systems. We review here several chemoproteomic strategies that have facilitated our understanding of specific protein interactions of irreversibly-acting pharmaceuticals, endogenous metabolites, and environmental electrophiles to reveal novel pharmacological, biological, and toxicological mechanisms. PMID:26647369

  12. Mapping of the interaction domains of the Crimean–Congo hemorrhagic fever virus nucleocapsid protein

    PubMed Central

    Macleod, Jesica M. Levingston; Marmor, Hannah; Frias-Staheli, Natalia

    2015-01-01

    Crimean–Congo hemorrhagic fever virus (CCHFV) is a member of the genus Nairovirus of the family Bunyaviridae, that can cause severe haemorrhagic fever in humans, with mortality rates above 30 %. CCHFV is the most widespread of the tick-borne human viruses and it is endemic in areas of central Asia, the Middle East, Africa and southern Europe. Its viral genome consists of three negative-sense RNA segments. The large segment (L) encodes a viral RNA-dependent RNA polymerase (L protein), the small segment (S) encodes the nucleocapsid protein (N protein) and the medium segment (M) encodes the envelope proteins. The N protein of bunyaviruses binds genomic RNA, forming the viral ribonucleoprotein (RNP) complex. The L protein interacts with these RNP structures, allowing the initiation of viral replication. The N protein also interacts with actin, although the regions and specific residues involved in these interactions have not yet been described. Here, by means of immunoprecipitation and immunofluorescence assays, we identified the regions within the CCHFV N protein implicated in homo-oligomerization and actin binding. We describe the interaction of the N protein with the CCHFV L protein, and identify the N- and C-terminal regions within the L protein that might be necessary for the formation of these N–L protein complexes. These results may guide the development of potent inhibitors of these complexes that could potentially block CCHFV replication. PMID:25389186

  13. Site-Directed Chemical Probing to map transient RNA/protein interactions.

    PubMed

    Duval, Mélodie; Marenna, Alessandra; Chevalier, Clément; Marzi, Stefano

    2017-03-15

    RNA-protein interactions are at the bases of many biological processes, forming either tight and stable functional ribonucleoprotein (RNP) complexes (i.e. the ribosome) or transitory ones, such as the complexes involving RNA chaperone proteins. To localize the sites where a protein interacts on an RNA molecule, a common simple and inexpensive biochemical method is the footprinting technique. The protein leaves its footprint on the RNA acting as a shield to protect the regions of interaction from chemical modification or cleavages obtained with chemical or enzymatic nucleases. This method has proven its efficiency to study in vitro the organization of stable RNA-protein complexes. Nevertheless, when the protein binds the RNA very dynamically, with high off-rates, protections are very often difficult to observe. For the analysis of these transient complexes, we describe an alternative strategy adapted from the Site Directed Chemical Probing (SDCP) approach and we compare it with classical footprinting. SDCP relies on the modification of the RNA binding protein to tether an RNA probe (usually Fe-EDTA) to specific protein positions. Local cleavages on the regions of interaction can be used to localize the protein and position its domains on the RNA molecule. This method has been used in the past to monitor stable complexes; we provide here a detailed protocol and a practical example of its application to the study of Escherichia coli RNA chaperone protein S1 and its transitory complexes with mRNAs.

  14. Mapping Functional Brain Development: Building a Social Brain through Interactive Specialization

    ERIC Educational Resources Information Center

    Johnson, Mark H.; Grossmann, Tobias; Kadosh, Kathrin Cohen

    2009-01-01

    The authors review a viewpoint on human functional brain development, interactive specialization (IS), and its application to the emerging network of cortical regions referred to as the "social brain." They advance the IS view in 2 new ways. First, they extend IS into a domain to which it has not previously been applied--the emergence of social…

  15. Mapping interactions between myosin relay and converter domains that power muscle function.

    PubMed

    Kronert, William A; Melkani, Girish C; Melkani, Anju; Bernstein, Sanford I

    2014-05-02

    Intramolecular communication within myosin is essential for its function as motor, but the specific amino acid residue interactions required are unexplored within muscle cells. Using Drosophila melanogaster skeletal muscle myosin, we performed a novel in vivo molecular suppression analysis to define the importance of three relay loop amino acid residues (Ile(508), Asn(509), and Asp(511)) in communicating with converter domain residue Arg(759). We found that the N509K relay mutation suppressed defects in myosin ATPase, in vitro motility, myofibril stability, and muscle function associated with the R759E converter mutation. Through molecular modeling, we define a mechanism for this interaction and suggest why the I508K and D511K relay mutations fail to suppress R759E. Interestingly, I508K disabled motor function and myofibril assembly, suggesting that productive relay-converter interaction is essential for both processes. We conclude that the putative relay-converter interaction mediated by myosin residues 509 and 759 is critical for the biochemical and biophysical function of skeletal muscle myosin and the normal ultrastructural and mechanical properties of muscle.

  16. Mapping of the interaction sites of galanthamine: a quantitative analysis through pairwise potentials and quantum chemistry.

    PubMed

    Galland, Nicolas; Kone, Soleymane; Le Questel, Jean-Yves

    2012-10-01

    A quantitative analysis of the interaction sites of the anti-Alzheimer drug galanthamine with molecular probes (water and benzene molecules) representative of its surroundings in the binding site of acetylcholinesterase (AChE) has been realized through pairwise potentials calculations and quantum chemistry. This strategy allows a full and accurate exploration of the galanthamine potential energy surface of interaction. Significantly different results are obtained according to the distances of approaches between the various molecular fragments and the conformation of the galanthamine N-methyl substituent. The geometry of the most relevant complexes has then been fully optimized through MPWB1K/6-31 + G(d,p) calculations, final energies being recomputed at the LMP2/aug-cc-pVTZ(-f) level of theory. Unexpectedly, galanthamine is found to interact mainly from its hydrogen-bond donor groups. Among those, CH groups in the vicinity of the ammonium group are prominent. The trends obtained provide rationales to the predilection of the equatorial orientation of the galanthamine N-methyl substituent for binding to AChE. The analysis of the interaction energies pointed out the independence between the various interaction sites and the rigid character of galanthamine. The comparison between the cluster calculations and the crystallographic observations in galanthamine-AChE co-crystals allows the validation of the theoretical methodology. In particular, the positions of several water molecules appearing as strongly conserved in galanthamine-AChE co-crystals are predicted by the calculations. Moreover, the experimental position and orientation of lateral chains of functionally important aminoacid residues are in close agreement with the ones predicted theoretically. Our study provides relevant information for a rational drug design of galanthamine based AChE inhibitors.

  17. Mapping specificity landscapes of RNA-protein interactions by high throughput sequencing.

    PubMed

    Jankowsky, Eckhard; Harris, Michael E

    2017-03-02

    To function in a biological setting, RNA binding proteins (RBPs) have to discriminate between alternative binding sites in RNAs. This discrimination can occur in the ground state of an RNA-protein binding reaction, in its transition state, or in both. The extent by which RBPs discriminate at these reaction states defines RBP specificity landscapes. Here, we describe the HiTS-Kin and HiTS-EQ techniques, which combine kinetic and equilibrium binding experiments with high throughput sequencing to quantitatively assess substrate discrimination for large numbers of substrate variants at ground and transition states of RNA-protein binding reactions. We discuss experimental design, practical considerations and data analysis and outline how a combination of HiTS-Kin and HiTS-EQ allows the mapping of RBP specificity landscapes.

  18. WIMAGR: An Interactive SSW IDL Tool for Mapping OVSA Legacy Microwave Interferometry Data

    NASA Astrophysics Data System (ADS)

    Nita, Gelu M.; Fleishman, Gregory D.; Gary, Dale E.

    2014-06-01

    The Owens Valley Solar Array (OVSA), which is currently the subject of a major upgrade leading to the new Expanded Owens Valley Solar Array (EOVSA), has operated between the years 2000-2007 as a 5-7 antenna solar-dedicated radio interferometer, with daily observations at typically 40 frequencies in the microwave frequency range, 1-18 GHz. Given the importance of these unique data for complementary studies with data taken during the same period by Yohkoh, RHESSI, SoHO, TRACE, Hinode and other NASA spacecraft, we have undertaken an effort to maximize their usefulness, ease of use, and longevity by creating a uniform, calibrated OVSA legacy database and community-friendly, SSW-based software, compatible with the RHESSI and EOVSA software packages. With these efforts, we can anticipate that the data will continue serving the community well into the future. In this presentation, we will introduce one of the recent upgrades of the OVSA SSW software package, WIMAGR, whose interface allows the user to generate OVSA radio maps in intensity and polarization at many available frequencies with a spatial resolution about 3” at 18 GHz, which is comparable with the spatial resolution of other imaging instruments. To illustrate the main capabilities of this software tool and its potential for promoting scientific discovery, we will present a real-time computation of a sequence of multi-frequency OVSA microwave maps and compare them with images obtained by other instruments. This work was supported in part by NSF grants AGS-1250374, and NASA grants NNX11AB49G and NNX14AC87G to New Jersey Institute of Technology

  19. Google Maps: You Are Here

    ERIC Educational Resources Information Center

    Jacobsen, Mikael

    2008-01-01

    Librarians use online mapping services such as Google Maps, MapQuest, Yahoo Maps, and others to check traffic conditions, find local businesses, and provide directions. However, few libraries are using one of Google Maps most outstanding applications, My Maps, for the creation of enhanced and interactive multimedia maps. My Maps is a simple and…

  20. Comprehensive Binary Interaction Mapping of SH2 Domains via Fluorescence Polarization Reveals Novel Functional Diversification of ErbB Receptors

    PubMed Central

    Ciaccio, Mark F.; Chuu, Chih-pin; Jones, Richard B.

    2012-01-01

    First-generation interaction maps of Src homology 2 (SH2) domains with receptor tyrosine kinase (RTK) phosphosites have previously been generated using protein microarray (PM) technologies. Here, we developed a large-scale fluorescence polarization (FP) methodology that was able to characterize interactions between SH2 domains and ErbB receptor phosphosites with higher fidelity and sensitivity than was previously achieved with PMs. We used the FP assay to query the interaction of synthetic phosphopeptides corresponding to 89 ErbB receptor intracellular tyrosine sites against 93 human SH2 domains and 2 phosphotyrosine binding (PTB) domains. From 358,944 polarization measurements, the affinities for 1,405 unique biological interactions were determined, 83% of which are novel. In contrast to data from previous reports, our analyses suggested that ErbB2 was not more promiscuous than the other ErbB receptors. Our results showed that each receptor displays unique preferences in the affinity and location of recruited SH2 domains that may contribute to differences in downstream signaling potential. ErbB1 was enriched versus the other receptors for recruitment of domains from RAS GEFs whereas ErbB2 was enriched for recruitment of domains from tyrosine and phosphatidyl inositol phosphatases. ErbB3, the kinase inactive ErbB receptor family member, was predictably enriched for recruitment of domains from phosphatidyl inositol kinases and surprisingly, was enriched for recruitment of domains from tyrosine kinases, cytoskeletal regulatory proteins, and RHO GEFs but depleted for recruitment of domains from phosphatidyl inositol phosphatases. Many novel interactions were also observed with phosphopeptides corresponding to ErbB receptor tyrosines not previously reported to be phosphorylated by mass spectrometry, suggesting the existence of many biologically relevant RTK sites that may be phosphorylated but below the detection threshold of standard mass spectrometry procedures. This

  1. Heterotic trait locus (HTL) mapping identifies intra-locus interactions that underlie reproductive hybrid vigor in Sorghum bicolor.

    PubMed

    Ben-Israel, Imri; Kilian, Benjamin; Nida, Habte; Fridman, Eyal

    2012-01-01

    Identifying intra-locus interactions underlying heterotic variation among whole-genome hybrids is a key to understanding mechanisms of heterosis and exploiting it for crop and livestock improvement. In this study, we present the development and first use of the heterotic trait locus (HTL) mapping approach to associate specific intra-locus interactions with an overdominant heterotic mode of inheritance in a diallel population using Sorghum bicolor as the model. This method combines the advantages of ample genetic diversity and the possibility of studying non-additive inheritance. Furthermore, this design enables dissecting the latter to identify specific intra-locus interactions. We identified three HTLs (3.5% of loci tested) with synergistic intra-locus effects on overdominant grain yield heterosis in 2 years of field trials. These loci account for 19.0% of the heterotic variation, including a significant interaction found between two of them. Moreover, analysis of one of these loci (hDPW4.1) in a consecutive F2 population confirmed a significant 21% increase in grain yield of heterozygous vs. homozygous plants in this locus. Notably, two of the three HTLs for grain yield are in synteny with previously reported overdominant quantitative trait loci for grain yield in maize. A mechanism for the reproductive heterosis found in this study is suggested, in which grain yield increase is achieved by releasing the compensatory tradeoffs between biomass and reproductive output, and between seed number and weight. These results highlight the power of analyzing a diverse set of inbreds and their hybrids for unraveling hitherto unknown allelic interactions mediating heterosis.

  2. Stochastic signalling rewires the interaction map of a multiple feedback network during yeast evolution

    PubMed Central

    Hsu, Chieh; Scherrer, Simone; Buetti-Dinh, Antoine; Ratna, Prasuna; Pizzolato, Julia; Jaquet, Vincent; Becskei, Attila

    2012-01-01

    During evolution, genetic networks are rewired through strengthening or weakening their interactions to develop new regulatory schemes. In the galactose network, the GAL1/GAL3 paralogues and the GAL2 gene enhance their own expression mediated by the Gal4p transcriptional activator. The wiring strength in these feedback loops is set by the number of Gal4p binding sites. Here we show using synthetic circuits that multiplying the binding sites increases the expression of a gene under the direct control of an activator, but this enhancement is not fed back in the circuit. The feedback loops are rather activated by genes that have frequent stochastic bursts and fast RNA decay rates. In this way, rapid adaptation to galactose can be triggered even by weakly expressed genes. Our results indicate that nonlinear stochastic transcriptional responses enable feedback loops to function autonomously, or contrary to what is dictated by the strength of interactions enclosing the circuit. PMID:22353713

  3. A Conformal Mapping Suitable for Problems Involving Interaction Between Given Geometries and Known Far Fields.

    DTIC Science & Technology

    1984-09-01

    A conformal transformation formula using Riemann-Stieltjes integrals is derived for use with problems involving the interaction between a given finite-sized geometry and a known far field. The derivative of this transformation is non-singular in the domain considered and tends to one at infinity. A formula is derived for transformation from the unit circle to the exterior of an arbitrarily given continuous curve with bounded variation . A special case of the transformation is very similar

  4. Early Interactions of Murine Macrophages with Francisella tularensis Map to Mouse Chromosome 19

    PubMed Central

    Fink, Avner; Hassan, Musa A.; Okan, Nihal A.; Sheffer, Michal; Camejo, Ana; Saeij, Jeroen P. J.

    2016-01-01

    ABSTRACT Differences among individuals in susceptibility to infectious diseases can be modulated by host genetics. Much of the research in this field has aimed to identify loci within the host genome that are associated with these differences. In mice, A/J (AJ) and C57BL/6J (B6) mice show differential susceptibilities to various pathogens, including the intracellular pathogen Francisella tularensis. Because macrophages are the main initial target during F. tularensis infection, we explored early interactions of macrophages from these two mouse strains with F. tularensis as well as the genetic factors underlying these interactions. Our results indicate that bacterial interactions with bone marrow-derived macrophages (BMDMs) during early stages of infection are different in the AJ and B6 strains. During these early stages, bacteria are more numerous in B6 than in AJ macrophages and display differences in trafficking and early transcriptional response within these macrophages. To determine the genetic basis for these differences, we infected BMDMs isolated from recombinant inbred (RI) mice derived from reciprocal crosses between AJ and B6, and we followed early bacterial counts within these macrophages. Quantitative trait locus (QTL) analysis revealed a locus on chromosome 19 that is associated with early differences in bacterial counts in AJ versus B6 macrophages. QTL analysis of published data that measured the differential susceptibilities of the same RI mice to an in vivo challenge with F. tularensis confirmed the F. tularensis susceptibility QTL on chromosome 19. Overall, our results show that early interactions of macrophages with F. tularensis are dependent on the macrophage genetic background. PMID:26980837

  5. Mapping the Interaction Anatomy of BmP02 on Kv1.3 Channel

    PubMed Central

    Wu, B.; Wu, B. F.; Feng, Y. J.; Tao, J.; Ji, Y. H.

    2016-01-01

    The potassium channel Kv 1.3 plays a vital part in the activation of T lymphocytes and is an attractive pharmacological target for autoimmune diseases. BmP02, a 28-residue peptide isolated from Chinese scorpion (Buthus martensi Karsch) venom, is a potent and selective Kv1.3 channel blocker. However, the mechanism through which BmP02 recognizes and inhibits the Kv1.3 channel is still unclear. In the present study, a complex molecular model of Kv1.3-BmP02 was developed by docking analysis and molecular dynamics simulations. From these simulations, it appears the large β-turn (residues 10–16) of BmP02 might be the binding interface with Kv 1.3. These results were confirmed by scanning alanine mutagenesis of BmP02, which identified His9, Lys11 and Lys13, which lie within BmP02’s β-turn, as key residues for interacting with Kv1.3. Based on these results and molecular modeling, two negatively charged residues of Kv1.3, D421 and D422, located in turret region, were predicted to act as the binding site for BmP02. Mutation of these residues reduced sensitivity of Kv 1.3 to BmP02 inhibition, suggesting that electrostatic interactions play a crucial role in Kv1.3-BmP02 interaction. This study revealed the molecular basis of Kv 1.3 recognition by BmP02 venom, and provides a novel interaction model for Kv channel-specific blocker complex, which may help guide future drug-design for Kv1.3-related channelopathies. PMID:27403813

  6. Mapping the Interaction Anatomy of BmP02 on Kv1.3 Channel

    NASA Astrophysics Data System (ADS)

    Wu, B.; Wu, B. F.; Feng, Y. J.; Tao, J.; Ji, Y. H.

    2016-07-01

    The potassium channel Kv 1.3 plays a vital part in the activation of T lymphocytes and is an attractive pharmacological target for autoimmune diseases. BmP02, a 28-residue peptide isolated from Chinese scorpion (Buthus martensi Karsch) venom, is a potent and selective Kv1.3 channel blocker. However, the mechanism through which BmP02 recognizes and inhibits the Kv1.3 channel is still unclear. In the present study, a complex molecular model of Kv1.3-BmP02 was developed by docking analysis and molecular dynamics simulations. From these simulations, it appears the large β-turn (residues 10–16) of BmP02 might be the binding interface with Kv 1.3. These results were confirmed by scanning alanine mutagenesis of BmP02, which identified His9, Lys11 and Lys13, which lie within BmP02’s β-turn, as key residues for interacting with Kv1.3. Based on these results and molecular modeling, two negatively charged residues of Kv1.3, D421 and D422, located in turret region, were predicted to act as the binding site for BmP02. Mutation of these residues reduced sensitivity of Kv 1.3 to BmP02 inhibition, suggesting that electrostatic interactions play a crucial role in Kv1.3-BmP02 interaction. This study revealed the molecular basis of Kv 1.3 recognition by BmP02 venom, and provides a novel interaction model for Kv channel-specific blocker complex, which may help guide future drug-design for Kv1.3-related channelopathies.

  7. Functional Mapping of Quantitative Trait Loci That Interact With the hg Mutation to Regulate Growth Trajectories in Mice

    PubMed Central

    Wu, Rongling; Ma, Chang-Xing; Hou, Wei; Corva, Pablo; Medrano, Juan F.

    2005-01-01

    The high growth (hg) mutation increases body size in mice by 30–50%. Given the complexity of the genetic regulation of animal growth, it is likely that the effect of this major locus is mediated by other quantitative trait loci (QTL) with smaller effects within a web of gene interactions. In this article, we extend our functional mapping model to characterize modifier QTL that interact with the hg locus during ontogenetic growth. Our model is derived within the maximum-likelihood context, incorporated by mathematical aspects of growth laws and implemented with the EM algorithm. In an F2 population founded by a congenic high growth (HG) line and non-HG line, a highly additive effect due to the hg gene was detected on growth trajectories. Three QTL located on chromosomes 2 and X were identified to trigger significant additive and/or dominant effects on the process of growth. The most significant finding made from our model is that these QTL interact with the hg locus to affect the shapes of the growth process. Our model provides a powerful means for understanding the genetic architecture and regulation of growth rate and body size in mammals. PMID:15965258

  8. Lunar Mapping and Modeling On-the-Go: A mobile framework for viewing and interacting with large geospatial datasets

    NASA Astrophysics Data System (ADS)

    Chang, G.; Kim, R.; Bui, B.; Sadaqathullah, S.; Law, E.; Malhotra, S.

    2012-12-01

    The Lunar Mapping and Modeling Portal (LMMP, https://www.lmmp.nasa.gov/) is a collaboration between four NASA centers, JPL, Marshall, Goddard, and Ames, along with the USGS and US Army to provide a centralized geospatial repository for storing processed lunar data collected from the Apollo missions to the latest data acquired by the Lunar Reconnaissance Orbiter (LRO). We offer various scientific and visualization tools to analyze rock and crater densities, lighting maps, thermal measurements, mineral concentrations, slope hazards, and digital elevation maps with the intention of serving not only scientists and lunar mission planners, but also the general public. The project has pioneered in leveraging new technologies and embracing new computing paradigms to create a system that is sophisticated, secure, robust, and scalable all the while being easy to use, streamlined, and modular. We have led innovations through the use of a hybrid cloud infrastructure, authentication through various sources, and utilizing an in-house GIS framework, TWMS (TiledWMS) as well as the commercial ArcGIS product from ESRI. On the client end, we also provide a Flash GUI framework as well as REST web services to interact with the portal. We have also developed a visualization framework on mobile devices, specifically Apple's iOS, which allows anyone from anywhere to interact with LMMP. At the most basic level, the framework allows users to browse LMMP's entire catalog of over 600 data imagery products ranging from global basemaps to LRO's Narrow Angle Camera (NAC) images that provide details of up to .5 meters/pixel. Users are able to view map metadata and can zoom in and out as well as pan around the entire lunar surface with the appropriate basemap. They can arbitrarily stack the maps and images on top of each other to show a layered view of the surface with layer transparency adjusted to suit the user's desired look. Once the user has selected a combination of layers, he can also

  9. A distance-weighted interaction map reveals a previously uncharacterized layer of the Bacillus subtilis spore coat.

    PubMed

    McKenney, Peter T; Driks, Adam; Eskandarian, Haig A; Grabowski, Paul; Guberman, Jonathan; Wang, Katherine H; Gitai, Zemer; Eichenberger, Patrick

    2010-05-25

    Bacillus subtilis spores are encased in a protein assembly called the spore coat that is made up of at least 70 different proteins. Conventional electron microscopy shows the coat to be organized into two distinct layers. Because the coat is about as wide as the theoretical limit of light microscopy, quantitatively measuring the localization of individual coat proteins within the coat is challenging. We used fusions of coat proteins to green fluorescent protein to map genetic dependencies for coat assembly and to define three independent subnetworks of coat proteins. To complement the genetic data, we measured coat protein localization at subpixel resolution and integrated these two data sets to produce a distance-weighted genetic interaction map. Using these data, we predict that the coat comprises at least four spatially distinct layers, including a previously uncharacterized glycoprotein outermost layer that we name the spore crust. We found that crust assembly depends on proteins we predicted to localize to the crust. The crust may be conserved in all Bacillus spores and may play critical functions in the environment.

  10. NMR spectral mapping of Lipid A molecular patterns affected by interaction with the innate immune receptor CD14

    SciTech Connect

    Albright, Seth; Agrawal, Prashansa; Jain, Nitin U.

    2009-01-23

    Soluble CD14 (sCD14) is a serum glycoprotein that binds to the Lipid A moiety of lipopolysaccharides (LPS) with high affinity as part of the innate immune response to bacterial endotoxins. In order to investigate structural interactions of Lipid A with sCD14, we have prepared an isotopically labeled form of a fully active and chemically defined endotoxin, Kdo{sub 2}-Lipid A, which allowed us to carry out detailed NMR spectral mapping of this agonist ligand bound to sCD14 and identify for the first time structural regions that are strongly affected during complex formation with sCD14. These map to two adjacent areas comprising the lower portions of the sugar headgroup and upper half of the acyl chains I, III, and V, which are spatially proximal to the 1- and 4'-phosphate ends. Additionally, we have detected for the first time, presence of differential dynamic behavior for the affected resonances, suggesting a likely role for dynamics in the mechanism of Lipid A pattern recognition by sCD14.

  11. Genetic interaction analysis of point mutations enables interrogation of gene function at a residue-level resolution: exploring the applications of high-resolution genetic interaction mapping of point mutations.

    PubMed

    Braberg, Hannes; Moehle, Erica A; Shales, Michael; Guthrie, Christine; Krogan, Nevan J

    2014-07-01

    We have achieved a residue-level resolution of genetic interaction mapping - a technique that measures how the function of one gene is affected by the alteration of a second gene - by analyzing point mutations. Here, we describe how to interpret point mutant genetic interactions, and outline key applications for the approach, including interrogation of protein interaction interfaces and active sites, and examination of post-translational modifications. Genetic interaction analysis has proven effective for characterizing cellular processes; however, to date, systematic high-throughput genetic interaction screens have relied on gene deletions or knockdowns, which limits the resolution of gene function analysis and poses problems for multifunctional genes. Our point mutant approach addresses these issues, and further provides a tool for in vivo structure-function analysis that complements traditional biophysical methods. We also discuss the potential for genetic interaction mapping of point mutations in human cells and its application to personalized medicine.

  12. Microscopic calculation of interacting boson model parameters by potential-energy surface mapping

    SciTech Connect

    Bentley, I.; Frauendorf, S.

    2011-06-15

    A coherent state technique is used to generate an interacting boson model (IBM) Hamiltonian energy surface which is adjusted to match a mean-field energy surface. This technique allows the calculation of IBM Hamiltonian parameters, prediction of properties of low-lying collective states, as well as the generation of probability distributions of various shapes in the ground state of transitional nuclei, the last two of which are of astrophysical interest. The results for krypton, molybdenum, palladium, cadmium, gadolinium, dysprosium, and erbium nuclei are compared with experiment.

  13. Mapping and Modeling the Extended Winds of the Massive Interacting Binary, Eta Carinae

    NASA Technical Reports Server (NTRS)

    Gull, Ted

    2010-01-01

    The combination HST/STIS high spatial and moderate spectral resolutions have revealed the massive interacting wind structure of Eta Carinae by forbidden lines of singly and doubly ionized elements. Throughout the 5.54-year period, lines of Fe++, Ne++, Ar++, S++ and N+ reveal the interacting wind structures, near critical electron densities of 10(exp 5) to 3 x 10(exp 7)cu cm, photoionized by the hot secondary, Eta Car B, Lines of Fe+ and Ni+ trace the denser (>10(exp 7)cu cm. less-ionized (< 8 eV) primary wind of Eta Car A as it wraps around the interacting binary stars. For 5 years of the 5.54 year period, the FUV radiation from Eta Car B escapes the orbital region, ionizing the boundaries of the expanding wind structures. But for three to six months, Eta Car B plunges into the primary wind approaching to within 1 to 2 AU, leading to cutoff of FUV and X-ray fluxes. The interacting wind structure, resolved out to 0.8", drops io ionization and then rebuilds as Eta Car B emerges from the primary wind envelope. Solid Particle Hydrodynamical(SPH) models have been developed extending out to 2000 AU and adapted to include FUV radiation effects of the winds. In turn, synthetic spectroimages of selected forbidden lines have been constructed and compared to the spectroimages recorded by the HST/STIS throughout 1998.0 to 2004.3, extending across the 1998 and 2003.5 minima. By this method, we show that the orbital axis of the binary system must bc within 15 degrees of the Homunculus axis of symmetry and that periastron occurs with Eta Car B passing on the far side of Eta Car B. This result ties the current binary orbit with the bipolar ejection with intervening skirt and leads to implications that the binary system influenced the mass ejection of the l840s and the lesser ejection of the 1890s.

  14. Characterization of the bionano interface and mapping extrinsic interactions of the corona of nanomaterials

    NASA Astrophysics Data System (ADS)

    O'Connell, D. J.; Bombelli, F. Baldelli; Pitek, A. S.; Monopoli, M. P.; Cahill, D. J.; Dawson, K. A.

    2015-09-01

    Nanoparticles in physiological environments are known to selectively adsorb proteins and other biomolecules forming a tightly bound biomolecular `corona' on their surface. Where the exchange times of the proteins are sufficiently long, it is believed that the protein corona constitutes the particle identity in biological milieu. Here we show that proteins in the corona retain their functional characteristics and can specifically bind to cognate proteins on arrays of thousands of immobilised human proteins. The biological identity of the nanomaterial is seen to be specific to the blood plasma concentration in which they are exposed. We show that the resulting in situ nanoparticle interactome is dependent on the protein concentration in plasma, with the emergence of a small number of dominant protein-protein interactions. These interactions are those driven by proteins that are adsorbed onto the particle surface and whose binding epitopes are subsequently expressed or presented suitably on the particle surface. We suggest that, since specific tailored protein arrays for target systems and organs can be designed, their use may be an important element in an overall study of the biomolecular corona.Nanoparticles in physiological environments are known to selectively adsorb proteins and other biomolecules forming a tightly bound biomolecular `corona' on their surface. Where the exchange times of the proteins are sufficiently long, it is believed that the protein corona constitutes the particle identity in biological milieu. Here we show that proteins in the corona retain their functional characteristics and can specifically bind to cognate proteins on arrays of thousands of immobilised human proteins. The biological identity of the nanomaterial is seen to be specific to the blood plasma concentration in which they are exposed. We show that the resulting in situ nanoparticle interactome is dependent on the protein concentration in plasma, with the emergence of a small

  15. Mapping functional brain development: Building a social brain through interactive specialization.

    PubMed

    Johnson, Mark H; Grossmann, Tobias; Cohen Kadosh, Kathrin

    2009-01-01

    The authors review a viewpoint on human functional brain development, interactive specialization (IS), and its application to the emerging network of cortical regions referred to as the social brain. They advance the IS view in 2 new ways. First, they extend IS into a domain to which it has not previously been applied--the emergence of social cognition and mentalizing computations in the brain. Second, they extend the implications of the IS view from the emergence of specialized functions within a cortical region to a focus on how different cortical regions with complementary functions become orchestrated into networks during human postnatal development.

  16. Trifunctional cross-linker for mapping protein-protein interaction networks and comparing protein conformational states

    PubMed Central

    Tan, Dan; Li, Qiang; Zhang, Mei-Jun; Liu, Chao; Ma, Chengying; Zhang, Pan; Ding, Yue-He; Fan, Sheng-Bo; Tao, Li; Yang, Bing; Li, Xiangke; Ma, Shoucai; Liu, Junjie; Feng, Boya; Liu, Xiaohui; Wang, Hong-Wei; He, Si-Min; Gao, Ning; Ye, Keqiong; Dong, Meng-Qiu; Lei, Xiaoguang

    2016-01-01

    To improve chemical cross-linking of proteins coupled with mass spectrometry (CXMS), we developed a lysine-targeted enrichable cross-linker containing a biotin tag for affinity purification, a chemical cleavage site to separate cross-linked peptides away from biotin after enrichment, and a spacer arm that can be labeled with stable isotopes for quantitation. By locating the flexible proteins on the surface of 70S ribosome, we show that this trifunctional cross-linker is effective at attaining structural information not easily attainable by crystallography and electron microscopy. From a crude Rrp46 immunoprecipitate, it helped identify two direct binding partners of Rrp46 and 15 protein-protein interactions (PPIs) among the co-immunoprecipitated exosome subunits. Applying it to E. coli and C. elegans lysates, we identified 3130 and 893 inter-linked lysine pairs, representing 677 and 121 PPIs. Using a quantitative CXMS workflow we demonstrate that it can reveal changes in the reactivity of lysine residues due to protein-nucleic acid interaction. DOI: http://dx.doi.org/10.7554/eLife.12509.001 PMID:26952210

  17. Mapping the interaction of Snf1 with TORC1 in Saccharomyces cerevisiae.

    PubMed

    Zhang, Jie; Vaga, Stefania; Chumnanpuen, Pramote; Kumar, Rahul; Vemuri, Goutham N; Aebersold, Ruedi; Nielsen, Jens

    2011-11-08

    Nutrient sensing and coordination of metabolic pathways are crucial functions for all living cells, but details of the coordination under different environmental conditions remain elusive. We therefore undertook a systems biology approach to investigate the interactions between the Snf1 and the target of rapamycin complex 1 (TORC1) in Saccharomyces cerevisiae. We show that Snf1 regulates a much broader range of biological processes compared with TORC1 under both glucose- and ammonium-limited conditions. We also find that Snf1 has a role in upregulating the NADP(+)-dependent glutamate dehydrogenase (encoded by GDH3) under derepressing condition, and therefore may also have a role in ammonium assimilation and amino-acid biosynthesis, which can be considered as a convergence of Snf1 and TORC1 pathways. In addition to the accepted role of Snf1 in regulating fatty acid (FA) metabolism, we show that TORC1 also regulates FA metabolism, likely through modulating the peroxisome and β-oxidation. Finally, we conclude that direct interactions between Snf1 and TORC1 pathways are unlikely under nutrient-limited conditions and propose that TORC1 is repressed in a manner that is independent of Snf1.

  18. Proteochemometrics mapping of the interaction space for retroviral proteases and their substrates.

    PubMed

    Kontijevskis, Aleksejs; Petrovska, Ramona; Yahorava, Sviatlana; Komorowski, Jan; Wikberg, Jarl E S

    2009-07-15

    Understanding the complex interactions of retroviral proteases with their ligands is an important scientific challenge in efforts to achieve control of retroviral infections. Development of drug resistance because of high mutation rates and extensive polymorphisms causes major problems in treating the deadly diseases these viruses cause, and prompts efforts to identify new strategies. Here we report a comprehensive analysis of the interaction of 63 retroviral proteases from nine different viral species with their substrates and inhibitors based on publicly available data from the past 17years of retroviral research. By correlating physico-chemical descriptions of retroviral proteases and substrates to their biological activities we constructed a highly statistically valid 'proteochemometric' model for the interactome of retroviral proteases. Analysis of the model indicated amino acid positions in retroviral proteases with the highest influence on ligand activity and revealed general physicochemical properties essential for tight binding of substrates across multiple retroviral proteases. Hexapeptide inhibitors developed based on the discovered general properties effectively inhibited HIV-1 proteases in vitro, and some exhibited uniformly high inhibitory activity against all HIV-1 proteases mutants evaluated. A generalized proteochemometric model for retroviral proteases interactome has been created and analysed in this study. Our results demonstrate the feasibility of using the developed general strategy in the design of inhibitory peptides that can potentially serve as templates for drug resistance-improved HIV retardants.

  19. Protein interaction maps for complete genomes based on gene fusion events

    NASA Astrophysics Data System (ADS)

    Enright, Anton J.; Iliopoulos, Ioannis; Kyrpides, Nikos C.; Ouzounis, Christos A.

    1999-11-01

    A large-scale effort to measure, detect and analyse protein-protein interactions using experimental methods is under way. These include biochemistry such as co-immunoprecipitation or crosslinking, molecular biology such as the two-hybrid system or phage display, and genetics such as unlinked noncomplementing mutant detection. Using the two-hybrid system, an international effort to analyse the complete yeast genome is in progress. Evidently, all these approaches are tedious, labour intensive and inaccurate. From a computational perspective, the question is how can we predict that two proteins interact from structure or sequence alone. Here we present a method that identifies gene-fusion events in complete genomes, solely based on sequence comparison. Because there must be selective pressure for certain genes to be fused over the course of evolution, we are able to predict functional associations of proteins. We show that 215 genes or proteins in the complete genomes of Escherichia coli, Haemophilus influenzae and Methanococcus jannaschii are involved in 64 unique fusion events. The approach is general, and can be applied even to genes of unknown function.

  20. Characterization of the bionano interface and mapping extrinsic interactions of the corona of nanomaterials.

    PubMed

    O'Connell, D J; Bombelli, F Baldelli; Pitek, A S; Monopoli, M P; Cahill, D J; Dawson, K A

    2015-10-07

    Nanoparticles in physiological environments are known to selectively adsorb proteins and other biomolecules forming a tightly bound biomolecular 'corona' on their surface. Where the exchange times of the proteins are sufficiently long, it is believed that the protein corona constitutes the particle identity in biological milieu. Here we show that proteins in the corona retain their functional characteristics and can specifically bind to cognate proteins on arrays of thousands of immobilised human proteins. The biological identity of the nanomaterial is seen to be specific to the blood plasma concentration in which they are exposed. We show that the resulting in situ nanoparticle interactome is dependent on the protein concentration in plasma, with the emergence of a small number of dominant protein-protein interactions. These interactions are those driven by proteins that are adsorbed onto the particle surface and whose binding epitopes are subsequently expressed or presented suitably on the particle surface. We suggest that, since specific tailored protein arrays for target systems and organs can be designed, their use may be an important element in an overall study of the biomolecular corona.

  1. Identification of Odorant-Receptor Interactions by Global Mapping of the Human Odorome

    PubMed Central

    Audouze, Karine; Tromelin, Anne; Le Bon, Anne Marie; Belloir, Christine; Petersen, Rasmus Koefoed; Kristiansen, Karsten; Brunak, Søren; Taboureau, Olivier

    2014-01-01

    The human olfactory system recognizes a broad spectrum of odorants using approximately 400 different olfactory receptors (hORs). Although significant improvements of heterologous expression systems used to study interactions between ORs and odorant molecules have been made, screening the olfactory repertoire of hORs remains a tremendous challenge. We therefore developed a chemical systems level approach based on protein-protein association network to investigate novel hOR-odorant relationships. Using this new approach, we proposed and validated new bioactivities for odorant molecules and OR2W1, OR51E1 and OR5P3. As it remains largely unknown how human perception of odorants influence or prevent diseases, we also developed an odorant-protein matrix to explore global relationships between chemicals, biological targets and disease susceptibilities. We successfully experimentally demonstrated interactions between odorants and the cannabinoid receptor 1 (CB1) and the peroxisome proliferator-activated receptor gamma (PPARγ). Overall, these results illustrate the potential of integrative systems chemical biology to explore the impact of odorant molecules on human health, i.e. human odorome. PMID:24695519

  2. BDNF stimulation of protein synthesis in cortical neurons requires the MAP kinase-interacting kinase MNK1.

    PubMed

    Genheden, Maja; Kenney, Justin W; Johnston, Harvey E; Manousopoulou, Antigoni; Garbis, Spiros D; Proud, Christopher G

    2015-01-21

    Although the MAP kinase-interacting kinases (MNKs) have been known for >15 years, their roles in the regulation of protein synthesis have remained obscure. Here, we explore the involvement of the MNKs in brain-derived neurotrophic factor (BDNF)-stimulated protein synthesis in cortical neurons from mice. Using a combination of pharmacological and genetic approaches, we show that BDNF-induced upregulation of protein synthesis requires MEK/ERK signaling and the downstream kinase, MNK1, which phosphorylates eukaryotic initiation factor (eIF) 4E. Translation initiation is mediated by the interaction of eIF4E with the m(7)GTP cap of mRNA and with eIF4G. The latter interaction is inhibited by the interactions of eIF4E with partner proteins, such as CYFIP1, which acts as a translational repressor. We find that BDNF induces the release of CYFIP1 from eIF4E, and that this depends on MNK1. Finally, using a novel combination of BONCAT and SILAC, we identify a subset of proteins whose synthesis is upregulated by BDNF signaling via MNK1 in neurons. Interestingly, this subset of MNK1-sensitive proteins is enriched for functions involved in neurotransmission and synaptic plasticity. Additionally, we find significant overlap between our subset of proteins whose synthesis is regulated by MNK1 and those encoded by known FMRP-binding mRNAs. Together, our data implicate MNK1 as a key component of BDNF-mediated translational regulation in neurons.

  3. Uncovering the genetic architecture of Colletotrichum lindemuthianum resistance through QTL mapping and epistatic interaction analysis in common bean

    PubMed Central

    González, Ana M.; Yuste-Lisbona, Fernando J.; Rodiño, A. Paula; De Ron, Antonio M.; Capel, Carmen; García-Alcázar, Manuel; Lozano, Rafael; Santalla, Marta

    2015-01-01

    Colletotrichum lindemuthianum is a hemibiotrophic fungal pathogen that causes anthracnose disease in common bean. Despite the genetics of anthracnose resistance has been studied for a long time, few quantitative trait loci (QTLs) studies have been conducted on this species. The present work examines the genetic basis of quantitative resistance to races 23 and 1545 of C. lindemuthianum in different organs (stem, leaf and petiole). A population of 185 recombinant inbred lines (RIL) derived from the cross PMB0225 × PHA1037 was evaluated for anthracnose resistance under natural and artificial photoperiod growth conditions. Using multi-environment QTL mapping approach, 10 and 16 main effect QTLs were identified for resistance to anthracnose races 23 and 1545, respectively. The homologous genomic regions corresponding to 17 of the 26 main effect QTLs detected were positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL) proteins. Among them, it is worth noting that the main effect QTLs detected on linkage group 05 for resistance to race 1545 in stem, petiole and leaf were located within a 1.2 Mb region. The NL gene Phvul.005G117900 is located in this region, which can be considered an important candidate gene for the non-organ-specific QTL identified here. Furthermore, a total of 39 epistatic QTL (E-QTLs) (21 for resistance to race 23 and 18 for resistance to race 1545) involved in 20 epistatic interactions (eleven and nine interactions for resistance to races 23 and 1545, respectively) were identified. None of the main and epistatic QTLs detected displayed significant environment interaction effects. The present research provides essential information not only for the better understanding of the plant-pathogen interaction but also for the application of genomic assisted breeding for anthracnose resistance improvement in common bean through application of marker-assisted selection (MAS). PMID:25852706

  4. Uncovering the genetic architecture of Colletotrichum lindemuthianum resistance through QTL mapping and epistatic interaction analysis in common bean.

    PubMed

    González, Ana M; Yuste-Lisbona, Fernando J; Rodiño, A Paula; De Ron, Antonio M; Capel, Carmen; García-Alcázar, Manuel; Lozano, Rafael; Santalla, Marta

    2015-01-01

    Colletotrichum lindemuthianum is a hemibiotrophic fungal pathogen that causes anthracnose disease in common bean. Despite the genetics of anthracnose resistance has been studied for a long time, few quantitative trait loci (QTLs) studies have been conducted on this species. The present work examines the genetic basis of quantitative resistance to races 23 and 1545 of C. lindemuthianum in different organs (stem, leaf and petiole). A population of 185 recombinant inbred lines (RIL) derived from the cross PMB0225 × PHA1037 was evaluated for anthracnose resistance under natural and artificial photoperiod growth conditions. Using multi-environment QTL mapping approach, 10 and 16 main effect QTLs were identified for resistance to anthracnose races 23 and 1545, respectively. The homologous genomic regions corresponding to 17 of the 26 main effect QTLs detected were positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL) proteins. Among them, it is worth noting that the main effect QTLs detected on linkage group 05 for resistance to race 1545 in stem, petiole and leaf were located within a 1.2 Mb region. The NL gene Phvul.005G117900 is located in this region, which can be considered an important candidate gene for the non-organ-specific QTL identified here. Furthermore, a total of 39 epistatic QTL (E-QTLs) (21 for resistance to race 23 and 18 for resistance to race 1545) involved in 20 epistatic interactions (eleven and nine interactions for resistance to races 23 and 1545, respectively) were identified. None of the main and epistatic QTLs detected displayed significant environment interaction effects. The present research provides essential information not only for the better understanding of the plant-pathogen interaction but also for the application of genomic assisted breeding for anthracnose resistance improvement in common bean through application of marker-assisted selection (MAS).

  5. Mapping Cholesterol Interaction Sites on Serotonin Transporter through Coarse-Grained Molecular Dynamics

    PubMed Central

    Ferraro, Mariarosaria; Masetti, Matteo; Recanatini, Maurizio; Cavalli, Andrea; Bottegoni, Giovanni

    2016-01-01

    Serotonin transporter (SERT) modulates serotonergic signaling via re-uptake of serotonin in pre-synaptic cells. The inclusion in cholesterol-enriched membrane domains is crucial for SERT activity, suggesting a cross-talk between the protein and the sterol. Here, we develop a protocol to identify potential cholesterol interaction sites coupling statistical analysis to multi-microsecond coarse-grained molecular dynamics simulations of SERT in a previously validated raft-like membrane model. Six putative sites were found, including a putative CRAC motif on TM4 and a CARC motif on TM10. Among them, four hot-spots near regions related to ion binding, transport, and inhibition were detected. Our results encourage prospective studies to unravel mechanistic features of the transporter and related drug discovery implications. PMID:27907003

  6. Development of a stereo analysis algorithm for generating topographic maps using interactive techniques of the MPP

    NASA Technical Reports Server (NTRS)

    Strong, James P.

    1987-01-01

    A local area matching algorithm was developed on the Massively Parallel Processor (MPP). It is an iterative technique that first matches coarse or low resolution areas and at each iteration performs matches of higher resolution. Results so far show that when good matches are possible in the two images, the MPP algorithm matches corresponding areas as well as a human observer. To aid in developing this algorithm, a control or shell program was developed for the MPP that allows interactive experimentation with various parameters and procedures to be used in the matching process. (This would not be possible without the high speed of the MPP). With the system, optimal techniques can be developed for different types of matching problems.

  7. Redrawing the Map of Great Britain from a Network of Human Interactions

    PubMed Central

    Ratti, Carlo; Sobolevsky, Stanislav; Calabrese, Francesco; Andris, Clio; Reades, Jonathan; Martino, Mauro; Claxton, Rob; Strogatz, Steven H.

    2010-01-01

    Do regional boundaries defined by governments respect the more natural ways that people interact across space? This paper proposes a novel, fine-grained approach to regional delineation, based on analyzing networks of billions of individual human transactions. Given a geographical area and some measure of the strength of links between its inhabitants, we show how to partition the area into smaller, non-overlapping regions while minimizing the disruption to each person's links. We tested our method on the largest non-Internet human network, inferred from a large telecommunications database in Great Britain. Our partitioning algorithm yields geographically cohesive regions that correspond remarkably well with administrative regions, while unveiling unexpected spatial structures that had previously only been hypothesized in the literature. We also quantify the effects of partitioning, showing for instance that the effects of a possible secession of Wales from Great Britain would be twice as disruptive for the human network than that of Scotland. PMID:21170390

  8. Mapping the interaction of SmpB with ribosomes by footprinting of ribosomal RNA

    PubMed Central

    Ivanova, Natalia; Pavlov, Michael Y.; Bouakaz, Elli; Ehrenberg, Måns; Schiavone, Lovisa Holmberg

    2005-01-01

    In trans-translation transfer messenger RNA (tmRNA) and small protein B (SmpB) rescue ribosomes stalled on truncated or in other ways problematic mRNAs. SmpB promotes the binding of tmRNA to the ribosome but there is uncertainty about the number of participating SmpB molecules as well as their ribosomal location. Here, the interaction of SmpB with ribosomal subunits and ribosomes was studied by isolation of SmpB containing complexes followed by chemical modification of ribosomal RNA with dimethyl sulfate, kethoxal and hydroxyl radicals. The results show that SmpB binds 30S and 50S subunits with 1:1 molar ratios and the 70S ribosome with 2:1 molar ratio. SmpB-footprints are similar on subunits and the ribosome. In the 30S subunit, SmpB footprints nucleotides that are in the vicinity of the P-site facing the E-site, and in the 50S subunit SmpB footprints nucleotides that are located below the L7/L12 stalk in the 3D structure of the ribosome. Based on these results, we suggest a mechanism where two molecules of SmpB interact with tmRNA and the ribosome during trans-translation. The first SmpB molecule binds near the factor-binding site on the 50S subunit helping tmRNA accommodation on the ribosome, whereas the second SmpB molecule may functionally substitute for a missing anticodon stem–loop in tmRNA during later steps of trans-translation. PMID:15972795

  9. Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions.

    PubMed

    Chu, Ci; Qu, Kun; Zhong, Franklin L; Artandi, Steven E; Chang, Howard Y

    2011-11-18

    Long noncoding RNAs (lncRNAs) are key regulators of chromatin state, yet the nature and sites of RNA-chromatin interaction are mostly unknown. Here we introduce Chromatin Isolation by RNA Purification (ChIRP), where tiling oligonucleotides retrieve specific lncRNAs with bound protein and DNA sequences, which are enumerated by deep sequencing. ChIRP-seq of three lncRNAs reveal that RNA occupancy sites in the genome are focal, sequence-specific, and numerous. Drosophila roX2 RNA occupies male X-linked gene bodies with increasing tendency toward the 3' end, peaking at CES sites. Human telomerase RNA TERC occupies telomeres and Wnt pathway genes. HOTAIR lncRNA preferentially occupies a GA-rich DNA motif to nucleate broad domains of Polycomb occupancy and histone H3 lysine 27 trimethylation. HOTAIR occupancy occurs independently of EZH2, suggesting the order of RNA guidance of Polycomb occupancy. ChIRP-seq is generally applicable to illuminate the intersection of RNA and chromatin with newfound precision genome wide.

  10. A Spatially Explicit Dual-Isotope Approach to Map Regions of Plant-Plant Interaction after Exotic Plant Invasion

    PubMed Central

    Hellmann, Christine; Werner, Christiane; Oldeland, Jens

    2016-01-01

    Understanding interactions between native and invasive plant species in field settings and quantifying the impact of invaders in heterogeneous native ecosystems requires resolving the spatial scale on which these processes take place. Therefore, functional tracers are needed that enable resolving the alterations induced by exotic plant invasion in contrast to natural variation in a spatially explicit way. 15N isoscapes, i.e., spatially referenced representations of stable nitrogen isotopic signatures, have recently provided such a tracer. However, different processes, e.g. water, nitrogen or carbon cycles, may be affected at different spatial scales. Thus multi-isotope studies, by using different functional tracers, can potentially return a more integrated picture of invader impact. This is particularly true when isoscapes are submitted to statistical methods suitable to find homogeneous subgroups in multivariate data such as cluster analysis. Here, we used model-based clustering of spatially explicit foliar δ15N and δ13C isoscapes together with N concentration of a native indicator species, Corema album, to map regions of influence in a Portuguese dune ecosystem invaded by the N2-fixing Acacia longifolia. Cluster analysis identified regions with pronounced alterations in N budget and water use efficiency in the native species, with a more than twofold increase in foliar N, and δ13C and δ15N enrichment of up to 2‰ and 8‰ closer to the invader, respectively. Furthermore, clusters of multiple functional tracers indicated a spatial shift from facilitation through N addition in the proximity of the invader to competition for resources other than N in close contact. Finding homogeneous subgroups in multi-isotope data by means of model-based cluster analysis provided an effective tool for detecting spatial structure in processes affecting plant physiology and performance. The proposed method can give an objective measure of the spatial extent of influence of

  11. Mapping and modeling the urban landscape in Bangkok, Thailand: Physical-spectral-spatial relations of population-environmental interactions

    NASA Astrophysics Data System (ADS)

    Shao, Yang

    This research focuses on the application of remote sensing, geographic information systems, statistical modeling, and spatial analysis to examine the dynamics of urban land cover, urban structure, and population-environment interactions in Bangkok, Thailand, with an emphasis on rural-to-urban migration from rural Nang Rong District, Northeast Thailand to the primate city of Bangkok. The dissertation consists of four main sections: (1) development of remote sensing image classification and change-detection methods for characterizing imperviousness for Bangkok, Thailand from 1993-2002; (2) development of 3-D urban mapping methods, using high spatial resolution IKONOS satellite images, to assess high-rises and other urban structures; (3) assessment of urban spatial structure from 2-D and 3-D perspectives; and (4) an analysis of the spatial clustering of migrants from Nang Rong District in Bangkok and the neighborhood environments of migrants' locations. Techniques are developed to improve the accuracy of the neural network classification approach for the analysis of remote sensing data, with an emphasis on the spectral unmixing problem. The 3-D building heights are derived using the shadow information on the high-resolution IKONOS image. The results from the 2-D and 3-D mapping are further examined to assess urban structure and urban feature identification. This research contributes to image processing of remotely-sensed images and urban studies. The rural-urban migration process and migrants' settlement patterns are examined using spatial statistics, GIS, and remote sensing perspectives. The results show that migrants' spatial clustering in urban space is associated with the source village and a number of socio-demographic variables. In addition, the migrants' neighborhood environments in urban setting are modeled using a set of geographic and socio-demographic variables, and the results are scale-dependent.

  12. Interactive Sonification of Spontaneous Movement of Children-Cross-Modal Mapping and the Perception of Body Movement Qualities through Sound.

    PubMed

    Frid, Emma; Bresin, Roberto; Alborno, Paolo; Elblaus, Ludvig

    2016-01-01

    cross-modal mapping of body motion qualities from bodily movement to sounds. Sound can be translated and understood from bodily motion, conveyed through sound visualizations in the shape of drawings and translated back from sound visualizations to audio. The work underlines the potential of using interactive sonification to communicate high-level features of human movement data.

  13. Interactive Sonification of Spontaneous Movement of Children—Cross-Modal Mapping and the Perception of Body Movement Qualities through Sound

    PubMed Central

    Frid, Emma; Bresin, Roberto; Alborno, Paolo; Elblaus, Ludvig

    2016-01-01

    cross-modal mapping of body motion qualities from bodily movement to sounds. Sound can be translated and understood from bodily motion, conveyed through sound visualizations in the shape of drawings and translated back from sound visualizations to audio. The work underlines the potential of using interactive sonification to communicate high-level features of human movement data. PMID:27891074

  14. Construction of a Comprehensive Protein-Protein Interaction Map for Vitiligo Disease to Identify Key Regulatory Elements: A Systemic Approach.

    PubMed

    Malhotra, Anvita Gupta; Jha, Mohit; Singh, Sudha; Pandey, Khushhali M

    2017-03-13

    Vitiligo is an idiopathic disorder characterized by depigmented patches on the skin due to progressive loss of melanocytes. Several genetic, immunological, and pathophysiological investigations have established vitiligo as a polygenetic disorder with multifactorial etiology. However, no definite model explaining the interplay between these causative factors has been established hitherto. Therefore, we studied the disorder at the system level to identify the key proteins involved by exploring their molecular connectivity in terms of topological parameters. The existing research data helped us in collating 215 proteins involved in vitiligo onset or progression. Interaction study of these proteins leads to a comprehensive vitiligo map with 4845 protein nodes linked with 107,416 edges. Based on centrality measures, a backbone network with 500 nodes has been derived. This has presented a clear overview of the proteins and processes involved and the crosstalk between them. Clustering backbone proteins revealed densely connected regions inferring major molecular interaction modules essential for vitiligo. Finally, a list of top order proteins that play a key role in the disease pathomechanism has been formulated. This includes SUMO2, ESR1, COPS5, MYC, SMAD3, and Cullin proteins. While this list is in fair agreement with the available literature, it also introduces new candidate proteins that can be further explored. A subnetwork of 64 vitiligo core proteins was built by analyzing the backbone and seed protein networks. Our finding suggests that the topology, along with functional clustering, provides a deep insight into the behavior of proteins. This in turn aids in the illustration of disease condition and discovery of significant proteins involved in vitiligo.

  15. Systematic Mapping of WNT-FZD Protein Interactions Reveals Functional Selectivity by Distinct WNT-FZD Pairs*

    PubMed Central

    Dijksterhuis, Jacomijn P.; Baljinnyam, Bolormaa; Stanger, Karen; Sercan, Hakki O.; Ji, Yun; Andres, Osler; Rubin, Jeffrey S.; Hannoush, Rami N.; Schulte, Gunnar

    2015-01-01

    The seven-transmembrane-spanning receptors of the FZD1–10 class are bound and activated by the WNT family of lipoglycoproteins, thereby inducing a complex network of signaling pathways. However, the specificity of the interaction between mammalian WNT and FZD proteins and the subsequent signaling cascade downstream of the different WNT-FZD pairs have not been systematically addressed to date. In this study, we determined the binding affinities of various WNTs for different members of the FZD family by using bio-layer interferometry and characterized their functional selectivity in a cell system. Using purified WNTs, we show that different FZD cysteine-rich domains prefer to bind to distinct WNTs with fast on-rates and slow off-rates. In a 32D cell-based system engineered to overexpress FZD2, FZD4, or FZD5, we found that WNT-3A (but not WNT-4, -5A, or -9B) activated the WNT-β-catenin pathway through FZD2/4/5 as measured by phosphorylation of LRP6 and β-catenin stabilization. Surprisingly, different WNT-FZD pairs showed differential effects on phosphorylation of DVL2 and DVL3, revealing a previously unappreciated DVL isoform selectivity by different WNT-FZD pairs in 32D cells. In summary, we present extensive mapping of WNT-FZD cysteine-rich domain interactions complemented by analysis of WNT-FZD pair functionality in a unique cell system expressing individual FZD isoforms. Differential WNT-FZD binding and selective functional readouts suggest that endogenous WNT ligands evolved with an intrinsic natural bias toward different downstream signaling pathways, a phenomenon that could be of great importance in the design of FZD-targeting drugs. PMID:25605717

  16. Web GIS in practice II: interactive SVG maps of diagnoses of sexually transmitted diseases by Primary Care Trust in London, 1997 – 2003

    PubMed Central

    Boulos, Maged N Kamel; Russell, Chris; Smith, Michael

    2005-01-01

    Background The rates of Sexually transmitted diseases (STDs) in England have been rising steadily since the mid 1990s, making them a major public health concern. In 2003, 672,718 people were diagnosed with an STD in England, and around one third of those cases were diagnosed in London. Results Using GeoReveal v1.1 for Windows, we produced Web-based interactive choropleth maps of diagnoses of STDs by Primary Care Trust (PCT) in London for the years from 1997 to 2003 . These maps are in Scalable Vector Graphics (SVG) format and require a freely available Adobe SVG browser plug-in to be displayed. They are based on data obtained from the House of Commons Hansard Written Answers for 15 October 2004. They show steadily rising rates of STDs in London over the covered seven-year period. Also, one can clearly see on the maps that PCTs located in central London had the highest numbers of STD diagnoses throughout the mapped seven years. A companion bar chart allows users to instantly compare the STD figure of a given PCT for a given year against the average figure for all 25 mapped PCTs for the same year, and also compare those figures across all seven years. The maps offer users a rich set of useful features and functions, including the ability to change the classification method in use, the number of ranges in the map, and the colour theme, among others. Conclusions Wizard-driven tools like GeoReveal have made it very easy to transform complex raw data into valuable decision support information products (interactive Web maps) in very little time and without requiring much expertise. The resultant interactive maps have the potential of further supporting health planners and decision makers in their planning and management tasks by allowing them to graphically interrogate data, instantly spot trends, and make quick and effective visual comparisons of geographically differentiated phenomena between different geographical areas and over time. SVG makes an ideal format for such

  17. An integrated protein localization and interaction map for Potato yellow dwarf virus, type species of the genus Nucleorhabdovirus

    SciTech Connect

    Bandyopadhyay, Anindya; Kopperud, Kristin; Anderson, Gavin; Martin, Kathleen; Goodin, Michael

    2010-06-20

    The genome of Potato yellow dwarf virus (PYDV; Nucleorhabdovirus type species) was determined to be 12,875 nucleotides (nt). The antigenome is organized into seven open reading frames (ORFs) ordered 3'-N-X-P-Y-M-G-L-5', which likely encode the nucleocapsid, phospho, movement, matrix, glyco and RNA-dependent RNA polymerase proteins, respectively, except for X, which is of unknown function. The ORFs are flanked by a 3' leader RNA of 149 nt and a 5' trailer RNA of 97 nt, and are separated by conserved intergenic junctions. Phylogenetic analyses indicated that PYDV is closely related to other leafhopper-transmitted rhabdoviruses. Functional protein assays were used to determine the subcellular localization of PYDV proteins. Surprisingly, the M protein was able to induce the intranuclear accumulation of the inner nuclear membrane in the absence of any other viral protein. Finally, bimolecular fluorescence complementation was used to generate the most comprehensive protein interaction map for a plant-adapted rhabdovirus to date.

  18. Rydberg and valence state excitation dynamics: a velocity map imaging study involving the E-V state interaction in HBr.

    PubMed

    Zaouris, Dimitris; Kartakoullis, Andreas; Glodic, Pavle; Samartzis, Peter C; Rafn Hróðmarsson, Helgi; Kvaran, Ágúst

    2015-04-28

    Photoexcitation dynamics of the E((1)Σ(+)) (v' = 0) Rydberg state and the V((1)Σ(+)) (v') ion-pair vibrational states of HBr are investigated by velocity map imaging (VMI). H(+) photoions, produced through a number of vibrational and rotational levels of the two states were imaged and kinetic energy release (KER) and angular distributions were extracted from the data. In agreement with previous work, we found the photodissociation channels forming H*(n = 2) + Br((2)P3/2)/Br*((2)P1/2) to be dominant. Autoionization pathways leading to H(+) + Br((2)P3/2)/Br*((2)P1/2) via either HBr(+)((2)Π3/2) or HBr(+)*((2)Π1/2) formation were also present. The analysis of KER and angular distributions and comparison with rotationally and mass resolved resonance enhanced multiphoton ionization (REMPI) spectra revealed the excitation transition mechanisms and characteristics of states involved as well as the involvement of the E-V state interactions and their v' and J' dependence.

  19. Genetic Interaction Mapping Reveals a Role for the SWI/SNF Nucleosome Remodeler in Spliceosome Activation in Fission Yeast

    PubMed Central

    Patrick, Kristin L.; Ryan, Colm J.; Xu, Jiewei; Lipp, Jesse J.; Nissen, Kelly E.; Roguev, Assen; Shales, Michael; Krogan, Nevan J.; Guthrie, Christine

    2015-01-01

    Although numerous regulatory connections between pre-mRNA splicing and chromatin have been demonstrated, the precise mechanisms by which chromatin factors influence spliceosome assembly and/or catalysis remain unclear. To probe the genetic network of pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, we constructed an epistatic mini-array profile (E-MAP) and discovered many new connections between chromatin and splicing. Notably, the nucleosome remodeler SWI/SNF had strong genetic interactions with components of the U2 snRNP SF3 complex. Overexpression of SF3 components in ΔSWI/SNF cells led to inefficient splicing of many fission yeast introns, predominantly those with non-consensus splice sites. Deletion of SWI/SNF decreased recruitment of the splicing ATPase Prp2, suggesting that SWI/SNF promotes co-transcriptional spliceosome assembly prior to first step catalysis. Importantly, defects in SWI/SNF as well as SF3 overexpression each altered nucleosome occupancy along intron-containing genes, illustrating that the chromatin landscape both affects—and is affected by—co-transcriptional splicing. PMID:25825871

  20. Comprehensive mapping of protein N-glycosylation in human liver by combining hydrophilic interaction chromatography and hydrazide chemistry.

    PubMed

    Zhu, Jun; Sun, Zhen; Cheng, Kai; Chen, Rui; Ye, Mingliang; Xu, Bo; Sun, Deguang; Wang, Liming; Liu, Jing; Wang, Fangjun; Zou, Hanfa

    2014-03-07

    Although glycoproteomics is greatly developed in recent years, our knowledge about N-glycoproteome of human tissues is still very limited. In this study, we comprehensively mapped the N-glycosylation sites of human liver by combining click maltose-hydrophilic interaction chromatography (HILIC) and the improved hydrazide chemistry. The specificity could be as high as 90% for hydrazide chemistry and 80% for HILIC. Altogether, we identified 14,480 N-glycopeptides matched with N-!P-[S|T|C] sequence motif from human liver, corresponding to 2210 N-glycoproteins and 4783 N-glycosylation sites. These N-glycoproteins are widely involved into different types of biological processes, such as hepatic stellate cell activation and acute phase response of human liver, which all highly associate with the progression of liver diseases. Moreover, the exact N-glycosylation sites of some key-regulating proteins within different human liver physiological processes were also obtained, such as E-cadherin, transforming growth factor beta receptor and 29 members of G protein coupled receptors family.

  1. Selection in spatial working memory is independent of perceptual selective attention, but they interact in a shared spatial priority map.

    PubMed

    Hedge, Craig; Oberauer, Klaus; Leonards, Ute

    2015-11-01

    We examined the relationship between the attentional selection of perceptual information and of information in working memory (WM) through four experiments, using a spatial WM-updating task. Participants remembered the locations of two objects in a matrix and worked through a sequence of updating operations, each mentally shifting one dot to a new location according to an arrow cue. Repeatedly updating the same object in two successive steps is typically faster than switching to the other object; this object switch cost reflects the shifting of attention in WM. In Experiment 1, the arrows were presented in random peripheral locations, drawing perceptual attention away from the selected object in WM. This manipulation did not eliminate the object switch cost, indicating that the mechanisms of perceptual selection do not underlie selection in WM. Experiments 2a and 2b corroborated the independence of selection observed in Experiment 1, but showed a benefit to reaction times when the placement of the arrow cue was aligned with the locations of relevant objects in WM. Experiment 2c showed that the same benefit also occurs when participants are not able to mark an updating location through eye fixations. Together, these data can be accounted for by a framework in which perceptual selection and selection in WM are separate mechanisms that interact through a shared spatial priority map.

  2. Interaction of two successive Alpine deformation fronts: constraints from low-temperature thermochronology and structural mapping (NW Iberian Peninsula)

    NASA Astrophysics Data System (ADS)

    Martín-González, F.; Barbero, L.; Capote, R.; Heredia, N.; Gallastegui, G.

    2012-07-01

    The lateral termination of the Alpine-Pyrenean Orogen relief onshore is located in the NW Iberian Peninsula. It overlies a Variscan basement (Iberian Massif), where the sedimentary record of the Alpine tectonic is very scarce. Thus, the characterisation of the tectonic evolution of the lateral termination is difficult and timing and geometries of the main tectonic structures remain unclear. Combining the tectonothermal histories obtained by modelling of the apatite fission-track data (AFT) with structural mapping allows for a comparative study of the different tectonic scenarios and deformation transfer in the lateral termination of an orogen. AFT ages for the studied area vary from 53.5 ± 12.9 and 222 ± 12 Ma (from Late Triassic to Early Eocene). The beginning of the Cenozoic cooling episodes is in agreement with the infilling of the Tertiary basins (Late Eocene or Oligocene). Calculated uplift for the Alpine Orogeny is around 2,400 m. The Cantabrian Mountains were uplifted and emplaced southwards and the main period of exhumation began in the Palaeogene at rates of ~0.02 mm/a and continued during the Neogene at rates of ~0.06 mm/a. However, the Galaico-Leoneses Mountains, located to the south of the studied area, were uplifted and emplaced northwards during the Neogene, showing more rapid uplift rates of ~0.08 mm/a, suggesting that the western termination of the Alpine-Pyrenean Orogen relief is the result of the successive interaction of two Alpine deformation fronts.

  3. Genetic interaction mapping reveals a role for the SWI/SNF nucleosome remodeler in spliceosome activation in fission yeast.

    PubMed

    Patrick, Kristin L; Ryan, Colm J; Xu, Jiewei; Lipp, Jesse J; Nissen, Kelly E; Roguev, Assen; Shales, Michael; Krogan, Nevan J; Guthrie, Christine

    2015-03-01

    Although numerous regulatory connections between pre-mRNA splicing and chromatin have been demonstrated, the precise mechanisms by which chromatin factors influence spliceosome assembly and/or catalysis remain unclear. To probe the genetic network of pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, we constructed an epistatic mini-array profile (E-MAP) and discovered many new connections between chromatin and splicing. Notably, the nucleosome remodeler SWI/SNF had strong genetic interactions with components of the U2 snRNP SF3 complex. Overexpression of SF3 components in ΔSWI/SNF cells led to inefficient splicing of many fission yeast introns, predominantly those with non-consensus splice sites. Deletion of SWI/SNF decreased recruitment of the splicing ATPase Prp2, suggesting that SWI/SNF promotes co-transcriptional spliceosome assembly prior to first step catalysis. Importantly, defects in SWI/SNF as well as SF3 overexpression each altered nucleosome occupancy along intron-containing genes, illustrating that the chromatin landscape both affects--and is affected by--co-transcriptional splicing.

  4. Biochemical mapping of interactions within the intraflagellar transport (IFT) B core complex: IFT52 binds directly to four other IFT-B subunits.

    PubMed

    Taschner, Michael; Bhogaraju, Sagar; Vetter, Melanie; Morawetz, Michaela; Lorentzen, Esben

    2011-07-29

    Cilia and flagella are complex structures emanating from the surface of most eukaroytic cells and serve important functions including motility, signaling, and sensory reception. A process called intraflagellar transport (IFT) is of central importance to ciliary assembly and maintenance. The IFT complex is required for this transport and consists of two distinct multisubunit subcomplexes, IFT-A and IFT-B. Despite the importance of the IFT complex, little is known about its overall architecture. This paper presents a biochemical dissection of the molecular interactions within the IFT-B core complex. Two stable subcomplexes consisting of IFT88/70/52/46 and IFT81/74/27/25 were recombinantly co-expressed and purified. We identify a novel interaction between IFT70/52 and map the interaction domains between IFT52 and the other subunits within the IFT88/70/52/46 complex. Additionally, we show that IFT52 binds directly to the IFT81/74/27/25 complex, indicating that it could mediate the interaction between the two subcomplexes. Our data lead to an improved architectural map for the IFT-B core complex with new interactions as well as domain resolution mapping for several subunits.

  5. e2g: an interactive web-based server for efficiently mapping large EST and cDNA sets to genomic sequences.

    PubMed

    Krüger, Jan; Sczyrba, Alexander; Kurtz, Stefan; Giegerich, Robert

    2004-07-01

    e2g is a web-based server which efficiently maps large expressed sequence tag (EST) and cDNA datasets to genomic DNA. It significantly extends the volume of data that can be mapped in reasonable time, and makes this improved efficiency available as a web service. Our server hosts large collections of EST sequences (e.g. 4.1 million mouse ESTs of 1.87 Gb) in precomputed indexed data structures for efficient sequence comparison. The user can upload a genomic DNA sequence of interest and rapidly compare this to the complete collection of ESTs on the server. This delivers a mapping of the ESTs on the genomic DNA. The e2g web interface provides a graphical overview of the mapping. Alignments of the mapped EST regions with parts of the genomic sequence are visualized. Zooming functions allow the user to interactively explore the results. Mapped sequences can be downloaded for further analysis. e2g is available on the Bielefeld University Bioinformatics Server at http://bibiserv.techfak.uni-bielefeld.de/e2g/.

  6. Analysis of origin and protein-protein interaction maps suggests distinct oncogenic role of nuclear EGFR during cancer evolution

    PubMed Central

    Sharip, Ainur; Abdukhakimova, Diyora; Wang, Xiao; Kim, Alexey; Kim, Yevgeniy; Sharip, Aigul; Orakov, Askarbek; Miao, Lixia; Sun, Qinglei; Chen, Yue; Chen, Zhenbang; Xie, Yingqiu

    2017-01-01

    Receptor tyrosine kinase EGFR usually is localized on plasma membrane to induce progression of many cancers including cancers in children (Bodey et al. In Vivo. 2005, 19:931-41), but it contains a nuclear localization signal (NLS) that mediates EGFR nuclear translocation (Lin et al. Nat Cell Biol. 2001, 3:802-8). Here we report that NLS of EGFR has its old evolutionary origin. Protein-protein interaction maps suggests that nEGFR pathways are different from membrane EGFR and EGF is not found in nEGFR network while androgen receptor (AR) is found, which suggests the evolution of prostate cancer, a well-known AR driven cancer, through changes in androgen- or EGF-dependence. Database analysis suggests that nEGFR correlates with the tumor grades especially in prostate cancer patients. Structural predication analysis suggests that NLS can compromise the differential protein binding to EGFR through stretch linkers with evolutionary mutation from N to V. In experiment, elevation of nEGFR but not membrane EGFR was found in castration resistant prostate cancer cells. Finally, systems analysis of NLS and transmembrane domain (TM) suggests that NLS has old origin while NLS neighboring domain of TM has been undergone accelerated evolution. Thus nEGFR has an old origin resembling the cancer evolution but TM may interfere with NLS driven signaling for natural selection of survival to evade NLS induced aggressive cancers. Our data suggest NLS is a dynamic inducer of EGFR oncogenesis during evolution for advanced cancers. Our model provides novel insights into the evolutionary role of NLS of oncogenic kinases in cancers. PMID:28382154

  7. Identification and mapping of leaf, stem and stripe rust resistance quantitative trait loci and their interactions in durum wheat.

    PubMed

    Singh, A; Pandey, M P; Singh, A K; Knox, R E; Ammar, K; Clarke, J M; Clarke, F R; Singh, R P; Pozniak, C J; Depauw, R M; McCallum, B D; Cuthbert, R D; Randhawa, H S; Fetch, T G

    2013-02-01

    Leaf rust (Puccinia triticina Eriks.), stripe rust (Puccinia striiformis f. tritici Eriks.) and stem rust (Puccinia graminis f. sp. tritici) cause major production losses in durum wheat (Triticum turgidum L. var. durum). The objective of this research was to identify and map leaf, stripe and stem rust resistance loci from the French cultivar Sachem and Canadian cultivar Strongfield. A doubled haploid population from Sachem/Strongfield and parents were phenotyped for seedling reaction to leaf rust races BBG/BN and BBG/BP and adult plant response was determined in three field rust nurseries near El Batan, Obregon and Toluca, Mexico. Stripe rust response was recorded in 2009 and 2011 nurseries near Toluca and near Njoro, Kenya in 2010. Response to stem rust was recorded in field nurseries near Njoro, Kenya, in 2010 and 2011. Sachem was resistant to leaf, stripe and stem rust. A major leaf rust quantitative trait locus (QTL) was identified on chromosome 7B at Xgwm146 in Sachem. In the same region on 7B, a stripe rust QTL was identified in Strongfield. Leaf and stripe rust QTL around DArT marker wPt3451 were identified on chromosome 1B. On chromosome 2B, a significant leaf rust QTL was detected conferred by Strongfield, and at the same QTL, a Yr gene derived from Sachem conferred resistance. Significant stem rust resistance QTL were detected on chromosome 4B. Consistent interactions among loci for resistance to each rust type across nurseries were detected, especially for leaf rust QTL on 7B. Sachem and Strongfield offer useful sources of rust resistance genes for durum rust breeding.

  8. Using GIS servers and interactive maps in spectral data sharing and administration: Case study of Ahvaz Spectral Geodatabase Platform (ASGP)

    NASA Astrophysics Data System (ADS)

    Karami, Mojtaba; Rangzan, Kazem; Saberi, Azim

    2013-10-01

    With emergence of air-borne and space-borne hyperspectral sensors, spectroscopic measurements are gaining more importance in remote sensing. Therefore, the number of available spectral reference data is constantly increasing. This rapid increase often exhibits a poor data management, which leads to ultimate isolation of data on disk storages. Spectral data without precise description of the target, methods, environment, and sampling geometry cannot be used by other researchers. Moreover, existing spectral data (in case it accompanied with good documentation) become virtually invisible or unreachable for researchers. Providing documentation and a data-sharing framework for spectral data, in which researchers are able to search for or share spectral data and documentation, would definitely improve the data lifetime. Relational Database Management Systems (RDBMS) are main candidates for spectral data management and their efficiency is proven by many studies and applications to date. In this study, a new approach to spectral data administration is presented based on spatial identity of spectral samples. This method benefits from scalability and performance of RDBMS for storage of spectral data, but uses GIS servers to provide users with interactive maps as an interface to the system. The spectral files, photographs and descriptive data are considered as belongings of a geospatial object. A spectral processing unit is responsible for evaluation of metadata quality and performing routine spectral processing tasks for newly-added data. As a result, by using internet browser software the users would be able to visually examine availability of data and/or search for data based on descriptive attributes associated to it. The proposed system is scalable and besides giving the users good sense of what data are available in the database, it facilitates participation of spectral reference data in producing geoinformation.

  9. Interaction Between Object-Based Attention and Pertinence Values Shapes the Attentional Priority Map of a Multielement Display

    PubMed Central

    2016-01-01

    Previous studies have shown that the perceptual organization of the visual scene constrains the deployment of attention. Here we investigated how the organization of multiple elements into larger configurations alters their attentional weight, depending on the “pertinence” or behavioral importance of the elements’ features. We assessed object-based effects on distinct aspects of the attentional priority map: top-down control, reflecting the tendency to encode targets rather than distracters, and the spatial distribution of attention weights across the visual scene, reflecting the tendency to report elements belonging to the same rather than different objects. In 2 experiments participants had to report the letters in briefly presented displays containing 8 letters and digits, in which pairs of characters could be connected with a line. Quantitative estimates of top-down control were obtained using Bundesen’s Theory of Visual Attention (1990). The spatial distribution of attention weights was assessed using the “paired response index” (PRI), indicating responses for within-object pairs of letters. In Experiment 1, grouping along the task-relevant dimension (targets with targets and distracters with distracters) increased top-down control and enhanced the PRI; in contrast, task-irrelevant grouping (targets with distracters) did not affect performance. In Experiment 2, we disentangled the effect of target-target and distracter-distracter grouping: Pairwise grouping of distracters enhanced top-down control whereas pairwise grouping of targets changed the PRI. We conclude that object-based perceptual representations interact with pertinence values (of the elements’ features and location) in the computation of attention weights, thereby creating a widespread pattern of attentional facilitation across the visual scene. PMID:26752732

  10. Topographical mapping of α- and β-keratins on developing chicken skin integuments: Functional interaction and evolutionary perspectives

    PubMed Central

    Wu, Ping; Ng, Chen Siang; Yan, Jie; Lai, Yung-Chih; Chen, Chih-Kuan; Lai, Yu-Ting; Wu, Siao-Man; Chen, Jiun-Jie; Luo, Weiqi; Widelitz, Randall B.; Li, Wen-Hsiung; Chuong, Cheng-Ming

    2015-01-01

    Avian integumentary organs include feathers, scales, claws, and beaks. They cover the body surface and play various functions to help adapt birds to diverse environments. These keratinized structures are mainly composed of corneous materials made of α-keratins, which exist in all vertebrates, and β-keratins, which only exist in birds and reptiles. Here, members of the keratin gene families were used to study how gene family evolution contributes to novelty and adaptation, focusing on tissue morphogenesis. Using chicken as a model, we applied RNA-seq and in situ hybridization to map α- and β-keratin genes in various skin appendages at embryonic developmental stages. The data demonstrate that temporal and spatial α- and β-keratin expression is involved in establishing the diversity of skin appendage phenotypes. Embryonic feathers express a higher proportion of β-keratin genes than other skin regions. In feather filament morphogenesis, β-keratins show intricate complexity in diverse substructures of feather branches. To explore functional interactions, we used a retrovirus transgenic system to ectopically express mutant α- or antisense β-keratin forms. α- and β-keratins show mutual dependence and mutations in either keratin type results in disrupted keratin networks and failure to form proper feather branches. Our data suggest that combinations of α- and β-keratin genes contribute to the morphological and structural diversity of different avian skin appendages, with feather-β-keratins conferring more possible composites in building intrafeather architecture complexity, setting up a platform of morphological evolution of functional forms in feathers. PMID:26598683

  11. Interaction of Antiparallel Microtubules in the Phragmoplast Is Mediated by the Microtubule-Associated Protein MAP65-3 in Arabidopsis[W

    PubMed Central

    Ho, Chin-Min Kimmy; Hotta, Takashi; Guo, Fengli; Roberson, Robert W.; Lee, Yuh-Ru Julie; Liu, Bo

    2011-01-01

    In plant cells, microtubules (MTs) in the cytokinetic apparatus phragmoplast exhibit an antiparallel array and transport Golgi-derived vesicles toward MT plus ends located at or near the division site. By transmission electron microscopy, we observed that certain antiparallel phragmoplast MTs overlapped and were bridged by electron-dense materials in Arabidopsis thaliana. Robust MT polymerization, reported by fluorescently tagged End Binding1c (EB1c), took place in the phragmoplast midline. The engagement of antiparallel MTs in the central spindle and phragmoplast was largely abolished in mutant cells lacking the MT-associated protein, MAP65-3. We found that endogenous MAP65-3 was selectively detected on the middle segments of the central spindle MTs at late anaphase. When MTs exhibited a bipolar appearance with their plus ends placed in the middle, MAP65-3 exclusively decorated the phragmoplast midline. A bacterially expressed MAP65-3 protein was able to establish the interdigitation of MTs in vitro. MAP65-3 interacted with antiparallel microtubules before motor Kinesin-12 did during the establishment of the phragmoplast MT array. Thus, MAP65-3 selectively cross-linked interdigitating MTs (IMTs) to allow antiparallel MTs to be closely engaged in the phragmoplast. Although the presence of IMTs was not essential for vesicle trafficking, they were required for the phragmoplast-specific motors Kinesin-12 and Phragmoplast-Associated Kinesin-Related Protein2 to interact with MT plus ends. In conclusion, we suggest that the phragmoplast contains IMTs and highly dynamic noninterdigitating MTs, which work in concert to bring about cytokinesis in plant cells. PMID:21873565

  12. The Application of Ligand-Mapping Molecular Dynamics Simulations to the Rational Design of Peptidic Modulators of Protein-Protein Interactions.

    PubMed

    Tan, Yaw Sing; Spring, David R; Abell, Chris; Verma, Chandra S

    2015-07-14

    A computational ligand-mapping approach to detect protein surface pockets that interact with hydrophobic moieties is presented. In this method, we incorporated benzene molecules into explicit solvent molecular dynamics simulations of various protein targets. The benzene molecules successfully identified the binding locations of hydrophobic hot-spot residues and all-hydrocarbon cross-links from known peptidic ligands. They also unveiled cryptic binding sites that are occluded by side chains and the protein backbone. Our results demonstrate that ligand-mapping molecular dynamics simulations hold immense promise to guide the rational design of peptidic modulators of protein-protein interactions, including that of stapled peptides, which show promise as an exciting new class of cell-penetrating therapeutic molecules.

  13. Making large class basic histology lectures more interactive: The use of draw-along mapping techniques and associated educational activities.

    PubMed

    Kotzé, Sanet Henriët; Mole, Calvin Gerald

    2015-01-01

    At Stellenbosch University, South Africa, basic histology is taught to a combination class of almost 400 first-year medical, physiotherapy, and dietetic students. Many students often find the amount of work in basic histology lectures overwhelming and consequently loose interest. The aim was to determine if a draw-along mapping activity would focus students during large class lectures. After each lecture on three basic histology tissues, a guided draw-along mapping session covering the work from the lecture was introduced in the form of a click-advance PowerPoint presentation which was used to demonstrate the unfolding of an "ideal" map. The lecturer simultaneously drew a similar map using an overhead projector allowing the students to draw their own maps on blank sheets of paper along with the lecturer. Students remained attentive during the activity and many participated in answering informal questions posed by the lecturer as the map-making session progressed. After the last session, students completed an anonymous, voluntary questionnaire (response rate of 78%). The majority of students found the draw-along maps useful (94%) and believed that its use should be continued in the future (93%). A significant increase (P < 0.001) was found in the test results of student cohorts who were given the current intervention compared to cohorts from previous years who were given mind maps as handouts only or had no intervention. The use of the draw-along mapping sessions were successful in focusing students during large class lectures while also providing them with a useful tool for their studies.

  14. A spatially explicit multi-isotope approach to map influence regions of plant-plant interactions after exotic plant invasion

    NASA Astrophysics Data System (ADS)

    Hellmann, Christine; Oldeland, Jens; Werner, Christiane

    2015-04-01

    Exotic plant invasions impose profound alterations to native ecosystems, including changes of water, carbon and nutrient cycles. However, explicitly quantifying these impacts remains a challenge. Stable isotopes, by providing natural tracers of biogeochemical processes, can help to identify and measure such alterations in space and time. Recently, δ15N isoscapes, i.e. spatially continuous representations of isotopic values, derived from native plant foliage, enabled to accurately trace nitrogen introduced by the N2-fixing invasive Acacia longifolia into a native Portuguese dune system. It could be shown that the area of the system which was altered by the invasive species exceeded the area which was covered by the invader by far. But still, definition of clear regions of influence is to some extent ambiguous. Here, we present an approach using multiple isoscapes derived from measured foliar δ13C and δ15N values of a native, non-fixing species, Corema album. By clustering isotopic information, we obtained an objective classification of the study area. Properties and spatial position of clusters could be interpreted to distinguish areas that were or were not influenced by A. longifolia. Spatial clusters at locations where A. longifolia was present had δ15N values that were enriched, i.e. close to the atmospheric signal of 0 o compared to the depleted values of the uninvaded system (ca. -11 o). Furthermore, C. album individuals in these clusters were characterized by higher foliar N content and enriched δ13C. These results indicate that the N2-fixing A. longifolia added nitrogen to the system which originated from the atmosphere and was used by the native C. album, inducing functional changes, i.e. an increase in WUE. Additionally, clusters were identified that were presumably determined by inherent properties of the native system. Thus, combining isotope ecology with geostatistical methods is a promising approach for mapping regions of influence in multi

  15. RadMap

    EPA Pesticide Factsheets

    RadMap is an interactive desktop tool featuring a nationwide geographic information systems (GIS) map of long-term radiation monitoring locations across the United States with access to key information about the monitor and the area surrounding it.

  16. The application of an emerging technique for protein-protein interaction interface mapping: the combination of photo-initiated cross-linking protein nanoprobes with mass spectrometry.

    PubMed

    Ptáčková, Renata; Ječmen, Tomáš; Novák, Petr; Hudeček, Jiří; Stiborová, Marie; Šulc, Miroslav

    2014-05-26

    Protein-protein interaction was investigated using a protein nanoprobe capable of photo-initiated cross-linking in combination with high-resolution and tandem mass spectrometry. This emerging experimental approach introduces photo-analogs of amino acids within a protein sequence during its recombinant expression, preserves native protein structure and is suitable for mapping the contact between two proteins. The contact surface regions involved in the well-characterized interaction between two molecules of human 14-3-3ζ regulatory protein were used as a model. The employed photo-initiated cross-linking techniques extend the number of residues shown to be within interaction distance in the contact surface of the 14-3-3ζ dimer (Gln8-Met78). The results of this study are in agreement with our previously published data from molecular dynamic calculations based on high-resolution chemical cross-linking data and Hydrogen/Deuterium exchange mass spectrometry. The observed contact is also in accord with the 14-3-3ζ X-ray crystal structure (PDB 3dhr). The results of the present work are relevant to the structural biology of transient interaction in the 14-3-3ζ protein, and demonstrate the ability of the chosen methodology (the combination of photo-initiated cross-linking protein nanoprobes and mass spectrometry analysis) to map the protein-protein interface or regions with a flexible structure.

  17. DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments.

    PubMed

    Wu, Feinan; Olson, Brennan G; Yao, Jie

    2016-01-27

    The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

  18. Making Large Class Basic Histology Lectures More Interactive: The Use of Draw-Along Mapping Techniques and Associated Educational Activities

    ERIC Educational Resources Information Center

    Kotzé, Sanet Henriët; Mole, Calvin Gerald

    2015-01-01

    At Stellenbosch University, South Africa, basic histology is taught to a combination class of almost 400 first-year medical, physiotherapy, and dietetic students. Many students often find the amount of work in basic histology lectures overwhelming and consequently loose interest. The aim was to determine if a draw-along mapping activity would…

  19. An interactive program to display user-generated or file-based maps on a personal computer monitor

    USGS Publications Warehouse

    Langer, W.H.; Stephens, R.W.

    1987-01-01

    PC MAP-MAKER is an ADVANCED BASIC program written to provide users of IBM XT, IBM AT, and compatible computers with a straight-forward, flexible method to display geographical data on a color or monochrome PC (personal computer) monitor. Data can be political boundaries such as State and county boundaries; natural curvilinear features such as rivers, drainage areas, and geological contacts; and points such as well locations and mineral localities. Essentially any point defined by a latitude and longitude and any line defined by a series of latitude and longitude values can be displayed using the program. PC MAP MAKER allows users to view tabular data from U.S. Geological Survey files such as WATSTORE (National Water Data Storage and Retrieval System) in a map format in a time much shorter than required by sending the data to a line plotter. The screen image can be saved to disk for recall at a later date, and hard copies can be printed with a dot matrix printer. The program is user-friendly, using menus or prompts to guide user input. It is fully documented and structured to allow the user to tailor the program to the user 's specific needs. The documentation includes a tutorial designed to introduce users to the capabilities of the program using the State of Colorado as a demonstration map area. (Author 's abstract)

  20. Multivariate PLS Modeling of Apicomplexan FabD-Ligand Interaction Space for Mapping Target-Specific Chemical Space and Pharmacophore Fingerprints

    PubMed Central

    Surolia, Avadhesha

    2015-01-01

    Biomolecular recognition underlying drug-target interactions is determined by both binding affinity and specificity. Whilst, quantification of binding efficacy is possible, determining specificity remains a challenge, as it requires affinity data for multiple targets with the same ligand dataset. Thus, understanding the interaction space by mapping the target space to model its complementary chemical space through computational techniques are desirable. In this study, active site architecture of FabD drug target in two apicomplexan parasites viz. Plasmodium falciparum (PfFabD) and Toxoplasma gondii (TgFabD) is explored, followed by consensus docking calculations and identification of fifteen best hit compounds, most of which are found to be derivatives of natural products. Subsequently, machine learning techniques were applied on molecular descriptors of six FabD homologs and sixty ligands to induce distinct multivariate partial-least square models. The biological space of FabD mapped by the various chemical entities explain their interaction space in general. It also highlights the selective variations in FabD of apicomplexan parasites with that of the host. Furthermore, chemometric models revealed the principal chemical scaffolds in PfFabD and TgFabD as pyrrolidines and imidazoles, respectively, which render target specificity and improve binding affinity in combination with other functional descriptors conducive for the design and optimization of the leads. PMID:26535573

  1. A protein interaction map for cell-cell adhesion regulators identifies DUSP23 as a novel phosphatase for β-catenin

    PubMed Central

    Gallegos, Lisa Leon; Ng, Mei Rosa; Sowa, Mathew E.; Selfors, Laura M.; White, Anne; Zervantonakis, Ioannis K.; Singh, Pragya; Dhakal, Sabin; Harper, J. Wade; Brugge, Joan S.

    2016-01-01

    Cell-cell adhesion is central to morphogenesis and maintenance of epithelial cell state. We previously identified 27 candidate cell-cell adhesion regulatory proteins (CCARPs) whose down-regulation disrupts epithelial cell-cell adhesion during collective migration. Using a protein interaction mapping strategy, we found that 18 CCARPs link to core components of adherens junctions or desmosomes. We further mapped linkages between the CCARPs and other known cell-cell adhesion proteins, including hits from recent screens uncovering novel components of E-cadherin adhesions. Mechanistic studies of one novel CCARP which links to multiple cell-cell adhesion proteins, the phosphatase DUSP23, revealed that it promotes dephosphorylation of β-catenin at Tyr 142 and enhances the interaction between α- and β-catenin. DUSP23 knockdown specifically diminished adhesion to E-cadherin without altering adhesion to fibronectin matrix proteins. Furthermore, DUSP23 knockdown produced “zipper-like” cell-cell adhesions, caused defects in transmission of polarization cues, and reduced coordination during collective migration. Thus, this study identifies multiple novel connections between proteins that regulate cell-cell interactions and provides evidence for a previously unrecognized role for DUSP23 in regulating E-cadherin adherens junctions through promoting the dephosphorylation of β-catenin. PMID:27255161

  2. Sharing our data—An overview of current (2016) USGS policies and practices for publishing data on ScienceBase and an example interactive mapping application

    USGS Publications Warehouse

    Chase, Katherine J.; Bock, Andrew R.; Sando, Roy

    2017-01-05

    This report provides an overview of current (2016) U.S. Geological Survey policies and practices related to publishing data on ScienceBase, and an example interactive mapping application to display those data. ScienceBase is an integrated data sharing platform managed by the U.S. Geological Survey. This report describes resources that U.S. Geological Survey Scientists can use for writing data management plans, formatting data, and creating metadata, as well as for data and metadata review, uploading data and metadata to ScienceBase, and sharing metadata through the U.S. Geological Survey Science Data Catalog. Because data publishing policies and practices are evolving, scientists should consult the resources cited in this paper for definitive policy information.An example is provided where, using the content of a published ScienceBase data release that is associated with an interpretive product, a simple user interface is constructed to demonstrate how the open source capabilities of the R programming language and environment can interact with the properties and objects of the ScienceBase item and be used to generate interactive maps.

  3. A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing.

    PubMed

    Wilmes, Gwendolyn M; Bergkessel, Megan; Bandyopadhyay, Sourav; Shales, Michael; Braberg, Hannes; Cagney, Gerard; Collins, Sean R; Whitworth, Gregg B; Kress, Tracy L; Weissman, Jonathan S; Ideker, Trey; Guthrie, Christine; Krogan, Nevan J

    2008-12-05

    We used a quantitative, high-density genetic interaction map, or E-MAP (Epistatic MiniArray Profile), to interrogate the relationships within and between RNA-processing pathways. Due to their complexity and the essential roles of many of the components, these pathways have been difficult to functionally dissect. Here, we report the results for 107,155 individual interactions involving 552 mutations, 166 of which are hypomorphic alleles of essential genes. Our data enabled the discovery of links between components of the mRNA export and splicing machineries and Sem1/Dss1, a component of the 19S proteasome. In particular, we demonstrate that Sem1 has a proteasome-independent role in mRNA export as a functional component of the Sac3-Thp1 complex. Sem1 also interacts with Csn12, a component of the COP9 signalosome. Finally, we show that Csn12 plays a role in pre-mRNA splicing, which is independent of other signalosome components. Thus, Sem1 is involved in three separate and functionally distinct complexes.

  4. Accurately mapping the location of the binding site for the interaction between hepatitis B virus X protein and cytochrome c oxidase III

    PubMed Central

    LI, DAN; DING, JIAN; CHEN, ZHIXIN; CHEN, YUN; LIN, NA; CHEN, FENGLIN; WANG, XIAOZHONG

    2015-01-01

    The hepatitis B virus (HBV) X protein (HBx) plays an important pathogenetic role in hepatocarcinoma tumorigenesis. As HBx does not have the ability to bind to double-stranded DNA (dsDNA), protein-protein interaction is crucial for HBx functions. In a previous study, we screened a novel HBx-interacting protein, the cytochrome c oxidase subunit III (COXIII). In the present study, we aimed to accurately map the location of the binding site for the interaction of HBx with COXIII. Two fragments of HBx mutants (X1 aa1-72 and X2 aa1-117) were amplified by polymerase chain reaction (PCR) and separately inserted into the pAS2-1 plasmid. PCR and gene sequencing confirmed the correct insertion of the mutant fragments in the plasmid. The tanscription of the mutant fragments in yeast cells was demonstrated by RT-PCR and western blot analysis confirmed that they were accurately translated into fusion proteins. Hybridization on solid medium and the detection of β-galactosidase (β-gal) activity indicated that the binding site for the interaction between HBx and COXIII was located between aa72 and aa117. Specific interactions between the HBxX2 protein and COXIII were verified by co-immunoprecipitation. To the best of our knowledge, this is the first study showing to demonstrate that aa72-117 in HBx is the key region for binding with COXIII. PMID:25483779

  5. Hydrogeological Mapping and Hydrological Process Modelling for understanding the interaction of surface runoff and infiltration in a karstic catchment

    NASA Astrophysics Data System (ADS)

    Stadler, Hermann; Reszler, Christian; Komma, Jürgen; Poltnig, Walter; Strobl, Elmar; Blöschl, Günter

    2013-04-01

    This paper presents a study at the interface hydrogeology - hydrology, concerning mapping of surface runoff generation areas in a karstic catchment. The governing processes range from surface runoff with subsequent infiltration to direct infiltration and further deep percolation into different karst conduits. The aim is to identify areas with a potential of surface erosion and thus, identify the hazard of solute/contaminant input into the karst system during aestival thundershowers, which can affect water quality at springs draining the karst massif. According to hydrogeological methods the emphasis of the study are field investigations based on hydrogeological mapping and field measurements in order to gain extensive knowledge about processes and their spatial distribution in the catchment to establish a site specific Dominant Process Concept (DPC). Based on the hydrogeological map, which describes the lithological units relating to their hydrogeological classification, mapping focuses on the following attributes of the overlaying loose material/debris and soils: (i) infiltration capability, (ii) soil depth (as a measure for storage capacity), and (iii) potential surface flow length. Detailed mapping is performed in the reference area, where a variety of data are acquired, such as soil grain size distribution, soil moisture through TDR measurements at characteristic points, etc. The reference area borders both end-members of the dominant surface runoff processes as described above. Geomorphologic analyses based on a 1m resolution Laserscan assist in allocating sinks and flow accumulation paths in the catchment. By a regionalisation model, developed and calibrated based on the results in the reference areas, the process disposition is transposed onto the whole study area. In a further step, a hydrological model will be set up, where model structure and parameters are identified based on above described working steps and following the DPC. The model will be

  6. BAID: The Barrow Area Information Database - an interactive web mapping portal and cyberinfrastructure for scientific activities in the vicinity of Barrow, Alaska

    NASA Astrophysics Data System (ADS)

    Cody, R. P.; Kassin, A.; Gaylord, A. G.; Tweedie, C. E.

    2013-12-01

    In 2013, the Barrow Area Information Database (BAID, www.baid.utep.edu) project resumed field operations in Barrow, AK. The Barrow area of northern Alaska is one of the most intensely researched locations in the Arctic. BAID is a cyberinfrastructure (CI) that details much of the historic and extant research undertaken within in the Barrow region in a suite of interactive web-based mapping and information portals (geobrowsers). The BAID user community and target audience for BAID is diverse and includes research scientists, science logisticians, land managers, educators, students, and the general public. BAID contains information on more than 11,000 Barrow area research sites that extend back to the 1940's and more than 640 remote sensing images and geospatial datasets. In a web-based setting, users can zoom, pan, query, measure distance, and save or print maps and query results. Data are described with metadata that meet Federal Geographic Data Committee standards and are archived at the University Corporation for Atmospheric Research Earth Observing Laboratory (EOL) where non-proprietary BAID data can be freely downloaded. Highlights for the 2013 season include the addition of more than 2000 additional research sites, providing differential global position system (dGPS) support to visiting scientists, surveying over 80 miles of coastline to document rates of erosion, training of local GIS personal, deployment of a wireless sensor network, and substantial upgrades to the BAID website and web mapping applications.

  7. Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

    PubMed Central

    Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

    2014-01-01

    Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

  8. Interactions between avian myeloblastosis reverse transcriptase and tRNATrp. Mapping of complexed tRNA with chemicals and nucleases.

    PubMed

    Garret, M; Romby, P; Giegé, R; Litvak, S

    1984-03-12

    The interactions between beef tRNATrp with avian myeloblastosis reverse transcriptase have been studied by statistical chemical modifications of phosphate (ethylnitrosourea) and cytidine (dimethyl sulfate) residues, as well as by digestion of complexed tRNA by Cobra venom nuclease and Neurospora crassa endonuclease. Results with nucleases and chemicals show that reverse transcriptase interacts preferentially with the D arm, the anticodon stem and the T psi stem. All these regions are located in the outside of the L-shaped structure of tRNA. This domain of interaction is different to that reported previously in the complex of beef tRNA with the cognate aminoacyl-tRNA synthetase (M. Garret et al.; Eur. J. Biochem. In press). Avian reverse transcriptase destabilizes the region of tRNA where most of the tertiary interactions maintaining the structure of tRNA are located.

  9. Interactions between avian myeloblastosis reverse transcriptase and tRNATrp. Mapping of complexed tRNA with chemicals and nucleases.

    PubMed Central

    Garret, M; Romby, P; Giegé, R; Litvak, S

    1984-01-01

    The interactions between beef tRNATrp with avian myeloblastosis reverse transcriptase have been studied by statistical chemical modifications of phosphate (ethylnitrosourea) and cytidine (dimethyl sulfate) residues, as well as by digestion of complexed tRNA by Cobra venom nuclease and Neurospora crassa endonuclease. Results with nucleases and chemicals show that reverse transcriptase interacts preferentially with the D arm, the anticodon stem and the T psi stem. All these regions are located in the outside of the L-shaped structure of tRNA. This domain of interaction is different to that reported previously in the complex of beef tRNA with the cognate aminoacyl-tRNA synthetase (M. Garret et al.; Eur. J. Biochem. In press). Avian reverse transcriptase destabilizes the region of tRNA where most of the tertiary interactions maintaining the structure of tRNA are located. Images PMID:6200830

  10. Mapping IR Enhancements in Closely Interacting Spiral-Spiral Pairs: I. ISO CAM and ISO SWS Observations

    NASA Technical Reports Server (NTRS)

    Xu, C.; Gao, Y.; Mazzarella, J.; Lu, N.; Sulentic, J.; Domingue, D.

    2000-01-01

    Mid-infrared (MIR) imaging and spectroscopic observations are presented for a well defined sample of eight closely interacting (CLO) pairs of spiral galaxies that have overlapping disks and show enhanced far-infrared (FIR) emission.

  11. Mapping the self-interacting domains of TuMV HC-Pro and the subcellular localization of the protein.

    PubMed

    Zheng, Hongying; Yan, Fei; Lu, Yuwen; Sun, Liying; Lin, Lin; Cai, Li; Hou, Mingsheng; Chen, Jianping

    2011-02-01

    The helper component-proteinase (HC-Pro) of potyviruses is a multifunctional protein involved in aphid transmission, polyprotein processing, cell-to-cell and long-distance movement, genome amplification and symptom expression. The HC-Pros of several potyviruses interact with themselves but the key domains responsible for self-interaction are apparently not conserved. In our experiments, yeast two-hybrid assays and bimolecular fluorescence complementation showed that Turnip mosaic virus (TuMV) HC-Pro interacted with itself in yeast cells, plant cells and insect cells. It was also shown that the central and C-terminal regions of the HC-Pro participated in these self-interactions. Fluorescence microscopy showed that TuMV HC-Pro was present in the cytoplasm and formed aggregates along the ER.

  12. The Gα4 G protein subunit interacts with the MAP kinase ERK2 using a D-motif that regulates developmental morphogenesis in Dictyostelium

    PubMed Central

    Nguyen, Hoai-Nghia; Hadwiger, Jeffrey A.

    2009-01-01

    G protein Gα subunits contribute to the specificity of different signal transduction pathways in Dictyostelium discoideum but Gα subunit-effector interactions have not been previously identified. The requirement of the Dictyostelium Gα4 subunit for MAP kinase (MAPK) activation and the identification of a putative MAPK docking site (D-motif) in this subunit suggested a possible interaction between the Gα4 subunit and MAPKs. In vivo association of the Gα4 subunit and ERK2 was demonstrated by pull-down and co-immunoprecipitation assays. Alteration of the D-motif reduced Gα4 subunit-ERK2 interactions but only slightly altered MAPK activation in response to folate. Expression of the Gα4 subunit with the altered D-motif in gα4− cells allowed for slug formation but not the morphogenesis associated with culmination. Expression of this mutant Gα4 subunit was sufficient to rescue chemotactic movement to folate. Alteration of the D-motif also reduced the aggregation defect associated with constitutively active Gα4 subunits. These results suggest Gα4 subunit-MAPK interactions are necessary for developmental morphogenesis but not for chemotaxis to folate. PMID:19765570

  13. Coupled trivial maps.

    PubMed

    Bunimovich, L. A.; Livi, R.; Martinez-Mekler, G.; Ruffo, S.

    1992-07-01

    The first nontrivial example of coupled map lattices that admits a rigorous analysis in the whole range of the strength of space interactions is considered. This class is generated by one-dimensional maps with a globally attracting superstable periodic trajectory that are coupled by a diffusive nearest-neighbor interaction.

  14. Mapping the interaction network of key proteins involved in histone mRNA generation - a hydrogen/deuterium exchange study

    PubMed Central

    Skrajna, Aleksandra; Yang, Xiao-cui; Tarnowski, Krzysztof; Fituch, Kinga; Marzluff, William F.; Dominski, Zbigniew; Dadlez, Michał

    2016-01-01

    Histone pre-mRNAs are cleaved at the 3′ end by a complex that contains U7 snRNP, the FLICE-Associated Huge protein (FLASH) and Histone pre-mRNA Cleavage Complex (HCC) consisting of several polyadenylation factors. Within the complex, the N-terminus of FLASH interacts with the N-terminus of the U7 snRNP protein Lsm11 and together they recruit the HCC. FLASH through its distant C-terminus independently interacts with the C-terminal SANT/Myb-like domain of Nuclear Protein, Ataxia-Telangiectasia locus (NPAT), a transcriptional co-activator required for expression of histone genes in S-phase. To gain structural information on these interactions, we used mass spectrometry to monitor hydrogen/deuterium (H/D) exchange in various regions of FLASH, Lsm11 and NPAT alone or in the presence of their respective binding partners. Our results indicate that the FLASH-interacting domain in Lsm11 is highly dynamic, while the more downstream region required for recruiting the HCC exchanges deuterium slowly and likely folds into a stable structure. In FLASH, a stable structure is adopted by the domain that interacts with Lsm11 and this domain is further stabilized by binding Lsm11. Notably, both H/D exchange experiments and in vitro binding assays demonstrate that Lsm11, in addition to interacting with the N-terminal region of FLASH, also contacts the C-terminal SANT/Myb-like domain of FLASH, the same region that binds NPAT. However, while NPAT stabilizes this domain, Lsm11 causes its partial relaxation. These competing reactions may play a role in regulating histone gene expression in vivo. PMID:26860583

  15. Nuclear Magnetic Resonance Structural Mapping Reveals Promiscuous Interactions between Clathrin-Box Motif Sequences and the N-Terminal Domain of the Clathrin Heavy Chain

    PubMed Central

    2016-01-01

    The recruitment and organization of clathrin at endocytic sites first to form coated pits and then clathrin-coated vesicles depend on interactions between the clathrin N-terminal domain (TD) and multiple clathrin binding sequences on the cargo adaptor and accessory proteins that are concentrated at such sites. Up to four distinct protein binding sites have been proposed to be present on the clathrin TD, with each site proposed to interact with a distinct clathrin binding motif. However, an understanding of how such interactions contribute to clathrin coat assembly must take into account observations that any three of these four sites on clathrin TD can be mutationally ablated without causing loss of clathrin-mediated endocytosis. To take an unbiased approach to mapping binding sites for clathrin-box motifs on clathrin TD, we used isothermal titration calorimetry (ITC) and nuclear magnetic resonance spectroscopy. Our ITC experiments revealed that a canonical clathrin-box motif peptide from the AP-2 adaptor binds to clathrin TD with a stoichiometry of 3:1. Assignment of 90% of the total visible amide resonances in the TROSY-HSQC spectrum of 13C-, 2H-, and 15N-labeled TD40 allowed us to map these three binding sites by analyzing the chemical shift changes as clathrin-box motif peptides were titrated into clathrin TD. We found that three different clathrin-box motif peptides can each simultaneously bind not only to the previously characterized clathrin-box site but also to the W-box site and the β-arrestin splice loop site on a single TD. The promiscuity of these binding sites can help explain why their mutation does not lead to larger effects on clathrin function and suggests a mechanism by which clathrin may be transferred between different proteins during the course of an endocytic event. PMID:25844500

  16. Third order spectral analysis robust to mixing artifacts for mapping cross-frequency interactions in EEG/MEG

    PubMed Central

    Chella, F.; Marzetti, L.; Pizzella, V.; Zappasodi, F.; Nolte, G.

    2014-01-01

    We present a novel approach to the third order spectral analysis, commonly called bispectral analysis, of electroencephalographic (EEG) and magnetoencephalographic (MEG) data for studying cross-frequency functional brain connectivity. The main obstacle in estimating functional connectivity from EEG and MEG measurements lies in the signals being a largely unknown mixture of the activities of the underlying brain sources. This often constitutes a severe confounder and heavily affects the detection of brain source interactions. To overcome this problem, we previously developed metrics based on the properties of the imaginary part of coherency. Here, we generalize these properties from the linear to the nonlinear case. Specifically, we propose a metric based on an antisymmetric combination of cross-bispectra, which we demonstrate to be robust to mixing artifacts. Moreover, our metric provides complex-valued quantities that give the opportunity to study phase relationships between brain sources. The effectiveness of the method is first demonstrated on simulated EEG data. The proposed approach shows a reduced sensitivity to mixing artifacts when compared with a traditional bispectral metric. It also exhibits a better performance in extracting phase relationships between sources than the imaginary part of cross-spectrum for delayed interactions. The method is then applied to real EEG data recorded during resting state. A cross-frequency interaction is observed between brain sources at 10 Hz and 20 Hz, i.e., for alpha and beta rhythms. This interaction is then projected from signal to source level by using a fit-based procedure. This approach highlights a 10–20 Hz dominant interaction localized in an occipito-parieto-central network. PMID:24418509

  17. Third order spectral analysis robust to mixing artifacts for mapping cross-frequency interactions in EEG/MEG.

    PubMed

    Chella, F; Marzetti, L; Pizzella, V; Zappasodi, F; Nolte, G

    2014-05-01

    We present a novel approach to the third order spectral analysis, commonly called bispectral analysis, of electroencephalographic (EEG) and magnetoencephalographic (MEG) data for studying cross-frequency functional brain connectivity. The main obstacle in estimating functional connectivity from EEG and MEG measurements lies in the signals being a largely unknown mixture of the activities of the underlying brain sources. This often constitutes a severe confounder and heavily affects the detection of brain source interactions. To overcome this problem, we previously developed metrics based on the properties of the imaginary part of coherency. Here, we generalize these properties from the linear to the nonlinear case. Specifically, we propose a metric based on an antisymmetric combination of cross-bispectra, which we demonstrate to be robust to mixing artifacts. Moreover, our metric provides complex-valued quantities that give the opportunity to study phase relationships between brain sources. The effectiveness of the method is first demonstrated on simulated EEG data. The proposed approach shows a reduced sensitivity to mixing artifacts when compared with a traditional bispectral metric. It also exhibits a better performance in extracting phase relationships between sources than the imaginary part of the cross-spectrum for delayed interactions. The method is then applied to real EEG data recorded during resting state. A cross-frequency interaction is observed between brain sources at 10Hz and 20Hz, i.e., for alpha and beta rhythms. This interaction is then projected from signal to source level by using a fit-based procedure. This approach highlights a 10-20Hz dominant interaction localized in an occipito-parieto-central network.

  18. BAID: The Barrow Area Information Database - An Interactive Web Mapping Portal and Cyberinfrastructure Showcasing Scientific Activities in the Vicinity of Barrow, Arctic Alaska.

    NASA Astrophysics Data System (ADS)

    Escarzaga, S. M.; Cody, R. P.; Kassin, A.; Barba, M.; Gaylord, A. G.; Manley, W. F.; Mazza Ramsay, F. D.; Vargas, S. A., Jr.; Tarin, G.; Laney, C. M.; Villarreal, S.; Aiken, Q.; Collins, J. A.; Green, E.; Nelson, L.; Tweedie, C. E.

    2015-12-01

    The Barrow area of northern Alaska is one of the most intensely researched locations in the Arctic and the Barrow Area Information Database (BAID, www.barrowmapped.org) tracks and facilitates a gamut of research, management, and educational activities in the area. BAID is a cyberinfrastructure (CI) that details much of the historic and extant research undertaken within in the Barrow region in a suite of interactive web-based mapping and information portals (geobrowsers). The BAID user community and target audience for BAID is diverse and includes research scientists, science logisticians, land managers, educators, students, and the general public. BAID contains information on more than 12,000 Barrow area research sites that extend back to the 1940's and more than 640 remote sensing images and geospatial datasets. In a web-based setting, users can zoom, pan, query, measure distance, save or print maps and query results, and filter or view information by space, time, and/or other tags. Additionally, data are described with metadata that meet Federal Geographic Data Committee standards. Recent advances include the addition of more than 2000 new research sites, the addition of a query builder user interface allowing rich and complex queries, and provision of differential global position system (dGPS) and high-resolution aerial imagery support to visiting scientists. Recent field surveys include over 80 miles of coastline to document rates of erosion and the collection of high-resolution sonar data for bathymetric mapping of Elson Lagoon and near shore region of the Chukchi Sea. A network of five climate stations has been deployed across the peninsula to serve as a wireless net for the research community and to deliver near real time climatic data to the user community. Local GIS personal have also been trained to better make use of scientific data for local decision making. Links to Barrow area datasets are housed at national data archives and substantial upgrades have

  19. BAID: The Barrow Area Information Database - an interactive web mapping portal and cyberinfrastructure for scientific activities in the vicinity of Barrow, Alaska

    NASA Astrophysics Data System (ADS)

    Cody, R. P.; Kassin, A.; Gaylord, A.; Brown, J.; Tweedie, C. E.

    2012-12-01

    The Barrow area of northern Alaska is one of the most intensely researched locations in the Arctic. The Barrow Area Information Database (BAID, www.baidims.org) is a cyberinfrastructure (CI) that details much of the historic and extant research undertaken within in the Barrow region in a suite of interactive web-based mapping and information portals (geobrowsers). The BAID user community and target audience for BAID is diverse and includes research scientists, science logisticians, land managers, educators, students, and the general public. BAID contains information on more than 9,600 Barrow area research sites that extend back to the 1940's and more than 640 remote sensing images and geospatial datasets. In a web-based setting, users can zoom, pan, query, measure distance, and save or print maps and query results. Data are described with metadata that meet Federal Geographic Data Committee standards and are archived at the University Corporation for Atmospheric Research Earth Observing Laboratory (EOL) where non-proprietary BAID data can be freely downloaded. BAID has been used to: Optimize research site choice; Reduce duplication of science effort; Discover complementary and potentially detrimental research activities in an area of scientific interest; Re-establish historical research sites for resampling efforts assessing change in ecosystem structure and function over time; Exchange knowledge across disciplines and generations; Facilitate communication between western science and traditional ecological knowledge; Provide local residents access to science data that facilitates adaptation to arctic change; (and) Educate the next generation of environmental and computer scientists. This poster describes key activities that will be undertaken over the next three years to provide BAID users with novel software tools to interact with a current and diverse selection of information and data about the Barrow area. Key activities include: 1. Collecting data on research

  20. Mapping and characterization of the interaction interface between two polypyrimidine-tract binding proteins and a nova-type protein of Solanum tuberosum.

    PubMed

    Shah, Shweta; Butler, Nathaniel M; Hannapel, David J; Rao, A Gururaj

    2013-01-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that generally contain four RNA recognition motifs (RRMs). In potato, six cDNAs encoding full-length PTB proteins have been identified. In the present study Nova1-like protein, designated StNova1, was identified as a potential interacting partner of the StPTB proteins via yeast two-hybrid screening. Nova protein is a RNA-binding protein that contains three K-homology (KH) domains. In humans, these proteins are involved in regulation of neuronal RNA metabolism but the role of Nova-like proteins in plants is poorly understood. We have validated this interaction and mapped the protein binding region on StNova1 and StPTB1 and -6 using a novel domain interaction phage display (DIPP) technique. The interaction between the two RNA-binding proteins StPTB1/6 and StNova1 is mediated through linker regions that are distinctly separated from the RRMs. Furthermore, using a random 21-mer phage-peptide library, we have identified a number of peptides with the consensus sequence motif [S/G][V/I][L/V]G that recognize the StPTB proteins. One over-represented peptide that recognizes StPTB6 contains the GVLGPWP sequence that is similar to the GIGGRYP sequence in the glycine-rich linker region between the KH2 and KH3 domains of StNova1. We show, through site-specific mutations, the importance of glycine and proline residues in StNova1-StPTB interactions.

  1. Genetic-linkage mapping of complex hereditary disorders to a whole-genome molecular-interaction network.

    PubMed

    Iossifov, Ivan; Zheng, Tian; Baron, Miron; Gilliam, T Conrad; Rzhetsky, Andrey

    2008-07-01

    Common hereditary neurodevelopmental disorders such as autism, bipolar disorder, and schizophrenia are most likely both genetically multifactorial and heterogeneous. Because of these characteristics traditional methods for genetic analysis fail when applied to such diseases. To address the problem we propose a novel probabilistic framework that combines the standard genetic linkage formalism with whole-genome molecular-interaction data to predict pathways or networks of interacting genes that contribute to common heritable disorders. We apply the model to three large genotype-phenotype data sets, identify a small number of significant candidate genes for autism (24), bipolar disorder (21), and schizophrenia (25), and predict a number of gene targets likely to be shared among the disorders.

  2. Complete genome sequence and integrated protein localization and interaction map for alfalfa dwarf virus, which combines properties of both cytoplasmic and nuclear plant rhabdoviruses

    SciTech Connect

    Bejerman, Nicolás; Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio; Dietzgen, Ralf G.

    2015-09-15

    Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses.

  3. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: gp32 monomer binding

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; von Hippel, Peter H.

    2015-01-01

    Combining biophysical measurements on T4 bacteriophage replication complexes with detailed structural information can illuminate the molecular mechanisms of these ‘macromolecular machines’. Here we use the low energy circular dichroism (CD) and fluorescent properties of site-specifically introduced base analogues to map and quantify the equilibrium binding interactions of short (8 nts) ssDNA oligomers with gp32 monomers at single nucleotide resolution. We show that single gp32 molecules interact most directly and specifically near the 3′-end of these ssDNA oligomers, thus defining the polarity of gp32 binding with respect to the ssDNA lattice, and that only 2–3 nts are directly involved in this tight binding interaction. The loss of exciton coupling in the CD spectra of dimer 2-AP (2-aminopurine) probes at various positions in the ssDNA constructs, together with increases in fluorescence intensity, suggest that gp32 binding directly extends the sugar-phosphate backbone of this ssDNA oligomer, particularly at the 3′-end and facilitates base unstacking along the entire 8-mer lattice. These results provide a model (and ‘DNA map’) for the isolated gp32 binding to ssDNA targets, which serves as the nucleation step for the cooperative binding that occurs at transiently exposed ssDNA sequences within the functioning T4 DNA replication complex. PMID:26275775

  4. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

    2015-01-01

    We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

  5. Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

    SciTech Connect

    Henke, Paul S.; Mak, Chi H.

    2014-08-14

    The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg{sup 2+} that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

  6. Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

    NASA Astrophysics Data System (ADS)

    Henke, Paul S.; Mak, Chi H.

    2014-08-01

    The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

  7. BAID: The Barrow Area Information Database - an interactive web mapping portal and cyberinfrastructure for scientific activities in the vicinity of Barrow, Alaska.

    NASA Astrophysics Data System (ADS)

    Cody, R. P.; Kassin, A.; Kofoed, K. B.; Copenhaver, W.; Laney, C. M.; Gaylord, A. G.; Collins, J. A.; Tweedie, C. E.

    2014-12-01

    The Barrow area of northern Alaska is one of the most intensely researched locations in the Arctic and the Barrow Area Information Database (BAID, www.barrowmapped.org) tracks and facilitates a gamut of research, management, and educational activities in the area. BAID is a cyberinfrastructure (CI) that details much of the historic and extant research undertaken within in the Barrow region in a suite of interactive web-based mapping and information portals (geobrowsers). The BAID user community and target audience for BAID is diverse and includes research scientists, science logisticians, land managers, educators, students, and the general public. BAID contains information on more than 12,000 Barrow area research sites that extend back to the 1940's and more than 640 remote sensing images and geospatial datasets. In a web-based setting, users can zoom, pan, query, measure distance, save or print maps and query results, and filter or view information by space, time, and/or other tags. Data are described with metadata that meet Federal Geographic Data Committee standards and are archived at the University Corporation for Atmospheric Research Earth Observing Laboratory (EOL) where non-proprietary BAID data can be freely downloaded. Recent advances include the addition of more than 2000 new research sites, provision of differential global position system (dGPS) and Unmanned Aerial Vehicle (UAV) support to visiting scientists, surveying over 80 miles of coastline to document rates of erosion, training of local GIS personal to better make use of science in local decision making, deployment and near real time connectivity to a wireless micrometeorological sensor network, links to Barrow area datasets housed at national data archives and substantial upgrades to the BAID website and web mapping applications.

  8. Site-directed mutagenesis maps interactions that enhance cognate and limit promiscuous catalysis by an alkaline phosphatase superfamily phosphodiesterase.

    PubMed

    Wiersma-Koch, Helen; Sunden, Fanny; Herschlag, Daniel

    2013-12-23

    Catalytic promiscuity, an evolutionary concept, also provides a powerful tool for gaining mechanistic insights into enzymatic reactions. Members of the alkaline phosphatase (AP) superfamily are highly amenable to such investigation, with several members having been shown to exhibit promiscuous activity for the cognate reactions of other superfamily members. Previous work has shown that nucleotide pyrophosphatase/phosphodiesterase (NPP) exhibits a >10⁶-fold preference for the hydrolysis of phosphate diesters over phosphate monoesters, and that the reaction specificity is reduced 10³-fold when the size of the substituent on the transferred phosphoryl group of phosphate diester substrates is reduced to a methyl group. Here we show additional specificity contributions from the binding pocket for this substituent (herein termed the R' substituent) that account for an additional ~250-fold differential specificity with the minimal methyl substituent. Removal of four hydrophobic side chains suggested on the basis of structural inspection to interact favorably with R' substituents decreases phosphate diester reactivity 10⁴-fold with an optimal diester substrate (R' = 5'-deoxythymidine) and 50-fold with a minimal diester substrate (R' = CH₃). These mutations also enhance the enzyme's promiscuous phosphate monoesterase activity by nearly an order of magnitude, an effect that is traced by mutation to the reduction of unfavorable interactions with the two residues closest to the nonbridging phosphoryl oxygen atoms. The quadruple R' pocket mutant exhibits the same activity toward phosphate diester and phosphate monoester substrates that have identical leaving groups, with substantial rate enhancements of ~10¹¹-fold. This observation suggests that the Zn²⁺ bimetallo core of AP superfamily enzymes, which is equipotent in phosphate monoester and diester catalysis, has the potential to become specialized for the hydrolysis of each class of phosphate esters via addition

  9. Epitope mapping of anti-human transferrin monoclonal antibodies: potential uses for transferrin-transferrin receptor interaction studies.

    PubMed

    Perera, Yasser; García, Darién; Guirola, Osmany; Huerta, Vivian; García, Yanet; Muñoz, Yasmiana

    2008-01-01

    Human transferrin (hTf) is an 80 kDa glycoprotein involved in iron transport from the absorption sites to the sites of storage and utilization. Additionally, transferrin also plays a relevant role as a bacteriostatic agent preventing uncontrolled bacterial growth in the host. In this work we describe a well-characterized Mabs panel in terms of precise epitope localization and estimate affinity for the two major hTf isoforms. We found at least four antigenic regions in the hTf molecule, narrowed down the interacting antigen residues within three of such regions, and located them on a molecular model of hTf. Two of the antigenic regions partially overlap with previously described transferrin-binding sites for both human receptor (antigenic region I: containing amino acid residues from Asp-69 to Asn-76 at the N-lobe) and bacterial receptors from two pathogenic species (antigenic region III: amino acid residues from Leu-665 to Ser-672 at the C-lobe). Hence, such monoclonal antibodies (Mabs) could be used as an additional tool for conformational studies and/or the characterization of the interaction between hTf and both types of receptor molecules.

  10. Geomorphic Mapping and Paleoterrain Generation for use in Modeling Holocene (8,000 1,500 yr) Agropastoral Landuse and Landscape Interactions in Southeast Spain

    NASA Astrophysics Data System (ADS)

    Arrowsmith, J. R.; Dimaggio, E. N.; Barton, C. M.; Sarjoughian, H. S.; Fall, P.; Falconer, S. E.; Ullah, I. I.

    2006-12-01

    Dramatic changes in land use were associated with the rise of agriculture in the mid Holocene. Both the surface properties and the drainage networks were changed. Along with the direct modifications to surface properties (vegetation change, sediment liberation, and compaction) and drainage network alteration (terracing, canals), up and downstream responses in the watersheds communicated these changes throughout the landscape. The magnitude, rate, and feedbacks with the growing human populations are critical questions in our effort to assess human-landscape interactions. Our interdisciplinary team has focused on two field sites around the Mediterranean for model development and testing. We are combining high resolution process- based models of landscape change implemented within the GRASS GIS with agent based models of agropastoral behavior and driven by high resolution climate and vegetation models. In the Spanish field area (Penaguila Valley, 38.41 N 0.23 W), we have produced detailed (1:10,000) geomorphic maps which we combine with high resolution Digital Elevation Models (DEMs) on which we can run the surface process models to assess the portions of the landscape that are most sensitive to the postulated agropastoral landuse changes. To support this modeling we have produced the 1 m DEMs from softcopy photogrammetry. This DEM has greatly improved our overall spatial resolution to permit more accurate terrace correlations and improved quantitative assessment of morphologic processes (e.g. channel erosion, slope stability). In stereo, we have mapped overall landscape morphology that emphasizes areas of active erosion and alluvial terrace surfaces. Alluvial terraces are crucial to this research because they record periods of past stable topography and those of mid Holocene age were settled and farmed. We have correlated mapped terraces across the landscape using elevation and morphological distinctions. Using ArcGIS, we interpolated surfaces across equivalent

  11. Evaluation and mapping of the DNA binding and oligomerization domains of the IE2 regulatory protein of human cytomegalovirus using yeast one and two hybrid interaction assays.

    PubMed

    Ahn, J H; Chiou, C J; Hayward, G S

    1998-03-27

    The 86-kDa IE2 nuclear phosphoprotein encoded by the human cytomegalovirus (HCMV) major immediate-early (MIE) gene behaves as both a non-specific transactivator of viral and cellular gene expression and as a specific DNA-binding protein targeted to the cis-repression sequence (CRS) at the cap site of its own promoter/enhancer region. Although the IE2 protein produced in bacteria has been shown to bind to the 14-bp palindromic CRS motif and IE2 synthesized in vitro forms stable dimers in solution through the conserved C-terminus of the protein, there is no direct evidence as yet that the intracellular mammalian forms of IE2 do so. Here, we show that the intact HCMV IE2 protein both binds to CRS DNA and dimerizes in yeast cells. In a one-hybrid assay system, a GAL4/IE2 fusion protein expressed in yeast cells activated target HIS3 expression only when CRS sites were located upstream of the GAL1 minimal promoter, but failed to do so on mutant CRS sites, demonstrating a requirement for sequence-specific DNA-binding by IE2. Examination of a series of deletion and triple amino acid point mutations in the C-terminal half of IE2 mapped the domains required for DNA-binding in yeast to the entire region between codons 313 and 579, whereas in the previous in-vitro study with truncated bacterial GST fusion proteins, it was mapped to between codons 346 and 579. Transient co-transfection assays with deleted IE2 effector genes in Vero cells showed that the extra segment of IE2 between codons 313 and 346 is also required for both autoregulation and transactivation activity in mammalian cells. In a two-hybrid assay to study IE2 self-interations, we generated both GAL4 DNA-binding (DB) and activation domain (A)/IE2 fusion proteins and showed that IE2 could also dimerize or oligomerize through the C-terminus of the protein in yeast cells. Domains required for this interaction were all mapped to within the region between codons 388 and 542, which is coincident with the domain mapped

  12. Mapping the Complement Factor H-Related Protein 1 (CFHR1):C3b/C3d Interactions

    PubMed Central

    Laskowski, Jennifer; Thurman, Joshua M.; Hageman, Gregory S.; Holers, V. Michael

    2016-01-01

    Complement factor H-related protein 1 (CFHR1) is a complement regulator which has been reported to regulate complement by blocking C5 convertase activity and interfering with C5b surface association. CFHR1 also competes with complement factor H (CFH) for binding to C3b, and may act as an antagonist of CFH-directed regulation on cell surfaces. We have employed site-directed mutagenesis in conjunction with ELISA-based and functional assays to isolate the binding interaction that CFHR1 undertakes with complement components C3b and C3d to a single shared interface. The C3b/C3d:CFHR1 interface is identical to that which occurs between the two C-terminal domains (SCR19-20) of CFH and C3b. Moreover, we have been able to corroborate that dimerization of CFHR1 is necessary for this molecule to bind effectively to C3b and C3d, or compete with CFH. Finally, we have established that CFHR1 competes with complement factor H-like protein 1 (CFHL-1) for binding to C3b. CFHL-1 is a CFH gene splice variant, which is almost identical to the N-terminal 7 domains of CFH (SCR1-7). CFHR1, therefore, not only competes with the C-terminus of CFH for binding to C3b, but also sterically blocks the interaction that the N-terminus of CFH undertakes with C3b, and which is required for CFH-regulation. PMID:27814381

  13. Mapping the Dynamic Network Interactions Underpinning Cognition: A cTBS-fMRI Study of the Flexible Adaptive Neural System for Semantics

    PubMed Central

    Jung, JeYoung; Lambon Ralph, Matthew A.

    2016-01-01

    Higher cognitive function reflects the interaction of a network of multiple brain regions. Previous investigations have plotted out these networks using functional or structural connectivity approaches. While these map the topography of the regions involved, they do not explore the key aspect of this neuroscience principle—namely that the regions interact in a dynamic fashion. Here, we achieved this aim with respect to semantic memory. Although converging evidence implicates the anterior temporal lobes (ATLs), bilaterally, as a crucial component in semantic representation, the underlying neural interplay between the ATLs remains unclear. By combining continuous theta-burst stimulation (cTBS) with functional magnetic resonance imaging (fMRI), we perturbed the left ventrolateral ATL (vATL) and investigated acute changes in neural activity and effective connectivity of the semantic system. cTBS resulted in decreased activity at the target region and compensatory, increased activity at the contralateral vATL. In addition, there were task-specific increases in effective connectivity between the vATLs, reflecting an increased facilitatory intrinsic connectivity from the right to left vATL. Our results suggest that semantic representation is founded on a flexible, adaptive bilateral neural system and reveals an adaptive plasticity-based mechanism that might support functional recovery after unilateral damage in neurological patients. PMID:27242027

  14. Genetic Mapping

    MedlinePlus

    ... Fact Sheets Fact Sheets En Español: Mapeo Genético Genetic Mapping What is genetic mapping? How do researchers ... genetic map? What are genetic markers? What is genetic mapping? Among the main goals of the Human ...

  15. Mapping the interactions of selective biochemical probes of antibody conformation by hydrogen-deuterium exchange mass spectrometry.

    PubMed

    Leurs, Ulrike; Beck, Hermann; Bonnington, Lea; Lindner, Ingo; Pol, Ewa; Rand, Kasper Dyrberg

    2017-03-27

    Protein-based pharmaceuticals represent the fastest growing group of drugs in development in the pharmaceutical industry. One of the major challenges in the discovery, development and distribution of biopharmaceuticals is the assessment of changes in their higher-order structure due to chemical modifications. Here, we investigate the interactions of three different biochemical probes (Fabs) generated to detect conformational changes in a therapeutic IgG1 antibody (mAbX) by local hydrogen-deuterium exchange mass spectrometry (HDX-MS). We show that two of the probes target the Fc part of the antibody, while the third probe binds to the hinge region. Through HDX-ETD, we can distinguish specific binding patterns of the Fc-binding probes on mAbX at the single amino acid level. Preliminary surface plasmon resonance (SPR) experiments show that these domain-selective Fab probes are sensitive to conformational changes in distinct regions of a full-length therapeutic antibody upon oxidation.

  16. Mapping intermolecular interactions and active site conformations: from human MMP-1 crystal structure to molecular dynamics free energy calculations.

    PubMed

    Nash, Anthony; Birch, Helen L; de Leeuw, Nora H

    2017-02-01

    The zinc-dependent Matrix Metalloproteinases (MMPs) found within the extracellular matrix (ECM) of vertebrates are linked to pathological processes such as arthritis, skin ulceration and cancer. Although a general backbone proteolytic mechanism is understood, crystallographic data continue to suggest an active site that is too narrow to encompass the respective substrate. We present a fully parameterised Molecular Dynamics (MD) study of the structural properties of an MMP-1-collagen crystallographic structure (Protein Data Bank - 4AUO), followed by an exploration of the free energy surface of a collagen polypeptide chain entering the active site, using a combined meta-dynamics and umbrella sampling (MDUS) approach. We conclude that the interactions between MMP-1 and the collagen substrate are in good agreement with a number of experimental studies. As such, our unrestrained MD simulations and our MDUS results, which indicate an energetic barrier for a local uncoiling and insertion event, can inform future investigations of the collagen-peptide non-bonded association steps with the active site prior to proteolytic mechanisms. The elucidation of such free energy barriers provides a better understanding of the role of the enzyme in the ECM and is important in the design of future MMP inhibitors.

  17. An artificially evolved albumin binding module facilitates chemical shift epitope mapping of GA domain interactions with phylogenetically diverse albumins.

    PubMed

    He, Yanan; Chen, Yihong; Rozak, David A; Bryan, Philip N; Orban, John

    2007-07-01

    Protein G-related albumin-binding (GA) modules occur on the surface of numerous Gram-positive bacterial pathogens and their presence may promote bacterial growth and virulence in mammalian hosts. We recently used phage display selection to evolve a GA domain, PSD-1 (phage selected domain-1), which tightly bound phylogenetically diverse albumins. With respect to PSD-1's broad albumin binding specificity, it remained unclear how the evolved binding epitope compared to those of naturally occurring GA domains and whether PSD-1's binding mode was the same for different albumins. We investigate these questions here using chemical shift perturbation measurements of PSD-1 with rabbit serum albumin (RSA) and human serum albumin (HSA) and put the results in the context of previous work on structure and dynamics of GA domains. Combined, these data provide insights into the requirements for broad binding specificity in GA-albumin interactions. Moreover, we note that using the phage-optimized PSD-1 protein significantly diminishes the effects of exchange broadening at the binding interface between GA modules and albumin, presumably through stabilization of a ligand-bound conformation. The employment of artificially evolved domains may be generally useful in NMR structural studies of other protein-protein complexes.

  18. The songbird syrinx morphome: a three-dimensional, high-resolution, interactive morphological map of the zebra finch vocal organ

    PubMed Central

    2013-01-01

    Background Like human infants, songbirds learn their species-specific vocalizations through imitation learning. The birdsong system has emerged as a widely used experimental animal model for understanding the underlying neural mechanisms responsible for vocal production learning. However, how neural impulses are translated into the precise motor behavior of the complex vocal organ (syrinx) to create song is poorly understood. First and foremost, we lack a detailed understanding of syringeal morphology. Results To fill this gap we combined non-invasive (high-field magnetic resonance imaging and micro-computed tomography) and invasive techniques (histology and micro-dissection) to construct the annotated high-resolution three-dimensional dataset, or morphome, of the zebra finch (Taeniopygia guttata) syrinx. We identified and annotated syringeal cartilage, bone and musculature in situ in unprecedented detail. We provide interactive three-dimensional models that greatly improve the communication of complex morphological data and our understanding of syringeal function in general. Conclusions Our results show that the syringeal skeleton is optimized for low weight driven by physiological constraints on song production. The present refinement of muscle organization and identity elucidates how apposed muscles actuate different syringeal elements. Our dataset allows for more precise predictions about muscle co-activation and synergies and has important implications for muscle activity and stimulation experiments. We also demonstrate how the syrinx can be stabilized during song to reduce mechanical noise and, as such, enhance repetitive execution of stereotypic motor patterns. In addition, we identify a cartilaginous structure suited to play a crucial role in the uncoupling of sound frequency and amplitude control, which permits a novel explanation of the evolutionary success of songbirds. PMID:23294804

  19. Mapping the targeted membrane pore formation mechanism by solution NMR: the nisin Z and lipid II interaction in SDS micelles.

    PubMed

    Hsu, Shang-Te; Breukink, Eefjan; de Kruijff, Ben; Kaptein, Robert; Bonvin, Alexandre M J J; van Nuland, Nico A J

    2002-06-18

    Nisin is an example of type-A lantibiotics that contain cyclic lanthionine rings and unusual dehydrated amino acids. Among the numerous pore-forming antimicrobial peptides, type-A lantibiotics form an unique family of post-translationally modified peptides. Via the recognition of cell wall precursor lipid II, nisin has the capacity to form pores against Gram-positive bacteria with an extremely high activity in the nanomolar (nM) range. Here we report a high-resolution NMR spectroscopy study of nisin/lipid II interactions in SDS micelles as a model membrane system in order to elucidate the mechanism of molecular recognition at residue level. The binding to lipid II was studied through (15)N-(1)H HSQC titration, backbone amide proton temperature coefficient analysis, and heteronuclear (15)N[(1)H]-NOE relaxation dynamics experiments. Upon the addition of lipid II, significant changes were monitored in the N-terminal part of nisin. An extremely low amide proton temperature coefficient (Delta delta/Delta T) was found for the amide proton of Ala3 (> -0.1 ppb/K) in the complex form. This suggests tight hydrogen bonding and/or isolation from the bulk solvent for this residue. Large chemical shift perturbations were also observed in the first two rings. In contrast, the C-terminal part of nisin was almost unaffected. This part of the molecule remains flexible and solvent-exposed. On the basis of our results, a multistep pore-forming mechanism is proposed. The N-terminal part of nisin first binds to lipid II, and a subsequent structural rearrangement takes place. The C-terminal part of nisin is possibly responsible for the activation of the pore formation. In light of the emerging antibiotic resistance problems, an understanding of the specific recognition mechanism of nisin with lipid II at the residue specific level may therefore aid in the development of novel antibiotics.

  20. Interactively Improving Agricultural Field Mapping in Sub-Saharan Africa with Crowd-Sourcing and Active Learning

    NASA Astrophysics Data System (ADS)

    Debats, S. R.; Estes, L. D.; Caylor, K. K.

    2015-12-01

    As satellite imagery becomes increasingly available, management of large image databases becomes more important for efficient image processing. We have developed a computer vision-based classification algorithm to distinguish smallholder agricultural land cover in Sub-Saharan Africa, using a group of high-resolution images from South Africa as a case study. For supervised classification, smallholder agriculture, with ambiguous patterns of small, irregular fields, requires a wide range of training data samples to adequately describe the variability in appearance. We employ crowd-sourcing to obtain new training data to expand the geographic range of our algorithm. A crowd-sourcing user is asked to hand-digitize the boundaries of agricultural fields in an assigned 1 km2 image. Yet random assignment of images to users could result in a highly redundant training data set with limited discriminative power. Furthermore, larger training data sets require a greater number of users to hand-digitize fields, which increases costs through crowd-sourcing engines like Amazon Mechanical Turk, as well as longer algorithm training times, which increases computing costs. Therefore, we employ an active learning approach to interactively select the most informative images to be hand-digitized for training data by crowd-sourcing users, based on changes in algorithm accuracy. We investigate the use of various image similarity measures used in content-based image retrieval systems, which quantify the distance, such as Euclidean distance or Manhattan distance, between a variety of extracted feature spaces to determine how similar the content of two images are. We determine the minimum training data set needed to maximize algorithm accuracy, as well as automate the selection of additional training images to classify a new target image that expands the geographic range of our algorithm.

  1. Integrating Databases with Maps: The Delivery of Cultural Data through TimeMap.

    ERIC Educational Resources Information Center

    Johnson, Ian

    TimeMap is a unique integration of database management, metadata and interactive maps, designed to contextualise and deliver cultural data through maps. TimeMap extends conventional maps with the time dimension, creating and animating maps "on-the-fly"; delivers them as a kiosk application or embedded in Web pages; links flexibly to…

  2. Cartographic mapping study

    NASA Technical Reports Server (NTRS)

    Wilson, C.; Dye, R.; Reed, L.

    1982-01-01

    The errors associated with planimetric mapping of the United States using satellite remote sensing techniques are analyzed. Assumptions concerning the state of the art achievable for satellite mapping systems and platforms in the 1995 time frame are made. An analysis of these performance parameters is made using an interactive cartographic satellite computer model, after first validating the model using LANDSAT 1 through 3 performance parameters. An investigation of current large scale (1:24,000) US National mapping techniques is made. Using the results of this investigation, and current national mapping accuracy standards, the 1995 satellite mapping system is evaluated for its ability to meet US mapping standards for planimetric and topographic mapping at scales of 1:24,000 and smaller.

  3. Exploring the Interactive Patterns of Concept Map-Based Online Discussion: A Sequential Analysis of Users' Operations, Cognitive Processing, and Knowledge Construction

    ERIC Educational Resources Information Center

    Wu, Sheng-Yi; Chen, Sherry Y.; Hou, Huei-Tse

    2016-01-01

    Concept maps can be used as a cognitive tool to assist learners' knowledge construction. However, in a concept map-based online discussion environment, studies that take into consideration learners' manipulative actions of composing concept maps, cognitive process among learners' discussion, and social knowledge construction at the same time are…

  4. Genotype-based association mapping of complex diseases: gene-environment interactions with multiple genetic markers and measurement error in environmental exposures.

    PubMed

    Lobach, Iryna; Fan, Ruzong; Carroll, Raymond J

    2010-12-01

    With the advent of dense single nucleotide polymorphism genotyping, population-based association studies have become the major tools for identifying human disease genes and for fine gene mapping of complex traits. We develop a genotype-based approach for association analysis of case-control studies of gene-environment interactions in the case when environmental factors are measured with error and genotype data are available on multiple genetic markers. To directly use the observed genotype data, we propose two genotype-based models: genotype effect and additive effect models. Our approach offers several advantages. First, the proposed risk functions can directly incorporate the observed genotype data while modeling the linkage disequilibrium information in the regression coefficients, thus eliminating the need to infer haplotype phase. Compared with the haplotype-based approach, an estimating procedure based on the proposed methods can be much simpler and significantly faster. In addition, there is no potential risk due to haplotype phase estimation. Further, by fitting the proposed models, it is possible to analyze the risk alleles/variants of complex diseases, including their dominant or additive effects. To model measurement error, we adopt the pseudo-likelihood method by Lobach et al. [2008]. Performance of the proposed method is examined using simulation experiments. An application of our method is illustrated using a population-based case-control study of association between calcium intake with the risk of colorectal adenoma development.

  5. Genotype-Based Association Mapping of Complex Diseases: Gene-Environment Interactions with Multiple Genetic Markers and Measurement Error in Environmental Exposures

    PubMed Central

    Lobach, Irvna; Fan, Ruzone; Carroll, Raymond T.

    2011-01-01

    With the advent of dense single nucleotide polymorphism genotyping, population-based association studies have become the major tools for identifying human disease genes and for fine gene mapping of complex traits. We develop a genotype-based approach for association analysis of case-control studies of gene-environment interactions in the case when environmental factors are measured with error and genotype data are available on multiple genetic markers. To directly use the observed genotype data, we propose two genotype-based models: genotype effect and additive effect models. Our approach offers several advantages. First, the proposed risk functions can directly incorporate the observed genotype data while modeling the linkage disequihbrium information in the regression coefficients, thus eliminating the need to infer haplotype phase. Compared with the haplotype-based approach, an estimating procedure based on the proposed methods can be much simpler and significantly faster. In addition, there is no potential risk due to haplotype phase estimation. Further, by fitting the proposed models, it is possible to analyze the risk alleles/variants of complex diseases, including their dominant or additive effects. To model measurement error, we adopt the pseudo-likelihood method by Lobach et al. [2008]. Performance of the proposed method is examined using simulation experiments. An application of our method is illustrated using a population-based case-control study of association between calcium intake with the risk of colorectal adenoma development. PMID:21031455

  6. Planetary maps

    USGS Publications Warehouse

    ,

    1992-01-01

    An important goal of the USGS planetary mapping program is to systematically map the geology of the Moon, Mars, Venus, and Mercury, and the satellites of the outer planets. These geologic maps are published in the USGS Miscellaneous Investigations (I) Series. Planetary maps on sale at the USGS include shaded-relief maps, topographic maps, geologic maps, and controlled photomosaics. Controlled photomosaics are assembled from two or more photographs or images using a network of points of known latitude and longitude. The images used for most of these planetary maps are electronic images, obtained from orbiting television cameras, various optical-mechanical systems. Photographic film was only used to map Earth's Moon.

  7. High-density Association Mapping and Interaction Analysis of PLA2R1 and HLA Regions with Idiopathic Membranous Nephropathy in Japanese

    PubMed Central

    Thiri, Myo; Honda, Kenjiro; Kashiwase, Koichi; Mabuchi, Akihiko; Suzuki, Hodaka; Watanabe, Kimio; Nakayama, Masaaki; Watanabe, Tsuyoshi; Doi, Kent; Tokunaga, Katsushi; Noiri, Eisei

    2016-01-01

    Although recent studies showed anti-PLA2R antibody plays a crucial role in idiopathic membranous nephropathy (IMN), detailed HLA mapping and interaction between the HLA genes and PLA2R1 have not been investigated in IMN. We genotyped across the PLA2R1 gene and the HLA region, using 183 IMN patients and 811 healthy controls. Five SNPs around the PLA2R1 gene were significantly associated with IMN. In addition to the two SNPs previously reported to be strongly associated with IMN, rs3749119 and rs35771982 (OR 3.02 and 2.93, P = 3.24E-14 and 4.64E-14, respectively), two novel intronic SNPs (rs2715928 and rs16844715) were also identified as IMN-associated SNPs (OR = 2.30 and 2.51, P = 3.15E-10 and 5.66E-13, respectively). In the HLA gene analysis, DRB1*1501 and DQB1*0602 were strongly associated with IMN (P = 1.14E-11 and 1.25E-11, respectively). The interaction was strongest between HLA-DRB1*15:01 - HLA-DQB1*06:02 and the intronic SNP rs2715928 (OR = 17.53, P = 4.26E-26). Furthermore, positive interaction was also observed between HLA-DRB1*15:01 - HLA-DQB1*06:02 and the missense SNP rs35771982 (OR = 15.91, P = 2.76E-29), which is in strong linkage disequilibrium with 5′UTR SNP rs3749119, and intronic SNP rs16844715 (OR = 15.91, P = 2.30E-26) for IMN. Neither HLA-DRB1*15:01 nor HLA-DQB1*06:02 was associated with steroid responsiveness, overall survival and renal survival during the observation period of mean 11 years though limited number of analysis. PMID:27934873

  8. Mapping structural landmarks, ligand binding sites, and missense mutations to the collagen IV heterotrimers predicts major functional domains, novel interactions, and variation in phenotypes in inherited diseases affecting basement membranes.

    PubMed

    Parkin, J Des; San Antonio, James D; Pedchenko, Vadim; Hudson, Billy; Jensen, Shane T; Savige, Judy

    2011-02-01

    Collagen IV is the major protein found in basement membranes. It comprises three heterotrimers (α1α1α2, α3α4α5, and α5α5α6) that form distinct networks, and are responsible for membrane strength and integrity.We constructed linear maps of the collagen IV heterotrimers ("interactomes") that indicated major structural landmarks, known and predicted ligand-binding sites, and missense mutations, in order to identify functional and disease-associated domains, potential interactions between ligands, and genotype–phenotype relationships. The maps documented more than 30 known ligand-binding sites as well as motifs for integrins, heparin, von Willebrand factor (VWF), decorin, and bone morphogenetic protein (BMP). They predicted functional domains for angiogenesis and haemostasis, and disease domains for autoimmunity, tumor growth and inhibition, infection, and glycation. Cooperative ligand interactions were indicated by binding site proximity, for example, between integrins, matrix metalloproteinases, and heparin. The maps indicated that mutations affecting major ligand-binding sites, for example, for Von Hippel Lindau (VHL) protein in the α1 chain or integrins in the α5 chain, resulted in distinctive phenotypes (Hereditary Angiopathy, Nephropathy, Aneurysms, and muscle Cramps [HANAC] syndrome, and early-onset Alport syndrome, respectively). These maps further our understanding of basement membrane biology and disease, and suggest novel membrane interactions, functions, and therapeutic targets.

  9. Contour Mapping

    NASA Technical Reports Server (NTRS)

    1995-01-01

    In the early 1990s, the Ohio State University Center for Mapping, a NASA Center for the Commercial Development of Space (CCDS), developed a system for mobile mapping called the GPSVan. While driving, the users can map an area from the sophisticated mapping van equipped with satellite signal receivers, video cameras and computer systems for collecting and storing mapping data. George J. Igel and Company and the Ohio State University Center for Mapping advanced the technology for use in determining the contours of a construction site. The new system reduces the time required for mapping and staking, and can monitor the amount of soil moved.

  10. USGS maps

    USGS Publications Warehouse

    ,

    2005-01-01

    Discover a small sample of the millions of maps produced by the U.S. Geological Survey (USGS) in its mission to map the Nation and survey its resources. This booklet gives a brief overview of the types of maps sold and distributed by the USGS through its Earth Science Information Centers (ESIC) and also available from business partners located in most States. The USGS provides a wide variety of maps, from topographic maps showing the geographic relief and thematic maps displaying the geology and water resources of the United States, to special studies of the moon and planets.

  11. How Service Choreography Statistics Reduce the Ontology Mapping Problem

    NASA Astrophysics Data System (ADS)

    Besana, Paolo; Robertson, Dave

    In open and distributed environments ontology mapping provides interoperability between interacting actors. However, conventional mapping systems focus on acquiring static information, and on mapping whole ontologies, which is infeasible in open systems. This paper shows that the interactions themselves between the actors can be used to predict mappings, simplifying dynamic ontology mapping. The intuitive idea is that similar interactions follow similar conventions and patterns, which can be analysed. The computed model can be used to suggest the possible mappings for the exchanged messages in new interactions. The suggestions can be evaluate by any standard ontology matcher: if they are accurate, the matchers avoid evaluating mappings unrelated to the interaction.

  12. Historical Mapping

    USGS Publications Warehouse

    ,

    1999-01-01

    Maps become out of date over time. Maps that are out of date, however, can be useful to historians, attorneys, environmentalists, genealogists, and others interested in researching the background of a particular area. Local historians can compare a series of maps of the same area compiled over a long period of time to learn how the area developed. A succession of such maps can provide a vivid picture of how a place changed over time.

  13. Topographic mapping

    USGS Publications Warehouse

    ,

    2008-01-01

    The U.S. Geological Survey (USGS) produced its first topographic map in 1879, the same year it was established. Today, more than 100 years and millions of map copies later, topographic mapping is still a central activity for the USGS. The topographic map remains an indispensable tool for government, science, industry, and leisure. Much has changed since early topographers traveled the unsettled West and carefully plotted the first USGS maps by hand. Advances in survey techniques, instrumentation, and design and printing technologies, as well as the use of aerial photography and satellite data, have dramatically improved mapping coverage, accuracy, and efficiency. Yet cartography, the art and science of mapping, may never before have undergone change more profound than today.

  14. A network approach of gene co-expression in the zea mays/Aspergillus flavus pathosystem to map host/pathogen interaction pathways

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A gene co-expression network was generated using a dual RNA-seq study with the fungal pathogen A. flavus and its plant host Z. mays during the initial 3 days of infection. The analysis deciphered novel pathways and mapped genes of interest in both organisms during the infection. This network reveal...

  15. ANL's Map and Data Browser

    SciTech Connect

    Hudson, Doug; Ayers, Andy

    1998-07-13

    The MaD browser is a web browser Java applet developed to display and interact with vector graphic (map) objects, relational database tables, and other data sources. It was designed for use in remedial action projects to quickly and widely disseminate sampling results but is generally applicable to many other mapping situations. Its primary value is its simplicity and general availability.

  16. Mapping Van

    NASA Technical Reports Server (NTRS)

    1994-01-01

    A NASA Center for the Commercial Development of Space (CCDS) - developed system for satellite mapping has been commercialized for the first time. Global Visions, Inc. maps an area while driving along a road in a sophisticated mapping van equipped with satellite signal receivers, video cameras and computer systems for collecting and storing mapping data. Data is fed into a computerized geographic information system (GIS). The resulting amps can be used for tax assessment purposes, emergency dispatch vehicles and fleet delivery companies as well as other applications.

  17. Interacting Compasses

    ERIC Educational Resources Information Center

    Riveros, Hector G.; Betancourt, Julian

    2009-01-01

    The use of multiple compasses to map and visualize magnetic fields is well-known. The magnetic field exerts a torque on the compasses aligning them along the lines of force. Some science museums show the field of a magnet using a table with many compasses in a closely packed arrangement. However, the very interesting interactions that occur…

  18. Genome mapping

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genome maps can be thought of much like road maps except that, instead of traversing across land, they traverse across the chromosomes of an organism. Genetic markers serve as landmarks along the chromosome and provide researchers information as to how close they may be to a gene or region of inter...

  19. Undersea Mapping.

    ERIC Educational Resources Information Center

    DiSpezio, Michael A.

    1991-01-01

    Presented is a cooperative learning activity in which students assume different roles in an effort to produce a relief map of the ocean floor. Materials, procedures, definitions, student roles, and questions are discussed. A reproducible map for the activity is provided. (CW)

  20. Question Mapping

    ERIC Educational Resources Information Center

    Martin, Josh

    2012-01-01

    After accepting the principal position at Farmersville (TX) Junior High, the author decided to increase instructional rigor through question mapping because of the success he saw using this instructional practice at his prior campus. Teachers are the number one influence on student achievement (Marzano, 2003), so question mapping provides a…

  1. Map Adventures.

    ERIC Educational Resources Information Center

    Geological Survey (Dept. of Interior), Reston, VA.

    This curriculum packet about maps, with seven accompanying lessons, is appropriate for students in grades K-3. Students learn basic concepts for visualizing objects from different perspectives and how to understand and use maps. Lessons in the packet center on a story about a little girl, Nikki, who rides in a hot-air balloon that gives her, and…

  2. Concept Mapping

    ERIC Educational Resources Information Center

    Technology & Learning, 2005

    2005-01-01

    Concept maps are graphical ways of working with ideas and presenting information. They reveal patterns and relationships and help students to clarify their thinking, and to process, organize and prioritize. Displaying information visually--in concept maps, word webs, or diagrams--stimulates creativity. Being able to think logically teaches…

  3. Collection Mapping.

    ERIC Educational Resources Information Center

    Harbour, Denise

    2002-01-01

    Explains collection mapping for library media collections. Discusses purposes for creating collection maps, including helping with selection and weeding decisions, showing how the collection supports the curriculum, and making budget decisions; and methods of data collection, including evaluating a collaboratively taught unit with the classroom…

  4. FracMAP: A user-interactive package for performing simulation and orientation-specific morphology analysis of fractal-like solid nano-agglomerates

    NASA Astrophysics Data System (ADS)

    Chakrabarty, Rajan K.; Garro, Mark A.; Chancellor, Shammah; Herald, Christopher; Moosmüller, Hans

    2009-08-01

    Computer simulation techniques have found extensive use in establishing empirical relationships between three-dimensional (3d) and two-dimensional (2d) projected properties of particles produced by the process of growth through the agglomeration of smaller particles (monomers). In this paper, we describe a package, FracMAP, that has been written to simulate 3d quasi-fractal agglomerates and create their 2d pixelated projection images by restricting them to stable orientations as commonly encountered for quasi-fractal agglomerates collected on filter media for electron microscopy. Resulting 2d images are analyzed for their projected morphological properties. Program summaryProgram title: FracMAP Catalogue identifier: AEDD_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEDD_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 4722 No. of bytes in distributed program, including test data, etc.: 27 229 Distribution format: tar.gz Programming language: C++ Computer: PC Operating system: Windows, Linux RAM: 2.0 Megabytes Classification: 7.7 Nature of problem: Solving for a suitable fractal agglomerate construction under constraints of typical morphological parameters. Solution method: Monte Carlo approximation. Restrictions: Problem complexity is not representative of run-time, since Monte Carlo iterations are of a constant complexity. Additional comments: The distribution file contains two versions of the FracMAP code, one for Windows and one for Linux. Running time: 1 hour for a fractal agglomerate of size 25 on a single processor.

  5. [C II] and {sup 12}CO(1-0) emission maps in HLSJ091828.6+514223: A strongly lensed interacting system at z = 5.24

    SciTech Connect

    Rawle, T. D.; Altieri, B.; Egami, E.; Rex, M.; Clement, B.; Bussmann, R. S.; Gurwell, M.; Fazio, G. G.; Ivison, R. J.; Boone, F.; Combes, F.; Danielson, A. L. R.; Smail, I.; Swinbank, A. M.; Edge, A. C.; Richard, J.; Blain, A. W.; Dessauges-Zavadsky, M.; Jones, T.; Kneib, J.-P.; and others

    2014-03-01

    We present Submillimeter Array [C II] 158 μm and Karl G. Jansky Very Large Array {sup 12}CO(1-0) line emission maps for the bright, lensed, submillimeter source at z = 5.2430 behind A 773: HLSJ091828.6+514223 (HLS0918). We combine these measurements with previously reported line profiles, including multiple {sup 12}CO rotational transitions, [C I], water, and [N II], providing some of the best constraints on the properties of the interstellar medium in a galaxy at z > 5. HLS0918 has a total far-infrared (FIR) luminosity L {sub FIR(8–1000} {sub μm)} = (1.6 ± 0.1) × 10{sup 14} L {sub ☉} μ{sup –1}, where the total magnification μ{sub total} = 8.9 ± 1.9, via a new lens model from the [C II] and continuum maps. Despite a HyLIRG luminosity, the FIR continuum shape resembles that of a local LIRG. We simultaneously fit all of the observed spectral line profiles, finding four components that correspond cleanly to discrete spatial structures identified in the maps. The two most redshifted spectral components occupy the nucleus of a massive galaxy, with a source-plane separation <1 kpc. The reddest dominates the continuum map (demagnified L {sub FIR,} {sub component} = (1.1 ± 0.2) × 10{sup 13} L {sub ☉}) and excites strong water emission in both nuclear components via a powerful FIR radiation field from the intense star formation. A third star-forming component is most likely a region of a merging companion (ΔV ∼ 500 km s{sup –1}) exhibiting generally similar gas properties. The bluest component originates from a spatially distinct region and photodissociation region analysis suggests that it is lower density, cooler, and forming stars less vigorously than the other components. Strikingly, it has very strong [N II] emission, which may suggest an ionized, molecular outflow. This comprehensive view of gas properties and morphology in HLS0918 previews the science possible for a large sample of high-redshift galaxies once ALMA attains full sensitivity.

  6. Mapping Children--Mapping Space.

    ERIC Educational Resources Information Center

    Pick, Herbert L., Jr.

    Research is underway concerning the way the perception, conception, and representation of spatial layout develops. Three concepts are important here--space itself, frame of reference, and cognitive map. Cognitive map refers to a form of representation of the behavioral space, not paired associate or serial response learning. Other criteria…

  7. Conformational mapping and energetics of saccharide-aromatic residue interactions: implications for the discrimination of anomers and epimers and in protein engineering.

    PubMed

    Kumari, Manju; Sunoj, Raghavan B; Balaji, Petety V

    2012-06-07

    Aromatic residues play a key role in saccharide-binding sites. Experimental studies have given an estimate of the energetics of saccharide-aromatic residue interactions. In this study, dependence of the energetics on the mutual position-orientation (PO) of saccharide and aromatic residue has been investigated by geometry optimization of a very large number (164) of complexes at MP2/6-31G(d,p) level of theory. The complexes are of Tyr and Phe analogs with α/β-D-Glc, β-D-Gal, α-D-Man and α/β-L-Fuc. A number of iso-energy POs are found for the complexes of all six saccharides. Stacking and non-stacking modes of binding are found to be of comparable strengths. In general, complexes of p-OHTol are stronger than those of Tol, and those dominated by OH···O interactions are more stable than ones dominated by CH···π interactions. The strengths of OH···O/π interactions, but not those of CH···π, show large variations. Even though an aromatic residue has a large variety of POs to interact with a saccharide, distinct preferences are found due to anomeric and epimeric differences. An aromatic residue can interact from either the a- or b-face of Glc, but only through the b-face with Gal, its C4-epimer. In contrast, stacking interaction with Man (C2-epimer of Glc) requires the participation of the -CH(2)OH group and free rotation of this group, as is observed in solution, precludes all modes of stacking interactions. It is also found that an aromatic residue can be strategically placed either to discriminate or to accommodate (i) anomers of Glc and of Fuc and (ii) Gal/Fuc. Thus, analysis of the optimized geometries of by far the largest number of complexes, and with six different saccharides, at this level of theory has given insights into how Nature cleverly uses aromatic residues to fine tune saccharide specificities of proteins. These are of immense utility for protein engineering and protein design studies.

  8. Mapping Biodiversity.

    ERIC Educational Resources Information Center

    World Wildlife Fund, Washington, DC.

    This document features a lesson plan that examines how maps help scientists protect biodiversity and how plants and animals are adapted to specific ecoregions by comparing biome, ecoregion, and habitat. Samples of instruction and assessment are included. (KHR)

  9. Map Separates

    USGS Publications Warehouse

    ,

    2001-01-01

    U.S. Geological Survey (USGS) topographic maps are printed using up to six colors (black, blue, green, red, brown, and purple). To prepare your own maps or artwork based on maps, you can order separate black-and-white film positives or negatives for any color printed on a USGS topographic map, or for one or more of the groups of related features printed in the same color on the map (such as drainage and drainage names from the blue plate.) In this document, examples are shown with appropriate ink color to illustrate the various separates. When purchased, separates are black-and-white film negatives or positives. After you receive a film separate or composite from the USGS, you can crop, enlarge or reduce, and edit to add or remove details to suit your special needs. For example, you can adapt the separates for making regional and local planning maps or for doing many kinds of studies or promotions by using the features you select and then printing them in colors of your choice.

  10. Venus mapping

    NASA Technical Reports Server (NTRS)

    Batson, R. M.; Morgan, H. F.; Sucharski, Robert

    1991-01-01

    Semicontrolled image mosaics of Venus, based on Magellan data, are being compiled at 1:50,000,000, 1:10,000,000, 1:5,000,000, and 1:1,000,000 scales to support the Magellan Radar Investigator (RADIG) team. The mosaics are semicontrolled in the sense that data gaps were not filled and significant cosmetic inconsistencies exist. Contours are based on preliminary radar altimetry data that is subjected to revision and improvement. Final maps to support geologic mapping and other scientific investigations, to be compiled as the dataset becomes complete, will be sponsored by the Planetary Geology and Geophysics Program and/or the Venus Data Analysis Program. All maps, both semicontrolled and final, will be published as I-maps by the United States Geological Survey. All of the mapping is based on existing knowledge of the spacecraft orbit; photogrammetric triangulation, a traditional basis for geodetic control on planets where framing cameras were used, is not feasible with the radar images of Venus, although an eventual shift of coordinate system to a revised spin-axis location is anticipated. This is expected to be small enough that it will affect only large-scale maps.

  11. Mapping the domain structure of the influenza A virus polymerase acidic protein (PA) and its interaction with the basic protein 1 (PB1) subunit

    SciTech Connect

    Guu, Tom S.Y.; Dong Liping; Wittung-Stafshede, Pernilla; Tao, Yizhi J.

    2008-09-15

    The influenza A virus polymerase consists of three subunits (PA, PB1, and PB2) necessary for viral RNA synthesis. The heterotrimeric polymerase complex forms through PA interacting with PB1 and PB1 interacting with PB2. PA has been shown to play critical roles in the assembly, catalysis, and nuclear localization of the polymerase. To probe the structure of PA, we isolated recombinant PA from insect cells. Limited proteolysis revealed that PA contained two domains connected by a 20-residue linker (residues 257-276). Far-UV circular dichroism established that the two domains folded into a mixed {alpha}/{beta} structure when separately expressed. In vitro pull-down assays showed that neither individually nor cooperatively expressed PA domains, without the linker, could assure PA-PB1 interaction. Protease treatment of PA-PB1 complex indicated that its PA subunit was significantly more stable than free PA, suggesting that the linker is protected and it constitutes an essential component of the PA-PB1 interface.

  12. Modes of Representation in Cognitive Mapping.

    ERIC Educational Resources Information Center

    Cohen, Michelle E.; Nodine, Calvin F.

    Recent investigations of the cognitive components of human-environmental interactions owe much to the work of city planner Kevin Lynch, who hypothesized cognitive mapping as a two-way interactive process between individuals and their environment. Lynch identified five elements which individuals used in the construction of cognitive maps,…

  13. Geoinquiries: Maps and Data for Everyone

    ERIC Educational Resources Information Center

    Baker, Thomas R.

    2015-01-01

    Ever want to take a quick, deep-dive into a map found in students' textbooks? Ever want to use a web-based map to bring that static, print map to life? Maybe the map would be better with interactive or near real-time data. This article discusses the new Earth Science GeoInquiries! Earth Science GeoInquiries from Esri are instructional resources…

  14. A Network Approach of Gene Co-expression in the Zea mays/Aspergillus flavus Pathosystem to Map Host/Pathogen Interaction Pathways

    PubMed Central

    Musungu, Bryan M.; Bhatnagar, Deepak; Brown, Robert L.; Payne, Gary A.; OBrian, Greg; Fakhoury, Ahmad M.; Geisler, Matt

    2016-01-01

    A gene co-expression network (GEN) was generated using a dual RNA-seq study with the fungal pathogen Aspergillus flavus and its plant host Zea mays during the initial 3 days of infection. The analysis deciphered novel pathways and mapped genes of interest in both organisms during the infection. This network revealed a high degree of connectivity in many of the previously recognized pathways in Z. mays such as jasmonic acid, ethylene, and reactive oxygen species (ROS). For the pathogen A. flavus, a link between aflatoxin production and vesicular transport was identified within the network. There was significant interspecies correlation of expression between Z. mays and A. flavus for a subset of 104 Z. mays, and 1942 A. flavus genes. This resulted in an interspecies subnetwork enriched in multiple Z. mays genes involved in the production of ROS. In addition to the ROS from Z. mays, there was enrichment in the vesicular transport pathways and the aflatoxin pathway for A. flavus. Included in these genes, a key aflatoxin cluster regulator, AflS, was found to be co-regulated with multiple Z. mays ROS producing genes within the network, suggesting AflS may be monitoring host ROS levels. The entire GEN for both host and pathogen, and the subset of interspecies correlations, is presented as a tool for hypothesis generation and discovery for events in the early stages of fungal infection of Z. mays by A. flavus. PMID:27917194

  15. A Network Approach of Gene Co-expression in the Zea mays/Aspergillus flavus Pathosystem to Map Host/Pathogen Interaction Pathways.

    PubMed

    Musungu, Bryan M; Bhatnagar, Deepak; Brown, Robert L; Payne, Gary A; OBrian, Greg; Fakhoury, Ahmad M; Geisler, Matt

    2016-01-01

    A gene co-expression network (GEN) was generated using a dual RNA-seq study with the fungal pathogen Aspergillus flavus and its plant host Zea mays during the initial 3 days of infection. The analysis deciphered novel pathways and mapped genes of interest in both organisms during the infection. This network revealed a high degree of connectivity in many of the previously recognized pathways in Z. mays such as jasmonic acid, ethylene, and reactive oxygen species (ROS). For the pathogen A. flavus, a link between aflatoxin production and vesicular transport was identified within the network. There was significant interspecies correlation of expression between Z. mays and A. flavus for a subset of 104 Z. mays, and 1942 A. flavus genes. This resulted in an interspecies subnetwork enriched in multiple Z. mays genes involved in the production of ROS. In addition to the ROS from Z. mays, there was enrichment in the vesicular transport pathways and the aflatoxin pathway for A. flavus. Included in these genes, a key aflatoxin cluster regulator, AflS, was found to be co-regulated with multiple Z. mays ROS producing genes within the network, suggesting AflS may be monitoring host ROS levels. The entire GEN for both host and pathogen, and the subset of interspecies correlations, is presented as a tool for hypothesis generation and discovery for events in the early stages of fungal infection of Z. mays by A. flavus.

  16. BDNF/ TrkB interaction regulates migration of SVZ precursor cells via PI3-K and MAP-K signalling pathways.

    PubMed

    Chiaramello, S; Dalmasso, G; Bezin, L; Marcel, D; Jourdan, F; Peretto, P; Fasolo, A; De Marchis, S

    2007-10-01

    Neuroblasts born in the subventricular zone (SVZ) migrate along the rostral migratory stream, reaching the olfactory bulb (OB) where they differentiate into local interneurons. Several extracellular factors have been suggested to control specific steps of this process. The brain-derived neurotrophic factor (BDNF) has been demonstrated to promote morphological differentiation and survival of OB interneurons. Here we show that BDNF and its receptor TrkB are expressed in vivo throughout the migratory pathway, implying that BDNF might also mediate migratory signals. By using in vitro models we demonstrate that BDNF promotes migration of SVZ neuroblasts, acting both as inducer and attractant through TrkB activation. We show that BDNF induces cAMP response element-binding protein (CREB) activation in migrating neuroblasts via phosphatidylinositol 3-kinase (PI3-K) and mitogen-activated protein kinase (MAP-K) signalling. Pharmacological blockade of these pathways on SVZ explants significantly reduces CREB activation and impairs neuronal migration. This study identifies a function of BDNF in the SVZ system, which involves multiple protein kinase pathways leading to neuroblast migration.

  17. Mapping the Interaction Site for a β-Scorpion Toxin in the Pore Module of Domain III of Voltage-gated Na+ Channels*

    PubMed Central

    Zhang, Joel Z.; Yarov-Yarovoy, Vladimir; Scheuer, Todd; Karbat, Izhar; Cohen, Lior; Gordon, Dalia; Gurevitz, Michael; Catterall, William A.

    2012-01-01

    Activation of voltage-gated sodium (Nav) channels initiates and propagates action potentials in electrically excitable cells. β-Scorpion toxins, including toxin IV from Centruroides suffusus suffusus (CssIV), enhance activation of NaV channels. CssIV stabilizes the voltage sensor in domain II in its activated state via a voltage-sensor trapping mechanism. Amino acid residues required for the action of CssIV have been identified in the S1-S2 and S3-S4 extracellular loops of domain II. The extracellular loops of domain III are also involved in toxin action, but individual amino acid residues have not been identified. We used site-directed mutagenesis and voltage clamp recording to investigate amino acid residues of domain III that are involved in CssIV action. In the IIISS2-S6 loop, five substitutions at four positions altered voltage-sensor trapping by CssIVE15A. Three substitutions (E1438A, D1445A, and D1445Y) markedly decreased voltage-sensor trapping, whereas the other two substitutions (N1436G and L1439A) increased voltage-sensor trapping. These bidirectional effects suggest that residues in IIISS2-S6 make both positive and negative interactions with CssIV. N1436G enhanced voltage-sensor trapping via increased binding affinity to the resting state, whereas L1439A increased voltage-sensor trapping efficacy. Based on these results, a three-dimensional model of the toxin-channel interaction was developed using the Rosetta modeling method. These data provide additional molecular insight into the voltage-sensor trapping mechanism of toxin action and define a three-point interaction site for β-scorpion toxins on NaV channels. Binding of α- and β-scorpion toxins to two distinct, pseudo-symmetrically organized receptor sites on NaV channels acts synergistically to modify channel gating and paralyze prey. PMID:22761417

  18. Mapping the interaction site for a β-scorpion toxin in the pore module of domain III of voltage-gated Na(+) channels.

    PubMed

    Zhang, Joel Z; Yarov-Yarovoy, Vladimir; Scheuer, Todd; Karbat, Izhar; Cohen, Lior; Gordon, Dalia; Gurevitz, Michael; Catterall, William A

    2012-08-31

    Activation of voltage-gated sodium (Na(v)) channels initiates and propagates action potentials in electrically excitable cells. β-Scorpion toxins, including toxin IV from Centruroides suffusus suffusus (CssIV), enhance activation of Na(V) channels. CssIV stabilizes the voltage sensor in domain II in its activated state via a voltage-sensor trapping mechanism. Amino acid residues required for the action of CssIV have been identified in the S1-S2 and S3-S4 extracellular loops of domain II. The extracellular loops of domain III are also involved in toxin action, but individual amino acid residues have not been identified. We used site-directed mutagenesis and voltage clamp recording to investigate amino acid residues of domain III that are involved in CssIV action. In the IIISS2-S6 loop, five substitutions at four positions altered voltage-sensor trapping by CssIV(E15A). Three substitutions (E1438A, D1445A, and D1445Y) markedly decreased voltage-sensor trapping, whereas the other two substitutions (N1436G and L1439A) increased voltage-sensor trapping. These bidirectional effects suggest that residues in IIISS2-S6 make both positive and negative interactions with CssIV. N1436G enhanced voltage-sensor trapping via increased binding affinity to the resting state, whereas L1439A increased voltage-sensor trapping efficacy. Based on these results, a three-dimensional model of the toxin-channel interaction was developed using the Rosetta modeling method. These data provide additional molecular insight into the voltage-sensor trapping mechanism of toxin action and define a three-point interaction site for β-scorpion toxins on Na(V) channels. Binding of α- and β-scorpion toxins to two distinct, pseudo-symmetrically organized receptor sites on Na(V) channels acts synergistically to modify channel gating and paralyze prey.

  19. MAPS of Cancer

    NASA Technical Reports Server (NTRS)

    Gray, Lincoln

    1998-01-01

    Our goal was to produce an interactive visualization from a mathematical model that successfully predicts metastases from head and neck cancer. We met this goal early in the project. The visualization is available for the public to view. Our work appears to fill a need for more information about this deadly disease. The idea of this project was to make an easily interpretable visualization based on what we call "functional maps" of disease. A functional map is a graphic summary of medical data, where distances between parts of the body are determined by the probability of disease, not by anatomical distances. Functional maps often beat little resemblance to anatomical maps, but they can be used to predict the spread of disease. The idea of modeling the spread of disease in an abstract multidimensional space is difficult for many people. Our goal was to make the important predictions easy to see. NASA must face this problem frequently: how to help laypersons and professionals see important trends in abstract, complex data. We took advantage of concepts perfected in NASA's graphics libraries. As an analogy, consider a functional map of early America. Suppose we choose travel times, rather than miles, as our measures of inter-city distances. For Abraham Lincoln, travel times would have been the more meaningful measure of separation between cities. In such a map New Orleans would be close to Memphis because of the Mississippi River. St. Louis would be close to Portland because of the Oregon Trail. Oklahoma City would be far from Little Rock because of the Cheyenne. Such a map would look puzzling to those of us who have always seen physical maps, but the functional map would be more useful in predicting the probabilities of inter-site transit. Continuing the analogy, we could predict the spread of social diseases such as gambling along the rivers and cattle rustling along the trails. We could simply print the functional map of America, but it would be more interesting

  20. ICAP: An Interactive Cluster Analysis Procedure for analyzing remotely sensed data. [to classify the radiance data to produce a thematic map

    NASA Technical Reports Server (NTRS)

    Wharton, S. W.

    1980-01-01

    An Interactive Cluster Analysis Procedure (ICAP) was developed to derive classifier training statistics from remotely sensed data. The algorithm interfaces the rapid numerical processing capacity of a computer with the human ability to integrate qualitative information. Control of the clustering process alternates between the algorithm, which creates new centroids and forms clusters and the analyst, who evaluate and elect to modify the cluster structure. Clusters can be deleted or lumped pairwise, or new centroids can be added. A summary of the cluster statistics can be requested to facilitate cluster manipulation. The ICAP was implemented in APL (A Programming Language), an interactive computer language. The flexibility of the algorithm was evaluated using data from different LANDSAT scenes to simulate two situations: one in which the analyst is assumed to have no prior knowledge about the data and wishes to have the clusters formed more or less automatically; and the other in which the analyst is assumed to have some knowledge about the data structure and wishes to use that information to closely supervise the clustering process. For comparison, an existing clustering method was also applied to the two data sets.

  1. Pharmacophore mapping based inhibitor selection and molecular interaction studies for identification of potential drugs on calcium activated potassium channel blockers, tamulotoxin

    PubMed Central

    Kumar, R. Barani; Suresh, M. Xavier

    2013-01-01

    Background: Tamulotoxin (TmTx) from Buthus tamulus was found to be a highly venomous toxin which accelerates the neurotransmitter release that directly affects the cardiovascular tissues and the respiratory system leading to death. TmTx from red Indian scorpion is a crucial inhibitor for Ca2+ activated K+ channel in humans. Objective: The study is aimed at the identification of potential inhibitors of TmTx through pharmacophore based inhibitor screening and understanding the molecular level interactions. Materials and Method: The potential inhibitors for TmTx were identified using pharmacophore model based descriptor information present in existing drugs with the analysis of pharmacokinetic properties. The compounds with good ADMET (Absorption, Distribution, Metabolism, Excretion and Toxicity) descriptors were subjected to molecular interaction studies. The stability of bound toxin-inhibitor complex was studied using molecular dynamics simulation over a period of one nanosecond. Results: From a dataset of 3406 compounds, few compounds were selected as potential inhibitors based on the generated best pharmacophore models, pharmacokinetic analysis, molecular docking and molecular dynamics studies. Conclusion: In conclusion, two compounds containing better inhibition properties against TmTx are suggested to be better lead molecules for drug development in future and this study will help us to explore more inhibitors from natural origin against tamulotoxin. PMID:23772102

  2. High-resolution mapping of the protein interaction network for the human transcription machinery and affinity purification of RNA polymerase II-associated complexes

    PubMed Central

    Cloutier, Philippe; Al-Khoury, Racha; Lavallée-Adam, Mathieu; Faubert, Denis; Jiang, Heng; Poitras, Christian; Bouchard, Annie; Forget, Diane; Blanchette, Mathieu; Coulombe, Benoit

    2015-01-01

    Thirty years of research on gene transcription has uncovered a myriad of factors that regulate, directly or indirectly, the activity of RNA polymerase II (RNAPII) during mRNA synthesis. Yet many regulatory factors remain to be discovered. Using protein affinity purification coupled to mass spectrometry (AP-MS), we recently unraveled a high-density interaction network formed by RNAPII and its accessory factors from the soluble fraction of human cell extracts. Validation of the dataset using a machine learning approach trained to minimize the rate of false positives and false negatives yielded a high-confidence dataset and uncovered novel interactors that regulate the RNAPII transcription machinery, including a new protein assembly we named the RNAPII-Associated Protein 3 (RPAP3) complex. PMID:19450687

  3. Mapping temporal dynamics in social interactions with unified structural equation modeling: A description and demonstration revealing time-dependent sex differences in play behavior.

    PubMed

    Beltz, Adriene M; Beekman, Charles; Molenaar, Peter C M; Buss, Kristin A

    2013-07-01

    Developmental science is rich with observations of social interactions, but few available methodological and statistical approaches take full advantage of the information provided by these data. The authors propose implementation of the unified structural equation model (uSEM), a network analysis technique, for observational data coded repeatedly across time; uSEM captures the temporal dynamics underlying changes in behavior at the individual level by revealing the ways in which a single person influences - concurrently and in the future - other people. To demonstrate the utility of uSEM, the authors applied it to ratings of positive affect and vigor of activity during children's unstructured laboratory play with unfamiliar, same-sex peers. Results revealed the time-dependent nature of sex differences in play behavior. For girls more than boys, positive affect was dependent upon peers' prior positive affect. For boys more than girls, vigor of activity was dependent upon peers' current vigor of activity.

  4. Pollen Killer Gene S35 Function Requires Interaction with an Activator That Maps Close to S24, Another Pollen Killer Gene in Rice

    PubMed Central

    Kubo, Takahiko; Yoshimura, Atsushi; Kurata, Nori

    2016-01-01

    Pollen killer genes disable noncarrier pollens, and are responsible for male sterility and segregation distortion in hybrid populations of distantly related plant species. The genetic networks and the molecular mechanisms underlying the pollen killer system remain largely unknown. Two pollen killer genes, S24 and S35, have been found in an intersubspecific cross of Oryza sativa ssp. indica and japonica. The effect of S24 is counteracted by an unlinked locus EFS. Additionally, S35 has been proposed to interact with S24 to induce pollen sterility. These genetic interactions are suggestive of a single S24-centric genetic pathway (EFS–S24–S35) for the pollen killer system. To examine this hypothetical genetic pathway, the S35 and the S24 regions were further characterized and genetically dissected in this study. Our results indicated that S35 causes pollen sterility independently of both the EFS and S24 genes, but is dependent on a novel gene close to the S24 locus, named incentive for killing pollen (INK). We confirmed the phenotypic effect of the INK gene separately from the S24 gene, and identified the INK locus within an interval of less than 0.6 Mb on rice chromosome 5. This study characterized the genetic effect of the two independent genetic pathways of INK–S35 and EFS–S24 in indica–japonica hybrid progeny. Our results provide clear evidence that hybrid male sterility in rice is caused by several pollen killer networks with multiple factors positively and negatively regulating pollen killer genes. PMID:27172610

  5. Pollen Killer Gene S35 Function Requires Interaction with an Activator That Maps Close to S24, Another Pollen Killer Gene in Rice.

    PubMed

    Kubo, Takahiko; Yoshimura, Atsushi; Kurata, Nori

    2016-05-03

    Pollen killer genes disable noncarrier pollens, and are responsible for male sterility and segregation distortion in hybrid populations of distantly related plant species. The genetic networks and the molecular mechanisms underlying the pollen killer system remain largely unknown. Two pollen killer genes, S24 and S35, have been found in an intersubspecific cross of Oryza sativa ssp. indica and japonica The effect of S24 is counteracted by an unlinked locus EFS Additionally, S35 has been proposed to interact with S24 to induce pollen sterility. These genetic interactions are suggestive of a single S24-centric genetic pathway (EFS-S24-S35) for the pollen killer system. To examine this hypothetical genetic pathway, the S35 and the S24 regions were further characterized and genetically dissected in this study. Our results indicated that S35 causes pollen sterility independently of both the EFS and S24 genes, but is dependent on a novel gene close to the S24 locus, named incentive for killing pollen (INK). We confirmed the phenotypic effect of the INK gene separately from the S24 gene, and identified the INK locus within an interval of less than 0.6 Mb on rice chromosome 5. This study characterized the genetic effect of the two independent genetic pathways of INK-S35 and EFS-S24 in indica-japonica hybrid progeny. Our results provide clear evidence that hybrid male sterility in rice is caused by several pollen killer networks with multiple factors positively and negatively regulating pollen killer genes.

  6. Mapping as a visual health communication tool: promises and dilemmas.

    PubMed

    Parrott, Roxanne; Hopfer, Suellen; Ghetian, Christie; Lengerich, Eugene

    2007-01-01

    In the era of evidence-based public health promotion and planning, the use of maps as a form of evidence to communicate about the multiple determinants of cancer is on the rise. Geographic information systems and mapping technologies make future proliferation of this strategy likely. Yet disease maps as a communication form remain largely unexamined. This content analysis considers the presence of multivariate information, credibility cues, and the communication function of publicly accessible maps for cancer control activities. Thirty-six state comprehensive cancer control plans were publicly available in July 2005 and were reviewed for the presence of maps. Fourteen of the 36 state cancer plans (39%) contained map images (N = 59 static maps). A continuum of map inter activity was observed, with 10 states having interactive mapping tools available to query and map cancer information. Four states had both cancer plans with map images and interactive mapping tools available to the public on their Web sites. Of the 14 state cancer plans that depicted map images, two displayed multivariate data in a single map. Nine of the 10 states with interactive mapping capability offered the option to display multivariate health risk messages. The most frequent content category mapped was cancer incidence and mortality, with stage at diagnosis infrequently available. The most frequent communication function served by the maps reviewed was redundancy, as maps repeated information contained in textual forms. The social and ethical implications for communicating about cancer through the use of visual geographic representations are discussed.

  7. Mapping the influence of molecular structure on rates of electron transfer using direct measurements of the electron spin-spin exchange interaction.

    PubMed

    Lukas, Aaron S; Bushard, Patrick J; Weiss, Emily A; Wasielewski, Michael R

    2003-04-02

    The spin-spin exchange interaction, 2J, in a radical ion pair produced by a photoinduced electron transfer reaction can provide a direct measure of the electronic coupling matrix element, V, for the subsequent charge recombination reaction. We have developed a series of dyad and triad donor-acceptor molecules in which 2J is measured directly as a function of incremental changes in their structures. In the dyads the chromophoric electron donors 4-(N-pyrrolidinyl)- and 4-(N-piperidinyl)naphthalene-1,8-dicarboximide, 5ANI and 6ANI, respectively, and a naphthalene-1,8:4,5-bis(dicarboximide) (NI) acceptor are linked to the meta positions of a phenyl spacer to yield 5ANI-Ph-NI and 6ANI-Ph-NI. In the triads the same structure is used, except that the piperidine in 6ANI is replaced by a piperazine in which a para-X-phenyl, where X = H, F, Cl, MeO, and Me(2)N, is attached to the N' nitrogen to form a para-X-aniline (XAn) donor to give XAn-6ANI-Ph-NI. Photoexcitation yields the respective 5ANI(+)-Ph-NI(-), 6ANI(+)-Ph-NI(-), and XAn(+)-6ANI-Ph-NI(-) singlet radical ion pair states, which undergo subsequent radical pair intersystem crossing followed by charge recombination to yield (3)NI. The radical ion pair distances within the dyads are about 11-12 A, whereas those in the triads are about approximately 16-19 A. The degree of delocalization of charge (and spin) density onto the aniline, and therefore the average distance between the radical ion pairs, is modulated by the para substituent. The (3)NI yields monitored spectroscopically exhibit resonances as a function of magnetic field, which directly yield 2J for the radical ion pairs. A plot of ln 2J versus r(DA), the distance between the centroids of the spin distributions of the two radicals that comprise the pair, yields a slope of -0.5 +/- 0.1. Since both 2J and k(CR), the rate of radical ion pair recombination, are directly proportional to V(2), the observed distance dependence of 2J shows directly that the recombination

  8. The distance temperature map as method to analyze the optical properties of Fresnel lenses and their interaction with multi-junction solar cells

    NASA Astrophysics Data System (ADS)

    Hornung, Thorsten; Kiefel, Peter; Nitz, Peter

    2015-09-01

    The optical efficiency of Fresnel lens based solar concentrators varies with the temperature of the Fresnel lens. The dependency of any quantity of interest (e.g. optical efficiency) on Fresnel lens temperature can be visualized by 2d color plots that simultaneously show it as a function of the distance between solar cell and Fresnel lens and as a function of Fresnel lens temperature. This visualization, which is called DTmap, strongly facilitates the analysis of the thermal behavior of a Fresnel lens and the optimization of module height. Based on DTmaps we reveal and discuss serveral details of the thermal behavior of silicone on glass (SOG) Fresnel lenses. In addition, the DTmap is shown for the efficiency of a system consisting of a Fresnel lens and a lattice matched three-junction and a four-junction solar cell. The results demonstrate that the interaction of the concentrator optics and the solar cell is not trivial and may also be studied using DTmaps.

  9. PfIRR Interacts with HrIGF-I and Activates the MAP-kinase and PI3-kinase Signaling Pathways to Regulate Glycogen Metabolism in Pinctada fucata

    PubMed Central

    Shi, Yu; He, Mao-xian

    2016-01-01

    The insulin-induced mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) pathways are major intracellular signaling modules and conserved among eukaryotes that are known to regulate diverse cellular processes. However, they have not been investigated in the mollusk species Pinctada fucata. Here, we demonstrate that insulin-related peptide receptor of P. fucata (pfIRR) interacts with human recombinant insulin-like growth factor I (hrIGF-I), and stimulates the MAPK and PI3K signaling pathways in P. fucata oocytes. We also show that inhibition of pfIRR by the inhibitor PQ401 significantly attenuates the basal and hrIGF-I-induced phosphorylation of MAPK and PI3K/Akt at amino acid residues threonine 308 and serine 473. Furthermore, our experiments show that there is cross-talk between the MAPK and PI3K/Akt pathways, in which MAPK kinase positively regulates the PI3K pathway, and PI3K positively regulates the MAPK cascade. Intramuscular injection of hrIGF-I stimulates the PI3K and MAPK pathways to increase the expression of pfirr, protein phosphatase 1, glucokinase, and the phosphorylation of glycogen synthase, decreases the mRNA expression of glycogen synthase kinase-3 beta, decreases glucose levels in hemocytes, and increases glycogen levels in digestive glands. These results suggest that the MAPK and PI3K pathways in P. fucata transmit the hrIGF-I signal to regulate glycogen metabolism. PMID:26911653

  10. Mapping the interactions of dengue virus NS1 protein with human liver proteins using a yeast two-hybrid system: identification of C1q as an interacting partner.

    PubMed

    Silva, Emiliana M; Conde, Jonas N; Allonso, Diego; Nogueira, Mauricio L; Mohana-Borges, Ronaldo

    2013-01-01

    Dengue constitutes a global health concern. The clinical manifestation of this disease varies from mild febrile illness to severe hemorrhage and/or fatal hypovolemic shock. Flavivirus nonstructural protein 1 (NS1) is a secreted glycoprotein that is displayed on the surface of infected cells but is absent in viral particles. NS1 accumulates at high levels in the plasma of dengue virus (DENV)-infected patients, and previous reports highlight its involvement in immune evasion, dengue severity, liver dysfunction and pathogenesis. In the present study, we performed a yeast two-hybrid screen to search for DENV2 NS1-interacting partners using a human liver cDNA library. We identified fifty genes, including human complement component 1 (C1q), which was confirmed by coimmunoprecipitation, ELISA and immunofluorescence assays, revealing for the first time the direct binding of this protein to NS1. Furthermore, the majority of the identified genes encode proteins that are secreted into the plasma of patients, and most of these proteins are classified as acute-phase proteins (APPs), such as plasminogen, haptoglobin, hemopexin, α-2-HS-glycoprotein, retinol binding protein 4, transferrin, and C4. The results presented here confirm the direct interaction of DENV NS1 with a key protein of the complement system and suggest a role for this complement protein in the pathogenesis of DENV infection.

  11. Modules and brain mapping.

    PubMed

    Friston, Karl J; Price, Cathy J

    2011-05-01

    This review highlights the key role of modularity and the additive factors method in functional neuroimaging. Our focus is on structure-function mappings in the human brain and how these are disclosed by brain mapping. We describe how modularity of processing (and possibly processes) was a key point of reference for establishing functional segregation as a principle of brain organization. Furthermore, modularity plays a crucial role when trying to characterize distributed brain responses in terms of functional integration or coupling among brain areas. We consider additive factors logic and how it helped to shape the design and interpretation of studies at the inception of brain mapping, with a special focus on factorial designs. We look at factorial designs in activation experiments and in the context of lesion-deficit mapping. In both cases, the presence or absence of interactions among various experimental factors has proven essential in understanding the context-sensitive nature of distributed but modular processing and discerning the nature of (potentially degenerate) structure-function relationships in cognitive neuroscience.

  12. Map projections

    USGS Publications Warehouse

    ,

    1993-01-01

    A map projection is used to portray all or part of the round Earth on a flat surface. This cannot be done without some distortion. Every projection has its own set of advantages and disadvantages. There is no "best" projection. The mapmaker must select the one best suited to the needs, reducing distortion of the most important features. Mapmakers and mathematicians have devised almost limitless ways to project the image of the globe onto paper. Scientists at the U. S. Geological Survey have designed projections for their specific needs—such as the Space Oblique Mercator, which allows mapping from satellites with little or no distortion. This document gives the key properties, characteristics, and preferred uses of many historically important projections and of those frequently used by mapmakers today.

  13. Link maps and map meetings: Scaffolding student learning

    NASA Astrophysics Data System (ADS)

    Lindstrøm, Christine; Sharma, Manjula D.

    2009-06-01

    With student numbers decreasing and traditional teaching methods having been found inefficient, it is widely accepted that alternative teaching methods need to be explored in tertiary physics education. In 2006 a different teaching environment was offered to 244 first year students with little or no prior formal instruction in physics. Students were invited to attend additional enrichment classes 1 h a week called map meetings. The focus of these classes was a different type of visual presentation of physics material called link maps. Link maps explicitly show the key concepts covered in lectures and how these interrelate to help novices establish their physics schemata. In each map meeting the link map for the different topic was interactively discussed by the researcher before the students worked on problems in groups using the link map. The class ended with the researcher going through one problem, talking aloud about how to logically attack it. The results were promising. Each week about 20% of the class voluntarily attended map meetings whereas 22% reported that they did not attend due to timetable clashes. Two questionnaires revealed that students thought the classes were helpful for gaining an overview of physics and for developing their problem solving abilities. In the final examination the 32 students who had attended at least eight out of ten map meetings achieved, on average, 9 points out of 90 better in the examination (p=0.004) than a comparison group (N=40) with similar academic background which had not attended map meetings. The results of this study suggest that map meetings are a valuable learning environment for physics novices. Further investigations are currently being undertaken.

  14. The Systems Mapping of Soils

    NASA Astrophysics Data System (ADS)

    Nikiforova, Alexandra; Fleis, Maria; Borisov, Mickail

    2013-04-01

    Soil, together with rocks, waters, air, and living organisms, is one of the natural elements, which make up landscapes. At the same time soil is a unique (derivative) natural element because only it originates from the interaction of all the other (basic) natural elements. Reasoning from this fact, soil maps must be unique too - fundamentally different from geological, geomorphological, natural vegetation, and other thematic maps of the basic natural elements. It is suggested creating conceptually new soil maps, namely the systems soil maps, which are derived from the systems landscape maps. Legends of such maps are based on hierarchical classification of natural landscapes-systems. The last-mentioned are regarded as elementary structural units of the Earth's landscape envelope comprised of interacting landscape elements. The landscapes-systems step by step are divided into divisions and subdivisions of different hierarchical levels unless reaching separate and isolated landscapes-systems, which can not be divided further because of their homogeneity. Criteria used to differentiate between landscapes-systems include the most prominent properties of natural landscape elements, for instance: sequence of the elements, range of altitudes and slopes, zonal vegetation types associated with effective heat sum and precipitation ratio, the main genetic soil horizons, genetic types and forms of relief, lithology of parent materials, depth of humus horizons, chemical composition of ground waters, and so forth. Levels at which criteria of classification are soil properties are named the "soil" one; they are the lowest one in each scale range. The systems soil maps are produced for "soil" levels and show certain soil properties in connection with those properties of the basic natural elements, which cause these soil properties. In GIS environment the systems soil maps are produced automatically from an integrated polygon layer created manually on the basis of expert analysis of

  15. The Biomes of Homewood: Interactive Map Software

    ERIC Educational Resources Information Center

    Shingles, Richard; Feist, Theron; Brosnan, Rae

    2005-01-01

    To build a learning community, the General Biology faculty at Johns Hopkins University conducted collaborative, problem-based learning assignments outside of class in which students are assigned to specific areas on campus, and gather and report data about their area. To overcome the logistics challenges presented by conducting such assignments in…

  16. National Interest Shown in Watershed Mapping Tool

    EPA Pesticide Factsheets

    The State of Maryland is able to identify prime locations for watershed restoration and preservation using an interactive mapping tool developed by a partnership of agencies led by EPA’s Mid-Atlantic Water Protection Division.

  17. BenMAP-CE Training Materials

    EPA Pesticide Factsheets

    Are you interested in learning more about how to operate the BenMAP-CE program? A variety of training resources are available, including self-paced exercises, online interactive modules and instructor-led training.

  18. Normal Shock Vortex Interaction

    DTIC Science & Technology

    2003-03-01

    Figure 9: Breakdown map for normal-shock vortex-interaction. References [1] O. Thomer, W. Schroder and M. Meinke , Numerical Simulation of Normal...and Oblique-Shock Vortex Interaction, ZAMM Band 80, Sub. 1, pp. 181-184, 2000. [2] O. Thomer, E. Krause, W. Schroder and M. Meinke , Computational

  19. Waste To Biogas Mapping Tool | Pacific Southwest, Region 9 ...

    EPA Pesticide Factsheets

    2016-02-23

    Interactive map (California, Arizona, Hawaii, Nevada) showing the location and contact information to connect organic waste producers and potential users. Add your business, ensure your information is correct.

  20. Practical review on the use of synchrotron based micro- and nano- X-ray fluorescence mapping and X-ray absorption spectroscopy to investigate the interactions between plants and engineered nanomaterials.

    PubMed

    Castillo-Michel, Hiram A; Larue, Camille; Pradas Del Real, Ana E; Cotte, Marine; Sarret, Geraldine

    2017-01-01

    The increased use of engineered nanomaterials (ENMs) in commercial products and the continuous development of novel applications, is leading to increased intentional and unintentional release of ENMs into the environment with potential negative impacts. Particularly, the partition of nanoparticles (NPs) to waste water treatment plant (WWTP) sludge represents a potential threat to agricultural ecosystems where these biosolids are being applied as fertilizers. Moreover, several applications of ENMs in agriculture and soil remediation are suggested. Therefore, detailed risk assessment should be done to evaluate possible secondary negative impacts. The impact of ENMS on plants as central component of ecosystems and worldwide food supply is of primary relevance. Understanding the fate and physical and chemical modifications of NPs in plants and their possible transfer into food chains requires specialized analytical techniques. Due to the importance of both chemical and physical factors to consider for a better understanding of ENMs behavior in complex matrices, these materials can be considered a new type of analyte. An ideal technique should require minimal sample preparation, be non-destructive, and offer the best balance between sensitivity, chemical specificity, and spatial resolution. Synchrotron radiation (SR) techniques are particularly adapted to investigate localization and speciation of ENMs in plants. SR X-ray fluorescence mapping (SR-XFM) offers multi-elemental detection with lateral resolution down to the tens of nm, in combination with spatially resolved X-ray absorption spectroscopy (XAS) speciation. This review will focus on important methodological aspects regarding sample preparation, data acquisition and data analysis of SR-XFM/XAS to investigate interactions between plants and ENMs.

  1. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    PubMed

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  2. Human Mind Maps

    ERIC Educational Resources Information Center

    Glass, Tom

    2016-01-01

    When students generate mind maps, or concept maps, the maps are usually on paper, computer screens, or a blackboard. Human Mind Maps require few resources and little preparation. The main requirements are space where students can move around and a little creativity and imagination. Mind maps can be used for a variety of purposes, and Human Mind…

  3. From Open Geographical Data to Tangible Maps: Improving the Accessibility of Maps for Visually Impaired People

    NASA Astrophysics Data System (ADS)

    Ducasse, J.; Macé, M.; Jouffrais, C.

    2015-08-01

    Visual maps must be transcribed into (interactive) raised-line maps to be accessible for visually impaired people. However, these tactile maps suffer from several shortcomings: they are long and expensive to produce, they cannot display a large amount of information, and they are not dynamically modifiable. A number of methods have been developed to automate the production of raised-line maps, but there is not yet any tactile map editor on the market. Tangible interactions proved to be an efficient way to help a visually impaired user manipulate spatial representations. Contrary to raised-line maps, tangible maps can be autonomously constructed and edited. In this paper, we present the scenarios and the main expected contributions of the AccessiMap project, which is based on the availability of many sources of open spatial data: 1/ facilitating the production of interactive tactile maps with the development of an open-source web-based editor; 2/ investigating the use of tangible interfaces for the autonomous construction and exploration of a map by a visually impaired user.

  4. Online Exhibits & Concept Maps

    NASA Astrophysics Data System (ADS)

    Douma, M.

    2009-12-01

    Presenting the complexity of geosciences to the public via the Internet poses a number of challenges. For example, utilizing various - and sometimes redundant - Web 2.0 tools can quickly devour limited time. Do you tweet? Do you write press releases? Do you create an exhibit or concept map? The presentation will provide participants with a context for utilizing Web 2.0 tools by briefly highlighting methods of online scientific communication across several dimensions. It will address issues of: * breadth and depth (e.g. from narrow topics to well-rounded views), * presentation methods (e.g. from text to multimedia, from momentary to enduring), * sources and audiences (e.g. for experts or for the public, content developed by producers to that developed by users), * content display (e.g. from linear to non-linear, from instructive to entertaining), * barriers to entry (e.g. from an incumbent advantage to neophyte accessible, from amateur to professional), * cost and reach (e.g. from cheap to expensive), and * impact (e.g. the amount learned, from anonymity to brand awareness). Against this backdrop, the presentation will provide an overview of two methods of online information dissemination, exhibits and concept maps, using the WebExhibits online museum (www.webexhibits.org) and SpicyNodes information visualization tool (www.spicynodes.org) as examples, with tips on how geoscientists can use either to communicate their science. Richly interactive online exhibits can serve to engage a large audience, appeal to visitors with multiple learning styles, prompt exploration and discovery, and present a topic’s breadth and depth. WebExhibits, which was among the first online museums, delivers interactive information, virtual experiments, and hands-on activities to the public. While large, multidisciplinary exhibits on topics like “Color Vision and Art” or “Calendars Through the Ages” require teams of scholars, user interface experts, professional writers and editors

  5. A Tangible Approach to Concept Mapping

    NASA Astrophysics Data System (ADS)

    Tanenbaum, Karen; Antle, Alissa N.

    2009-05-01

    The Tangible Concept Mapping project investigates using a tangible user interface to engage learners in concept map creation. This paper describes a prototype implementation of the system, presents some preliminary analysis of its ease of use and effectiveness, and discusses how elements of tangible interaction support concept mapping by helping users organize and structure their knowledge about a domain. The role of physical engagement and embodiment in supporting the mental activity of creating the concept map is explored as one of the benefits of a tangible approach to learning.

  6. Concept Mapping

    PubMed Central

    Brennan, Laura K.; Brownson, Ross C.; Kelly, Cheryl; Ivey, Melissa K.; Leviton, Laura C.

    2016-01-01

    Background From 2003 to 2008, 25 cross-sector, multidisciplinary community partnerships funded through the Active Living by Design (ALbD) national program designed, planned, and implemented policy and environmental changes, with complementary programs and promotions. This paper describes the use of concept-mapping methods to gain insights into promising active living intervention strategies based on the collective experience of community representatives implementing ALbD initiatives. Methods Using Concept Systems software, community representatives (n=43) anonymously generated actions and changes in their communities to support active living (183 original statements, 79 condensed statements). Next, respondents (n=26, from 23 partnerships) sorted the 79 statements into self-created categories, or active living intervention approaches. Respondents then rated statements based on their perceptions of the most important strategies for creating community changes (n=25, from 22 partnerships) and increasing community rates of physical activity (n=23, from 20 partnerships). Cluster analysis and multidimensional scaling were used to describe data patterns. Results ALbD community partnerships identified three active living intervention approaches with the greatest perceived importance to create community change and increase population levels of physical activity: changes to the built and natural environment, partnership and collaboration efforts, and land-use and transportation policies. The relative importance of intervention approaches varied according to subgroups of partnerships working with different populations. Conclusions Decision makers, practitioners, and community residents can incorporate what has been learned from the 25 community partnerships to prioritize active living policy, physical project, promotional, and programmatic strategies for work in different populations and settings. PMID:23079266

  7. Maps & minds : mapping through the ages

    USGS Publications Warehouse

    ,

    1984-01-01

    Throughout time, maps have expressed our understanding of our world. Human affairs have been influenced strongly by the quality of maps available to us at the major turning points in our history. "Maps & Minds" traces the ebb and flow of a few central ideas in the mainstream of mapping. Our expanding knowledge of our cosmic neighborhood stems largely from a small number of simple but grand ideas, vigorously pursued.

  8. Mapping: A Course.

    ERIC Educational Resources Information Center

    Whitmore, Paul M.

    1988-01-01

    Reviews the history of cartography. Describes the contributions of Strabo and Ptolemy in early maps. Identifies the work of Gerhard Mercator as the most important advancement in mapping. Discusses present mapping standards from history. (CW)

  9. Mapping a Crisis, One Text Message at a Time

    ERIC Educational Resources Information Center

    Bauduy, Jennifer

    2010-01-01

    An interactive mapping project is revolutionizing the way crises are reported and managed, and is spotlighting the value of citizen journalism. The project, called Ushahidi, which means testimony in Swahili, uses crowdsourcing (gathering information from a large number of people) to map crisis information. This crisis mapping tool has since been…

  10. The Future of Web Maps in Next Generation Textbooks

    NASA Astrophysics Data System (ADS)

    DiBiase, D.; Prasad, S.

    2014-12-01

    The reformation of the "Object Formerly Known as Textbook" (coined by the Chronicle of Higher Education) toward a digital future is underway. Emerging nextgen texts look less like electronic books ("ebooks") and more like online courseware. In addition to text and illustrations, nextgen textbooks for STEM subjects are likely to combine quizzes, grade management tools, support for social learning, and interactive media including web maps. Web maps are interactive, multi-scale, online maps that enable teachers and learners to explore, interrogate, and mash up the wide variety of map layers available in the cloud. This presentation will show how web maps coupled with interactive quizzes enable students' purposeful explorations and interpretations of spatial patterns related to humankind's interactions with the earth. Attendees will also learn about Esri's offer to donate ArcGIS Online web mapping subscriptions to every U.S. school as part of the President Obama's ConnectED initiative.

  11. Heatmapper: web-enabled heat mapping for all

    PubMed Central

    Babicki, Sasha; Arndt, David; Marcu, Ana; Liang, Yongjie; Grant, Jason R.; Maciejewski, Adam; Wishart, David S.

    2016-01-01

    Heatmapper is a freely available web server that allows users to interactively visualize their data in the form of heat maps through an easy-to-use graphical interface. Unlike existing non-commercial heat map packages, which either lack graphical interfaces or are specialized for only one or two kinds of heat maps, Heatmapper is a versatile tool that allows users to easily create a wide variety of heat maps for many different data types and applications. More specifically, Heatmapper allows users to generate, cluster and visualize: (i) expression-based heat maps from transcriptomic, proteomic and metabolomic experiments; (ii) pairwise distance maps; (iii) correlation maps; (iv) image overlay heat maps; (v) latitude and longitude heat maps and (vi) geopolitical (choropleth) heat maps. Heatmapper offers a number of simple and intuitive customization options for facile adjustments to each heat map's appearance and plotting parameters. Heatmapper also allows users to interactively explore their numeric data values by hovering their cursor over each heat map cell, or by using a searchable/sortable data table view. Heat map data can be easily uploaded to Heatmapper in text, Excel or tab delimited formatted tables and the resulting heat map images can be easily downloaded in common formats including PNG, JPG and PDF. Heatmapper is designed to appeal to a wide range of users, including molecular biologists, structural biologists, microbiologists, epidemiologists, environmental scientists, agriculture/forestry scientists, fish and wildlife biologists, climatologists, geologists, educators and students. Heatmapper is available at http://www.heatmapper.ca. PMID:27190236

  12. Usability Evaluation of Public Web Mapping Sites

    NASA Astrophysics Data System (ADS)

    Wang, C.

    2014-04-01

    Web mapping sites are interactive maps that are accessed via Webpages. With the rapid development of Internet and Geographic Information System (GIS) field, public web mapping sites are not foreign to people. Nowadays, people use these web mapping sites for various reasons, in that increasing maps and related map services of web mapping sites are freely available for end users. Thus, increased users of web mapping sites led to more usability studies. Usability Engineering (UE), for instance, is an approach for analyzing and improving the usability of websites through examining and evaluating an interface. In this research, UE method was employed to explore usability problems of four public web mapping sites, analyze the problems quantitatively and provide guidelines for future design based on the test results. Firstly, the development progress for usability studies were described, and simultaneously several usability evaluation methods such as Usability Engineering (UE), User-Centered Design (UCD) and Human-Computer Interaction (HCI) were generally introduced. Then the method and procedure of experiments for the usability test were presented in detail. In this usability evaluation experiment, four public web mapping sites (Google Maps, Bing maps, Mapquest, Yahoo Maps) were chosen as the testing websites. And 42 people, who having different GIS skills (test users or experts), gender (male or female), age and nationality, participated in this test to complete the several test tasks in different teams. The test comprised three parts: a pretest background information questionnaire, several test tasks for quantitative statistics and progress analysis, and a posttest questionnaire. The pretest and posttest questionnaires focused on gaining the verbal explanation of their actions qualitatively. And the design for test tasks targeted at gathering quantitative data for the errors and problems of the websites. Then, the results mainly from the test part were analyzed. The

  13. Map of the Physical Sciences

    SciTech Connect

    Boyack, Kevin W.

    1999-07-02

    Various efforts to map the structure of science have been undertaken over the years. Using a new tool, VxInsight{trademark}, we have mapped and displayed 3000 journals in the physical sciences. This map is navigable and interactively reveals the structure of science at many different levels. Science mapping studies are typically focused at either the macro-or micro-level. At a macro-level such studies seek to determine the basic structural units of science and their interrelationships. The majority of studies are performed at the discipline or specialty level, and seek to inform science policy and technical decision makers. Studies at both levels probe the dynamic nature of science, and the implications of the changes. A variety of databases and methods have been used for these studies. Primary among databases are the citation indices (SCI and SSCI) from the Institute for Scientific Information, which have gained widespread acceptance for bibliometric studies. Maps are most often based on computed similarities between journal articles (co-citation), keywords or topics (co-occurrence or co-classification), or journals (journal-journal citation counts). Once the similarity matrix is defined, algorithms are used to cluster the data.

  14. Mapping the Heart

    ERIC Educational Resources Information Center

    Hulse, Grace

    2012-01-01

    In this article, the author describes how her fourth graders made ceramic heart maps. The impetus for this project came from reading "My Map Book" by Sara Fanelli. This book is a collection of quirky, hand-drawn and collaged maps that diagram a child's world. There are maps of her stomach, her day, her family, and her heart, among others. The…

  15. National Atlas maps

    USGS Publications Warehouse

    ,

    1991-01-01

    The National Atlas of the United States of America was published by the U.S. Geological Survey in 1970. Its 765 maps and charts are on 335 14- by 19-inch pages. Many of the maps span facing pages. It's worth a quick trip to the library just to leaf through all 335 pages of this book. Rapid scanning of its thematic maps yields rich insights to the geography of issues of continuing national interest. On most maps, the geographic patterns are still valid, though the data are not current. The atlas is out of print, but many of its maps can be purchased separately. Maps that span facing pages in the atlas are printed on one sheet. The maps dated after 1970 are either revisions of original atlas maps, or new maps published in atlas format. The titles of the separate maps are listed here.

  16. Map reading tools for map libraries.

    USGS Publications Warehouse

    Greenberg, G.L.

    1982-01-01

    Engineers, navigators and military strategists employ a broad array of mechanical devices to facilitate map use. A larger number of map users such as educators, students, tourists, journalists, historians, politicians, economists and librarians are unaware of the available variety of tools which can be used with maps to increase the speed and efficiency of their application and interpretation. This paper identifies map reading tools such as coordinate readers, protractors, dividers, planimeters, and symbol-templets according to a functional classification. Particularly, arrays of tools are suggested for use in determining position, direction, distance, area and form (perimeter-shape-pattern-relief). -from Author

  17. Conception and realization of a living map

    NASA Astrophysics Data System (ADS)

    Taladoire, Gilles; Lille, Didier

    1998-05-01

    Our objective is to obtain a 'living map' in which the traditional elements of a map are not static but can evolve in real time and interact. We therefore developed a system with a graphic interface allowing simulations to be constructed and both natural and man-induced phenomena to be monitored in real time. For this system, we coupled an expert system and an image processing system specialized in Remote Sensing. These two components accept many kind of data (aerial photographs, satellite pictures, maps, digital elevation models, . . .) and interact in real time. The system is built with four levels and uses an object methodology. It works according to the semantic wealth of the handled objects. The hierarchy of handled graphic objects essentially includes the geo- referenced objects and the 'maps' objects. Our prototype uses the object-oriented expert system of Gensym 'G2' and the graphic visualization system developed by Latical, 'Visiter.' An example will be presented.

  18. Smart "geomorphological" map browsing - a tale about geomorphological maps and the internet

    NASA Astrophysics Data System (ADS)

    Geilhausen, M.; Otto, J.-C.

    2012-04-01

    With the digital production of geomorphological maps, the dissemination of research outputs now extends beyond simple paper products. Internet technologies can contribute to both, the dissemination of geomorphological maps and access to geomorphologic data and help to make geomorphological knowledge available to a greater public. Indeed, many national geological surveys employ end-to-end digital workflows from data capture in the field to final map production and dissemination. This paper deals with the potential of web mapping applications and interactive, portable georeferenced PDF maps for the distribution of geomorphological information. Web mapping applications such as Google Maps have become very popular and widespread and increased the interest and access to mapping. They link the Internet with GIS technology and are a common way of presenting dynamic maps online. The GIS processing is performed online and maps are visualised in interactive web viewers characterised by different capabilities such as zooming, panning or adding further thematic layers, with the map refreshed after each task. Depending on the system architecture and the components used, advanced symbology, map overlays from different applications and sources and their integration into a Desktop GIS are possible. This interoperability is achieved through the use of international open standards that include mechanisms for the integration and visualisation of information from multiple sources. The portable document format (PDF) is commonly used for printing and is a standard format that can be processed by many graphic software and printers without loss of information. A GeoPDF enables the sharing of geospatial maps and data in PDF documents. Multiple, independent map frames with individual spatial reference systems are possible within a GeoPDF, for example, for map overlays or insets. Geospatial functionality of a GeoPDF includes scalable map display, layer visibility control, access to attribute

  19. Mapping Human Epigenomes

    PubMed Central

    Rivera, Chloe M.; Ren, Bing

    2013-01-01

    As the second dimension to the genome, the epigenome contains key information specific to every type of cells. Thousands of human epigenome maps have been produced in recent years thanks to rapid development of high throughput epigenome mapping technologies. In this review, we discuss the current epigenome mapping toolkit and utilities of epigenome maps. We focus particularly on mapping of DNA methylation, chromatin modification state and chromatin structures, and emphasize the use of epigenome maps to delineate human gene regulatory sequences and developmental programs. We also provide a perspective on the progress of the epigenomics field and challenges ahead. PMID:24074860

  20. Special surgical considerations for functional brain mapping.

    PubMed

    Kekhia, Hussein; Rigolo, Laura; Norton, Isaiah; Golby, Alexandra J

    2011-04-01

    The development of functional mapping techniques gives neurosurgeons many options for preoperative planning. Integrating functional and anatomic data can inform patient selection and surgical planning and makes functional mapping more accessible than when only invasive studies were available. However, the applications of functional mapping to neurosurgical patients are still evolving. Functional imaging remains complex and requires an understanding of the underlying physiologic and imaging characteristics. Neurosurgeons must be accustomed to interpreting highly processed data. Successful implementation of functional image-guided procedures requires efficient interactions between neurosurgeon, neurologist, radiologist, neuropsychologist, and others, but promises to enhance the care of patients.

  1. Rethinking map legends with visualization.

    PubMed

    Dykes, Jason; Wood, Jo; Slingsby, Aidan

    2010-01-01

    This design paper presents new guidance for creating map legends in a dynamic environment. Our contribution is a set of guidelines for legend design in a visualization context and a series of illustrative themes through which they may be expressed. These are demonstrated in an applications context through interactive software prototypes. The guidelines are derived from cartographic literature and in liaison with EDINA who provide digital mapping services for UK tertiary education. They enhance approaches to legend design that have evolved for static media with visualization by considering: selection, layout, symbols, position, dynamism and design and process. Broad visualization legend themes include: The Ground Truth Legend, The Legend as Statistical Graphic and The Map is the Legend. Together, these concepts enable us to augment legends with dynamic properties that address specific needs, rethink their nature and role and contribute to a wider re-evaluation of maps as artifacts of usage rather than statements of fact. EDINA has acquired funding to enhance their clients with visualization legends that use these concepts as a consequence of this work. The guidance applies to the design of a wide range of legends and keys used in cartography and information visualization.

  2. Creative Concept Mapping.

    ERIC Educational Resources Information Center

    Brown, David S.

    2002-01-01

    Recommends the use of concept mapping in science teaching and proposes that it be presented as a creative activity. Includes a sample lesson plan of a potato stamp concept mapping activity for astronomy. (DDR)

  3. Using maps in genealogy

    USGS Publications Warehouse

    ,

    1994-01-01

    In genealogy, maps are most often used as clues to where public or other records about an ancestor are likely to be found. Searching for maps seldom begins until a newcomer to genealogy has mastered basic genealogical routines

  4. Active Fire Mapping Program

    MedlinePlus

    Active Fire Mapping Program Current Large Incidents (Home) New Large Incidents Fire Detection Maps MODIS Satellite Imagery VIIRS Satellite Imagery Fire Detection GIS Data Fire Data in Google Earth ...

  5. Riparian Wetlands: Mapping

    EPA Science Inventory

    Riparian wetlands are critical systems that perform functions and provide services disproportionate to their extent in the landscape. Mapping wetlands allows for better planning, management, and modeling, but riparian wetlands present several challenges to effective mapping due t...

  6. Oil Exploration Mapping

    NASA Technical Reports Server (NTRS)

    1994-01-01

    After concluding an oil exploration agreement with the Republic of Yemen, Chevron International needed detailed geologic and topographic maps of the area. Chevron's remote sensing team used imagery from Landsat and SPOT, combining images into composite views. The project was successfully concluded and resulted in greatly improved base maps and unique topographic maps.

  7. Adventures with Maps.

    ERIC Educational Resources Information Center

    Hofferber, Michael

    1989-01-01

    Orienteering--the game of following a map to find predetermined locations--can spark interest and develop skills in map making and map reading. This article gives background on orienteering; describes indoor and outdoor orienteering activities; offers suggestions for incorporating orienteering into science, math, and language arts; and provides a…

  8. Reading Angles in Maps

    ERIC Educational Resources Information Center

    Izard, Véronique; O'Donnell, Evan; Spelke, Elizabeth S.

    2014-01-01

    Preschool children can navigate by simple geometric maps of the environment, but the nature of the geometric relations they use in map reading remains unclear. Here, children were tested specifically on their sensitivity to angle. Forty-eight children (age 47:15-53:30 months) were presented with fragments of geometric maps, in which angle sections…

  9. Using maps in genealogy

    USGS Publications Warehouse

    ,

    1999-01-01

    Maps are one of many sources you may need to complete a family tree. In genealogical research, maps can provide clues to where our ancestors may have lived and where to look for written records about them. Beginners should master basic genealogical research techniques before starting to use topographic maps.

  10. Quantitative DNA fiber mapping

    DOEpatents

    Gray, Joe W.; Weier, Heinz-Ulrich G.

    1998-01-01

    The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

  11. What Do Maps Show?

    ERIC Educational Resources Information Center

    Geological Survey (Dept. of Interior), Reston, VA.

    This curriculum packet, appropriate for grades 4-8, features a teaching poster which shows different types of maps (different views of Salt Lake City, Utah), as well as three reproducible maps and reproducible activity sheets which complement the maps. The poster provides teacher background, including step-by-step lesson plans for four geography…

  12. Mapping a Changing World.

    ERIC Educational Resources Information Center

    Stoltman, Joseph P.

    1992-01-01

    Addresses the importance of maps for instruction in both history and geography. Suggests that maps have gotten recent attention because of the rapid political changes occurring in Europe and the quincentenary of Columbus' voyage. Discusses different map projections and the importance of media and satellite display of real pictures of the world.…

  13. Mapping Sociological Concepts.

    ERIC Educational Resources Information Center

    Trepagnier, Barbara

    2002-01-01

    Focuses on the use of cognitive mapping within sociology. Describes an assignment where students created a cognitive map that focused on names of theorists and concepts related to them. Discusses sociological imagination in relation to cognitive mapping and the assessment of the assignment. (CMK)

  14. Adaptive Composite Map Projections.

    PubMed

    Jenny, B

    2012-12-01

    All major web mapping services use the web Mercator projection. This is a poor choice for maps of the entire globe or areas of the size of continents or larger countries because the Mercator projection shows medium and higher latitudes with extreme areal distortion and provides an erroneous impression of distances and relative areas. The web Mercator projection is also not able to show the entire globe, as polar latitudes cannot be mapped. When selecting an alternative projection for information visualization, rivaling factors have to be taken into account, such as map scale, the geographic area shown, the map's height-to-width ratio, and the type of cartographic visualization. It is impossible for a single map projection to meet the requirements for all these factors. The proposed composite map projection combines several projections that are recommended in cartographic literature and seamlessly morphs map space as the user changes map scale or the geographic region displayed. The composite projection adapts the map's geometry to scale, to the map's height-to-width ratio, and to the central latitude of the displayed area by replacing projections and adjusting their parameters. The composite projection shows the entire globe including poles; it portrays continents or larger countries with less distortion (optionally without areal distortion); and it can morph to the web Mercator projection for maps showing small regions.

  15. Map projections for larger-scale mapping

    NASA Technical Reports Server (NTRS)

    Snyder, J. P.

    1982-01-01

    For the U.S. Geological Survey maps at 1:1,000,000-scale and larger, the most common projections are conformal, such as the Transverse Mercator and Lambert Conformal Conic. Projections for these scales should treat the Earth as an ellipsoid. In addition, the USGS has conceived and designed some new projections, including the Space Oblique Mercator, the first map projection designed to permit low-distortion mapping of the Earth from satellite imagery, continuously following the groundtrack. The USGS has programmed nearly all pertinent projection equations for inverse and forward calculations. These are used to plot maps or to transform coordinates from one projection to another. The projections in current use are described.

  16. On genetic map functions

    SciTech Connect

    Zhao, Hongyu; Speed, T.P.

    1996-04-01

    Various genetic map functions have been proposed to infer the unobservable genetic distance between two loci from the observable recombination fraction between them. Some map functions were found to fit data better than others. When there are more than three markers, multilocus recombination probabilities cannot be uniquely determined by the defining property of map functions, and different methods have been proposed to permit the use of map functions to analyze multilocus data. If for a given map function, there is a probability model for recombination that can give rise to it, then joint recombination probabilities can be deduced from this model. This provides another way to use map functions in multilocus analysis. In this paper we show that stationary renewal processes give rise to most of the map functions in the literature. Furthermore, we show that the interevent distributions of these renewal processes can all be approximated quite well by gamma distributions. 43 refs., 4 figs.

  17. Comparing landslide inventory maps

    NASA Astrophysics Data System (ADS)

    Galli, Mirco; Ardizzone, Francesca; Cardinali, Mauro; Guzzetti, Fausto; Reichenbach, Paola

    Landslide inventory maps are effective and easily understandable products for both experts, such as geomorphologists, and for non experts, including decision-makers, planners, and civil defense managers. Landslide inventories are essential to understand the evolution of landscapes, and to ascertain landslide susceptibility and hazard. Despite landslide maps being compiled every year in the word at different scales, limited efforts are made to critically compare landslide maps prepared using different techniques or by different investigators. Based on the experience gained in 20 years of landslide mapping in Italy, and on the limited literature on landslide inventory assessment, we propose a general framework for the quantitative comparison of landslide inventory maps. To test the proposed framework we exploit three inventory maps. The first map is a reconnaissance landslide inventory prepared for the Umbria region, in central Italy. The second map is a detailed geomorphological landslide map, also prepared for the Umbria region. The third map is a multi-temporal landslide inventory compiled for the Collazzone area, in central Umbria. Results of the experiment allow for establishing how well the individual inventories describe the location, type and abundance of landslides, to what extent the landslide maps can be used to determine the frequency-area statistics of the slope failures, and the significance of the inventory maps as predictors of landslide susceptibility. We further use the results obtained in the Collazzone area to estimate the quality and completeness of the two regional landslide inventory maps, and to outline general advantages and limitations of the techniques used to complete the inventories.

  18. Understanding splicing regulation through RNA splicing maps.

    PubMed

    Witten, Joshua T; Ule, Jernej

    2011-03-01

    Alternative splicing is a highly regulated process that greatly increases the proteome diversity and plays an important role in cellular differentiation and disease. Interactions between RNA-binding proteins (RBPs) and pre-mRNA are the principle regulator of splicing decisions. Findings from recent genome-wide studies of protein-RNA interactions have been combined with assays of the global effects of RBPs on splicing to create RNA splicing maps. These maps integrate information from all pre-mRNAs regulated by single RBPs to identify the global positioning principles guiding splicing regulation. Recent studies using this approach have identified a set of positional principles that are shared between diverse RBPs. Here, we discuss how insights from RNA splicing maps of different RBPs inform the mechanistic models of splicing regulation.

  19. Multiresolution saliency map based object segmentation

    NASA Astrophysics Data System (ADS)

    Yang, Jian; Wang, Xin; Dai, ZhenYou

    2015-11-01

    Salient objects' detection and segmentation are gaining increasing research interest in recent years. A saliency map can be obtained from different models presented in previous studies. Based on this saliency map, the most salient region (MSR) in an image can be extracted. This MSR, generally a rectangle, can be used as the initial parameters for object segmentation algorithms. However, to our knowledge, all of those saliency maps are represented in a unitary resolution although some models have even introduced multiscale principles in the calculation process. Furthermore, some segmentation methods, such as the well-known GrabCut algorithm, need more iteration time or additional interactions to get more precise results without predefined pixel types. A concept of a multiresolution saliency map is introduced. This saliency map is provided in a multiresolution format, which naturally follows the principle of the human visual mechanism. Moreover, the points in this map can be utilized to initialize parameters for GrabCut segmentation by labeling the feature pixels automatically. Both the computing speed and segmentation precision are evaluated. The results imply that this multiresolution saliency map-based object segmentation method is simple and efficient.

  20. Fractional dissipative standard map.

    PubMed

    Tarasov, Vasily E; Edelman, M

    2010-06-01

    Using kicked differential equations of motion with derivatives of noninteger orders, we obtain generalizations of the dissipative standard map. The main property of these generalized maps, which are called fractional maps, is long-term memory. The memory effect in the fractional maps means that their present state of evolution depends on all past states with special forms of weights. Already a small deviation of the order of derivative from the integer value corresponding to the regular dissipative standard map (small memory effects) leads to the qualitatively new behavior of the corresponding attractors. The fractional dissipative standard maps are used to demonstrate a new type of fractional attractors in the wide range of the fractional orders of derivatives.

  1. Heat Capacity Mapping Mission

    NASA Technical Reports Server (NTRS)

    Nilsson, C. S.; Andrews, J. C.; Scully-Power, P.; Ball, S.; Speechley, G.; Latham, A. R. (Principal Investigator)

    1980-01-01

    The Tasman Front was delineated by airborne expendable bathythermograph survey; and an Heat Capacity Mapping Mission (HCMM) IR image on the same day shows the same principal features as determined from ground-truth. It is clear that digital enhancement of HCMM images is necessary to map ocean surface temperatures and when done, the Tasman Front and other oceanographic features can be mapped by this method, even through considerable scattered cloud cover.

  2. MapReduce SVM Game

    SciTech Connect

    Vineyard, Craig M.; Verzi, Stephen J.; James, Conrad D.; Aimone, James B.; Heileman, Gregory L.

    2015-08-10

    Despite technological advances making computing devices faster, smaller, and more prevalent in today's age, data generation and collection has outpaced data processing capabilities. Simply having more compute platforms does not provide a means of addressing challenging problems in the big data era. Rather, alternative processing approaches are needed and the application of machine learning to big data is hugely important. The MapReduce programming paradigm is an alternative to conventional supercomputing approaches, and requires less stringent data passing constrained problem decompositions. Rather, MapReduce relies upon defining a means of partitioning the desired problem so that subsets may be computed independently and recom- bined to yield the net desired result. However, not all machine learning algorithms are amenable to such an approach. Game-theoretic algorithms are often innately distributed, consisting of local interactions between players without requiring a central authority and are iterative by nature rather than requiring extensive retraining. Effectively, a game-theoretic approach to machine learning is well suited for the MapReduce paradigm and provides a novel, alternative new perspective to addressing the big data problem. In this paper we present a variant of our Support Vector Machine (SVM) Game classifier which may be used in a distributed manner, and show an illustrative example of applying this algorithm.

  3. MapReduce SVM Game

    DOE PAGES

    Vineyard, Craig M.; Verzi, Stephen J.; James, Conrad D.; ...

    2015-08-10

    Despite technological advances making computing devices faster, smaller, and more prevalent in today's age, data generation and collection has outpaced data processing capabilities. Simply having more compute platforms does not provide a means of addressing challenging problems in the big data era. Rather, alternative processing approaches are needed and the application of machine learning to big data is hugely important. The MapReduce programming paradigm is an alternative to conventional supercomputing approaches, and requires less stringent data passing constrained problem decompositions. Rather, MapReduce relies upon defining a means of partitioning the desired problem so that subsets may be computed independently andmore » recom- bined to yield the net desired result. However, not all machine learning algorithms are amenable to such an approach. Game-theoretic algorithms are often innately distributed, consisting of local interactions between players without requiring a central authority and are iterative by nature rather than requiring extensive retraining. Effectively, a game-theoretic approach to machine learning is well suited for the MapReduce paradigm and provides a novel, alternative new perspective to addressing the big data problem. In this paper we present a variant of our Support Vector Machine (SVM) Game classifier which may be used in a distributed manner, and show an illustrative example of applying this algorithm.« less

  4. A Graphics System for Pole-Zero Map Analysis.

    ERIC Educational Resources Information Center

    Beyer, William Fred, III

    Computer scientists have developed an interactive, graphical display system for pole-zero map analysis. They designed it for use as an educational tool in teaching introductory courses in automatic control systems. The facilities allow the user to specify a control system and an input function in the form of a pole-zero map and then examine the…

  5. BOREAS Hardcopy Maps

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Nelson, Elizabeth; Newcomer, Jeffrey A.

    2000-01-01

    Boreal Ecosystem-Atmospheric Study (BOREAS) hardcopy maps are a collection of approximately 1,000 hardcopy maps representing the physical, climatological, and historical attributes of areas covering primarily the Manitoba and Saskatchewan provinces of Canada. These maps were collected by BOREAS Information System (BORIS) and Canada for Remote Sensing (CCRS) staff to provide basic information about site positions, manmade features, topography, geology, hydrology, land cover types, fire history, climate, and soils of the BOREAS study region. These maps are not available for distribution through the BOREAS project but may be used as an on-site resource. Information is provided within this document for individuals who want to order copies of these maps from the original map source. Note that the maps are not contained on the BOREAS CD-ROM set. An inventory listing file is supplied on the CD-ROM to inform users of the maps that are available. This inventory listing is available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). For hardcopies of the individual maps, contact the sources provided.

  6. Denali image map

    USGS Publications Warehouse

    Binnie, Douglas R.; Colvocoresses, Alden P.

    1987-01-01

    The Denali National Park and Preserve 1:250,000-scale image map has been prepared and published as part of the US Geological Survey's (USGS) continuing research to improve image mapping techniques. Nine multispectral scanner (MSS) images were geometrically corrected, digitally mosaicked, and enhanced at the National Mapping Division's (NMD) EROS Data Center (EDC). This process involves ground control and digital resampling to the Universal Tranverse Mercator (UTM) projection. This paper specifically discusses the preparation of the digital mosaic and the production peculiarities associated with the Denali National Park and Preserve image map.

  7. [Concept maps of the graduate programme in nursing: experience report].

    PubMed

    Bittencourt, Greicy Kelly Gouveia Dias; da Nóbrega, Maria Miriam Lima; Medeiros, Ana Cláudia Torres; Furtado, Luciana Gomes

    2013-06-01

    The conceptual map is considered a strategy that enables the development of critical thinking skills. The aim of this article was to evaluate concept maps produced by students to obtain an understanding of research projects. This is an experience report based on the Special Topic: concept map of the Graduate Program in Nursing/Federal University of Paraiba in February/2012. Methodology comprised interactive reading of concept maps, installation and use of Cmap Tools software and construction of concept maps. Concept evaluation included coherence, propositions, clarity of ideas and logical relation between concepts. This evaluation of maps revealed consistency among concepts, significant relationships, clarity of ideas and logical relationship between the stages of a research project. Results showed that the concept map is a valid strategy to evaluate the learning-teaching process and can be used for education, research and reflection in the nursing practice.

  8. Mapping the binding site pocket of the serotonin 5-Hydroxytryptamine2A receptor. Ser3.36(159) provides a second interaction site for the protonated amine of serotonin but not of lysergic acid diethylamide or bufotenin.

    PubMed

    Almaula, N; Ebersole, B J; Zhang, D; Weinstein, H; Sealfon, S C

    1996-06-21

    Like other amine neurotransmitters that activate G-protein-coupled receptors, 5-hydroxytryptamine (5-HT) binds to the 5-HT2A receptor through the interaction of its cationic primary amino group with the conserved Asp3.32(155) in transmembrane helix 3. Computational experiments with a 5-HT2A receptor model suggest that the same functional group of 5-hydroxytryptamine also forms a hydrogen bond with the side chain of Ser3.36(159), which is adjacent in space to Asp3.32(155). However, other 5-HT2A receptor ligands like lysergic acid diethylamide (LSD), in which the amine nitrogen is embedded in a heterocycle, or N,N-dimethyl 5-HT, in which the side chain is a tertiary amine, are found in the computational simulations to interact with the aspartate but not with the serine, due mainly to steric hindrance. The predicted difference in the interaction of various ligands in the same receptor binding pocket was tested with site-directed mutagenesis of Ser3.36(159) --> Ala and Ser3.36(159) --> Cys. The alanine substitution led to an 18-fold reduction in 5-HT affinity and the cysteine substitution to an intermediate 5-fold decrease. LSD affinity, in contrast, was unaffected by either mutation. N,N-Dimethyl 5-HT affinity was unaffected by the cysteine mutation and had a comparatively small 3-fold decrease in affinity for the alanine mutant. These findings identify a mode of ligand-receptor complexation that involves two receptor side chains interacting with the same functional group of specific serotonergic ligands. This interaction serves to orient the ligands in the binding pocket and may influence the degree of receptor activation.

  9. Occupancy Grid Map Merging Using Feature Maps

    DTIC Science & Technology

    2010-11-01

    Gonzalez, “Toward a unified bayesian approach to hybrid metric-topological SLAM,” IEEE Transactions on Robotics , 24(2), April 2008, 259-270. [14] G...Risetti, C. Stachniss, and W. Burgard, “Improved Techniques for grid mapping with Rao-Blackwellized Particle Filter,” IEEE Transactions on Robotics , 23

  10. Maps and Map Learning in Social Studies

    ERIC Educational Resources Information Center

    Bednarz, Sarah Witham; Acheson, Gillian; Bednarz, Robert S.

    2006-01-01

    The importance of maps and other graphic representations has become more important to geography and geographers. This is due to the development and widespread diffusion of geographic (spatial) technologies. As computers and silicon chips have become more capable and less expensive, geographic information systems (GIS), global positioning satellite…

  11. Sao Paulo Map Collections.

    ERIC Educational Resources Information Center

    McLean, G. Robert

    1985-01-01

    Describes geographical, subject, and chronological aspects of 25 cartographic collections housed in university, public, special, state, and semi-state libraries in Sao Paulo, Brazil. Three size categories of map holdings (more than 10,000, 1,000-10,000, less than 1,000) are distinguished. A list of 27 Sao Paulo institutions housing map collections…

  12. Managing Vocabulary Mapping Services

    PubMed Central

    Che, Chengjian; Monson, Kent; Poon, Kasey B.; Shakib, Shaun C.; Lau, Lee Min

    2005-01-01

    The efficient management and maintenance of large-scale and high-quality vocabulary mapping is an operational challenge. The 3M Health Information Systems (HIS) Healthcare Data Dictionary (HDD) group developed an information management system to provide controlled mapping services, resulting in improved efficiency and quality maintenance. PMID:16779203

  13. Map of Nasca Geoglyphs

    NASA Astrophysics Data System (ADS)

    Hanzalová, K.; Pavelka, K.

    2013-07-01

    The Czech Technical University in Prague in the cooperation with the University of Applied Sciences in Dresden (Germany) work on the Nasca Project. The cooperation started in 2004 and much work has been done since then. All work is connected with Nasca lines in southern Peru. The Nasca project started in 1995 and its main target is documentation and conservation of the Nasca lines. Most of the project results are presented as WebGIS application via Internet. In the face of the impending destruction of the soil drawings, it is possible to preserve this world cultural heritage for the posterity at least in a digital form. Creating of Nasca lines map is very useful. The map is in a digital form and it is also available as a paper map. The map contains planimetric component of the map, map lettering and altimetry. Thematic folder in this map is a vector layer of the geoglyphs in Nasca/Peru. Basis for planimetry are georeferenced satellite images, altimetry is created from digital elevation model. This map was created in ArcGis software.

  14. Chizu Task Mapping Tool

    SciTech Connect

    2014-07-01

    Chizu is a tool for Mapping MPI processes or tasks to physical processors or nodes for optimizing communication performance. It takes the communication graph of a High Performance Computing (HPC) application and the interconnection topology of a supercomputer as input. It outputs a new MPI rand to processor mapping, which can be used when launching the HPC application.

  15. Mapping the Llano Estacado

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Early maps of North America, prepared in the 18th and early 19th centuries, often depicted the Llano Estacado as a conspicuous blank spot - a terra incognita. A good example is a map of the southwest sketched by Alexander von Humboldt in 1804. In 1830, Stephen F. Austin added little detail to the ...

  16. Handmade Multitextured Maps.

    ERIC Educational Resources Information Center

    Trevelyan, Simon

    1984-01-01

    Tactile maps for visually impaired persons can be made by drawing lines with an aqueous adhesive solution, dusting with thermoengraving powder, and exposing the card to a source of intense heat (such as a heat gun or microwave oven). A raised line map results. (CL)

  17. Acoustic mapping velocimetry

    NASA Astrophysics Data System (ADS)

    Muste, M.; Baranya, S.; Tsubaki, R.; Kim, D.; Ho, H.; Tsai, H.; Law, D.

    2016-05-01

    Knowledge of sediment dynamics in rivers is of great importance for various practical purposes. Despite its high relevance in riverine environment processes, the monitoring of sediment rates remains a major and challenging task for both suspended and bed load estimation. While the measurement of suspended load is currently an active area of testing with nonintrusive technologies (optical and acoustic), bed load measurement does not mark a similar progress. This paper describes an innovative combination of measurement techniques and analysis protocols that establishes the proof-of-concept for a promising technique, labeled herein Acoustic Mapping Velocimetry (AMV). The technique estimates bed load rates in rivers developing bed forms using a nonintrusive measurements approach. The raw information for AMV is collected with acoustic multibeam technology that in turn provides maps of the bathymetry over longitudinal swaths. As long as the acoustic maps can be acquired relatively quickly and the repetition rate for the mapping is commensurate with the movement of the bed forms, successive acoustic maps capture the progression of the bed form movement. Two-dimensional velocity maps associated with the bed form migration are obtained by implementing algorithms typically used in particle image velocimetry to acoustic maps converted in gray-level images. Furthermore, use of the obtained acoustic and velocity maps in conjunction with analytical formulations (e.g., Exner equation) enables estimation of multidirectional bed load rates over the whole imaged area. This paper presents a validation study of the AMV technique using a set of laboratory experiments.

  18. What do maps show?

    USGS Publications Warehouse

    ,

    1994-01-01

    The purpose of the teaching package is to help students understand and use maps. The U.S. Geological Survey (USGS) has provided the package as a service to educators so that more Americans will learn to understand the world of information on maps. Everything in the package teaches and reinforces geographic skills that are required in your curriculum.

  19. BenMAP Downloads

    EPA Pesticide Factsheets

    Download the current and legacy versions of the BenMAP program. Download configuration and aggregation/pooling/valuation files to estimate benefits. BenMAP-CE is free and open source software, and the source code is available upon request.

  20. The Map Corner.

    ERIC Educational Resources Information Center

    Cheyney, Arnold B.; Capone, Donald L.

    This teaching resource is aimed at helping students develop the skills necessary to locate places on the earth. Designed as a collection of map skill exercises rather than a sequential program of study, this program expects that students have access to and some knowledge of how to use globes, maps, atlases, and encyclopedias. The volume contains 6…

  1. Temporal mapping and analysis

    NASA Technical Reports Server (NTRS)

    O'Hara, Charles G. (Inventor); Shrestha, Bijay (Inventor); Vijayaraj, Veeraraghavan (Inventor); Mali, Preeti (Inventor)

    2011-01-01

    A compositing process for selecting spatial data collected over a period of time, creating temporal data cubes from the spatial data, and processing and/or analyzing the data using temporal mapping algebra functions. In some embodiments, the temporal data cube is creating a masked cube using the data cubes, and computing a composite from the masked cube by using temporal mapping algebra.

  2. World Stress Map Published

    NASA Astrophysics Data System (ADS)

    Heidbach, Oliver; Müller, Birgit; Fuchs, Karl; Wenzel, Friedemann; Reinecker, John; Tingay, Mark; Sperner, Blanka; Cadet, Jean-Paul; Rossi, Philipp

    2007-11-01

    The World Stress Map (WSM), published in April 2007 by the Commission for the Geological Map of the World and the Heidelberg Academy of Sciences and Humanities, displays the tectonic regime and the orientation of the contemporary maximum horizontal compressional stress at more than 12,000 locations within the Earth's crust. The Mercator projection is a scale of 1:46,000,000.

  3. The interactive brain hypothesis

    PubMed Central

    Di Paolo, Ezequiel; De Jaegher, Hanne

    2012-01-01

    Enactive approaches foreground the role of interpersonal interaction in explanations of social understanding. This motivates, in combination with a recent interest in neuroscientific studies involving actual interactions, the question of how interactive processes relate to neural mechanisms involved in social understanding. We introduce the Interactive Brain Hypothesis (IBH) in order to help map the spectrum of possible relations between social interaction and neural processes. The hypothesis states that interactive experience and skills play enabling roles in both the development and current function of social brain mechanisms, even in cases where social understanding happens in the absence of immediate interaction. We examine the plausibility of this hypothesis against developmental and neurobiological evidence and contrast it with the widespread assumption that mindreading is crucial to all social cognition. We describe the elements of social interaction that bear most directly on this hypothesis and discuss the empirical possibilities open to social neuroscience. We propose that the link between coordination dynamics and social understanding can be best grasped by studying transitions between states of coordination. These transitions form part of the self-organization of interaction processes that characterize the dynamics of social engagement. The patterns and synergies of this self-organization help explain how individuals understand each other. Various possibilities for role-taking emerge during interaction, determining a spectrum of participation. This view contrasts sharply with the observational stance that has guided research in social neuroscience until recently. We also introduce the concept of readiness to interact to describe the practices and dispositions that are summoned in situations of social significance (even if not interactive). This latter idea links interactive factors to more classical observational scenarios. PMID:22701412

  4. Arabidopsis MAP3K16 and Other Salt-Inducible MAP3Ks Regulate ABA Response Redundantly

    PubMed Central

    Choi, Seo-wha; Lee, Seul-bee; Na, Yeon-ju; Jeung, Sun-geum; Kim, Soo Young

    2017-01-01

    In the Arabidopsis genome, approximately 80 MAP3Ks (mitogen-activated protein kinase kinase kinases) have been identified. However, only a few of them have been characterized, and the functions of most MAP3Ks are largely unknown. In this paper, we report the function of MAP3K16 and several other MAP3Ks, MAP3K14/15/17/18, whose expression is salt-inducible. We prepared MAP3K16 overexpression (OX) lines and analyzed their phenotypes. The result showed that the transgenic plants were ABA-insensitive during seed germination and cotyledon greening stage but their root growth was ABA-hypersensitive. The OX lines were more susceptible to water-deficit condition at later growth stage in soil. A MAP3K16 knockout (KO) line, on the other hand, exhibited opposite phenotypes. In similar transgenic analyses, we found that MAP3K14/15/17/18 OX and KO lines displayed similar phenotypes to those of MA3K16, suggesting the functional redundancy among them. MAP3K16 possesses in vitro kinase activity, and we carried out two-hybrid analyses to identify MAP3K16 substrates. Our results indicate that MAP3K16 interacts with MKK3 and the negative regulator of ABA response, ABR1, in yeast. Furthermore, MAP3K16 recombinant protein could phosphorylate MKK3 and ABR1, suggesting that they might be MAP3K16 substrates. Collectively, our results demonstrate that MAP3K16 and MAP3K14/15/17/18 are involved in ABA response, playing negative or positive roles depending on developmental stage and that MAP3K16 may function via MKK3 and ABR1. PMID:28292003

  5. Factorized Diffusion Map Approximation.

    PubMed

    Amizadeh, Saeed; Valizadegan, Hamed; Hauskrecht, Milos

    2012-01-01

    Diffusion maps are among the most powerful Machine Learning tools to analyze and work with complex high-dimensional datasets. Unfortunately, the estimation of these maps from a finite sample is known to suffer from the curse of dimensionality. Motivated by other machine learning models for which the existence of structure in the underlying distribution of data can reduce the complexity of estimation, we study and show how the factorization of the underlying distribution into independent subspaces can help us to estimate diffusion maps more accurately. Building upon this result, we propose and develop an algorithm that can automatically factorize a high dimensional data space in order to minimize the error of estimation of its diffusion map, even in the case when the underlying distribution is not decomposable. Experiments on both the synthetic and real-world datasets demonstrate improved estimation performance of our method over the standard diffusion-map framework.

  6. Factorized Diffusion Map Approximation

    PubMed Central

    Amizadeh, Saeed; Valizadegan, Hamed; Hauskrecht, Milos

    2013-01-01

    Diffusion maps are among the most powerful Machine Learning tools to analyze and work with complex high-dimensional datasets. Unfortunately, the estimation of these maps from a finite sample is known to suffer from the curse of dimensionality. Motivated by other machine learning models for which the existence of structure in the underlying distribution of data can reduce the complexity of estimation, we study and show how the factorization of the underlying distribution into independent subspaces can help us to estimate diffusion maps more accurately. Building upon this result, we propose and develop an algorithm that can automatically factorize a high dimensional data space in order to minimize the error of estimation of its diffusion map, even in the case when the underlying distribution is not decomposable. Experiments on both the synthetic and real-world datasets demonstrate improved estimation performance of our method over the standard diffusion-map framework. PMID:25309676

  7. Geologic map of Mars

    USGS Publications Warehouse

    Tanaka, Kenneth L.; Skinner, James A.; Dohm, James M.; Irwin, Rossman P.; Kolb, Eric J.; Fortezzo, Corey M.; Platz, Thomas; Michael, Gregory G.; Hare, Trent M.

    2014-01-01

    This global geologic map of Mars, which records the distribution of geologic units and landforms on the planet's surface through time, is based on unprecedented variety, quality, and quantity of remotely sensed data acquired since the Viking Orbiters. These data have provided morphologic, topographic, spectral, thermophysical, radar sounding, and other observations for integration, analysis, and interpretation in support of geologic mapping. In particular, the precise topographic mapping now available has enabled consistent morphologic portrayal of the surface for global mapping (whereas previously used visual-range image bases were less effective, because they combined morphologic and albedo information and, locally, atmospheric haze). Also, thermal infrared image bases used for this map tended to be less affected by atmospheric haze and thus are reliable for analysis of surface morphology and texture at even higher resolution than the topographic products.

  8. Bodily maps of emotions

    PubMed Central

    Nummenmaa, Lauri; Glerean, Enrico; Hari, Riitta; Hietanen, Jari K.

    2014-01-01

    Emotions are often felt in the body, and somatosensory feedback has been proposed to trigger conscious emotional experiences. Here we reveal maps of bodily sensations associated with different emotions using a unique topographical self-report method. In five experiments, participants (n = 701) were shown two silhouettes of bodies alongside emotional words, stories, movies, or facial expressions. They were asked to color the bodily regions whose activity they felt increasing or decreasing while viewing each stimulus. Different emotions were consistently associated with statistically separable bodily sensation maps across experiments. These maps were concordant across West European and East Asian samples. Statistical classifiers distinguished emotion-specific activation maps accurately, confirming independence of topographies across emotions. We propose that emotions are represented in the somatosensory system as culturally universal categorical somatotopic maps. Perception of these emotion-triggered bodily changes may play a key role in generating consciously felt emotions. PMID:24379370

  9. Iconicity as structure mapping

    PubMed Central

    Emmorey, Karen

    2014-01-01

    Linguistic and psycholinguistic evidence is presented to support the use of structure-mapping theory as a framework for understanding effects of iconicity on sign language grammar and processing. The existence of structured mappings between phonological form and semantic mental representations has been shown to explain the nature of metaphor and pronominal anaphora in sign languages. With respect to processing, it is argued that psycholinguistic effects of iconicity may only be observed when the task specifically taps into such structured mappings. In addition, language acquisition effects may only be observed when the relevant cognitive abilities are in place (e.g. the ability to make structural comparisons) and when the relevant conceptual knowledge has been acquired (i.e. information key to processing the iconic mapping). Finally, it is suggested that iconicity is better understood as a structured mapping between two mental representations than as a link between linguistic form and human experience. PMID:25092669

  10. Bodily maps of emotions.

    PubMed

    Nummenmaa, Lauri; Glerean, Enrico; Hari, Riitta; Hietanen, Jari K

    2014-01-14

    Emotions are often felt in the body, and somatosensory feedback has been proposed to trigger conscious emotional experiences. Here we reveal maps of bodily sensations associated with different emotions using a unique topographical self-report method. In five experiments, participants (n = 701) were shown two silhouettes of bodies alongside emotional words, stories, movies, or facial expressions. They were asked to color the bodily regions whose activity they felt increasing or decreasing while viewing each stimulus. Different emotions were consistently associated with statistically separable bodily sensation maps across experiments. These maps were concordant across West European and East Asian samples. Statistical classifiers distinguished emotion-specific activation maps accurately, confirming independence of topographies across emotions. We propose that emotions are represented in the somatosensory system as culturally universal categorical somatotopic maps. Perception of these emotion-triggered bodily changes may play a key role in generating consciously felt emotions.

  11. Getting Results with Curriculum Mapping

    ERIC Educational Resources Information Center

    Jacobs, Heidi Hayes

    2004-01-01

    This helpful resource will speed the mapping effort along and apply curriculum mapping to special situations. In this book teachers and administrators offer concrete advice on how to get the most out of curriculum mapping in districts and schools: (1) Steps to implementing mapping procedures and leading the mapping process; (2) Tools and resources…

  12. Method for Stereo Mapping Based on Objectarx and Pipeline Technology

    NASA Astrophysics Data System (ADS)

    Liu, F.; Chen, T.; Lin, Z.; Yang, Y.

    2012-07-01

    Stereo mapping is an important way to acquire 4D production. Based on the development of the stereo mapping and the characteristics of ObjectARX and pipeline technology, a new stereo mapping scheme which can realize the interaction between the AutoCAD and digital photogrammetry system is offered by ObjectARX and pipeline technology. An experiment is made in order to make sure the feasibility with the example of the software MAP-AT (Modern Aerial Photogrammetry Automatic Triangulation), the experimental results show that this scheme is feasible and it has very important meaning for the realization of the acquisition and edit integration.

  13. Univiewer: Visualisation Program for HEALPix Maps

    NASA Astrophysics Data System (ADS)

    Mingaliev, Shamil M.; Ashdown, Mark; Stolyarov, Vlad

    2011-10-01

    Univiewer is a visualisation program for HEALPix maps. It is written in C++ and uses OpenGL and the wxWidgets library for cross-platform portability. Using it you can: Rotate and zoom maps on the sphere in 3D;Create high-resolution views of square patches of the map;Change maximum and minimum values of the colourmap interactively;Calculate the power spectrum of the full-sky map or a patch;Display any column of a HEALPix map FITS file on the sphere.Since Univiewer uses OpenGL for 3D graphics, its performance is dependent your video card. It has been tested successfully on computers with as little as 8Mb video memory, but it is recommended to have at least 32Mb to get good performance. In the 3D view, a HEALPix map is projected onto a ECP pixelation to create a texture which is wrapped around the sphere. In calculating the power spectrum, the spherical harmonic transforms are computed using the same ECP pixelation. This inevitably leads to some discrepancies at small scales due to repixelation effects, but they are reasonably small.

  14. Interaction of fibrin(ogen) with the endothelial cell receptor VE-cadherin: mapping of the receptor-binding site in the NH2-terminal portions of the fibrin beta chains.

    PubMed

    Gorlatov, Sergei; Medved, Leonid

    2002-03-26

    Interaction of fibrin with endothelial cells stimulates capillary tube formation thus promoting angiogenesis. This interaction occurs via endothelial cell receptor VE-cadherin and fibrin beta chain 15-42 regions [Bach, T. L., et al. (1998) J. Biol. Chem. 272, 30719-30728]. To clarify the mechanism of this interaction, we expressed in Escherichia coli a number of recombinant fibrin(ogen) fragments containing the beta15-42 region or the VE-cad(1-2) and VE-cad(1-4) fragments encompassing two and four extracellular NH2-terminal domains of VE-cadherin, respectively, and tested interaction between them by surface plasmon resonance and ELISA. Neither the recombinant Bbeta1-57 or Bbeta1-64 fragments, nor beta15-57 or beta15-64 prepared from the latter fragments by thrombin treatment to remove fibrinopeptides B, bound the recombinant VE-cadherin fragments. At the same time, a dimeric recombinant thrombin-treated (beta15-66)2 fragment, which had been disulfide-linked via Cys65 to mimic the dimeric arrangement of the beta chains in fibrin, bound VE-cad(1-4) well, but not VE-cad(1-2); no binding was observed with the untreated (Bbeta1-66)2 dimer. We next mutated several residues in the dimer, His16, Arg17, Pro18, and Asp20, and tested the interaction of the thrombin-treated mutants with VE-cad(1-4) by ligand blotting and surface plasmon resonance. No binding was observed with the H16A and R17Q single mutants and the H16P, P18V double mutant while the P18A and D20N single mutants bound VE-cad(1-4) with the same affinity as the thrombin-treated wild-type dimer. These results indicate that the VE-cadherin binding site in fibrin includes NH2-terminal regions of both fibrin beta-chains, that His16 and Arg17 are critical for the binding, and that the third and/or fourth extracellular domains of VE-cadherin are required for the binding to occur.

  15. Software for genome mapping by fingerprinting techniques.

    PubMed

    Sulston, J; Mallett, F; Staden, R; Durbin, R; Horsnell, T; Coulson, A

    1988-03-01

    A genome mapping package has been developed for reading and assembling data from clones analysed by restriction enzyme fragmentation and polyacrylamide gel electrophoresis. The package comprises: data entry; matching; assembly; statistical analysis; modelling. Data entry can be either manual or by a semiautomatic system based on a scanning densitometer. The primary emphasis in the analytical routines is on flexibility and interactive convenience, so that the operator has full knowledge of and control over the growing map, but a variety of automatic options are included. The package continually grows to meet the needs of the Caenorhabditis project.

  16. Analyzing thematic maps and mapping for accuracy

    USGS Publications Warehouse

    Rosenfield, G.H.

    1982-01-01

    Two problems which exist while attempting to test the accuracy of thematic maps and mapping are: (1) evaluating the accuracy of thematic content, and (2) evaluating the effects of the variables on thematic mapping. Statistical analysis techniques are applicable to both these problems and include techniques for sampling the data and determining their accuracy. In addition, techniques for hypothesis testing, or inferential statistics, are used when comparing the effects of variables. A comprehensive and valid accuracy test of a classification project, such as thematic mapping from remotely sensed data, includes the following components of statistical analysis: (1) sample design, including the sample distribution, sample size, size of the sample unit, and sampling procedure; and (2) accuracy estimation, including estimation of the variance and confidence limits. Careful consideration must be given to the minimum sample size necessary to validate the accuracy of a given. classification category. The results of an accuracy test are presented in a contingency table sometimes called a classification error matrix. Usually the rows represent the interpretation, and the columns represent the verification. The diagonal elements represent the correct classifications. The remaining elements of the rows represent errors by commission, and the remaining elements of the columns represent the errors of omission. For tests of hypothesis that compare variables, the general practice has been to use only the diagonal elements from several related classification error matrices. These data are arranged in the form of another contingency table. The columns of the table represent the different variables being compared, such as different scales of mapping. The rows represent the blocking characteristics, such as the various categories of classification. The values in the cells of the tables might be the counts of correct classification or the binomial proportions of these counts divided by

  17. Noise Mapping and Annoyance.

    PubMed

    Knauss, D.

    2002-01-01

    The EC has published a Green Paper on noise policy in the EU and has issued a directive on the assessment and reduction of environmental noise. This directive will make noise mapping mandatory for cities with at least 250.000 inhabitants. Due to the development in computer technology it is possible to calculate noise maps for large urban areas using the available data on buildings, ground profile, road and rail traffic. Examples for noise mapping are Birmingham (GB), Linz (A) and various German cities. Based on noise maps and empirical data on the correlation between annoyance and noise levels annoyance maps for different sources (rail, road, aircraft) can be calculated. Under the assumption that the annoyance for the different sources are only weakly correlated, a combined annoyance map can be calculated. In a second step using the distribution of the population the actual number of annoyed people can be evaluated. This analysis can be used, for example, to identify noise hot spots and to assess the impact of major traffic projects - roads, airports- on the noise situation as well as the impact on the population. Furthermore, the combined annoyance maps can be used to investigate on health effects and to check whether or not empirical correlations between annoyance and noise levels are sufficiently correct.

  18. Color on emergency mapping

    NASA Astrophysics Data System (ADS)

    Jiang, Lili; Qi, Qingwen; Zhang, An

    2007-06-01

    There are so many emergency issues in our daily life. Such as typhoons, tsunamis, earthquake, fires, floods, epidemics, etc. These emergencies made people lose their lives and their belongings. Every day, every hour, even every minute people probably face the emergency, so how to handle it and how to decrease its hurt are the matters people care most. If we can map it exactly before or after the emergencies; it will be helpful to the emergency researchers and people who live in the emergency place. So , through the emergency map, before emergency is occurring we can predict the situation, such as when and where the emergency will be happen; where people can refuge, etc. After disaster, we can also easily assess the lost, discuss the cause and make the lost less. The primary effect of mapping is offering information to the people who care about the emergency and the researcher who want to study it. Mapping allows the viewers to get a spatial sense of hazard. It can also provide the clues to study the relationship of the phenomenon in emergency. Color, as the basic element of the map, it can simplify and clarify the phenomenon. Color can also affects the general perceptibility of the map, and elicits subjective reactions to the map. It is to say, structure, readability, and the reader's psychological reactions can be affected by the use of color.

  19. Coastal mapping handbook

    USGS Publications Warehouse

    ,; ,; Ellis, Melvin Y.

    1978-01-01

    Passage of the Coastal Zone Management Act of 1972 focused attention on the Nation's coastal land and water areas. As plans for more effective management of the coastal zone evolved, it soon became apparent that improved maps and charts of these areas were needed. This handbook was prepared with the requirements of the entire coastal community in mind, giving greatest attention to the needs of coastal zone managers and planners at the State and local levels. Its principal objective is to provide general information and guidance; it is neither a textbook nor a technical manual, but rather a primer on coastal mapping. This handbook should help planners and managers of coastal programs to determine their mapping requirements, select the best maps and charts for their particular needs, and to deal effectively with personnel who gather data and prepare maps. The sections on "Sources of Assistance and Advice" and "Product and Data Sources" should be especially useful to all involved in mapping the coastal zone. Brief summaries of the mapping efforts of several State coastal zone management programs are included. "Future outlook" discusses anticipated progress and changes in mapping procedures and techniques. Illustrations are inserted, where appropriate, to illustrate the products and equipment discussed. Because of printing restrictions, the colors in map illustrations may vary from those in the original publication. The appendixes include substantial material which also should be of interest. In addition a glossary and an index are included to provide easy and quick access to the terms and concepts used in the text. For those interested in more technical detail than is provided in this handbook, the "Selected references" will be useful. Also, the publications of the professional societies listed in appendix 4 will provide technical information in detail.

  20. IκB kinase-induced interaction of TPL-2 kinase with 14-3-3 is essential for Toll-like receptor activation of ERK-1 and -2 MAP kinases

    PubMed Central

    Ben-Addi, Abduelhakem; Mambole-Dema, Agnes; Brender, Christine; Martin, Stephen R.; Janzen, Julia; Kjaer, Sven; Smerdon, Stephen J.; Ley, Steven C.

    2014-01-01

    The MEK-1/2 kinase TPL-2 is critical for Toll-like receptor activation of the ERK-1/2 MAP kinase pathway during inflammatory responses, but it can transform cells following C-terminal truncation. IκB kinase (IKK) complex phosphorylation of the TPL-2 C terminus regulates full-length TPL-2 activation of ERK-1/2 by a mechanism that has remained obscure. Here, we show that TPL-2 Ser-400 phosphorylation by IKK and TPL-2 Ser-443 autophosphorylation cooperated to trigger TPL-2 association with 14-3-3. Recruitment of 14-3-3 to the phosphorylated C terminus stimulated TPL-2 MEK-1 kinase activity, which was essential for TPL-2 activation of ERK-1/2. The binding of 14-3-3 to TPL-2 was also indispensible for lipopolysaccharide-induced production of tumor necrosis factor by macrophages, which is regulated by TPL-2 independently of ERK-1/2 activation. Our data identify a key step in the activation of TPL-2 signaling and provide a mechanistic insight into how C-terminal deletion triggers the oncogenic potential of TPL-2 by rendering its kinase activity independent of 14-3-3 binding. PMID:24912162

  1. Automatic cloud cover mapping.

    NASA Technical Reports Server (NTRS)

    Strong, J. P., III; Rosenfeld, A.

    1971-01-01

    A method of converting a picture into a 'cartoon' or 'map' whose regions correspond to differently textured regions is described. Texture edges in the picture are detected, and solid regions surrounded by these (usually broken) edges are 'colored in' using a propagation process. The resulting map is cleaned by comparing the region colors with the textures of the corresponding regions in the picture, and also by merging some regions with others according to criteria based on topology and size. The method has been applied to the construction of cloud cover maps from cloud cover pictures obtained by satellites.

  2. Mapping the Baby Universe

    NASA Technical Reports Server (NTRS)

    Wanjek, Christopher

    2003-01-01

    In June, NASA plans to launch the Microwave Anisotropy Probe (MAP) to survey the ancient radiation in unprecedented detail. MAP will map slight temperature fluctuations within the microwave background that vary by only 0.00001 C across a chilly radiation that now averages 2.73 C above absolute zero. The temperature differences today point back to density differences in the fiery baby universe, in which there was a little more matter here and a little less matter there. Areas of slightly enhanced density had stronger gravity than low-density areas. The high-density areas pulled back on the background radiation, making it appear slightly cooler in those directions.

  3. Mapping the Interaction of B Cell Leukemia 3 (BCL-3) and Nuclear Factor κB (NF-κB) p50 Identifies a BCL-3-mimetic Anti-inflammatory Peptide*

    PubMed Central

    Collins, Patricia E.; Grassia, Gianluca; Colleran, Amy; Kiely, Patrick A.; Ialenti, Armando; Maffia, Pasquale; Carmody, Ruaidhrí J.

    2015-01-01

    The NF-κB transcriptional response is tightly regulated by a number of processes including the phosphorylation, ubiquitination, and subsequent proteasomal degradation of NF-κB subunits. The IκB family protein BCL-3 stabilizes a NF-κB p50 homodimer·DNA complex through inhibition of p50 ubiquitination. This complex inhibits the binding of the transcriptionally active NF-κB subunits p65 and c-Rel on the promoters of NF-κB target genes and functions to suppress inflammatory gene expression. We have previously shown that the direct interaction between p50 and BCL-3 is required for BCL-3-mediated inhibition of pro-inflammatory gene expression. In this study we have used immobilized peptide array technology to define regions of BCl-3 that mediate interaction with p50 homodimers. Our data show that BCL-3 makes extensive contacts with p50 homodimers and in particular with ankyrin repeats (ANK) 1, 6, and 7, and the N-terminal region of Bcl-3. Using these data we have designed a BCL-3 mimetic peptide based on a region of the ANK1 of BCL-3 that interacts with p50 and shares low sequence similarity with other IκB proteins. When fused to a cargo carrying peptide sequence this BCL-3-derived peptide, but not a mutated peptide, inhibited Toll-like receptor-induced cytokine expression in vitro. The BCL-3 mimetic peptide was also effective in preventing inflammation in vivo in the carrageenan-induced paw edema mouse model. This study demonstrates that therapeutic strategies aimed at mimicking the functional activity of BCL-3 may be effective in the treatment of inflammatory disease. PMID:25922067

  4. Mapping Protein–Protein Interactions of the Resistance-Related Bacterial Zeta Toxin–Epsilon Antitoxin Complex (ε2ζ2) with High Affinity Peptide Ligands Using Fluorescence Polarization

    PubMed Central

    Fernández-Bachiller, María Isabel; Brzozowska, Iwona; Odolczyk, Norbert; Zielenkiewicz, Urszula; Zielenkiewicz, Piotr; Rademann, Jörg

    2016-01-01

    Toxin–antitoxin systems constitute a native survival strategy of pathogenic bacteria and thus are potential targets of antibiotic drugs. Here, we target the Zeta–Epsilon toxin–antitoxin system, which is responsible for the stable maintenance of certain multiresistance plasmids in Gram-positive bacteria. Peptide ligands were designed on the basis of the ε2ζ2 complex. Three α helices of Zeta forming the protein–protein interaction (PPI) site were selected and peptides were designed conserving the residues interacting with Epsilon antitoxin while substituting residues binding intramolecularly to other parts of Zeta. Designed peptides were synthesized with an N-terminal fluoresceinyl-carboxy-residue for binding assays and provided active ligands, which were used to define the hot spots of the ε2ζ2 complex. Further shortening and modification of the binding peptides provided ligands with affinities <100 nM, allowing us to determine the most relevant PPIs and implement a robust competition binding assay. PMID:27438853

  5. Geological mapping goes 3-D in response to societal needs

    USGS Publications Warehouse

    Thorleifson, H.; Berg, R.C.; Russell, H.A.J.

    2010-01-01

    The transition to 3-D mapping has been made possible by technological advances in digital cartography, GIS, data storage, analysis, and visualization. Despite various challenges, technological advancements facilitated a gradual transition from 2-D maps to 2.5-D draped maps to 3-D geological mapping, supported by digital spatial and relational databases that can be interrogated horizontally or vertically and viewed interactively. Challenges associated with data collection, human resources, and information management are daunting due to their resource and training requirements. The exchange of strategies at the workshops has highlighted the use of basin analysis to develop a process-based predictive knowledge framework that facilitates data integration. Three-dimensional geological information meets a public demand that fills in the blanks left by conventional 2-D mapping. Two-dimensional mapping will, however, remain the standard method for extensive areas of complex geology, particularly where deformed igneous and metamorphic rocks defy attempts at 3-D depiction.

  6. MAPPING IN MICRONESIA.

    USGS Publications Warehouse

    Olsen, Randle W.; Swinnerton, J.R.

    1984-01-01

    The U. S. Geological Survey has recently completed a series of new topographic maps of Micronesia in cooperation with the Trust Territory of the Pacific Islands, the Federal agency administering the islands. Monocolor 1:10,000-scale manuscripts were compiled, from which 1:25,000-scale metric quadrangles were derived with symbology consistent with USGS quadrangle mapping. The publication of these new maps coincides with the impending political changes resulting from self-determination referendums held in Micronesia. Local sources have helped considerably with field logistics and resolution of geographic name controversies. Technical aspects of this project included development of tropical feature symbology, location of cadastral subdivisions and associated boundaries and mapping of many outlying coral reefs.

  7. Vitiligo road map.

    PubMed

    Lee, Brian W; Schwartz, Robert A; Hercogová, Jana; Valle, Yan; Lotti, Torello M

    2012-01-01

    Vitiligo is a depigmenting disorder stemming from melanocyte loss or dysfunction. It has a complex, multifaceted etiology. We constructed a "vitiligo road map," consisting of basic science, clinical, and treatment components, in order to better portray our current understanding of vitiligo pathogenesis and reflect upon novel biomarkers and therapeutic targets for future research. The melanocyte map elaborates on the molecular processes and intracellular signaling pathways initiated by various external autocrine/paracrine factors in representing normal melanocyte homeostatic functions modulating its viability, proliferation, differentiation, dendricity, migration, and melanogenic processes. This vitiligo map identifies known inducers/triggers of vitiligo onset and progression that cultivate a microenvironment for melanocyte disappearance, real or functional. This map describes the molecular mechanisms of currently utilized clinical and experimental treatments of vitiligo that facilitate repigmentation.

  8. Map of physics

    NASA Astrophysics Data System (ADS)

    2008-10-01

    Based on bibliometric data from information-services provider Thomson Reuters, this map reveals "core areas" of physics, shown as coloured circular nodes, and the relationship between these subdisciplines, shown as lines.

  9. DAM - detection and mapping

    NASA Technical Reports Server (NTRS)

    1977-01-01

    Integrated set of manual procedures, computer programs, and graphic devices processes multispectral scanner data from orbiting Landsat into precisely registered and formatted maps of surface water and other resources at variety of scales, sheet formats, and tick intervals.

  10. Dating the Vinland Map

    ScienceCinema

    None

    2016-07-12

    Scientists from Brookhaven National Laboratory, the University of Arizona, and the Smithsonian Institution used carbon-dating technology to determine the age of a controversial parchment that might be the first-ever map of North America.

  11. Dating the Vinland Map

    SciTech Connect

    2013-01-04

    Scientists from Brookhaven National Laboratory, the University of Arizona, and the Smithsonian Institution used carbon-dating technology to determine the age of a controversial parchment that might be the first-ever map of North America.

  12. Automated mapping system patented

    NASA Astrophysics Data System (ADS)

    A patent on a satellite system dubbed Mapsat, which would be able to map the earth from space and would thereby reduce the time and cost of mapping on a smaller scale, has been issued to the U.S. Geological Survey.The Mapsat concept, invented by Alden F. Colvocoresses, a research cartographer at the USGS National Center, is based on Landsat technology but uses sensors that acquire higher-resolution image data in either a stereo or monoscopic mode. Stereo data can be processed relatively simply with automation to produce images for interpretation or to produce maps. Monoscopic and multispectral data can be processed in a computer to derive information on earth resources. Ground control, one of the most expensive phases of mapping, could be kept to a minimum.

  13. enceladus_stress_map

    NASA Video Gallery

    This is a map of the changing stress on the surface of Enceladus' icy crust from the wobble and gravitational tides. Blue lines show the direction of forces pulling the crust apart, and red lines s...

  14. Air Data - Concentration Map

    EPA Pesticide Factsheets

    Make a map of daily concentrations over several days. The daily air quality can be displayed in terms of the Air Quality Index or in concentration ranges for certain PM species like organic carbon, nitrates, and sulfates.

  15. Spinal Cord Injury Map

    MedlinePlus

    ... Counseling About Blog Facing Disability Jeff Shannon Donate Spinal Cord Injury Map Loss of function depends on what ... control. Learn more about spinal cord injuries. A spinal cord injury affects the entire family FacingDisability is designed ...

  16. Barrier Island Hazard Mapping.

    ERIC Educational Resources Information Center

    Pilkey, Orrin H.; Neal, William J.

    1980-01-01

    Describes efforts to evaluate and map the susceptibility of barrier islands to damage from storms, erosion, rising sea levels and other natural phenomena. Presented are criteria for assessing the safety and hazard potential of island developments. (WB)

  17. The wavy Mutation Maps to the Inositol 1,4,5-Trisphosphate 3-Kinase 2 (IP3K2) Gene of Drosophila and Interacts with IP3R to Affect Wing Development.

    PubMed

    Dean, Derek M; Maroja, Luana S; Cottrill, Sarah; Bomkamp, Brent E; Westervelt, Kathleen A; Deitcher, David L

    2015-11-27

    Inositol 1,4,5-trisphosphate (IP3) regulates a host of biological processes from egg activation to cell death. When IP3-specific receptors (IP3Rs) bind to IP3, they release calcium from the ER into the cytoplasm, triggering a variety of cell type- and developmental stage-specific responses. Alternatively, inositol polyphosphate kinases can phosphorylate IP3; this limits IP3R activation by reducing IP3 levels, and also generates new signaling molecules altogether. These divergent pathways draw from the same IP3 pool yet cause very different cellular responses. Therefore, controlling the relative rates of IP3R activation vs. phosphorylation of IP3 is essential for proper cell functioning. Establishing a model system that sensitively reports the net output of IP3 signaling is crucial for identifying the controlling genes. Here we report that mutant alleles of wavy (wy), a classic locus of the fruit fly Drosophila melanogaster, map to IP3 3-kinase 2 (IP3K2), a member of the inositol polyphosphate kinase gene family. Mutations in wy disrupt wing structure in a highly specific pattern. RNAi experiments using GAL4 and GAL80(ts) indicated that IP3K2 function is required in the wing discs of early pupae for normal wing development. Gradations in the severity of the wy phenotype provide high-resolution readouts of IP3K2 function and of overall IP3 signaling, giving this system strong potential as a model for further study of the IP3 signaling network. In proof of concept, a dominant modifier screen revealed that mutations in IP3R strongly suppress the wy phenotype, suggesting that the wy phenotype results from reduced IP4 levels, and/or excessive IP3R signaling.

  18. Maps and (no) Simulations

    NASA Astrophysics Data System (ADS)

    Forest, Etienne

    As the title suggests, I examine the role of maps in accelerator theory, conveniently leaving simulation out of the picture for lack of time and space. This is really a primer on the map-based "Courant Snyder" theory as independently proposed by Dragt's group (author included) and Turchetti's group at Bologna. Quite obviously it is viewed here from the author's own perspective and prejudices.

  19. Mapping the human genome

    SciTech Connect

    Annas, G.C.; Elias, S.

    1992-01-01

    This article is a review of the book Mapping the Human Genome: Using Law and Ethics as Guides, edited by George C. Annas and Sherman Elias. The book is a collection of essays on the subject of using ethics and laws as guides to justify human gene mapping. It addresses specific issues such problems related to eugenics, patents, insurance as well as broad issues such as the societal definitions of normality.

  20. Fundamentals of petroleum maps

    SciTech Connect

    Mc Elroy, D.P.

    1986-01-01

    It's a complete guide to the fundamentals of reading, using, and making petroleum maps. The topics covered are well spotting, lease posting, contouring, hanging cross sections, and ink drafting. This book not only tells the how of petroleum mapping, but it also tells the why to better understand the principles and techniques. The books does not teach ''drafting,'' but does describe the proper care and use of drafting equipment for those who are totally new to the task.

  1. Wind Resource Maps (Postcard)

    SciTech Connect

    Not Available

    2011-07-01

    The U.S. Department of Energy's Wind Powering America initiative provides high-resolution wind maps and estimates of the wind resource potential that would be possible from development of the available windy land areas after excluding areas unlikely to be developed. This postcard is a marketing piece that stakeholders can provide to interested parties; it will guide them to Wind Powering America's online wind energy resource maps.

  2. Mars Gravity Anomoly Map

    NASA Technical Reports Server (NTRS)

    2001-01-01

    This is a vertical gravity map of Mars color-coded in mgals based on radio tracking. Note correlations and lack of correlations with the Mars Orbiter Laser Altimeter (MOLA) global topography.

    This map was created using MGS data under the direction of Bill Sjogren, a member of the MGS Radio Science Team. The Radio Science Team is led by G. Leonard Tyler of Stanford University in Palo Alto, CA.

  3. Musician Map: visualizing music collaborations over time

    NASA Astrophysics Data System (ADS)

    Yim, Ji-Dong; Shaw, Chris D.; Bartram, Lyn

    2009-01-01

    In this paper we introduce Musician Map, a web-based interactive tool for visualizing relationships among popular musicians who have released recordings since 1950. Musician Map accepts search terms from the user, and in turn uses these terms to retrieve data from MusicBrainz.org and AudioScrobbler.net, and visualizes the results. Musician Map visualizes relationships of various kinds between music groups and individual musicians, such as band membership, musical collaborations, and linkage to other artists that are generally regarded as being similar in musical style. These relationships are plotted between artists using a new timeline-based visualization where a node in a traditional node-link diagram has been transformed into a Timeline-Node, which allows the visualization of an evolving entity over time, such as the membership in a band. This allows the user to pursue social trend queries such as "Do Hip-Hop artists collaborate differently than Rock artists".

  4. Mapping between parallel processor structures and programs

    NASA Technical Reports Server (NTRS)

    Ngai, Tin-Fook; Yan, Jerry C.; Mak, Victor W. K.; Flynn, Michael J.; Lundstrom, Stephen F.

    1987-01-01

    This paper reports some ongoing research efforts at Stanford in allocation of parallel processing resources. Both processor structures and program structures have their own characteristics. Resource allocation binds the two structures during program execution. The mapping problem determines what processor structure and program structure may be combined to obtain maximum speedup. Three approaches to this mapping problem are considered. Two important factors, granularity and interaction delay, are also considered. A new hierarchical approach to structure definition is outlined. Effective and efficient tools are necessary for the study of the mapping problem. A fast turn-around simulation environment developed for investigating partition strategies for distributed computations and a computationally efficient method to predict performance of parallel processor structures are described.

  5. Functional mapping of ontogeny in flowering plants.

    PubMed

    Zhao, Xiyang; Tong, Chunfa; Pang, Xiaoming; Wang, Zhong; Guo, Yunqian; Du, Fang; Wu, Rongling

    2012-05-01

    All organisms face the problem of how to perform a sequence of developmental changes and transitions during ontogeny. We revise functional mapping, a statistical model originally derived to map genes that determine developmental dynamics, to take into account the entire process of ontogenetic growth from embryo to adult and from the vegetative to reproductive phase. The revised model provides a framework that reconciles the genetic architecture of development at different stages and elucidates a comprehensive picture of the genetic control mechanisms of growth that change gradually from a simple to a more complex level. We use an annual flowering plant, as an example, to demonstrate our model by which to map genes and their interactions involved in embryo and postembryonic growth. The model provides a useful tool to study the genetic control of ontogenetic growth in flowering plants and any other organisms through proper modifications based on their biological characteristics.

  6. The National Map - Orthoimagery

    USGS Publications Warehouse

    Mauck, James; Brown, Kim; Carswell, William J.

    2009-01-01

    Orthorectified digital aerial photographs and satellite images of 1-meter (m) pixel resolution or finer make up the orthoimagery component of The National Map. The process of orthorectification removes feature displacements and scale variations caused by terrain relief and sensor geometry. The result is a combination of the image characteristics of an aerial photograph or satellite image and the geometric qualities of a map. These attributes allow users to: *Measure distance *Calculate areas *Determine shapes of features *Calculate directions *Determine accurate coordinates *Determine land cover and use *Perform change detection *Update maps The standard digital orthoimage is a 1-m or finer resolution, natural color or color infra-red product. Most are now produced as GeoTIFFs and accompanied by a Federal Geographic Data Committee (FGDC)-compliant metadata file. The primary source for 1-m data is the National Agriculture Imagery Program (NAIP) leaf-on imagery. The U.S. Geological Survey (USGS) utilizes NAIP imagery as the image layer on its 'Digital- Map' - a new generation of USGS topographic maps (http://nationalmap.gov/digital_map). However, many Federal, State, and local governments and organizations require finer resolutions to meet a myriad of needs. Most of these images are leaf-off, natural-color products at resolutions of 1-foot (ft) or finer.

  7. Global Water Maps

    NASA Astrophysics Data System (ADS)

    Maidment, D. R.; Salas, F.; Teng, W. L.

    2013-12-01

    A global water map is a coverage of the earth that describes the state of water circulation in a phase of the hydrologic cycle. This information can be published as a map showing the state of the water variable at a particular point in time, or charted as a time series showing the temporal variation of that variable at a point in space. Such maps can be created through the NASA Land Data Assimilation System (LDAS) for precipitation, evaporation, soil moisture, and other parameters describing the vertical exchange of water between the land and atmosphere, through a combination of observations and simulation modeling. Point observations of water variables such as precipitation and streamflow are carried out by local hydrologic measurement agencies associated with a particular area. These point observations are now being published as web services in the WaterML language and federated using the Global Earth Observing System of Systems to enable the publication of water observations maps for these variables. By combining water maps derived from LDAS with those from federated point observations, a deeper understanding of global water conditions and movement can be created. This information should be described in a Hydrologic Data Book that specifies the information content of each of these map layers so that they can be appropriately used and combined.

  8. Creating Heliophysics Concept Maps

    NASA Astrophysics Data System (ADS)

    Ali, N. A.; Peticolas, L. M.; Paglierani, R.; Mendez, B. J.

    2011-12-01

    The Center for Science Education at University of California Berkeley's Space Sciences Laboratory is creating concept maps for Heliophysics and would like to get input from scientists. The purpose of this effort is to identify key concepts related to Heliophysics and map their progression to show how students' understanding of Heliophysics might develop from Kindergarten through higher education. These maps are meant to tie into the AAAS Project 2061 Benchmarks for Scientific Literacy and National Science Education Standards. It is hoped that the results of this effort will be useful for curriculum designers developing Heliophysics-related curriculum materials and classroom teachers using Heliophysics materials. The need for concept maps was identified as a result of product analysis undertaken by the NASA Heliophysics Forum Team. The NASA Science Education and Public Outreach Forums have as two of their goals to improve the characterization of the contents of the Science Mission Directorate and Public Outreach (SMD E/PO) portfolio (Objective 2.1) and assist SMD in addressing gaps in the portfolio of SMD E/PO products and project activities (Objective 2.2). An important part of this effort is receiving feedback from solar scientists regarding the inclusion of key concepts and their progression in the maps. This session will introduce the draft concept maps and elicit feedback from scientists.

  9. Geologic Mapping of Mars

    NASA Astrophysics Data System (ADS)

    Price, Katherine H.

    1998-05-01

    Planetary geologic mapping involves integrating a terrestrial-based understanding of surface and subsurface processes and mapping principles to investigate scientific questions. Mars mappers must keep in mind that physical processes, such as wind and flowing water on Mars, are or were different from terrestrial processes because the planetary atmospheres have changed differently over time. Geologic mapping of Mars has traditionally been done by hand using overlays on photomosaics of Viking Orbiter and Mariner images. Photoclinometry and shadow measurements have been used to determine elevations, and the distribution and size of craters have been used to determine the relative ages of surfaces- more densely cratered surfaces are older. Some mappers are now using computer software (ranging from Photoshop to ArcInfo) to facilitate mapping, though their applications must be carefully executed so that registration of the images remains true. Images and some mapping results are now available on the internet, and new data from recent missions to Mars (Pathfinder and Surveyor) will offer clarifying information to mapping efforts. This paper consists chiefly of pictures and diagrams.

  10. Mars synthetic topographic mapping

    USGS Publications Warehouse

    Wu, S.S.C.

    1978-01-01

    Topographic contour maps of Mars are compiled by the synthesis of data acquired from various scientific experiments of the Mariner 9 mission, including S-band radio-occulation, the ultraviolet spectrometer (UVS), the infrared radiometer (IRR), the infrared interferometer spectrometer (IRIS) and television imagery, as well as Earth-based radar information collected at Goldstone, Haystack, and Arecibo Observatories. The entire planet is mapped at scales of 1:25,000,000 and 1:25,000,000 using Mercator, Lambert, and polar stereographic map projections. For the computation of map projections, a biaxial spheroid figure is adopted. The semimajor and semiminor axes are 3393.4 and 3375.7 km, respectively, with a polar flattening of 0.0052. For the computation of elevations, a topographic datum is defined by a gravity field described in terms of spherical harmonics of fourth order and fourth degree combined with a 6.1-mbar occulation pressure surface. This areoid can be approximated by a triaxial ellipsoid with semimajor axes of A = 3394.6 km and B = 3393.3 km and a semiminor axis of C = 3376.3 km. The semimajor axis A intersects the Martian surface at longitude 105??W. The dynamic flattening of Mars is 0.00525. The contour intercal of the maps is 1 km. For some prominent features where overlapping pictures from Mariner 9 are available, local contour maps at relatively larger scales were also compiled by photogrammetric methods on stereo plotters. ?? 1978.

  11. Development of base maps' role in soil mapping

    NASA Astrophysics Data System (ADS)

    Miller, Brad; Brevik, Eric

    2014-05-01

    One of the ultimate goals of soil science is the production of accurate soil maps, but historically these thematic maps have relied upon base maps for positional reference and later for parameters that help predict soil properties. This presentation reviews the history of base maps and the dependence of soil mapping on them. The availability of geographic technology for producing these base maps has constrained and directed the geographic study of soil. A lack of accurate methods for determining location limited early geographic description of soils to narratives. The availability of accurate topographic maps in the late 18th century, fueled by governments' interests in documenting national boundaries and popular interest in world atlases, provided the first base maps for soil geographers. These soil maps primarily used the topographic maps as a spatial reference onto which the thematic details were drawn. Due to the late start of a systematic topographic survey in the United States, early Soil Survey maps depended upon plat maps for spatial reference. The adoption of aerial photographs in the process of soil mapping increased the role of base maps as predictive parameters. In the current geospatial revolution, global positioning systems and geographic information systems have nearly replaced the need for base maps to provide spatial reference. Today, base maps are more likely to be used as parameters in landscape models for predicting the spatial distribution of soil properties and classes. As model parameters for digital soil maps, base maps constitute the library of predictive variables and constrain the supported resolution of the soil map. This change in the relationship between base maps and the soil map is a paradigm shift that affects fundamental definitions of geography, such as scale, resolution, and detectable features. These concepts are the essential tools used to study the spatial characteristics of Earth Systems.

  12. Geologic Mapping of Vesta

    NASA Technical Reports Server (NTRS)

    Yingst, R. A.; Mest, S. C.; Berman, D. C.; Garry, W. B.; Williams, D. A.; Buczkowski, D.; Jaumann, R.; Pieters, C. M.; De Sanctis, M. C.; Frigeri, A.; Le Corre, L.; Preusker, F.; Raymond, C. A.; Reddy, V.; Russell, C. T.; Roatsch, T.; Schenk, P. M.

    2014-01-01

    We report on a preliminary global geologic map of Vesta, based on data from the Dawn spacecraft's High- Altitude Mapping Orbit (HAMO) and informed by Low-Altitude Mapping Orbit (LAMO) data. This map is part of an iterative mapping effort; the geologic map has been refined with each improvement in resolution. Vesta has a heavily-cratered surface, with large craters evident in numerous locations. The south pole is dominated by an impact structure identified before Dawn's arrival. Two large impact structures have been resolved: the younger, larger Rheasilvia structure, and the older, more degraded Veneneia structure. The surface is also characterized by a system of deep, globe-girdling equatorial troughs and ridges, as well as an older system of troughs and ridges to the north. Troughs and ridges are also evident cutting across, and spiraling arcuately from, the Rheasilvia central mound. However, no volcanic features have been unequivocally identified. Vesta can be divided very broadly into three terrains: heavily-cratered terrain; ridge-and-trough terrain (equatorial and northern); and terrain associated with the Rheasilvia crater. Localized features include bright and dark material and ejecta (some defined specifically by color); lobate deposits; and mass-wasting materials. No obvious volcanic features are evident. Stratigraphy of Vesta's geologic units suggests a history in which formation of a primary crust was followed by the formation of impact craters, including Veneneia and the associated Saturnalia Fossae unit. Formation of Rheasilvia followed, along with associated structural deformation that shaped the Divalia Fossae ridge-and-trough unit at the equator. Subsequent impacts and mass wasting events subdued impact craters, rims and portions of ridge-and-trough sets, and formed slumps and landslides, especially within crater floors and along crater rims and scarps. Subsequent to the formation of Rheasilvia, discontinuous low-albedo deposits formed or were

  13. Geologic mapping of Vesta

    NASA Astrophysics Data System (ADS)

    Yingst, R. A.; Mest, S. C.; Berman, D. C.; Garry, W. B.; Williams, D. A.; Buczkowski, D.; Jaumann, R.; Pieters, C. M.; De Sanctis, M. C.; Frigeri, A.; Le Corre, L.; Preusker, F.; Raymond, C. A.; Reddy, V.; Russell, C. T.; Roatsch, T.; Schenk, P. M.

    2014-11-01

    We report on a preliminary global geologic map of Vesta, based on data from the Dawn spacecraft's High-Altitude Mapping Orbit (HAMO) and informed by Low-Altitude Mapping Orbit (LAMO) data. This map is part of an iterative mapping effort; the geologic map has been refined with each improvement in resolution. Vesta has a heavily-cratered surface, with large craters evident in numerous locations. The south pole is dominated by an impact structure identified before Dawn's arrival. Two large impact structures have been resolved: the younger, larger Rheasilvia structure, and the older, more degraded Veneneia structure. The surface is also characterized by a system of deep, globe-girdling equatorial troughs and ridges, as well as an older system of troughs and ridges to the north. Troughs and ridges are also evident cutting across, and spiraling arcuately from, the Rheasilvia central mound. However, no volcanic features have been unequivocally identified. Vesta can be divided very broadly into three terrains: heavily-cratered terrain; ridge-and-trough terrain (equatorial and northern); and terrain associated with the Rheasilvia crater. Localized features include bright and dark material and ejecta (some defined specifically by color); lobate deposits; and mass-wasting materials. No obvious volcanic features are evident. Stratigraphy of Vesta's geologic units suggests a history in which formation of a primary crust was followed by the formation of impact craters, including Veneneia and the associated Saturnalia Fossae unit. Formation of Rheasilvia followed, along with associated structural deformation that shaped the Divalia Fossae ridge-and-trough unit at the equator. Subsequent impacts and mass wasting events subdued impact craters, rims and portions of ridge-and-trough sets, and formed slumps and landslides, especially within crater floors and along crater rims and scarps. Subsequent to the formation of Rheasilvia, discontinuous low-albedo deposits formed or were

  14. Comparative gene map of hypertriglyceridaemia.

    PubMed

    Seda, O

    2004-01-01

    Elevated triglyceride levels in the circulation are currently recognized as an independent risk factor for coronary artery disease. Hypertriglyceridaemia represents one of the attributes of metabolic syndrome and is present in the most common genetic dyslipidaemia, the familial combined hyperlipidaemia. The factual concentration of triglycerides is determined by a complex interaction of environmental and genetic components. Deeper understanding of the causative gene variants and the mode of their participation in the pathogenesis of hypertriglyceridaemia is required for devising efficient therapy of hypertriglyceridaemia. This is the first systematic review of linkage and candidate gene studies dealing with the dissection of genetic determinants of (hyper)triglyceridaemia in human and two major mammalian model species, mouse and rat. Based on the merged sets of data, a synthetic view of the genetic component of triglyceridaemia, the "hypertriglyceridaemia gene map", is presented.

  15. Charting the map of life.

    PubMed Central

    Schmidt, C W

    2001-01-01

    Scientists expect that mapping the human genome will lead to a host of innovations in biology and research. For example, it may become possible to use DNA microarrays to accurately diagnose cancer and infectious disease subtypes and to predict clinical outcomes. Scientists might also use the genome to look at the interactions of the environment, genetic makeup, and toxic exposures, including the ability of certain beneficial genes to detoxify the body and resist disease. But despite the great potential of the field of genomics, scientists caution that public expectations need to be tempered by reality. People are as much a product of their environment as they are of their genes, say experts, and to suggest that genetics is the sole determinant that defines humans as individuals stretches the science beyond the current data. PMID:11171541

  16. Validation of Satellite Snow Cover Maps in North America and Norway

    NASA Technical Reports Server (NTRS)

    Hall, Dorothy K.; Solberg, Rune; Riggs, George A.

    2002-01-01

    Satellite-derived snow maps from NASA's Earth Observing System Moderate Resolution Imaging Spectroradiometer (MODIS) have been produced since February of 2000. The global maps are available daily at 500-m resolution, and at a climate-modeling grid (CMG) resolution of 1/20 deg (approximately 5.6 km). We compared the 8-day composite CMG MODIS-derived global maps from November 1,2001, through March 21,2002, and daily CMG maps from February 26 - March 5,2002, with National Oceanic and Atmospheric Administration (NOAA) Interactive Multisensor Snow and Ice Mapping System (IMS) 25-km resolution maps for North America. For the Norwegian study area, national snow maps, based on synoptic measurements as well as visual interpretation of AVHRR images, published by the Det Norske Meteorologiske Institutt (Norwegian Meteorological Institute) (MI) maps, as well as Landsat ETM+ images were compared with the MODIS maps. The MODIS-derived maps agreed over most areas with the IMS or MI maps, however, there are important areas of disagreement between the maps, especially when the 8-day composite maps were used. It is concluded that MODIS daily CMG maps should be studied for validation purposes rather than the 8-day composite maps, despite the limitations imposed by cloud obscuration when using the daily maps.

  17. Mapping Murine Corneal Neovascularization and Weight Loss Virulence Determinants in the Herpes Simplex Virus 1 Genome and the Detection of an Epistatic Interaction between the UL and IRS/US Regions

    PubMed Central

    Lee, Kyubin; Kolb, Aaron W.; Larsen, Inna; Craven, Mark

    2016-01-01

    ABSTRACT Herpes simplex virus 1 (HSV-1) most commonly causes recrudescent labial ulcers; however, it is also the leading cause of infectious blindness in developed countries. Previous research in animal models has demonstrated that the severity of HSV-1 ocular disease is influenced by three main factors: host innate immunity, host immune response, and viral strain. We have previously shown that mixed infection with two avirulent HSV-1 strains (OD4 and CJ994) results in recombinants with a wide range of ocular disease phenotype severity. Recently, we developed a quantitative trait locus (QTL)-based computational approach (vQTLmap) to identify viral single nucleotide polymorphisms (SNPs) predicted to influence the severity of the ocular disease phenotypes. We have now applied vQTLmap to identify HSV-1 SNPs associated with corneal neovascularization and mean peak percentage weight loss (MPWL) using 65 HSV-1 OD4-CJ994 recombinants. The vQTLmap analysis using Random Forest for neovascularization identified phenotypically meaningful nonsynonymous SNPs in the ICP4, UL41 (VHS), UL42, UL46 (VP11/12), UL47 (VP13/14), UL48 (VP22), US3, US4 (gG), US6 (gD), and US7 (gI) coding regions. The ICP4 gene was previously identified as a corneal neovascularization determinant, validating the vQTLmap method. Further analysis detected an epistatic interaction for neovascularization between a segment of the unique long (UL) region and a segment of the inverted repeat short (IRS)/unique short (US) region. Ridge regression was used to identify MPWL-associated nonsynonymous SNPs in the UL1 (gL), UL2, UL4, UL49 (VP22), UL50, and ICP4 coding regions. The data provide additional insights into virulence gene and epistatic interaction discovery in HSV-1. IMPORTANCE Herpes simplex virus 1 (HSV-1) typically causes recurrent cold sores; however, it is also the leading source of infectious blindness in developed countries. Corneal neovascularization is critical for the progression of blinding ocular

  18. Novice to Expert Cognition During Geologic Bedrock Mapping

    NASA Astrophysics Data System (ADS)

    Petcovic, H. L.; Libarkin, J.; Hambrick, D. Z.; Baker, K. M.; Elkins, J. T.; Callahan, C. N.; Turner, S.; Rench, T. A.; LaDue, N.

    2011-12-01

    Bedrock geologic mapping is a complex and cognitively demanding task. Successful mapping requires domain-specific content knowledge, visuospatial ability, navigation through the field area, creating a mental model of the geology that is consistent with field data, and metacognition. Most post-secondary geology students in the United States receive training in geologic mapping, however, not much is known about the cognitive processes that underlie successful bedrock mapping, or about how these processes change with education and experience. To better understand cognition during geologic mapping, we conducted a 2-year research study in which 67 volunteers representing a range from undergraduate sophomore to 20+ years professional experience completed a suite of cognitive measures plus a 1-day bedrock mapping task in the Rocky Mountains, Montana, USA. In addition to participants' geologic maps and field notes, the cognitive suite included tests and questionnaires designed to measure: (1) prior geologic experience, via a self-report survey; (2) geologic content knowledge, via a modified version of the Geoscience Concept Inventory; (3) visuospatial ability, working memory capacity, and perceptual speed, via paper-and-pencil and computerized tests; (4) use of space and time during mapping via GPS tracking; and (5) problem-solving in the field via think-aloud audio logs during mapping and post-mapping semi-structured interviews. Data were examined for correlations between performance on the mapping task and other measures. We found that both geological knowledge and spatial visualization ability correlated positively with accuracy in the field mapping task. More importantly, we found a Visuospatial Ability × Geological Knowledge interaction, such that visuospatial ability positively predicted mapping performance at low, but not high, levels of geological knowledge. In other words, we found evidence to suggest that visuospatial ability mattered for bedrock mapping for the

  19. Mechanistically based mapping of human cardiac fibrillation

    PubMed Central

    Zaman, Junaid A. B.

    2016-01-01

    Abstract The mechanisms underpinning human cardiac fibrillation remain elusive. In his 1913 paper ‘On dynamic equilibrium in the heart’, Mines proposed that an activation wave front could propagate repeatedly in a circle, initiated by a stimulus in the vulnerable period. While the dynamics of activation and recovery are central to cardiac fibrillation, these physiological data are rarely used in clinical mapping. Fibrillation is a rapid irregular rhythm with spatiotemporal disorder resulting from two fundamental mechanisms – sources in preferred cardiac regions or spatially diffuse self‐sustaining activity, i.e. with no preferred source. On close inspection, however, this debate may also reflect mapping technique. Fibrillation is initiated from triggers by regional dispersion in repolarization, slow conduction and wavebreak, then sustained by non‐uniform interactions of these mechanisms. Notably, optical mapping of action potentials in atrial fibrillation (AF) show spiral wave sources (rotors) in nearly all studies including humans, while most traditional electrogram analyses of AF do not. Techniques may diverge in fibrillation because electrograms summate non‐coherent waves within an undefined field whereas optical maps define waves with a visually defined field. Also fibrillation operates at the limits of activation and recovery, which are well represented by action potentials while fibrillatory electrograms poorly represent repolarization. We conclude by suggesting areas for study that may be used, until such time as optical mapping is clinically feasible, to improve mechanistic understanding and therapy of human cardiac fibrillation. PMID:26607671

  20. Statistical and computational challenges in physical mapping

    SciTech Connect

    Nelson, D.O.; Speed, T.P.

    1994-06-01

    One of the great success stories of modern molecular genetics has been the ability of biologists to isolate and characterize the genes responsible for serious inherited diseases like Huntington`s disease, cystic fibrosis, and myotonic dystrophy. Instrumental in these efforts has been the construction of so-called {open_quotes}physical maps{close_quotes} of large regions of human chromosomes. Constructing a physical map of a chromosome presents a number of interesting challenges to the computational statistician. In addition to the general ill-posedness of the problem, complications include the size of the data sets, computational complexity, and the pervasiveness of experimental error. The nature of the problem and the presence of many levels of experimental uncertainty make statistical approaches to map construction appealing. Simultaneously, however, the size and combinatorial complexity of the problem make such approaches computationally demanding. In this paper we discuss what physical maps are and describe three different kinds of physical maps, outlining issues which arise in constructing them. In addition, we describe our experience with powerful, interactive statistical computing environments. We found that the ability to create high-level specifications of proposed algorithms which could then be directly executed provided a flexible rapid prototyping facility for developing new statistical models and methods. The ability to check the implementation of an algorithm by comparing its results to that of an executable specification enabled us to rapidly debug both specification and implementation in an environment of changing needs.

  1. User-controlled mapping of significant literatures

    PubMed Central

    White, Howard D.; Lin, Xia; Buzydlowski, Jan W.; Chen, Chaomei

    2004-01-01

    We apply a version of our web-based literature-mapping system to PNAS for 1971-2002, as indexed by the National Library of Medicine and the Institute for Scientific Information. Given a single input term from a user, a medical subject heading, a cocited author, or a cocited journal, pnaslink rapidly displays views in which that term and the other 24 terms that most frequently co-occur with it in a bibliographic database are interrelated in ways suggesting fruitful combinations for document retrieval. The interrelationships are produced by two algorithms, pathfinder networks and Kohonen-style self-organizing maps. pnaslink displays are themselves interactive interfaces that can retrieve documents from digital libraries (e.g., PNAS Online). This style of visualizing knowledge domains is called “localized” because it does not attempt to map the indexing of literatures in full but concentrates on the top terms in an “associative thesaurus” reflecting user interests. It also permits swift remappings, as the user recognizes terms worth pursuing. pnaslink is illustrated with maps drawn from the literature of population genetics. Some comparative and evaluative comments are added, one from a domain expert indicating that the face validity of the system may be tempered by insufficient specificity in the indexing terms being mapped. PMID:15112665

  2. Elementary maps on nest algebras

    NASA Astrophysics Data System (ADS)

    Li, Pengtong

    2006-08-01

    Let , be algebras and let , be maps. An elementary map of is an ordered pair (M,M*) such that for all , . In this paper, the general form of surjective elementary maps on standard subalgebras of nest algebras is described. In particular, such maps are automatically additive.

  3. Genetic and physical map correlation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic and physical maps illustrate the arrangement of genes and DNA markers on a chromosome. The relative distances between positions on a genetic map are calculated using recombination frequencies while a physical map is based on the actual number of nucleotide pairs between loci. These maps ar...

  4. The Perfect Map

    NASA Astrophysics Data System (ADS)

    Suri, Veenu; Rauscher, Emily; Cowan, Nicolas B.

    2017-01-01

    Thermal phase curves and eclipses provide the best constraints on the atmospheric temperature and circulation of short-period planets. The temperature structure of a planet can be expressed as a sum of spherical harmonics. Each spherical harmonic has a corresponding harmonic light curve, which is a function of system geometry (orbital inclination, planet/star radius ratio, and orbital separation). Depending on system geometry, there may be significant degeneracies between harmonic light curves: very different maps may produce similar light curves. Here we use Principal Component Analysis (PCA) to identify and quantify these degeneracies. Starting from a set of harmonic light curves, we use PCA to calculate the set of orthonormal "eigen-light-curves". In addition, PCA determines the importance of every eigen-light-curve, telling us which components provide the most information. From these eigen-curves we can then reconstruct corresponding "eigen-maps". These eigen-light-curves and eigen-maps are the mathematically ideal basis set for inverting phase curve and eclipse data to create maps of a planet's emission. We determine how many eigen-maps can be fit to full-orbit light curves, as a function of photometric precision and system geometry.

  5. Prioritising Infectious Disease Mapping

    PubMed Central

    Pigott, David M.; Howes, Rosalind E.; Wiebe, Antoinette; Battle, Katherine E.; Golding, Nick; Gething, Peter W.; Dowell, Scott F.; Farag, Tamer H.; Garcia, Andres J.; Kimball, Ann M.; Krause, L. Kendall; Smith, Craig H.; Brooker, Simon J.; Kyu, Hmwe H.; Vos, Theo; Murray, Christopher J. L.; Moyes, Catherine L.; Hay, Simon I.

    2015-01-01

    Background Increasing volumes of data and computational capacity afford unprecedented opportunities to scale up infectious disease (ID) mapping for public health uses. Whilst a large number of IDs show global spatial variation, comprehensive knowledge of these geographic patterns is poor. Here we use an objective method to prioritise mapping efforts to begin to address the large deficit in global disease maps currently available. Methodology/Principal Findings Automation of ID mapping requires bespoke methodological adjustments tailored to the epidemiological characteristics of different types of diseases. Diseases were therefore grouped into 33 clusters based upon taxonomic divisions and shared epidemiological characteristics. Disability-adjusted life years, derived from the Global Burden of Disease 2013 study, were used as a globally consistent metric of disease burden. A review of global health stakeholders, existing literature and national health priorities was undertaken to assess relative interest in the diseases. The clusters were ranked by combining both metrics, which identified 44 diseases of main concern within 15 principle clusters. Whilst malaria, HIV and tuberculosis were the highest priority due to their considerable burden, the high priority clusters were dominated by neglected tropical diseases and vector-borne parasites. Conclusions/Significance A quantitative, easily-updated and flexible framework for prioritising diseases is presented here. The study identifies a possible future strategy for those diseases where significant knowledge gaps remain, as well as recognising those where global mapping programs have already made significant progress. For many conditions, potential shared epidemiological information has yet to be exploited. PMID:26061527

  6. Remote sensing aids geologic mapping

    NASA Technical Reports Server (NTRS)

    Knepper, D. H., Jr.; Marrs, R. W.

    1972-01-01

    Remote sensing techniques were applied to general geologic mapping along the Rio Grande rift zone in central Colorado. A geologic map of about 1,100 square miles was prepared utilizing (1) prior published and unpublished maps, (2) detailed and reconnaissance field maps made for this study, and (3) remote sensor data interpretations. The map is used for interpretation of the complex Cenozoic tectonic and geomorphic histories of the area.

  7. Mapping nanoscale light fields

    NASA Astrophysics Data System (ADS)

    Rotenberg, N.; Kuipers, L.

    2014-12-01

    The control of light fields on subwavelength scales in nanophotonic structures has become ubiquitous, driven by both curiosity and a multitude of applications in fields ranging from biosensing to quantum optics. Mapping these fields in detail is crucial, as theoretical modelling is far from trivial and highly dependent on nanoscale geometry. Recent developments of nanoscale field mapping, particularly with near-field microscopy, have not only led to a vastly increased resolution, but have also resulted in increased functionality. The phase and amplitude of different vector components of both the electric and magnetic fields are now accessible, as is the ultrafast temporal or spectral evolution of propagating pulses in nanostructures. In this Review we assess the current state-of-the-art of subwavelength light mapping, highlighting the new science and nanostructures that have subsequently become accessible.

  8. Bone Surface Mapping Method

    PubMed Central

    Fan, Yifang; Fan, Yubo; Li, Zhiyu; Lv, Changsheng; Zhang, Bo

    2012-01-01

    Bone shape is an important factor to determine the bone's structural function. For the asymmetrically shaped and anisotropically distributed bone in vivo, a surface mapping method is proposed on the bases of its geometric transformation invariance and its uniqueness of the principal axes of inertia. Using spiral CT scanning, we can make precise measurements to bone in vivo. The coordinate transformations lead to the principal axes of inertia, with which the prime meridian and the contour can be set. Methods such as tomographic reconstruction and boundary development are employed so that the surface of bone in vivo can be mapped. Experimental results show that the surface mapping method can reflect the shape features and help study the surface changes of bone in vivo. This method can be applied to research into the surface characteristics and changes of organ, tissue or cell whenever its digitalized surface is obtained. PMID:22412952

  9. Map display design

    NASA Technical Reports Server (NTRS)

    Aretz, Anthony J.

    1990-01-01

    This paper presents a cognitive model of a pilot's navigation task and describes an experiment comparing a visual momentum map display to the traditional track-up and north-up approaches. The data show the advantage to a track-up map is its congruence with the ego-centered forward view; however, the development of survey knowledge is hindered by the inconsistency of the rotating display. The stable alignment of a north-up map aids the acquisition of survey knowledge, but there is a cost associated with the mental rotation of the display to a track-up alignment for ego-centered tasks. The results also show that visual momentum can be used to reduce the mental rotation costs of a north-up display.

  10. Resource Destroying Maps.

    PubMed

    Liu, Zi-Wen; Hu, Xueyuan; Lloyd, Seth

    2017-02-10

    Resource theory is a widely applicable framework for analyzing the physical resources required for given tasks, such as computation, communication, and energy extraction. In this Letter, we propose a general scheme for analyzing resource theories based on resource destroying maps, which leave resource-free states unchanged but erase the resource stored in all other states. We introduce a group of general conditions that determine whether a quantum operation exhibits typical resource-free properties in relation to a given resource destroying map. Our theory reveals fundamental connections among basic elements of resource theories, in particular, free states, free operations, and resource measures. In particular, we define a class of simple resource measures that can be calculated without optimization, and that are monotone nonincreasing under operations that commute with the resource destroying map. We apply our theory to the resources of coherence and quantum correlations (e.g., discord), two prominent features of nonclassicality.

  11. Resource Destroying Maps

    NASA Astrophysics Data System (ADS)

    Liu, Zi-Wen; Hu, Xueyuan; Lloyd, Seth

    2017-02-01

    Resource theory is a widely applicable framework for analyzing the physical resources required for given tasks, such as computation, communication, and energy extraction. In this Letter, we propose a general scheme for analyzing resource theories based on resource destroying maps, which leave resource-free states unchanged but erase the resource stored in all other states. We introduce a group of general conditions that determine whether a quantum operation exhibits typical resource-free properties in relation to a given resource destroying map. Our theory reveals fundamental connections among basic elements of resource theories, in particular, free states, free operations, and resource measures. In particular, we define a class of simple resource measures that can be calculated without optimization, and that are monotone nonincreasing under operations that commute with the resource destroying map. We apply our theory to the resources of coherence and quantum correlations (e.g., discord), two prominent features of nonclassicality.

  12. Mapping your competitive position.

    PubMed

    D'Aveni, Richard A

    2007-11-01

    A price-benefit positioning map helps you see, through your customers' eyes, how your product compares with all its competitors in a market. You can draw such a map quickly and objectively, without having to resort to costly, time-consuming consumer surveys or subjective estimates of the excellence of your product and the shortcomings of all the others. Creating a positioning map involves three steps: First, define your market to include everything your customers might consider to be your product's competitors or substitutes. Second, track the price your customers actually pay (wholesale or retail? bundled or unbundled?) and identify what your customers see as your offering's primary benefit. This is done through regression analysis, determining which of the product's attributes (as described objectively by rating services, government agencies, R&D departments, and the like) explains most of the variance in its price. Third, draw the map by plotting on a graph the position of every product in the market you've selected according to its price and its level of primary benefit, and draw a line that runs through the middle of the points. What you get is a picture of the competitive landscape of your market, where all the products above the line command a price premium owing to some secondary benefit customers value, and all those below the line are positioned to earn market share through lower prices and reduced secondary benefits. Using examples as varied as Harley-Davidson motorcycles, Motorola cell phones, and the New York restaurant market, Tuck professor D'Aveni demonstrates some of the many ways the maps can be used: to locate unoccupied or less-crowded spaces in highly competitive markets, for instance, or to identify opportunities created through changes in the relationship between the primary benefit and prices. The maps even allow companies to anticipate--and counter-- rivals' strategies. R eprint RO711G

  13. Geologic Map of Nevada

    USGS Publications Warehouse

    Crafford, A. Elizabeth Jones

    2007-01-01

    The purpose of the Geologic Map of Nevada is to provide an integrated set of digital geologic information that can be used for regional geologic and rigorous spatial analysis. Two components of this map represent new information that has not been published in this form before. The new geology layer was created by merging into a single file individual digital Nevada county geologic maps (Hess and Johnson, 1997), published at a scale of 1:250,000. A new regional interpretation was created to unify all of the different county rock units, and then appropriate edits and modifications were made to the file to reflect additional geologic information and more current geologic interpretations. All possible sources of information were not utilized in the scope of this project, but rather the goal was to create a consistent Statewide 1:250,000-scale map that would facilitate regional geologic interpretation and be a foundation for future spatial analyses of digital data. Secondly, a new database of conodont biostratigraphic data compiled and analyzed by Anita Harris is also incorporated into the map. Information about many, but not all, of these conodont samples have been published separately elsewhere over the years, but they have not been presented together in a single digital database. Other previously published data layers are used in this map to enhance the usefulness of the geologic information. These layers include mineral deposit locations, oil well locations, and cartographic layers such as county boundaries, roads, towns, cities, rivers, water bodies, township, range and section grids, quadrangle grids, and topography. A summary of these components is given below, and complete descriptions of each layer are provided in the digital metadata.

  14. Maps and inverse maps in open quantum dynamics

    SciTech Connect

    Jordan, Thomas F.

    2010-10-15

    Two kinds of maps that describe evolution of states of a subsystem coming from dynamics described by a unitary operator for a larger system, maps defined for fixed mean values and maps defined for fixed correlations, are found to be quite different for the same unitary dynamics in the same situation in the larger system. An affine form is used for both kinds of maps to find necessary and sufficient conditions for inverse maps. All the different maps with the same homogeneous part in their affine forms have inverses if and only if the homogeneous part does. Some of these maps are completely positive; others are not, but the homogeneous part is always completely positive. The conditions for an inverse are the same for maps that are not completely positive as for maps that are. For maps defined for fixed mean values, the homogeneous part depends only on the unitary operator for the dynamics of the larger system, not on any state or mean values or correlations. Necessary and sufficient conditions for an inverse are stated several different ways: in terms of the maps of matrices, basis matrices, density matrices, or mean values. The inverse maps are generally not tied to the dynamics the way the maps forward are. A trace-preserving completely positive map that is unital cannot have an inverse that is obtained from any dynamics described by any unitary operator for any states of a larger system.

  15. Lightning mapping system

    NASA Technical Reports Server (NTRS)

    Lennon, C.; Maier, L.

    1991-01-01

    A Lightning Detection and Ranging (LDAR) System is being implemented at KSC in Florida. The first operational use is expected in the late summer of 1991. The system is designed to map the location of in-cloud and cloud-to-ground lightning based on the time of arrival (TOA) of electromagnetic radiation. The system detects very high frequency (VHF) radiation and designed to map the volumetric extent of lightning. The system implements two independent antenna arrays to provide a fast data quality check, as necessary for a real-time warning system. The system performance goals and a comparison with a similar system implemented in the mid-1970's is made.

  16. The NASA/USGS Planetary Geologic Mapping Program

    NASA Astrophysics Data System (ADS)

    Tanaka, K.

    NASA's Planetary Geologic Mapping Program (PGM) publishes geologic maps of the planets based on released, geodetically controlled spacecraft data. The general objectives of PGM include (1) production of geologic maps that will greatly increase our knowledge of the materials and processes that have contributed to the evolution of Solar System bodies, and (2) geologic surveys of areas of special interest that may be investigated by future missions. Although most map authors are from U.S. institutions, some European investigators have also served as authors. PGM is sponsored by NASA's Planetary Geology and Geophysics Program (PGG) and has been supported by personnel of the Astrogeology Team of the U.S. Geological Survey (USGS) for more than 40 years. PGG also supports the Astrogeology Team to prepare and distribute controlled data products necessary for the production of geologic maps. USGS coordination and outreach activities for PGM include developing new planetary geologic map series, managing existing map series, generating geologic mapping databases and packages for individual mapping investigators, providing oversight and expertise in meeting the requirements of USGS map standards, providing editorial support in map reviews and revisions, supporting map pre-press production, and maintaining an informative planetary geologic mapping web page (http://astrogeology.usgs.gov/Projects/PlanetaryMapping/). The Astrogeology Team also provides a Geographic Information Systems (GIS) web site (Planetary Interactive GIS on the Web Analyzable Database, or PIGWAD) to facilitate distribution and analysis of spatially registered, planetary geologic data primarily in vector form. USGS now publishes planetary geologic map data in GIS format. Geologic maps of planetary bodies published by USGS through 2005 include 80 of the Moon from 1:10K to 1:5M scale, 93 of Mars from 1:500K to 1:15M scale, 18 of Venus at 1:5M and 1:15M scales, 9 of Mercury at 1:5M scale, and 16 of the Galilean

  17. Regional mapping of hydrothermally altered igneous rocks along the Urumieh-Dokhtar, Chagai, and Alborz Belts of western Asia using Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) data and Interactive Data Language (IDL) logical operators: a tool for porphyry copper exploration and assessment: Chapter O in Global mineral resource assessment

    USGS Publications Warehouse

    Mars, John L.; Zientek, M.L.; Hammarstrom, J.M.; Johnson, K.M.; Pierce, F.W.

    2014-01-01

    The ASTER alteration map and corresponding geologic maps were used to select circular to elliptical patterns of argillic- and phyllic-altered volcanic and intrusive rocks as potential porphyry copper sites. One hundred and seventy eight potential porphyry copper sites were mapped along the UDVB, and 23 sites were mapped along the CVB. The potential sites were selected to assist in further exploration and assessments of undiscovered porphyry copper deposits.

  18. Mapping the Campus.

    ERIC Educational Resources Information Center

    Stigner, Kenneth J.

    2001-01-01

    Discusses how aerial photography and photogrammetry technology can help schools create visual records of their campus, land, and properties. Addresses efficiency and cost effectiveness of this method. Discusses how to develop the digital photogrammetry method for mapping from aerial photos. (GR)

  19. Global Wind Map

    ERIC Educational Resources Information Center

    Journal of College Science Teaching, 2005

    2005-01-01

    This brief article describes a new global wind-power map that has quantified global wind power and may help planners place turbines in locations that can maximize power from the winds and provide widely available low-cost energy. The researchers report that their study can assist in locating wind farms in regions known for strong and consistent…

  20. Mapping World Hunger.

    ERIC Educational Resources Information Center

    Van Vliet, Lucille W.

    1988-01-01

    Describes a lesson designed to involve students in grades 6 through 8 in learning how geography was affected the problem of world hunger. Emphasis is placed on using maps, globes, atlases, and geographic dictionaries, as well as books, magazines, and other resources. (MES)