NASA Astrophysics Data System (ADS)
Shimura, Kazuo; Nakajima, Nobuyoshi; Tanaka, Hiroshi; Ishida, Masamitsu; Kato, Hisatoyo
1993-09-01
Dual-energy X-ray absorptiometry (DXA) is one of the bone densitometry techniques to diagnose osteoporosis, and has been gradually getting popular due to its high degree of precision. However, DXA involves a time-consuming examination because of its pencil-beam scan, and the equipment is expensive. In this study, we examined a new bone densitometry technique (CR-DXA) utilizing an X-ray imaging system and Computed Radiography (CR) used for medical X-ray image diagnosis. High level of measurement precision and accuracy could be achieved by X-ray rube voltage/filter optimization and various nonuniformity corrections based on simulation and experiment. The phantom study using a bone mineral block showed precision of 0.83% c.v. (coefficient of variation), and accuracy of 0.01 g/cm2, suggesting that a practically equivalent degree of measurement precision and accuracy to that of the DXA approach is achieved. CR-DXA is considered to provide bone mineral densitometry to facilitate simple, quick and precise bone mineral density measurement.
High resolution bone mineral densitometry with a gamma camera
NASA Technical Reports Server (NTRS)
Leblanc, A.; Evans, H.; Jhingran, S.; Johnson, P.
1983-01-01
A technique by which the regional distribution of bone mineral can be determined in bone samples from small animals is described. The technique employs an Anger camera interfaced to a medical computer. High resolution imaging is possible by producing magnified images of the bone samples. Regional densitometry of femurs from oophorectomised and bone mineral loss.
D'iachkova, G V; Mitina, Iu L
2007-01-01
Based on the data of computed tomography, radiography and densitometry in 39 patients the authors describe in detail the signs of osteonecrosis and sequestration of different localization and extension.
Lung densitometry: why, how and when
Camiciottoli, Gianna; Diciotti, Stefano
2017-01-01
Lung densitometry assesses with computed tomography (CT) the X-ray attenuation of the pulmonary tissue which reflects both the degree of inflation and the structural lung abnormalities implying decreased attenuation, as in emphysema and cystic diseases, or increased attenuation, as in fibrosis. Five reasons justify replacement with lung densitometry of semi-quantitative visual scales used to measure extent and severity of diffuse lung diseases: (I) improved reproducibility; (II) complete vs. discrete assessment of the lung tissue; (III) shorter computation times; (IV) better correlation with pathology quantification of pulmonary emphysema; (V) better or equal correlation with pulmonary function tests (PFT). Commercially and open platform software are available for lung densitometry. It requires attention to technical and methodological issues including CT scanner calibration, radiation dose, and selection of thickness and filter to be applied to sections reconstructed from whole-lung CT acquisition. Critical is also the lung volume reached by the subject at scanning that can be measured in post-processing and represent valuable information per se. The measurements of lung density include mean and standard deviation, relative area (RA) at −970, −960 or −950 Hounsfield units (HU) and 1st and 15th percentile for emphysema in inspiratory scans, and RA at −856 HU for air trapping in expiratory scans. Kurtosis and skewness are used for evaluating pulmonary fibrosis in inspiratory scans. The main indication for lung densitometry is assessment of emphysema component in the single patient with chronic obstructive pulmonary diseases (COPD). Additional emerging applications include the evaluation of air trapping in COPD patients and in subjects at risk of emphysema and the staging in patients with lymphangioleiomyomatosis (LAM) and with pulmonary fibrosis. It has also been applied to assess prevalence of smoking-related emphysema and to monitor progression of smoking-related emphysema, alpha1 antitrypsin deficiency emphysema, and pulmonary fibrosis. Finally, it is recommended as end-point in pharmacological trials of emphysema and lung fibrosis. PMID:29221318
DOE Office of Scientific and Technical Information (OSTI.GOV)
Riggs, B.L. Melton III, L.J.
This book contains 20 chapters. Some of the titles are: Radiology of asteoporosis; Quantitative computed tomography in assessment of osteoporosis; Nuclear medicine and densitometry; Assessment of bone turnover by histormorphometry in osteoporosis; and The biochemistry of bone.
76 FR 55069 - Government-Owned Inventions; Availability for Licensing
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-06
... health problem primarily affecting the elderly and women after menopause. More specifically, the... automated bone mineral densitometry in a single examination. J Comput Assist Tomogr. 2011 Mar- Apr;35(2):212...
Corneal Densitometry as a Tool to Measure Epithelial Ingrowth After Laser In Situ Keratomileusis.
Adran, Daniel; Vaillancourt, Louis; Harissi-Dagher, Mona; Kruh, Jonathan N; Syed, Zeba A; Robinson, Steven; Melki, Samir
2017-04-01
This study evaluates the correlation between corneal densitometry and epithelial ingrowth (EI) after laser in situ keratomileusis (LASIK). Corneal densitometry of 3 patients who developed EI after LASIK was measured with the Oculus Pentacam. Corneal densitometry readings of each patient were obtained preoperatively and postoperatively after ingrowth was discovered. Densitometry was recorded at the central nest of opacity and at the leading edges of EI. For all patients, the most severe stages of EI observed on slit-lamp photographs correlated with the highest densitometry readings, with peak densitometry ranging from 73.3 to 95.1. These values were much higher than preoperative densitometry readings, which ranged from 21.8 to 27.2. In 2 cases, the Pentacam densitometry map revealed progression of EI toward the visual axis that was only faintly detectable or not detectable at all on the corresponding slit-lamp photographs. Corneal densitometry seems to be an objective measure of the severity and progression of EI after LASIK.
Bone Densitometry (Bone Density Scan)
... News Physician Resources Professions Site Index A-Z Bone Densitometry (DEXA) Bone densitometry, also called dual-energy ... limitations of DEXA Bone Densitometry? What is a Bone Density Scan (DEXA)? Bone density scanning, also called ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tan, Han Yen; Ng, Tuck Wah; Liew, Oi Wah
2010-03-20
Flatbed scanner densitometers can be operated under various illumination and recording exposure levels. In this work, we show that optical density measurement accuracy, sensitivity, and stability of stained polyacrylamide electrophoresis gel densitometry are crucially dependent on these two factors (brightness and exposure level), notwithstanding that the source is monochromatic, spatially uniform, and the measurements are made using an accurately calibrated step wedge in tandem. We further outline a method to accommodate the intensity deviations over a range of illumination and exposure levels in order to maintain sensitivity and repeatability in the computed optical densities. Comparisons were also made with resultsmore » from a commercial densitometer.« less
Corneal densitometry and its correlation with age, pachymetry, corneal curvature, and refraction.
Garzón, Nuria; Poyales, Francisco; Illarramendi, Igor; Mendicute, Javier; Jáñez, Óscar; Caro, Pedro; López, Alfredo; Argüeso, Francisco
2017-12-01
To determine normative corneal densitometry values in relation to age, sex, refractive error, corneal thickness, and keratometry, measured using the Oculus Pentacam system. Three hundred and thirty-eight healthy subjects (185 men; 153 women) with no corneal disease underwent an exhaustive ocular examination. Corneal densitometry was expressed in standardized grayscale units (GSU). The mean corneal densitometry over the total area was 16.46 ± 1.85 GSU. The Pearson correlation coefficient for total densitometry was r = 0.542 (p < 0.001). Statistically significant differences were found between men and women for the total area (p = 0.006), with readings of 16.22 ± 1.54 GSU and 16.60 ± 1.83 GSU, respectively. When the cornea was divided into layers of different depths, a significant correlation was found for all layers and age: r = 0.447 (p < 0.001), r = 0.563 (p < 0.001), and r = 0.520 (p < 0.001) for the anterior, central, and posterior layers, respectively. However, when the cornea was divided into concentric annuli starting from the center of the cornea, densitometry was strongly correlated only with age in the 6-10-mm annulus (p < 0.001). Neither mean keratometry nor spherical equivalent was correlated with corneal densitometry in any zone of the cornea (p > 0.05). This is the first report of normative corneal densitometry values in relation to keratometry, corneal thickness, and spherical equivalent measured with the latest Oculus Pentacam software. Corneal densitometry increases with age, but corneal keratometry and refractive parameters do not affect light scattering in the human cornea.
Assessment of liver volume with computed tomography and comparison of findings with ultrasonography.
Bora, Aydın; Alptekin, Cem; Yavuz, Alpaslan; Batur, Abdussamet; Akdemir, Zülküf; Berköz, Mehmet
2014-12-01
In this study, we aimed to investigate the impact of non-alcoholic hepatic steatosis on the liver volume. As investigating hepatic steatosis, we utilized computed tomography (CT) to determine the degree of steatosis and we utilized hepatobiliary ultrasonography (USG) for densitometry and correlation. As hepatosteatosis group, 35 patients over 18 years of age and whose abdominal CT scans were requested by several clinics and performed routinely were included in this study, and as control group, 40 healthy subjects without hepatosteatosis (clinically and radiologically) and correlated with hepatosteatosis group in terms of age and gender were included in this study. CT densitometry and liver attenuation index (LAI) of all individuals who participated in our study were calculated, and contrast images of patients were transferred to CT-Volume Software (Siemens Syngo Multimodality Workplace; Version VE52A). In this study, interactive and automated volume measurement techniques were used together. The volumes were measured separately in patient and control group. In this study for each stage in USG, there was found a direct correlation in terms of LAI and volume, and this correlation was statistically significant (p < 0.01). Furthermore, statistical significance between size and USG stage draws attention (p < 0.05). A significance relationship between USG stage and age could not be determined. As a result, we have reached the conclusion that CT densitometry can be used as an assistive technique along with USG to determine the degree of steatosis in the non-alcoholic fatty liver disease, and there is a positive linear correlation between the liver size and volume, and liver volume increases in the non-alcoholic fatty liver disease.
2004-01-01
Following publication of the proceedings from the first Position Development Conference (PDC) of the International Society for Clinical Densitometry (ISCD), members of the ISCD Scientific Advisory Committee (SAC) addressed additional topics of interest in the field of bone densitometry. These topics were addressed at a subsequent PDC, which was held in Cincinnati, Ohio, July 25-27, 2003. Five topics were chosen for discussion: (1) the diagnosis of osteoporosis in men, premenopausal women, and children; (2) technical standardization for dual-energy X-ray absorptiometry (DXA); (3) indications for bone densitometry; (4) reporting of bone density results; and (5) nomenclature and decimal places for bone densitometry. This report describes the methodology used for the development, presentation, and finalization of PDC positions. These positions are discussed in the following papers.
Clinical value of bone densitometry.
Sartoris, D J
1994-07-01
The purpose of this article is to provide insight into the long-standing controversy over the clinical value of noninvasive measurement of bone mass. Results of recent studies have increasingly supported the judicious use of bone densitometry as a clinical tool [1]. These reports contradict editorials on the limitations of bone densitometry that have appeared in a variety of subspecialty publications [2,3]. The importance of bone mass measurement is underscored by the lack of success in predicting bone density from various combinations of anthropometric and historical variables. Growing evidence suggests that densitometry is a useful tool for determining which women near menopause are at risk for osteoporosis and, therefore, are candidates for estrogen-replacement therapy. This article summarizes current concepts on the subject and attempts to prove that bone densitometry is a beneficial and indicated procedure for selected patients.
Schousboe, J T; Gourlay, M; Fink, H A; Taylor, B C; Orwoll, E S; Barrett-Connor, E; Melton, L J; Cummings, S R; Ensrud, K E
2013-01-01
We used a microsimulation model to estimate the threshold body weights at which screening bone densitometry is cost-effective. Among women aged 55-65 years and men aged 55-75 years without a prior fracture, body weight can be used to identify those for whom bone densitometry is cost-effective. Bone densitometry may be more cost-effective for those with lower body weight since the prevalence of osteoporosis is higher for those with low body weight. Our purpose was to estimate weight thresholds below which bone densitometry is cost-effective for women and men without a prior clinical fracture at ages 55, 60, 65, 75, and 80 years. We used a microsimulation model to estimate the costs and health benefits of bone densitometry and 5 years of fracture prevention therapy for those without prior fracture but with femoral neck osteoporosis (T-score ≤ -2.5) and a 10-year hip fracture risk of ≥3%. Threshold pre-test probabilities of low BMD warranting drug therapy at which bone densitometry is cost-effective were calculated. Corresponding body weight thresholds were estimated using data from the Study of Osteoporotic Fractures (SOF), the Osteoporotic Fractures in Men (MrOS) study, and the National Health and Nutrition Examination Survey (NHANES) for 2005-2006. Assuming a willingness to pay of $75,000 per quality adjusted life year (QALY) and drug cost of $500/year, body weight thresholds below which bone densitometry is cost-effective for those without a prior fracture were 74, 90, and 100 kg, respectively, for women aged 55, 65, and 80 years; and were 67, 101, and 108 kg, respectively, for men aged 55, 75, and 80 years. For women aged 55-65 years and men aged 55-75 years without a prior fracture, body weight can be used to select those for whom bone densitometry is cost-effective.
A field-to-desktop toolchain for X-ray CT densitometry enables tree ring analysis
De Mil, Tom; Vannoppen, Astrid; Beeckman, Hans; Van Acker, Joris; Van den Bulcke, Jan
2016-01-01
Background and Aims Disentangling tree growth requires more than ring width data only. Densitometry is considered a valuable proxy, yet laborious wood sample preparation and lack of dedicated software limit the widespread use of density profiling for tree ring analysis. An X-ray computed tomography-based toolchain of tree increment cores is presented, which results in profile data sets suitable for visual exploration as well as density-based pattern matching. Methods Two temperate (Quercus petraea, Fagus sylvatica) and one tropical species (Terminalia superba) were used for density profiling using an X-ray computed tomography facility with custom-made sample holders and dedicated processing software. Key Results Density-based pattern matching is developed and able to detect anomalies in ring series that can be corrected via interactive software. Conclusions A digital workflow allows generation of structure-corrected profiles of large sets of cores in a short time span that provide sufficient intra-annual density information for tree ring analysis. Furthermore, visual exploration of such data sets is of high value. The dated profiles can be used for high-resolution chronologies and also offer opportunities for fast screening of lesser studied tropical tree species. PMID:27107414
Collection of wood quality data by X-ray densitometry: a case study with three southern pines
Thomas L. Eberhardt; Lisa J. Samuelson
2015-01-01
X-ray densitometry is a technique often used in tree growth and wood quality studies to incrementally measure density (specific gravity) along a radial strip of wood. Protocols for this technique vary between laboratories because of differences in species, equipment, tree age, and other factors. Here, the application of X-ray densitometry is discussed in terms of a...
Direct-to-consumer marketing of osteoporosis drugs and bone densitometry.
Hollon, Matthew F; Larson, Eric B; Koepsell, Thomas D; Downer, Ann E
2003-01-01
To determine whether there is an association between a woman's exposure to direct-to-consumer (DTC) advertisements for 2 osteoporosis drugs and presentation for bone densitometry. A matched case-control study was conducted between October and December 1998 at an academic primary care clinic in Seattle, WA. Seventeen women from the study population (aged >/=18 y, seen in the previous 2 y at the academic primary care clinic) presented for bone densitometry. All 51 women completed a self-administered questionnaire. Women familiar with 1 of 2 osteoporosis drugs due to exposure to advertisements had 9 times the odds of densitometry (unadjusted OR 9.3, 95% CI 1.0 to 86). Multivariate analysis, including confounders such as education level and whether a woman had previously had 3 screening tests (mammography, Pap smear, serum cholesterol), revealed a significant and strong association between exposure to advertisements and densitometry (adjusted OR 29, 95% CI 1.6 to 511). DTC marketing may increase health services utilization. Further independent evaluation of DTC marketing based on available observational evidence is feasible and warranted.
A field-to-desktop toolchain for X-ray CT densitometry enables tree ring analysis.
De Mil, Tom; Vannoppen, Astrid; Beeckman, Hans; Van Acker, Joris; Van den Bulcke, Jan
2016-06-01
Disentangling tree growth requires more than ring width data only. Densitometry is considered a valuable proxy, yet laborious wood sample preparation and lack of dedicated software limit the widespread use of density profiling for tree ring analysis. An X-ray computed tomography-based toolchain of tree increment cores is presented, which results in profile data sets suitable for visual exploration as well as density-based pattern matching. Two temperate (Quercus petraea, Fagus sylvatica) and one tropical species (Terminalia superba) were used for density profiling using an X-ray computed tomography facility with custom-made sample holders and dedicated processing software. Density-based pattern matching is developed and able to detect anomalies in ring series that can be corrected via interactive software. A digital workflow allows generation of structure-corrected profiles of large sets of cores in a short time span that provide sufficient intra-annual density information for tree ring analysis. Furthermore, visual exploration of such data sets is of high value. The dated profiles can be used for high-resolution chronologies and also offer opportunities for fast screening of lesser studied tropical tree species. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Minami, Keiichiro; Honbo, Masato; Mori, Yosai; Kataoka, Yasushi; Miyata, Kazunori
2015-11-01
To compare area densitometry analysis using rotating Scheimpflug photography in quantifications of posterior capsule opacification (PCO) and surface light scattering with previous anterior-segment analyzer measurement. Miyata Eye Hospital, Miyazaki, Japan. Prospective observational case series. Scheimpflug images of eyes with foldable intraocular lenses (IOLs) were obtained using rotating and fixed Scheimpflug photography. Area densitometry on the posterior and anterior surfaces was conducted for PCO and surface light scattering analyses, respectively, with an identical area size. Correlation between two measurements was analyzed using linear regression. The study included 105 eyes of 74 patients who received IOLs 1 to 18 years (mean, 4.9 ± 4.5 years) postoperatively. In the PCO analysis on the posterior IOL surface, there was a significant correlation between the two measurements (P < .001, R(2) = 0.60). In the surface light scattering analysis, a significant and higher correlation was obtained (P < .001, R(2) = 0.91) until the fixed Scheimpflug photography exhibited saturation due to intensive scatterings. Area densitometry combined with a rotating Scheimpflug photography was exchangeable to previously established densitometry measurement, and allowed successive evaluation in longer-term observations. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Is Breast Densitometry a Measure of Breast Cancer Risk
2001-09-01
preparing the same or similar computer software, or (c) used by a party other than the Government, except that the Government may release or disclose...compositional density. This increases the accuracy, dynamic range and precision of the measurement. This is the principal difference between...vivo whole body %FAT. By subtracting two x-ray images acquired at different x-ray energies, one component (say soft tissue) of a two component model (say
Crespo, André L B; Spencer, Terence A; Nekl, Emily; Pusztai-Carey, Marianne; Moar, William J; Siegfried, Blair D
2008-01-01
Standardization of toxin preparations derived from Bacillus thuringiensis (Berliner) used in laboratory bioassays is critical for accurately assessing possible changes in the susceptibility of field populations of target pests. Different methods were evaluated to quantify Cry1Ab, the toxin expressed by 80% of the commercially available transgenic maize that targets the European corn borer, Ostrinia nubilalis (Hübner). We compared three methods of quantification on three different toxin preparations from independent sources: enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis and densitometry (SDS-PAGE/densitometry), and the Bradford assay for total protein. The results were compared to those obtained by immunoblot analysis and with the results of toxin bioassays against susceptible laboratory colonies of O. nubilalis. The Bradford method resulted in statistically higher estimates than either ELISA or SDS-PAGE/densitometry but also provided the lowest coefficients of variation (CVs) for estimates of the Cry1Ab concentration (from 2.4 to 5.4%). The CV of estimates obtained by ELISA ranged from 12.8 to 26.5%, whereas the CV of estimates obtained by SDS-PAGE/densitometry ranged from 0.2 to 15.4%. We standardized toxin concentration by using SDS-PAGE/densitometry, which is the only method specific for the 65-kDa Cry1Ab protein and is not confounded by impurities detected by ELISA and Bradford assay for total protein. Bioassays with standardized Cry1Ab preparations based on SDS-PAGE/densitometry showed no significant differences in LC(50) values, although there were significant differences in growth inhibition for two of the three Cry1Ab preparations. However, the variation in larval weight caused by toxin source was only 4% of the total variation, and we conclude that standardization of Cry1Ab production and quantification by SDS-PAGE/densitometry may improve data consistency in monitoring efforts to identify changes in insect susceptibility to Cry1Ab.
Colour thresholding and objective quantification in bioimaging
NASA Technical Reports Server (NTRS)
Fermin, C. D.; Gerber, M. A.; Torre-Bueno, J. R.
1992-01-01
Computer imaging is rapidly becoming an indispensable tool for the quantification of variables in research and medicine. Whilst its use in medicine has largely been limited to qualitative observations, imaging in applied basic sciences, medical research and biotechnology demands objective quantification of the variables in question. In black and white densitometry (0-256 levels of intensity) the separation of subtle differences between closely related hues from stains is sometimes very difficult. True-colour and real-time video microscopy analysis offer choices not previously available with monochrome systems. In this paper we demonstrate the usefulness of colour thresholding, which has so far proven indispensable for proper objective quantification of the products of histochemical reactions and/or subtle differences in tissue and cells. In addition, we provide interested, but untrained readers with basic information that may assist decisions regarding the most suitable set-up for a project under consideration. Data from projects in progress at Tulane are shown to illustrate the advantage of colour thresholding over monochrome densitometry and for objective quantification of subtle colour differences between experimental and control samples.
Assessment of Corneal Backward Light Scattering in Diabetic Patients.
Özyol, Pelin; Özyol, Erhan
2016-10-03
To analyze corneal backward light scattering differences in patients with type 2 diabetes mellitus. We enrolled 43 eyes from 43 diabetic patients and 40 eyes from 40 healthy controls. Corneal backward light scattering was evaluated using densitometry measurements from different corneal layers and zones obtained using Scheimpflug tomography (PentacamHR). When densitometry values were divided by depth, anterior layer of diabetic corneas displayed significantly higher corneal backward light scattering values than controls (32.05, 95% confidence intervals [CI], 31.02-33.08 vs. 29.18, 95% CI, 27.60-30.76, P=0.024). Corneal densitometry measurements were also significantly higher in diabetic eyes compared with control eyes, when considered by concentric zones of total cornea in the 0 to 2 mm (21.65, 95% CI, 20.28-23.01 vs. 18.87 95% CI, 18.49-19.25, P=0.020), and anterior layer in the 0 to 2 mm (27.3, 95% CI, 25.04-29.56 vs. 22.31, 95% CI, 20.57-24.05, P<0.001), 2 to 6 mm (26.2, 95% CI, 24.99-27.41 vs. 22.4, 95% CI, 20.18-24.62, P<0.001) and 6 to 10 mm (32.19, 95% CI, 29.98-34.40 vs. 27.2, 95% CI, 25.39-29.01, P=0.022). There was excellent positive correlation between anterior total corneal densitometry measurements and duration of diabetes (r=0.802, P<0.001), although no significant correlation was observed with anterior total corneal densitometry measurements and hemoglobin A1c levels (r=0.080, P=0.621) in diabetic eyes. Backward light scattering values from the anterior layer of the cornea is greater in diabetic eyes than in controls. Anterior total corneal densitometry measurements show positive correlation with the duration of diabetes.
Computational Literacy and "The Big Picture" Concerning Computers in Mathematics Education
ERIC Educational Resources Information Center
diSessa, Andrea A.
2018-01-01
This article develops some ideas concerning the "big picture" of how using computers might fundamentally change learning, with an emphasis on mathematics (and, more generally, STEM education). I develop the big-picture model of "computation as a new literacy" in some detail and with concrete examples of sixth grade students…
The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment.
Stagi, Stefano; Cavalli, Loredana; Seminara, Salvatore; de Martino, Maurizio; Brandi, Maria Luisa
2014-06-07
In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed.
The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment
2014-01-01
In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed. PMID:24906390
NASA Astrophysics Data System (ADS)
Perera, Kshanthi; Kumara, W. A. S.; Hansen, Fredrik; Mylvaganam, Saba; Time, Rune W.
2018-06-01
Measurement techniques are vital for the control and operation of multiphase oil–water flow in pipes. The development of such techniques depends on laboratory experiments involving flow visualization, liquid fraction (‘hold-up’), phase slip and pressure drop measurements. They provide valuable information by revealing the physics, spatial and temporal structures of complex multiphase flow phenomena. This paper presents the hold-up measurement of oil–water flow in pipelines using gamma densitometry and electrical capacitance tomography (ECT) sensors. The experiments were carried out with different pipe inclinations from ‑5° to +6° for selected mixture velocities (0.2–1.5 m s‑1), and at selected watercuts (0.05–0.95). Mineral oil (Exxsol D60) and water were used as test fluids. Nine flow patterns were identified including a new pattern called stratified wavy and mixed interface flow. As a third direct method, visual observations and high-speed videos were used for the flow regime and interface identification. ECT and gamma densitometry hold-up measurements show similar trends for changes in pipeline inclinations. Changing the pipe inclination affected the flow mostly at lower mixture velocities and caused a change of flow patterns, allowing the highest change of hold-up. ECT hold-up measurements overpredict the gamma densitometry measurements at higher input water cuts and underpredict at intermediate water cuts. Gamma hold-up results showed good agreement with the literature results, having a maximum deviation of 6%, while it was as high as 22% for ECT in comparison to gamma densitometry. Uncertainty analysis of the measurement techniques was carried out with single-phase oil flow. This shows that the measurement error associated with gamma densitometry is approximately 3.2%, which includes 1.3% statistical error and 2.9% error identified as electromagnetically induced noise in electronics. Thus, gamma densitometry can predict hold-up with a higher accuracy in comparison to ECT when applied to oil–water systems at minimized electromagnetic noise.
Qualitative identification of rigid gas permeable contact lens materials by densitometry.
Arce, C G; Schuman, P D; Schuman, W P
1999-10-01
We describe a practical method to qualitatively identify polymethylmethacrylate (PMMA) and rigid gas permeable (RGP) contact lens materials. By progressive dilution of a saturated saline solution made with distilled or tap water and sodium chloride, we recorded comparative densitometry of rigid contact lens materials using a small hydrometer or by liquid displacement. The method was sensitive enough to separate the polymethylmethacrylate, all silicon-methacrylates, and all but two fluorine-containing silicon-methacrylates. The hydrometer had a precision of three decimals rounded to the nearest 0.005. There was only one RGP product that could have been confused with the PMMA material. Most silicon-methacrylates had lower densities than fluorine containing silicon-methacrylates. Only four of 25 products under 1.117 gm/cm3 contained fluorine. Densitometry with a hydrometer is an effective non-destructive method to identify RGP materials and to verify their quality. The method is easier when lens blanks are tested, but in spite of differences in shape, size, and weight, densitometry may also be used with new or used contact lenses. Its simplicity and low cost makes densitometry feasible for any contact lens laboratory or clinic to use on a routine basis. Only silicon-methacrylates had an inverse relationship between density and oxygen permeability. As the silicon content of the contact lens increases, the Dk increases and the density decreases.
Knowledge Acquisition with Static and Animated Pictures in Computer-Based Learning.
ERIC Educational Resources Information Center
Schnotz, Wolfgang; Grzondziel, Harriet
In educational settings, computers provide specific possibilities of visualizing information for instructional purposes. Besides the use of static pictures, computers can present animated pictures which allow exploratory manipulation by the learner and display the dynamic behavior of a system. This paper develops a theoretical framework for…
What Is Carotid Artery Disease?
... Your doctor can see these pictures on a computer screen. For this test, your doctor may give ... pictures of the body from many angles. A computer combines the pictures into two- and three-dimensional ...
Marcos, S; Tornow, R P; Elsner, A E; Navarro, R
1997-07-01
Foveal cone spacing was measured in vivo using an objective technique: ocular speckle interferometry. Cone packing density was computed from cone spacing data. Foveal cone photopigment density difference was measured in the same subjects using retinal densitometry with a scanning laser ophthalmoscope. Both the cone packing density and cone photopigment density difference decreased sharply with increasing retinal eccentricity. From the comparison of both sets of measurements, the computed amounts of photopigment per cone increased slightly with increasing retinal eccentricity. Consistent with previous results, decreases in cone outer segment length are over-compensated by an increase in the outer segment area, at least in retinal eccentricities up to 1 deg.
Progress in Development of Methods in Bone Densitometry
NASA Technical Reports Server (NTRS)
Whedon, G. D.; Neumann, William F.; Jenkins, Dale W.
1966-01-01
The effects of weightlessness and decreased activity on the astronaut's musculoskeletal system during prolonged space flight, missions are of concern to NASA. This problem was anticipated from the knowledge that human subjects lose significant quantities of calcium from the skeleton during periods of bedrest, immobilization, and water immersion. An accurate method of measurement of the changes in mineral content of the skeleton is required not only in the space program but also in the biological, medical, and dental fields for mineral metabolism studies and for studying various pathological conditions of the skeleton and teeth. This method is a difficult one requiring the coordinated efforts of physiologists, biophysicists, radiologists, and clinicians. The densitometry methods reported in this conference which have been used or are being developed include X-ray, beta excited X-rays, radioisotopes, sonic vibration, and neutron activation analysis Studies in the Gemini, Biosatellite, and Apollo flights use the X-ray bone densitometry method which requires making X-rays before and after the flights. An in-flight method of bone densitometry would be valuable, and use of radioisotope sources has been suggested. Many advances in bone densitometry have been made in the last five years, and the urgency of the requirement makes this working conference timely and valuable. In such a rapidly developing field with investigators working independently in a variety of scientific disciplines, a working conference is of great value in exchanging information and ideas, critically evaluating approaches and methods, and pointing out new research pathways.
Stoel, Berend C; Borman, Terry M; de Jongh, Ronald
2012-01-01
Classical violins produced by makers such as Antonio Stradivari and Guarneri del Gesu have long been considered the epitome of the luthier's art and the expressive tool of choice for the most celebrated violinists. It has been speculated these makers had access to wood that was unique in some way and that this was responsible for their acclaimed tonal characteristics. In an attempt to discern whether the above conjecture is true, we analyzed 17 modern and classical Dutch, German, Austrian and French violins by wood densitometry using computed tomography and correlated these results with our previous study of modern and Cremonese violins; in all studying 30 instruments of the violin family. In order to make this comparison possible we developed methods to cross calibrate results from different CT manufacturers using calibration wood pieces. We found no significant differences in median densities between modern and classical violins, or between classical violins from different origins. These results suggest that it is unlikely classical Cremonese makers had access to wood with significantly different wood density characteristics than that available to contemporaneous or modern makers.
Automation of film densitometry for application in personal monitoring.
Taheri, M; Movafeghi, A; Rastkhah, N
2011-03-01
In this research work, a semi-automatic densitometry system has been developed for large-scale monitoring services by use of film badge dosemeters. The system consists of a charge-coupled device (CCD)-based scanner that can scan optical densities (ODs) up to 4.2, a computer vision algorithm to improve the quality of digitised films and an analyser program to calculate the necessary information, e.g. the mean OD of region of interest and radiation doses. For calibration of the system, two reference films were used. The Microtek scanner International Color Consortium (ICC) profiler is applied for determining the colour attributes of the scanner accurately and a reference of the density step tablet, Bundesanstalt für Materialforschung und-prüfung (BAM) is used for calibrating the automatic conversion of gray-level values to OD values in the range of 0.2-4.0 OD. The system contributes to achieve more objectives and reliable results. So by applying this system, we can digitise a set of 20 films at once and calculate their relative doses less than about 4 min, and meanwhile it causes to avoid disadvantages of manual process and to enhance the accuracy of dosimetry.
USDA-ARS?s Scientific Manuscript database
The International Osteoporosis Foundation (IOF) and the International Society for Clinical Densitometry (ISCD) appointed a joint Task Force to develop resource documents in order to make recommendations on how to improve FRAX and better inform clinicians who use FRAX. The Task Force met in November...
Wielpütz, Mark O.; Weinheimer, Oliver; Eichinger, Monika; Wiebel, Matthias; Biederer, Jürgen; Kauczor, Hans-Ulrich; Heußel, Claus P.
2013-01-01
Background Histopathological studies on lung specimens from patients with cystic fibrosis (CF) and recent results from a mouse model indicate that emphysema may contribute to CF lung disease. However, little is known about the relevance of emphysema in patients with CF. In the present study, we used computationally generated density masks based on multidetector computed tomography (MDCT) of the chest for non-invasive characterization and quantification of emphysema in CF. Methods Volumetric MDCT scans were acquired in parallel to pulmonary function testing in 41 patients with CF (median age 20.1 years; range 7-66 years) and 21 non-CF controls (median age 30.4 years; range 4-68 years), and subjected to dedicated software. The lung was segmented, low attenuation volumes below a threshold of -950 Hounsfield units were assigned to emphysema volume (EV), and the emphysema index was computed (EI). Results were correlated with forced expiratory volume in 1 s percent predicted (FEV1%), residual volume (RV), and RV/total lung capacity (RV/TLC). Results We show that EV was increased in CF (457±530 ml) compared to non-CF controls (78±90 ml) (P<0.01). EI was also increased in CF (7.7±7.5%) compared to the control group (1.2±1.4%) (P<0.05). EI correlated inversely with FEV1% (rs=-0.66), and directly with RV (rs=0.69) and RV/TLC (rs=0.47) in patients with CF (P<0.007), but not in non-CF controls. Emphysema in CF was detected from early adolescence (~13 years) and increased with age (rs=0.67, P<0.001). Conclusions Our results indicate that early onset emphysema detected by densitometry on chest MDCT is a characteristic pathology that contributes to airflow limitation and may serve as a novel endpoint for monitoring lung disease in CF. PMID:23991177
DOE Office of Scientific and Technical Information (OSTI.GOV)
Newby, M.J.; Keim, N.L.; Brown, D.L.
1990-08-01
This study contrasts body compositions (by six methods) of eight cystic fibrosis (CF) subjects with those of eight control subjects matched for age, height, and sex. CF subjects weighed 84% as much as control subjects. Densitometry and two bioelectrical impedance-analysis methods suggested that reduced CF weights were due to less lean tissue (10.7, 9.5, and 10.4 kg). Total-body electrical conductivity (TOBEC) and skinfold-thickness measurements indicated that CF subjects were leaner than control subjects and had less fat (5.4 and 3.6 kg) and less lean (5.2 and 7 kg) tissue. D2O dilution showed a pattern similar to TOBEC (8.3 kg lessmore » lean, 2.7 kg less fat tissue). Densitometry estimates of fat (mass and percent) were not correlated (r less than 0.74, p greater than 0.05) with any other method for CF subjects but were correlated with all other methods for control subjects. CF subjects contained less fat and lean tissue than did control subjects. Densitometry by underwater weighing is unsuitable for assessing body composition of CF patients.« less
Validation of Long Bone Mechanical Properties from Densitometry
NASA Technical Reports Server (NTRS)
Whalen, R.; Katz, B.; Cleek, T.; Hargens, Alan R. (Technical Monitor)
1995-01-01
The objective of this study was to assess whether cross-sectional areal properties, calculated from densitometry, correlate to the true flexural properties. Right and left male embalmed tibiae were used in the study. Prior to scanning, the proximal end of each tibia was potted in a fixture with registration pins, flushed thoroughly with water under pressure to remove trapped air, and then placed in a constant thickness water bath attached to a precision indexer. Two sets of three scans of the entire tibia were taken with an Hologic QDR 1000/W densitometer at rotations of 0, 45, and 90 degrees about the tibia long axis. An aluminum step phantom and a bone step phantom, machined from bovine cortical bone, were also in the bath and scanned separately. Pixel attenuation data from the two sets of scans were averaged to reduce noise. Pixel data from the high energy beam were then converted to equivalent thicknesses using calibration equations. Cross-sectional areal properties (centroid, principal area moments and principal angle) along the length were computed from the three registered scans using methods developed in our laboratory. Flexural rigidities. Four strain gages were bonded around the circumference of each of 5 cross-sections encompassing the entire diaphysis. A known transverse load was then applied to the distal end and the bone was rotated 360 degrees in eight increments of 45 degrees each. Strains from the eight orientations were analyzed along with the known applied bending moments at each section to compute section centroids, curvatures, principal flexural rigidities and principal angle. Reference axes between the two methods were maintained within +/- 0.5 degrees using an electronic inclinometer. Principal angles (flexural - areal) differed by -2.0 +/- 4.0 degrees, and 1.0 +/- 2.5 degrees for the right and left tibia, respectively. Section principal flexural rigidities were highly correlated to principal areal moments (right: r(sup 2)= 0.997; left: r(sup 2)= 0.978) indicating a nearly constant effective flexural modulus. Right and left tibia exhibited a very high degree of symmetry when comparing either flexural or areal properties. To our knowledge this is the first study to validate the use of densitometry (DXA) to predict three dimensional structural properties of long bones. Our initial results support the conclusion that bone mineral and its distribution are the primary determinants of flexural modulus and rigidity.
An Intelligent Pictorial Information System
NASA Astrophysics Data System (ADS)
Lee, Edward T.; Chang, B.
1987-05-01
In examining the history of computer application, we discover that early computer systems were developed primarily for applications related to scientific computation, as in weather prediction, aerospace applications, and nuclear physics applications. At this stage, the computer system served as a big calculator to perform, in the main, manipulation of numbers. Then it was found that computer systems could also be used for business applications, information storage and retrieval, word processing, and report generation. The history of computer application is summarized in Table I. The complexity of pictures makes picture processing much more difficult than number and alphanumerical processing. Therefore, new techniques, new algorithms, and above all, new pictorial knowledge, [1] are needed to overcome the limitatins of existing computer systems. New frontiers in designing computer systems are the ways to handle the representation,[2,3] classification, manipulation, processing, storage, and retrieval of pictures. Especially, the ways to deal with similarity measures and the meaning of the word "approximate" and the phrase "approximate reasoning" are an important and an indispensable part of an intelligent pictorial information system. [4,5] The main objective of this paper is to investigate the mathematical foundation for the effective organization and efficient retrieval of pictures in similarity-directed pictorial databases, [6] based on similarity retrieval techniques [7] and fuzzy languages [8]. The main advantage of this approach is that similar pictures are stored logically close to each other by using quantitative similarity measures. Thus, for answering queries, the amount of picture data needed to be searched can be reduced and the retrieval time can be improved. In addition, in a pictorial database, very often it is desired to find pictures (or feature vectors, histograms, etc.) that are most similar to or most dissimilar [9] to a test picture (or feature vector). Using similarity measures, one can not only store similar pictures logically or physically close to each other in order to improve retrieval or updating efficiency, one can also use such similarity measures to answer fuzzy queries involving nonexact retrieval conditions. In this paper, similarity directed pictorial databases involving geometric figures, chromosome images, [10] leukocyte images, cardiomyopathy images, and satellite images [11] are presented as illustrative examples.
NASA Astrophysics Data System (ADS)
Luebke, J. P.; Gentry, D.
2016-12-01
This summer I spent my time in the largest state of all the states, with the people who take care of the most important parks, owned by all of us. My job was to take a lot of pictures of real things, small and large, and to make them into one piece on a computer, into pictures that can be moved and turned and can be easily shared across the world at any time. My job had three different classes: very small, pretty big, and very big. For the small things: Using a table that turns, I took many still pictures of old animals turned into rocks as well as things thrown away by people who are now dead. The pieces of rock and old things are important and exciting, but they can break quite easily, so only a few people are allowed to touch them. With the pictures you can move, many more people can learn about, "touch", and see them, but they use a computer instead of their hands. For a pretty big block of ice moving down a long area of land, I took many pictures of the end of it, while at the same time knowing just where I was on the face of the world. Using a computer, I again put all the pictures together into one picture that could be turned and moved. One person with a computer could look at any part of the piece of ice without having to actually visit it. Finally, for the very big things, I was part of a team that would fly slowly over the areas we were interested in, taking pictures about every half of a second. After taking tens of hundreds of pictures, the computer join all the pictures together into a single picture that showed each and every little up and down of the land that we had flown over, getting very few wrong. This way of making pictures you can move doesn't take as much money as other means, and it can be used on things of very different areas, from something as small as a finger to something as large as a huge field of ice moving slowly over time. The people who care for the parks that we all own don't have as much money as some, and in the biggest state, the parks are very far away from each other, but with this way of sharing real things through a computer, the biggest State gets a little smaller.
NASA Astrophysics Data System (ADS)
Linneman, C.; Hults, C.
2017-12-01
This summer I spent my time in the largest state of all the states, with the people who take care of the most important parks, owned by all of us. My job was to take a lot of pictures of real things, small and large, and to make them into one piece on a computer, into pictures that can be moved and turned and can be easily shared across the world at any time. My job had three different classes: very small, pretty big, and very big. For the small things: Using a table that turns, I took many still pictures of old animals turned into rocks as well as things thrown away by people who are now dead. The pieces of rock and old things are important and exciting, but they can break quite easily, so only a few people are allowed to touch them. With the pictures you can move, many more people can learn about, "touch", and see them, but they use a computer instead of their hands. For a pretty big block of ice moving down a long area of land, I took many pictures of the end of it, while at the same time knowing just where I was on the face of the world. Using a computer, I again put all the pictures together into one picture that could be turned and moved. One person with a computer could look at any part of the piece of ice without having to actually visit it. Finally, for the very big things, I was part of a team that would fly slowly over the areas we were interested in, taking pictures about every half of a second. After taking tens of hundreds of pictures, the computer join all the pictures together into a single picture that showed each and every little up and down of the land that we had flown over, getting very few wrong. This way of making pictures you can move doesn't take as much money as other means, and it can be used on things of very different areas, from something as small as a finger to something as large as a huge field of ice moving slowly over time. The people who care for the parks that we all own don't have as much money as some, and in the biggest state, the parks are very far away from each other, but with this way of sharing real things through a computer, the biggest State gets a little smaller.
Dependence of Long Bone Flexural Properties on Bone Mineral Distribution
NASA Technical Reports Server (NTRS)
Katz, BethAnn; Cleek, Tammy M.; Whalen, Robert T.; Connolly, James P. (Technical Monitor)
1995-01-01
The objective of this study is to assess whether a non-invasive determination of long bone cross-sectional areal properties using bone densitometry accurately estimates true long bone flexural properties. In this study, section properties of two pairs of human female embalmed tibiae were compared using two methods: special analysis of bone densitometry data, and experimental determination of flexural regidities from bone surface strain measurements during controlled loading.
Brennan, Sharon L; Wluka, Anita E; Gould, Haslinda; Nicholson, Geoffrey C; Leslie, William D; Ebeling, Peter R; Oldenburg, Brian; Kotowicz, Mark A; Pasco, Julie A
2012-01-01
The World Health Organization identifies that osteoporosis is one of the leading health problems in the Western world. An increased risk of fragility fracture is observed in more socially disadvantaged individuals in most Western countries. Dual-energy X-ray absorptiometry (DXA) is currently the procedure of choice to diagnose osteoporosis and assess fracture risk. We systematically reviewed the literature regarding social determinants of DXA utilization for osteoporosis detection in patients aged 50yr and older using a computer-aided search of MEDLINE, EMBASE, CINAHL, and PsychINFO from January 1994 to December 2010. Five cross-sectional studies, incorporating 16 separate analyses, were identified for inclusion in this review. The best evidence analysis identified limited evidence for a positive association between either income or education with DXA utilization; furthermore, the best evidence analysis found no evidence for an association between either marital status or working status and DXA utilization. Further research is required to identify whether a relationship exists and elucidate reasons for disparities in DXA utilization between different social groups, such as choice and referral processes, as a necessary precursor in identifying modifiable determinants and appropriate strategies to promote preventive screening to identify fracture risk. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Kawase, Setsuko; Naganawa, Shinji; Sone, Michihiko; Ikeda, Mitsuru; Ishigaki, Takeo
2006-06-01
The appropriate cutoff Hounsfield unit (HU) value for the diagnosis of otosclerosis was determined and the correlation between the bone conduction threshold and the findings of computed tomography (CT) densitometry investigated. CT images, 0.5-mm thick, were evaluated in 24 ears with otosclerosis and 19 control ears. Eight regions of interest were set around the otic capsule. The mean HU values in the area anterior to the oval window (A-OW) and anterior to the internal auditory canal (A-IAC) were significantly lower in otosclerosis than in controls. Based on receiver operating characteristic (ROC) analysis, the cutoff HU value in A-OW was determined to be 2,187.3 HU. The mean HU value in retrofenestral otosclerosis was significantly lower in the area A-OW, A-IAC and around the cochlea than in controls. Based on ROC analysis, the cutoff HU value in the latter was determined to be 2,045 HU. A statistically significant correlation was found between the density of the area A-OW and the hearing level at 500 and 1,000 Hz, and between the density of the area around the cochlea and the hearing level at most frequencies. These results suggest the semi-automated diagnosis of otosclerosis may be possible.
Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods
NASA Technical Reports Server (NTRS)
Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.
1990-01-01
Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modem video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.
Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods
NASA Technical Reports Server (NTRS)
Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.
1990-01-01
Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modern video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.
NASA Technical Reports Server (NTRS)
1981-01-01
The Space Transportation System (STS) is discussed, including the launch processing system, the thermal protection subsystem, meteorological research, sound supression water system, rotating service structure, improved hypergol or removal systems, fiber optics research, precision positioning, remote controlled solid rocket booster nozzle plugs, ground operations for Centaur orbital transfer vehicle, parachute drying, STS hazardous waste disposal and recycle, toxic waste technology and control concepts, fast analytical densitometry study, shuttle inventory management system, operational intercommunications system improvement, and protective garment ensemble. Terrestrial applications are also covered, including LANDSAT applications to water resources, satellite freeze forecast system, application of ground penetrating radar to soil survey, turtle tracking, evaluating computer drawn ground cover maps, sparkless load pulsar, and coupling a microcomputer and computing integrator with a gas chromatograph.
Processor Would Find Best Paths On Map
NASA Technical Reports Server (NTRS)
Eberhardt, Silvio P.
1990-01-01
Proposed very-large-scale integrated (VLSI) circuit image-data processor finds path of least cost from specified origin to any destination on map. Cost of traversal assigned to each picture element of map. Path of least cost from originating picture element to every other picture element computed as path that preserves as much as possible of signal transmitted by originating picture element. Dedicated microprocessor at each picture element stores cost of traversal and performs its share of computations of paths of least cost. Least-cost-path problem occurs in research, military maneuvers, and in planning routes of vehicles.
Pleurisy and Other Pleural Disorders
... structures in your chest. This test provides a computer-generated picture of your lungs that can show ... chest MRI , uses radio waves, magnets, and a computer to created detailed pictures of the structures in ...
Development, Maintenance & Operation - Computer Hardware & Software No Picture Jim Alessi - Group , Maintenance & Operation No Picture Bob Eich - Accelerator Operator No Picture Irv Feigenbaum (Retired
Quantitative data standardization of X-ray based densitometry methods
NASA Astrophysics Data System (ADS)
Sergunova, K. A.; Petraikin, A. V.; Petrjajkin, F. A.; Akhmad, K. S.; Semenov, D. S.; Potrakhov, N. N.
2018-02-01
In the present work is proposed the design of special liquid phantom for assessing the accuracy of quantitative densitometric data. Also are represented the dependencies between the measured bone mineral density values and the given values for different X-ray based densitometry techniques. Shown linear graphs make it possible to introduce correction factors to increase the accuracy of BMD measurement by QCT, DXA and DECT methods, and to use them for standardization and comparison of measurements.
Advanced imaging of the macrostructure and microstructure of bone
NASA Technical Reports Server (NTRS)
Genant, H. K.; Gordon, C.; Jiang, Y.; Link, T. M.; Hans, D.; Majumdar, S.; Lang, T. F.
2000-01-01
Noninvasive and/or nondestructive techniques are capable of providing more macro- or microstructural information about bone than standard bone densitometry. Although the latter provides important information about osteoporotic fracture risk, numerous studies indicate that bone strength is only partially explained by bone mineral density. Quantitative assessment of macro- and microstructural features may improve our ability to estimate bone strength. The methods available for quantitatively assessing macrostructure include (besides conventional radiographs) quantitative computed tomography (QCT) and volumetric quantitative computed tomography (vQCT). Methods for assessing microstructure of trabecular bone noninvasively and/or nondestructively include high-resolution computed tomography (hrCT), micro-computed tomography (muCT), high-resolution magnetic resonance (hrMR), and micromagnetic resonance (muMR). vQCT, hrCT and hrMR are generally applicable in vivo; muCT and muMR are principally applicable in vitro. Although considerable progress has been made in the noninvasive and/or nondestructive imaging of the macro- and microstructure of bone, considerable challenges and dilemmas remain. From a technical perspective, the balance between spatial resolution versus sampling size, or between signal-to-noise versus radiation dose or acquisition time, needs further consideration, as do the trade-offs between the complexity and expense of equipment and the availability and accessibility of the methods. The relative merits of in vitro imaging and its ultrahigh resolution but invasiveness versus those of in vivo imaging and its modest resolution but noninvasiveness also deserve careful attention. From a clinical perspective, the challenges for bone imaging include balancing the relative advantages of simple bone densitometry against the more complex architectural features of bone or, similarly, the deeper research requirements against the broader clinical needs. The considerable potential biological differences between the peripheral appendicular skeleton and the central axial skeleton have to be addressed further. Finally, the relative merits of these sophisticated imaging techniques have to be weighed with respect to their applications as diagnostic procedures requiring high accuracy or reliability on one hand and their monitoring applications requiring high precision or reproducibility on the other. Copyright 2000 S. Karger AG, Basel.
Tornow, R P; Stilling, R; Zrenner, E
1999-10-01
To test the feasibility of scanning laser densitometry with a modified Rodenstock scanning laser ophthalmoscope (SLO) to measure the rod and cone photopigment distribution in patients with retinal diseases. Scanning laser densitometry was performed using a modified Rodenstock scanning laser ophthalmoscope. The distribution of the photopigments was calculated from dark adapted and bleached images taken with the 514 nm laser of the SLO. This wavelength is absorbed by rod and cone photopigments. Discrimination is possible due to their different spatial distribution. Additionally, to measure retinal sensitivity profiles, dark adapted two color static perimetry with a Tübinger manual perimeter was performed along the horizontal meridian with 1 degree spacing. A patient with retinitis pigmentosa had slightly reduced photopigment density within the central +/- 5 degrees but no detectable photopigment for eccentricities beyond 5 degrees. A patient with cone dystrophy had nearly normal pigment density beyond +/- 5 degrees, but considerably reduced photopigment density within the central +/- 5 degrees. Within the central +/- 5 degrees, the patient with retinitis pigmentosa had normal sensitivity for the red stimulus and reduced sensitivity for the green stimulus. There was no measurable function beyond 7 degrees. The patient with cone dystrophy had normal sensitivity for the green stimulus outside the foveal center and reduced sensitivity for the red stimulus at the foveal center. The results of color perimetry for this patient with a central scotoma were probably influenced by eccentric fixation. Scanning laser densitometry with a modified Rodenstock SLO is a useful method to assess the human photopigment distribution. Densitometry results were confirmed by dark adapted two color static perimetry. Photopigment distribution and retinal sensitivity profiles can be measured with high spatial resolution. This may help to measure exactly the temporal development of retinal diseases and to test the success of different therapeutic treatments. Both methods have limitations at the present state of development. However, some of these limitations can be overcome by further improving the instruments.
Internet design preferences of patients with cancer.
Chernecky, Cynthia; Macklin, Denise; Walter, Jennifer
2006-07-01
To describe computer experience and preferences for multimedia design. Prospective, descriptive. Physician office and outpatient cancer centers in an urban area in the southeastern United States. Convenience sample of 22 volunteer patients with cancer from four racial groups. A questionnaire on computer experiences was followed by a hands-on computer session with questions regarding preferences for seven interface items. Data termination occurred when sample size was obtained. Design of Internet education site for patients. Variables include preferences, computer, cancer, multimedia, and education. Eighty-two percent had personal computers, 41% used a computer daily, and 95% believed that computers would be a good avenue for learning about cancer care. Preferences included display colors in blue and green hues; colored buttons; easy-to-read text; graphics with a simple design and large, clear pictures; serif font in dark type; light-colored background; and larger photo size in a rectangle shape. Most popular graphic icons as metaphors were 911 for emergency, picture of skull and crossbones for danger, and a picture of a string on an index finger representing reminder. The simple layout most preferred for appearances was one that included text and pictures, read from left to right, and was symmetrical in its placement of pictures and text on the page. Preferences are necessary to maintain interest and support navigation through computer designs to enhance the translation of knowledge to patients. Development of multimedia based on patient preferences will enhance education, learning, and, ultimately, quality patient care.
Hans, Didier B; Kanis, John A; Baim, Sanford; Bilezikian, John P; Binkley, Neil; Cauley, Jane A; Compston, Juliet E; Cooper, Cyrus; Dawson-Hughes, Bess; El-Hajj Fuleihan, Ghada; Leslie, William D; Lewiecki, E Michael; Luckey, Marjorie M; McCloskey, Eugene V; Papapoulos, Socrates E; Poiana, Catalina; Rizzoli, René
2011-01-01
The International Society for Clinical Densitometry (ISCD) and the International Osteoporosis Foundation (IOF) convened the FRAX(®) Position Development Conference (PDC) in Bucharest, Romania, on November 14, 2010, following a two-day joint meeting of the ISCD and IOF on the "Interpretation and Use of FRAX(®) in Clinical Practice." These three days of critical discussion and debate, led by a panel of international experts from the ISCD, IOF and dedicated task forces, have clarified a number of important issues pertaining to the interpretation and implementation of FRAX(®) in clinical practice. The Official Positions resulting from the PDC are intended to enhance the quality and clinical utility of fracture risk assessment worldwide. Since the field of skeletal assessment is still evolving rapidly, some clinically important issues addressed at the PDCs are not associated with robust medical evidence. Accordingly, some Official Positions are based largely on expert opinion. Despite limitations inherent in such a process, the ISCD and IOF believe it is important to provide clinicians and technologists with the best distillation of current knowledge in the discipline of bone densitometry and provide an important focus for the scientific community to consider. This report describes the methodology and results of the ISCD-IOF PDC dedicated to FRAX(®). Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Perceptual Considerations in Icon Design for Instructional Communication.
ERIC Educational Resources Information Center
Lee, Shih-Chung
1996-01-01
Discusses the use of icons in computer interface design. Highlights include picture processing time, complexity, recognition memory, differences between picture icons and picture/text icons, the use of color, size, placement, and touch design. (LRW)
Shaded-Color Picture Generation of Computer-Defined Arbitrary Shapes
NASA Technical Reports Server (NTRS)
Cozzolongo, J. V.; Hermstad, D. L.; Mccoy, D. S.; Clark, J.
1986-01-01
SHADE computer program generates realistic color-shaded pictures from computer-defined arbitrary shapes. Objects defined for computer representation displayed as smooth, color-shaded surfaces, including varying degrees of transparency. Results also used for presentation of computational results. By performing color mapping, SHADE colors model surface to display analysis results as pressures, stresses, and temperatures. NASA has used SHADE extensively in sign and analysis of high-performance aircraft. Industry should find applications for SHADE in computer-aided design and computer-aided manufacturing. SHADE written in VAX FORTRAN and MACRO Assembler for either interactive or batch execution.
NASA Astrophysics Data System (ADS)
Coecke, Bob; Kissinger, Aleks
2017-03-01
Preface; 1. Introduction; 2. Guide to reading this textbook; 3. Processes as diagrams; 4. String diagrams; 5. Hilbert space from diagrams; 6. Quantum processes; 7. Quantum measurement; 8. Picturing classical-quantum processes; 9. Picturing phases and complementarity; 10. Quantum theory: the full picture; 11. Quantum foundations; 12. Quantum computation; 13. Quantum resources; 14. Quantomatic; Appendix A. Some notations; References; Index.
28 CFR 75.6 - Statement describing location of books and records.
Code of Federal Regulations, 2011 CFR
2011-07-01
...- or computer-manipulated image, digital image, or picture, or other matter (including but not limited... the book, magazine, periodical, film, videotape, digitally- or computer-manipulated image, digital image, picture, or other matter to affix the statement. In this paragraph, the term “copy” includes...
ERIC Educational Resources Information Center
Presno, Caroline
1997-01-01
Discusses computer instruction in light of Bruner's theory of three forms of representation (action, icons, and symbols). Examines how studies regarding Paivio's dual-coding theory and studies focusing on procedural knowledge support Bruner's theory. Provides specific examples for instruction in three categories: demonstrations, pictures and…
Sklarew, R J
1983-10-01
A method has been developed for densitometric estimation of the Feulgen-stained DNA content of 3H-labeled nuclei in autoradiographs in conjunction with automated grain counting using a Quantimet Imaging System. Refinements in the methodology are reported which include 1) the incorporation of an Image-Editor Module into the Quantimet module configuration; 2) the optimization of incident illumination based upon evaluation of various light sources; 3) changes in the optical configuration which reduce glare and minimize the level of monitor shading correction; 4) the optimization of scanner sensitivity; and 5) the evaluation of cell-flattening and staining with respect to densitometry resolution and sensitivity. These refinements resulted in a CV of less than 6.4% in the G-1 and G-2 DNA peaks of rat kidney cells in autoradiographs compared to the previous CV of 10.5%, and a G-2 to G-1 ratio of 2.025. For a fixed field position the CV was 5.1% and the replication error less than 1.0%.
Current methods and advances in bone densitometry
NASA Technical Reports Server (NTRS)
Guglielmi, G.; Gluer, C. C.; Majumdar, S.; Blunt, B. A.; Genant, H. K.
1995-01-01
Bone mass is the primary, although not the only, determinant of fracture. Over the past few years a number of noninvasive techniques have been developed to more sensitively quantitate bone mass. These include single and dual photon absorptiometry (SPA and DPA), single and dual X-ray absorptiometry (SXA and DXA) and quantitative computed tomography (QCT). While differing in anatomic sites measured and in their estimates of precision, accuracy, and fracture discrimination, all of these methods provide clinically useful measurements of skeletal status. It is the intent of this review to discuss the pros and cons of these techniques and to present the new applications of ultrasound (US) and magnetic resonance (MRI) in the detection and management of osteoporosis.
Simulating forest pictures by impact printers
Elliot L. Amidon; E. Joyce Dye
1978-01-01
Two mechanical devices that are mainly used to print computer output in text form can simulate pictures of terrain and forests. The line printer, which is available for batch processing at many computer installations, can approximate halftones by using overstruck characters to produce successively larger "dots." The printer/plotter, which is normally used as...
Pedersen, Iben Bach; Ivarsen, Anders; Hjortdal, Jesper
2017-01-01
To evaluate 12-month changes in refraction, visual outcome, corneal densitometry, and postoperative aberrations after small incision lenticule extraction (SMILE) for myopic astigmatism. This 12-month prospective clinical trial comprised 101 eyes (101 patients) treated with SMILE for myopic astigmatism with cylinder of 0.75 to 4.00 diopters (D). The preoperative, 1-week, and 1-, 3-, 6-, 9-, and 12-month examinations included measurement of manifest refraction, uncorrected distance visual acuity (UDVA), and corrected (CDVA) distance visual acuity. Astigmatic error vector analysis was performed using Al-pin's method. Densitometry and aberrations were evaluated with Pentacam HR (Oculus Optikgeräte, Wetzlar, Germany). Preoperative spherical equivalent averaged -6.78 ± 1.90 D with 1.81 ± 1.00 D in cylinder correction. After 12 months, 74% and 93% of the eyes were within ±0.50 and ±1.00 D of the attempted refraction, respectively. The logMAR UDVA and CDVA averaged 0.03 ± 0.16 and -0.08 ± 0.09, respectively. Vector analysis showed a with-the-rule undercorrection at 12 months with a mean difference vector of 0.31 D @ 91°. There was a minor counterclockwise rotation of the axis, with an arithmetic angle of error of 0.34° ± 14°. An undercorrection of approximately 11% per diopter of attempted correction was seen at 12 months. Spherical aberrations, coma, and higher order aberrations remained stable during the postoperative period (P < .09). After 12 months, no increase in densitometry could be identified. Treatment of astigmatism with SMILE seems to be predictable and effective, but with an astigmatic undercorrection of approximately 11% and a small counterclockwise rotation of the axis. [J Refract Surg. 2017;33(1):11-17.]. Copyright 2017, SLACK Incorporated.
The usefulness of densitometry in predicting the composition and fragility of urolithiasis.
Argüelles-Salido, Enrique; Lozano-Blasco, Jose Maria; Subira-Rios, Jorge; Bernardo-Villar, Pastora; Podio-Lora, Virtudes; Campoy-Martínez, Pedro; Vazquez-Albertino, Ricardo; Medina-Lopez, Rafael
2014-04-01
The choice of ideal treatment for a given lithiasis is a crucial factor for its success, minimizing the number of interventions and complications. Previous determination of stone composition and its fragility is desirable, to predict its behavior during extracorporeal shock wave lithotripsy and for evaluation of its appropriateness, or to set the indication for other techniques. To determine the role of densitometry in the prediction of composition and fragility of urinary lithiasis undergoing SWL. Experimental prospective, blinded, in vitro study using 193 urinary calculi of known composition : monohydrated calcium oxalate, mixed calcium oxalate, uric acid, and calcium carbonate, obtained from spontaneous passage or surgery. Densitometry and SWL were performed on them. We compare the mineral composition of the stone and mineral density of each composition group to check if they are characteristic of each type and correlate these parameters with the energy dose required to fragment them down to a given fragment size. Only 53 out of 193 stones showed valuable data. Calcium carbonate was the composition showing grater mineral content and density (1,24 gr and 0,47 gr/cm2), followed by mixed oxalate (0,51/0,26) and uric acid (0,52/ 0,15), finishing with the monohydrate calcium oxalate group (0,32/0,05).Only the comparison between calcium carbonate and monohydrated calcium oxalate showed statistically significant results (p<0,05). Correlation coefficients between mineral content (0,347) and density (0,424) and the energy used for stone fragmentation to a given fragment size were statistically significant (p<0,05) CONCLUSIONS: In our study, the use of densitometry to determine stone composition and lithiasic fragility did not show conclusive results due to the limited number of calculi tested. Nevertheless, there are signs that, with a different study design , more practically useful results could be achieved.
The Mariner 6 and 7 pictures of Mars
NASA Technical Reports Server (NTRS)
Collins, S. A., Jr.
1971-01-01
A comprehensive set of high quality reproductions of the final, computer-processed television pictures of Mars is presented. The genesis and unique characteristics of the pictures are explained, interesting features are pointed out, and some indication of their significance in the history of Mars investigations is provided.
The Development of a Computer Controlled Super 8 Motion Picture Projector.
ERIC Educational Resources Information Center
Reynolds, Eldon J.
Instructors in Child Development at the University of Texas at Austin selected sound motion pictures as the most effective medium to simulate the observation of children in nursery laboratories. A computer controlled projector was designed for this purpose. An interface and control unit controls the Super 8 projector from a time-sharing computer…
29 CFR 541.709 - Motion picture producing industry.
Code of Federal Regulations, 2010 CFR
2010-07-01
... DEFINING AND DELIMITING THE EXEMPTIONS FOR EXECUTIVE, ADMINISTRATIVE, PROFESSIONAL, COMPUTER AND OUTSIDE SALES EMPLOYEES Definitions and Miscellaneous Provisions § 541.709 Motion picture producing industry...
29 CFR 541.709 - Motion picture producing industry.
Code of Federal Regulations, 2014 CFR
2014-07-01
... DEFINING AND DELIMITING THE EXEMPTIONS FOR EXECUTIVE, ADMINISTRATIVE, PROFESSIONAL, COMPUTER AND OUTSIDE SALES EMPLOYEES Definitions and Miscellaneous Provisions § 541.709 Motion picture producing industry...
29 CFR 541.709 - Motion picture producing industry.
Code of Federal Regulations, 2011 CFR
2011-07-01
... DEFINING AND DELIMITING THE EXEMPTIONS FOR EXECUTIVE, ADMINISTRATIVE, PROFESSIONAL, COMPUTER AND OUTSIDE SALES EMPLOYEES Definitions and Miscellaneous Provisions § 541.709 Motion picture producing industry...
29 CFR 541.709 - Motion picture producing industry.
Code of Federal Regulations, 2013 CFR
2013-07-01
... DEFINING AND DELIMITING THE EXEMPTIONS FOR EXECUTIVE, ADMINISTRATIVE, PROFESSIONAL, COMPUTER AND OUTSIDE SALES EMPLOYEES Definitions and Miscellaneous Provisions § 541.709 Motion picture producing industry...
29 CFR 541.709 - Motion picture producing industry.
Code of Federal Regulations, 2012 CFR
2012-07-01
... DEFINING AND DELIMITING THE EXEMPTIONS FOR EXECUTIVE, ADMINISTRATIVE, PROFESSIONAL, COMPUTER AND OUTSIDE SALES EMPLOYEES Definitions and Miscellaneous Provisions § 541.709 Motion picture producing industry...
Neutron Resonance Densitometry for Particle-like Debris of Melted Fuel
NASA Astrophysics Data System (ADS)
Harada, H.; Kitatani, F.; Koizumi, M.; Takamine, J.; Kureta, M.; Tsutiya, H.; Iimura, H.; Seya, M.; Becker, B.; Kopecky, S.; Schillebeeckx, P.
2014-04-01
Neutron Resonance Densitometry (NRD) is proposed for the quantification of nuclear materials in particle-like debris of melted fuel from the reactors of the Fukushima Daiichi nuclear power plant. The method is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). It uses the neutron time-of-flight (TOF) technique with a pulsed white neutron source and a neutron flight path as short as 5 m. The spectrometer for NRCA is made of LaBr3(Ce) detectors. The achievable uncertainty due to only counting statistics is less than 1 % to determine Pu and U isotopes.
Seasonal vegetation differences from ERTS imagery
NASA Technical Reports Server (NTRS)
Ashley, M. D.; Rea, J.
1975-01-01
Knowledge of the times when crop and forest vegetation experience seasonally related changes in development is important in understanding growth and yield relationships. This article describes how densitometry of earth resources technology satellite (ERTS-1) multispectral scanner (MSS) imagery can be used to identify such phenological events. Adjustments for instrument calibration, aperture size, gray-scale differences between overpasses, and normalization of changing solar elevation are considered in detail. Seasonal vegetation differences can be identified by densitometry of band 5 (0.6-0.7 microns) and band 7 (0.8-1.1 microns) MSS imagery. Band-to-band ratios of the densities depicted the changes more graphically than the individual band readings.
Comparison of instruments for dual-energy X-ray bone mineral densitometry.
Vainio, P; Ahonen, E; Leinonen, K; Sievänen, H; Koski, E
1992-04-01
While bone mineral densitometry has become a common laboratory test, it is important to pay attention to the compatibility of the results from different instruments. In this study results from three commercially available bone densitometers are compared using both patient and phantom studies. Overall correlation between instruments was good but there were systematic discrepancies in the results. The three instruments provided bone mineral density (BMD) values that differed by as much as 13.5% due to differences as large as 6% in bone mineral content and as large as 7% in bone area. Thus, the BMD values obtained from different manufacturers' instruments are not directly comparable.
Pitakpawasutthi, Yamon; Thitikornpong, Worathat; Palanuvej, Chanida; Ruangrungsi, Nijsiri
2016-01-01
Chromolaena odorata (L.) R. M. King and H. Rob. is a Thai medicinal plant used for the treatment of wounds, rashes, diabetes, and insect repellent. The leaves of C. odorata were collected from 10 different sources throughout Thailand. The chemical constituents of essential oils were hydro-distilled from the leaves and were analyzed by gas chromatography-mass spectrometry. Chlorogenic acid contents were determined by thin-layer chromatography (TLC) - densitometry with winCATS software and TLC image analysis with ImageJ software. The TLC plate was developed in the mobile phase that consisted of ethyl acetate:water:formic acid (17:3:2). Antioxidant activities were examined by 1,1-diphenyl-2-picryl hydrazyl (DPPH) radical scavenging and β-carotene bleaching assays. C. odorata essential oil has shown the major components of pregeijerene, dauca-5, 8-diene, (E)-caryophyllene, β-pinene, and α-pinene. The chlorogenic acid content of C. odorata leaves was determined by TLC-densitometry and TLC image analysis. Results have shown that TLC-densitometry and TLC image analysis method were not statistically significantly different. DPPH radical scavenging and β-carotene bleaching assays of ethanolic extract of C. odorata leaves showed its antioxidant potential. PMID:27144150
ERIC Educational Resources Information Center
Marschalek, Douglas G.
1988-01-01
Describes study of children in grades one, three, and five that examined their active processing and short term memory (STM) of color, contour, and interior pattern of shapes found in computer digitized pictures. Age-related differences are examined, and the role of processing visual information in the learning process is discussed. (12…
Grasp Representations Depend on Knowledge and Attention
ERIC Educational Resources Information Center
Chua, Kao-Wei; Bub, Daniel N.; Masson, Michael E. J.; Gauthier, Isabel
2018-01-01
Seeing pictures of objects activates the motor cortex and can have an influence on subsequent grasping actions. However, the exact nature of the motor representations evoked by these pictures is unclear. For example, action plans engaged by pictures could be most affected by direct visual input and computed online based on object shape.…
Using bone densitometry to monitor therapy in treating osteoporosis: pros and cons.
Deal, C L
2001-06-01
Measurement of bone density is crucial for evaluating fracture risk. Low bone mass is a powerful predictor of fracture and is necessary to assess the need for treatment. Dual energy x-ray absorptiometry is accurate and precise. Use of bone density for monitoring therapy is an important tool for evaluating response to therapy, but an understanding of the limitations of the procedure are important for the practicing physician. Precision error of the technology and what change in density is clinically significant (least significant change) are important concepts to interpret results and make appropriate treatment decisions. This article reviews the use of bone densitometry as a tool for monitoring treatment in patients with low bone mass.
ERIC Educational Resources Information Center
Walker, Jearl
1982-01-01
Spatial filtering, based on diffraction/interference of light waves, is a technique by which unwanted information in a picture ("noise") can be separated from wanted information. A series of experiments is described in which students can create a system that functions as an optical computer to create clearer pictures. (Author/JN)
[Evaluation of bone mineral density in children with sickle cell disease].
Garrido Colino, C; Beléndez Bieler, C; Pérez Díaz, M; Cela de Julián, E
2015-04-01
To evaluate bone mineral density (BMD) in children with sickle cell disease (SCD) in the Community of Madrid. The BMD was estimated in 40 children with SCD, and with an age range between 3 and 16 years, using densitometry (DXA), as recommended by the International Society for Clinical Densitometry (ISCD). The mean age at the time of the study was 7.97±3.95 years, the mean value of the DXA expressed in Z -score was -0.91±1.46 with a range of minimum values - 5.30 and 2.30 maximum. More than half (57.5%) of all the children had normal BMD (Z>-1), 25% had low BMD (Z between -1 and -2), and 17.5% showed an abnormal Z -score values of osteoporosis (Z -score<-2). The Pearson linear correlation was statistically significant between Z -score value and the haemoglobin level (r=0.368, p=.019), finding no correlation with the levels of 25 (OH) vitamin D. Prospective studies are needed with a larger number of patients to understand the future implications of bone densitometry changes and associated risk factors. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.
A systematic quality assurance study in bone densitometry devices
NASA Astrophysics Data System (ADS)
Tuncman, Duygu; Kovan, Hatice; Kovan, Bilal; Demir, Bayram; Turkmen, Cuneyt
2015-07-01
Osteoporosis is the most common metabolic bone disease and can result in devastating physical, psychosocial, and economic consequences. It occurs in women after menopause and affects most elderly. Dual-energy x-ray absorptiometry (DXA) is currently the most widely used method for the measurement of areal Bone Mineral Density (BMD) (g/cm2) .DXA is based on the variable absorption of X-ray by the different body components and uses high and low energy X-ray photons. There are two important values in the assessment of the DXA. These values are T-score and Z-score. The T-score is calculated by taking the difference between a patient's measured BMD with the mean BMD of the young normal population, matched for gender and ethnicity, and then by dividing the difference with the standard deviation (SD) of the BMD of the young normal population. T-score and also Z-score are directly depends on the Bone Mineral Density (BMD). BMD measurements should be made periodically in a patient life. But mostly, it is not possible with the same device. Therefore, in this study, for the quality assurance of bone densitometry devices, we evaluated the BMD results measured in the different Bone Densitometry (DXA) devices using a spine phantom.
2012-03-01
by using a common communication technology there is no need to develop a complicated communications plan and generate an ad - hoc communications...DISTRIBUTION CODE A 13. ABSTRACT (maximum 200 words) Maintaining an accurate Common Operational Picture (COP) is a strategic requirement for...TERMS Android Programming, Cloud Computing, Common Operating Picture, Web Programing 16. PRICE CODE 17. SECURITY CLASSIFICATION OF REPORT
Aerenhouts, Dirk
2015-01-01
A recommended field method to assess body composition in adolescent sprint athletes is currently lacking. Existing methods developed for non-athletic adolescents were not longitudinally validated and do not take maturation status into account. This longitudinal study compared two field methods, i.e., a Bio Impedance Analysis (BIA) and a skinfold based equation, with underwater densitometry to track body fat percentage relative to years from age at peak height velocity in adolescent sprint athletes. In this study, adolescent sprint athletes (34 girls, 35 boys) were measured every 6 months during 3 years (age at start = 14.8 ± 1.5yrs in girls and 14.7 ± 1.9yrs in boys). Body fat percentage was estimated in 3 different ways: 1) using BIA with the TANITA TBF 410; 2) using a skinfold based equation; 3) using underwater densitometry which was considered as the reference method. Height for age since birth was used to estimate age at peak height velocity. Cross-sectional analyses were performed using repeated measures ANOVA and Pearson correlations between measurement methods at each occasion. Data were analyzed longitudinally using a multilevel cross-classified model with the PROC Mixed procedure. In boys, compared to underwater densitometry, the skinfold based formula revealed comparable values for body fatness during the study period whereas BIA showed a different pattern leading to an overestimation of body fatness starting from 4 years after age at peak height velocity. In girls, both the skinfold based formula and BIA overestimated body fatness across the whole range of years from peak height velocity. The skinfold based method appears to give an acceptable estimation of body composition during growth as compared to underwater densitometry in male adolescent sprinters. In girls, caution is warranted when interpreting estimations of body fatness by both BIA and a skinfold based formula since both methods tend to give an overestimation. PMID:26317426
Pekel, Gökhan; Cetin, Ebru Nevin; Acer, Semra; Yagci, Ramazan; Altintas, Seher; Ongun, Gülin Tugba
2014-06-01
To evaluate the effects of chronic tobacco smoking on lens nucleus by Pentacam HR lens densitometry (LD) in young adults. Prospective cross-sectional case series. Thirty subjects (23 M, 7 F) who were chronic cigarette smokers (≥10 cigarettes/day for at least 2 years) (group 1) and another 30 subjects (23 M, 7 F) who did not smoke (group 2), were included in this study. The patients were matched for age and sex between the groups. The exclusion criteria were any history of ocular surgery, any systemic disorders and any ocular diseases except for mild refractive disorders. Lens densitometry measurements were done with the Pentacam HR (Oculus, Wetzlar, Germany). The Schirmer test and pachymetry measurements were also performed. Mean age of the patients for both groups was 28.90 ± 8.20 years (range: 18-40 years). Mean lens densitometry (LD) measurements of Group 1 (chronic cigarette smoking group) were higher than those of Group 2 (control group) in all LD techniques; however only mean "peak" LD measurements showed a statistically significant difference between these two groups (Group 1: 8.67 ± 0.61, Group 2: 8.44 ± 0.70, p = 0.04). The mean Schirmer test value was 12.43 ± 5.60 mm in Group 1 and 13.00 ± 4.26 mm in Group 2 (p = 0.55). The mean central corneal thickness (CCT) value was 564.23 ± 34.61 µm in Group 1 and 550.47 ± 32.94 µm in Group 2 (p = 0.03). The Pentacam HR LD seems to be an important option for the evaluation of lens nucleus in young adults, because it gives objective and quantitative data. Although chronic smoking increases lens nucleus density in young adults, the effect is not statistically significant when compared with the control group.
We Have Met Our Past and Our Future: Thanks for the Walk down Memory Lane
ERIC Educational Resources Information Center
Wiseman, Robert C.
2006-01-01
In this article, the author takes the readers for a walk down memory lane on the use of teaching aids. He shares his experience of the good old days of Audio Visual--opaque projector, motion pictures/films, recorders, and overhead projector. Computers have arrived, and now people can make graphics, pictures, motion pictures, and many different…
Incremental Lexical Learning in Speech Production: A Computational Model and Empirical Evaluation
ERIC Educational Resources Information Center
Oppenheim, Gary Michael
2011-01-01
Naming a picture of a dog primes the subsequent naming of a picture of a dog (repetition priming) and interferes with the subsequent naming of a picture of a cat (semantic interference). Behavioral studies suggest that these effects derive from persistent changes in the way that words are activated and selected for production, and some have…
Photojournalism Issues for the 1990s: Concerns for All Teachers of Journalism Courses.
ERIC Educational Resources Information Center
Lester, Paul
Journalism instructors are concerned that the credibility of images and consequently of words will suffer if the image content, as the photographer took the picture at the time, is altered by a computer operator far removed from the actual scene. Any discussion of picture manipulation ethics must take into account where and why a picture was…
ERIC Educational Resources Information Center
Eisenberg, Sarita L.; Guo, Ling-Yu
2015-01-01
Purpose: The purpose of this study was to investigate whether a shorter language sample elicited with fewer pictures (i.e., 7) would yield a percent grammatical utterances (PGU) score similar to that computed from a longer language sample elicited with 15 pictures for 3-year-old children. Method: Language samples were elicited by asking forty…
Interactive computer graphics - Why's, wherefore's and examples
NASA Technical Reports Server (NTRS)
Gregory, T. J.; Carmichael, R. L.
1983-01-01
The benefits of using computer graphics in design are briefly reviewed. It is shown that computer graphics substantially aids productivity by permitting errors in design to be found immediately and by greatly reducing the cost of fixing the errors and the cost of redoing the process. The possibilities offered by computer-generated displays in terms of information content are emphasized, along with the form in which the information is transferred. The human being is ideally and naturally suited to dealing with information in picture format, and the content rate in communication with pictures is several orders of magnitude greater than with words or even graphs. Since science and engineering involve communicating ideas, concepts, and information, the benefits of computer graphics cannot be overestimated.
Three-Dimensional Computer Graphics Brain-Mapping Project
1988-03-24
1975-76, one of these brains was hand digitized. It was then reconstructed three dimensionally, using an Evans and Sutherland Picture System 2. This...Yakovlev Collection, we use the Evans and Sutherland Picture System 2 which we have been employing for this purpose for a dozen years. Its virtue is...careful, experimentally designed new protocol (See Figure 20). Most of these heads were imaged with Computed Tomography, thanks to Clint Stiles of Picker
Investigating Background Pictures for Picture Gesture Authentication
2017-06-01
computing , stating “Microsoft is committed to making sure that the technology within the agreement has a mobile-first focus, and we 2 expect to begin to...Budget, Paperwork Reduction Project (0704-0188) Washington DC 20503. 1. AGENCY USE ONLY (Leave Blank) 2. REPORT DATE 06-16-2017 3. REPORT TYPE AND...unlimited. 12b. DISTRIBUTION CODE 13. ABSTRACT (maximum 200 words) The military relies heavily on computer systems. Without a strong method of authentication
Summers, Ronald M; Baecher, Nicolai; Yao, Jianhua; Liu, Jiamin; Pickhardt, Perry J; Choi, J Richard; Hill, Suvimol
2011-01-01
To show the feasibility of calculating the bone mineral density (BMD) from computed tomographic colonography (CTC) scans using fully automated software. Automated BMD measurement software was developed that measures the BMD of the first and second lumbar vertebrae on computed tomography and calculates the mean of the 2 values to provide a per patient BMD estimate. The software was validated in a reference population of 17 consecutive women who underwent quantitative computed tomography and in a population of 475 women from a consecutive series of asymptomatic patients enrolled in a CTC screening trial conducted at 3 medical centers. The mean (SD) BMD was 133.6 (34.6) mg/mL (95% confidence interval, 130.5-136.7; n = 475). In women aged 42 to 60 years (n = 316) and 61 to 79 years (n = 159), the mean (SD) BMDs were 143.1 (33.5) and 114.7 (28.3) mg/mL, respectively (P < 0.0001). Fully automated BMD measurements were reproducible for a given patient with 95% limits of agreement of -9.79 to 8.46 mg/mL for the mean difference between paired assessments on supine and prone CTC. Osteoporosis screening can be performed simultaneously with screening for colorectal polyps.
A novel method to acquire 3D data from serial 2D images of a dental cast
NASA Astrophysics Data System (ADS)
Yi, Yaxing; Li, Zhongke; Chen, Qi; Shao, Jun; Li, Xinshe; Liu, Zhiqin
2007-05-01
This paper introduced a newly developed method to acquire three-dimensional data from serial two-dimensional images of a dental cast. The system consists of a computer and a set of data acquiring device. The data acquiring device is used to take serial pictures of the a dental cast; an artificial neural network works to translate two-dimensional pictures to three-dimensional data; then three-dimensional image can reconstruct by the computer. The three-dimensional data acquiring of dental casts is the foundation of computer-aided diagnosis and treatment planning in orthodontics.
Ashizawa, Yuko; Tachikawa, Hirokazu; Hori, Masashi; Hori, Takafumi; Mizukami, Katsuyoshi; Asada, Takashi
2004-01-01
A patient with catatonic type schizophrenia drawing 3-dimensional computer graphics (3DCGs) before and after the onset is reported. His 3DCGs are discussed from the view of psychopathology. A 21-year-old male was admitted to our hospital. He was an art student. For three months before admission, he had been absorbed in drawing 3DCGs. When he was asked to draw handmade pictures by his teacher, he experienced a bizarre mood and took an overdose of aspirin. At the time of admission, he was in a stupor state, and was diagnosed with catatonic type schizophrenia. After admission, he exhibited excitement and disorganized speech. These symptoms disappeared after administration of neuroleptics, and he was discharged. The 3DCGs he drew before and after the onset revealed several special characteristics. First, the compositions of his pictures were too geometric and too precise. Secondly, the themes of his pictures changed from romantic before the onset to symbolic after it, and the styles changed from realistic to abstractive after the onset. Finally, histograms of the 3DCGs revealed many colors before onset, which converged to simple colors after. Therefore, it was suggested that the latent pathological process at the beginning of schizophrenia might be reflected in his 3DCGs. 3DCGs are a new type of fine art. They can express beautiful and cool images more simply than handmade pictures. Due to these features, artists can create images of their innerworld, with less effort and talent than picture drawings, by computer assistance. This case suggests that the geometric working space, change-free viewpoints, and computer assistance, which are characteristics of the methods in making 3DCGs may be suitable for schizophrenic artists to create images of their innerworld. However, being absorbed in making 3DCGs could also promote the latent schizophrenic process to the onset.
Study of journal bearing dynamics using 3-dimensional motion picture graphics
NASA Technical Reports Server (NTRS)
Brewe, D. E.; Sosoka, D. J.
1985-01-01
Computer generated motion pictures of three dimensional graphics are being used to analyze journal bearings under dynamically loaded conditions. The motion pictures simultaneously present the motion of the journal and the pressures predicted within the fluid film of the bearing as they evolve in time. The correct prediction of these fluid film pressures can be complicated by the development of cavitation within the fluid. The numerical model that is used predicts the formation of the cavitation bubble and its growth, downstream movement, and subsequent collapse. A complete physical picture is created in the motion picture as the journal traverses through the entire dynamic cycle.
NASA Technical Reports Server (NTRS)
1984-01-01
L & M Electronics, Inc.'s telemetry system is used to measure degree and location of abnormal muscle activity. This telemetry was originally used to monitor astronauts vital functions. Leg sensors send wireless signals to computer which develops pictures of gait patterns. System records, measures and analyzes muscle activities in limbs and spine. Computer developed pictures of gait patterns help physicians determine potential of corrective surgery, evaluate various types of braces, or decide whether physical therapy may improve motor functions.
Computer-based training for safety: comparing methods with older and younger workers.
Wallen, Erik S; Mulloy, Karen B
2006-01-01
Computer-based safety training is becoming more common and is being delivered to an increasingly aging workforce. Aging results in a number of changes that make it more difficult to learn from certain types of computer-based training. Instructional designs derived from cognitive learning theories may overcome some of these difficulties. Three versions of computer-based respiratory safety training were shown to older and younger workers who then took a high and a low level learning test. Younger workers did better overall. Both older and younger workers did best with the version containing text with pictures and audio narration. Computer-based training with pictures and audio narration may be beneficial for workers over 45 years of age. Computer-based safety training has advantages but workers of different ages may benefit differently. Computer-based safety programs should be designed and selected based on their ability to effectively train older as well as younger learners.
Attitude determination using digital earth pictures
NASA Technical Reports Server (NTRS)
Gunshol, L. P.
1975-01-01
A computer program called PICATT is reported, which stands for picture attitude determination. Described are the particular satellite to which this technique of attitude determination has been applied, the method of solution, and the results that have been attained using the PICATT program.
Hanak, Viktor; Hartman, Thomas E; Ryu, Jay H
2005-07-01
To define the demographic, clinical, and radiological features of patients with cough-induced rib fractures and to assess potential risk factors. For this retrospective, single-center study, we identified all cases of cough-induced rib fractures diagnosed at the Mayo Clinic in Rochester, Minn, over a 9-year period between January 1, 1996, and January 31, 2005. Bone densitometry data from patients' medical records were analyzed, and T scores were used to classify patients into bone density categories. The mean +/- SD age of the 54 study patients at presentation was 55+/-17 years, and 42 patients (78%) were female. Patients presented with chest wall pain after onset of cough. Rib fracture was associated with chronic cough (> or =3 weeks' duration) in 85% of patients. Rib fractures were documented by chest radiography, rib radiography, computed tomography, or bone scan. Chest radiography had been performed in 52 patients and revealed rib fracture in 30 (58%). There were 112 fractured ribs in 54 patients. One half of patients had more than one fractured rib. Right-sided rib fractures alone were present in 17 patients (26 fractured ribs), left-sided in 23 patients (35 fractured ribs), and bilateral in 14 patients (51 fractured ribs). The most commonly fractured rib on both sides was rib 6. The fractures were most common at the lateral aspect of the rib cage. Bone densitometry was done in 26 patients and revealed osteopenia or osteoporosis in 17 (65%). Cough-induced rib fractures occur primarily in women with chronic cough. Middle ribs along the lateral aspect of the rib cage are affected most commonly. Although reduced bone density is likely a risk factor, cough-induced rib fractures can occur in the presence of normal bone density.
Automated Illustration of Patients Instructions
Bui, Duy; Nakamura, Carlos; Bray, Bruce E.; Zeng-Treitler, Qing
2012-01-01
A picture can be a powerful communication tool. However, creating pictures to illustrate patient instructions can be a costly and time-consuming task. Building on our prior research in this area, we developed a computer application that automatically converts text to pictures using natural language processing and computer graphics techniques. After iterative testing, the automated illustration system was evaluated using 49 previously unseen cardiology discharge instructions. The completeness of the system-generated illustrations was assessed by three raters using a three-level scale. The average inter-rater agreement for text correctly represented in the pictograph was about 66 percent. Since illustration in this context is intended to enhance rather than replace text, these results support the feasibility of conducting automated illustration. PMID:23304392
ERIC Educational Resources Information Center
Prosise, Jeff
This document presents the principles behind modern computer graphics without straying into the arcane languages of mathematics and computer science. Illustrations accompany the clear, step-by-step explanations that describe how computers draw pictures. The 22 chapters of the book are organized into 5 sections. "Part 1: Computer Graphics in…
Computer-assisted Crystallization.
ERIC Educational Resources Information Center
Semeister, Joseph J., Jr.; Dowden, Edward
1989-01-01
To avoid a tedious task for recording temperature, a computer was used for calculating the heat of crystallization for the compound sodium thiosulfate. Described are the computer-interfacing procedures. Provides pictures of laboratory equipment and typical graphs from experiments. (YP)
Digital overlaying of the universal transverse Mercator grid with LANDSAT data derived products
NASA Technical Reports Server (NTRS)
Graham, M. H.
1977-01-01
Picture elements of data from the LANDSAT multispectral scanner are correlated with the universal tranverse Mercator grid. In the procedure, a series of computer modules was used to make approximations of universal transverse Mercator grid locations for all picture elements from the grid locations of a limited number of known control points and to provide display and digital storage of the data. The software has been written in FORTRAN 4 language for a Varian 70-series computer.
ERIC Educational Resources Information Center
Samaras, Anastasia P.
1996-01-01
Suggests that teachers and social context determine what young children acquire from computer experiences. Provides anecdotes of teachers working with children who are using a computer program to complete a picture puzzle. The computer allowed teachers to present a problem, witness children's cognitive capabilities, listen to their metacognitive…
Effects of prosodically modulated sub-phonetic variation on lexical competition.
Salverda, Anne Pier; Dahan, Delphine; Tanenhaus, Michael K; Crosswhite, Katherine; Masharov, Mikhail; McDonough, Joyce
2007-11-01
Eye movements were monitored as participants followed spoken instructions to manipulate one of four objects pictured on a computer screen. Target words occurred in utterance-medial (e.g., Put the cap next to the square) or utterance-final position (e.g., Now click on the cap). Displays consisted of the target picture (e.g., a cap), a monosyllabic competitor picture (e.g., a cat), a polysyllabic competitor picture (e.g., a captain) and a distractor (e.g., a beaker). The relative proportion of fixations to the two types of competitor pictures changed as a function of the position of the target word in the utterance, demonstrating that lexical competition is modulated by prosodically conditioned phonetic variation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, Jerry T.; Kamyar, Farzad; Molloi, Sabee
2007-10-15
Densitometry measurements have been performed previously using subtracted images. However, digital subtraction angiography (DSA) in coronary angiography is highly susceptible to misregistration artifacts due to the temporal separation of background and target images. Misregistration artifacts due to respiration and patient motion occur frequently, and organ motion is unavoidable. Quantitative densitometric techniques would be more clinically feasible if they could be implemented using unsubtracted images. The goal of this study is to evaluate image recovery techniques for densitometry measurements using unsubtracted images. A humanoid phantom and eight swine (25-35 kg) were used to evaluate the accuracy and precision of the followingmore » image recovery techniques: Local averaging (LA), morphological filtering (MF), linear interpolation (LI), and curvature-driven diffusion image inpainting (CDD). Images of iodinated vessel phantoms placed over the heart of the humanoid phantom or swine were acquired. In addition, coronary angiograms were obtained after power injections of a nonionic iodinated contrast solution in an in vivo swine study. Background signals were estimated and removed with LA, MF, LI, and CDD. Iodine masses in the vessel phantoms were quantified and compared to known amounts. Moreover, the total iodine in left anterior descending arteries was measured and compared with DSA measurements. In the humanoid phantom study, the average root mean square errors associated with quantifying iodine mass using LA and MF were approximately 6% and 9%, respectively. The corresponding average root mean square errors associated with quantifying iodine mass using LI and CDD were both approximately 3%. In the in vivo swine study, the root mean square errors associated with quantifying iodine in the vessel phantoms with LA and MF were approximately 5% and 12%, respectively. The corresponding average root mean square errors using LI and CDD were both 3%. The standard deviations in the differences between measured iodine mass in left anterior descending arteries using DSA and LA, MF, LI, or CDD were calculated. The standard deviations in the DSA-LA and DSA-MF differences (both {approx}21 mg) were approximately a factor of 3 greater than that of the DSA-LI and DSA-CDD differences (both {approx}7 mg). Local averaging and morphological filtering were considered inadequate for use in quantitative densitometry. Linear interpolation and curvature-driven diffusion image inpainting were found to be effective techniques for use with densitometry in quantifying iodine mass in vitro and in vivo. They can be used with unsubtracted images to estimate background anatomical signals and obtain accurate densitometry results. The high level of accuracy and precision in quantification associated with using LI and CDD suggests the potential of these techniques in applications where background mask images are difficult to obtain, such as lumen volume and blood flow quantification using coronary arteriography.« less
... density test; Bone densitometry; DEXA scan; DXA; Dual-energy x-ray absorptiometry; p-DEXA; Osteoporosis - BMD ... most common and accurate way uses a dual-energy x-ray absorptiometry (DEXA) scan. DEXA uses low- ...
A neural net based architecture for the segmentation of mixed gray-level and binary pictures
NASA Technical Reports Server (NTRS)
Tabatabai, Ali; Troudet, Terry P.
1991-01-01
A neural-net-based architecture is proposed to perform segmentation in real time for mixed gray-level and binary pictures. In this approach, the composite picture is divided into 16 x 16 pixel blocks, which are identified as character blocks or image blocks on the basis of a dichotomy measure computed by an adaptive 16 x 16 neural net. For compression purposes, each image block is further divided into 4 x 4 subblocks; a one-bit nonparametric quantizer is used to encode 16 x 16 character and 4 x 4 image blocks; and the binary map and quantizer levels are obtained through a neural net segmentor over each block. The efficiency of the neural segmentation in terms of computational speed, data compression, and quality of the compressed picture is demonstrated. The effect of weight quantization is also discussed. VLSI implementations of such adaptive neural nets in CMOS technology are described and simulated in real time for a maximum block size of 256 pixels.
Decision-making based on emotional images.
Katahira, Kentaro; Fujimura, Tomomi; Okanoya, Kazuo; Okada, Masato
2011-01-01
The emotional outcome of a choice affects subsequent decision making. While the relationship between decision making and emotion has attracted attention, studies on emotion and decision making have been independently developed. In this study, we investigated how the emotional valence of pictures, which was stochastically contingent on participants' choices, influenced subsequent decision making. In contrast to traditional value-based decision-making studies that used money or food as a reward, the "reward value" of the decision outcome, which guided the update of value for each choice, is unknown beforehand. To estimate the reward value of emotional pictures from participants' choice data, we used reinforcement learning models that have successfully been used in previous studies for modeling value-based decision making. Consequently, we found that the estimated reward value was asymmetric between positive and negative pictures. The negative reward value of negative pictures (relative to neutral pictures) was larger in magnitude than the positive reward value of positive pictures. This asymmetry was not observed in valence for an individual picture, which was rated by the participants regarding the emotion experienced upon viewing it. These results suggest that there may be a difference between experienced emotion and the effect of the experienced emotion on subsequent behavior. Our experimental and computational paradigm provides a novel way for quantifying how and what aspects of emotional events affect human behavior. The present study is a first step toward relating a large amount of knowledge in emotion science and in taking computational approaches to value-based decision making.
Optical Fiber Transmission In A Picture Archiving And Communication System For Medical Applications
NASA Astrophysics Data System (ADS)
Aaron, Gilles; Bonnard, Rene
1984-03-01
In an hospital, the need for an electronic communication network is increasing along with the digitization of pictures. This local area network is intended to link some picture sources such as digital radiography, computed tomography, nuclear magnetic resonance, ultrasounds etc...with an archiving system. Interactive displays can be used in examination rooms, physicians offices and clinics. In such a system, three major requirements must be considered : bit-rate, cable length, and number of devices. - The bit-rate is very important because a maximum response time of a few seconds must be guaranteed for several mega-bit pictures. - The distance between nodes may be a few kilometers in some large hospitals. - The number of devices connected to the network is never greater than a few tens because picture sources and computers represent important hardware, and simple displays can be concentrated. All these conditions are fulfilled by optical fiber transmissions. Depending on the topology and the access protocol, two solutions are to be considered - Active ring - Active or passive star Finally Thomson-CSF developments of optical transmission devices for large networks of TV distribution bring us a technological support and a mass produc-tion which will cut down hardware costs.
Aerial projection of three-dimensional motion pictures by electro-holography and parabolic mirrors.
Kakue, Takashi; Nishitsuji, Takashi; Kawashima, Tetsuya; Suzuki, Keisuke; Shimobaba, Tomoyoshi; Ito, Tomoyoshi
2015-07-08
We demonstrate an aerial projection system for reconstructing 3D motion pictures based on holography. The system consists of an optical source, a spatial light modulator corresponding to a display and two parabolic mirrors. The spatial light modulator displays holograms calculated by computer and can reconstruct holographic motion pictures near the surface of the modulator. The two parabolic mirrors can project floating 3D images of the motion pictures formed by the spatial light modulator without mechanical scanning or rotating. In this demonstration, we used a phase-modulation-type spatial light modulator. The number of pixels and the pixel pitch of the modulator were 1,080 × 1,920 and 8.0 μm × 8.0 μm, respectively. The diameter, the height and the focal length of each parabolic mirror were 288 mm, 55 mm and 100 mm, respectively. We succeeded in aerially projecting 3D motion pictures of size ~2.5 mm(3) by this system constructed by the modulator and mirrors. In addition, by applying a fast computational algorithm for holograms, we achieved hologram calculations at ~12 ms per hologram with 4 CPU cores.
Aerial projection of three-dimensional motion pictures by electro-holography and parabolic mirrors
Kakue, Takashi; Nishitsuji, Takashi; Kawashima, Tetsuya; Suzuki, Keisuke; Shimobaba, Tomoyoshi; Ito, Tomoyoshi
2015-01-01
We demonstrate an aerial projection system for reconstructing 3D motion pictures based on holography. The system consists of an optical source, a spatial light modulator corresponding to a display and two parabolic mirrors. The spatial light modulator displays holograms calculated by computer and can reconstruct holographic motion pictures near the surface of the modulator. The two parabolic mirrors can project floating 3D images of the motion pictures formed by the spatial light modulator without mechanical scanning or rotating. In this demonstration, we used a phase-modulation-type spatial light modulator. The number of pixels and the pixel pitch of the modulator were 1,080 × 1,920 and 8.0 μm × 8.0 μm, respectively. The diameter, the height and the focal length of each parabolic mirror were 288 mm, 55 mm and 100 mm, respectively. We succeeded in aerially projecting 3D motion pictures of size ~2.5 mm3 by this system constructed by the modulator and mirrors. In addition, by applying a fast computational algorithm for holograms, we achieved hologram calculations at ~12 ms per hologram with 4 CPU cores. PMID:26152453
Optimized Laplacian image sharpening algorithm based on graphic processing unit
NASA Astrophysics Data System (ADS)
Ma, Tinghuai; Li, Lu; Ji, Sai; Wang, Xin; Tian, Yuan; Al-Dhelaan, Abdullah; Al-Rodhaan, Mznah
2014-12-01
In classical Laplacian image sharpening, all pixels are processed one by one, which leads to large amount of computation. Traditional Laplacian sharpening processed on CPU is considerably time-consuming especially for those large pictures. In this paper, we propose a parallel implementation of Laplacian sharpening based on Compute Unified Device Architecture (CUDA), which is a computing platform of Graphic Processing Units (GPU), and analyze the impact of picture size on performance and the relationship between the processing time of between data transfer time and parallel computing time. Further, according to different features of different memory, an improved scheme of our method is developed, which exploits shared memory in GPU instead of global memory and further increases the efficiency. Experimental results prove that two novel algorithms outperform traditional consequentially method based on OpenCV in the aspect of computing speed.
Neural classification of the selected family of butterflies
NASA Astrophysics Data System (ADS)
Zaborowicz, M.; Boniecki, P.; Piekarska-Boniecka, H.; Koszela, K.; Mueller, W.; Górna, K.; Okoń, P.
2017-07-01
There have been noticed growing explorers' interest in drawing conclusions based on information of data coded in a graphic form. The neuronal identification of pictorial data, with special emphasis on both quantitative and qualitative analysis, is more frequently utilized to gain and deepen the empirical data knowledge. Extraction and then classification of selected picture features, such as color or surface structure, enables one to create computer tools in order to identify these objects presented as, for example, digital pictures. The work presents original computer system "Processing the image v.1.0" designed to digitalize pictures on the basis of color criterion. The system has been applied to generate a reference learning file for generating the Artificial Neural Network (ANN) to identify selected kinds of butterflies from the Papilionidae family.
ERIC Educational Resources Information Center
Barker, Philip; Manji, Karim
1991-01-01
Discussion of the design of interactive environments focuses on three types of electronic book metaphors that use optical discs and can facilitate computer-based learning: (1) static picture books, (2) moving picture books, and (3) multimedia books. Guidelines for designing electronic books are presented, and future directions are discussed. (17…
Affective Computing and the Impact of Gender and Age
Rukavina, Stefanie; Gruss, Sascha; Hoffmann, Holger; Tan, Jun-Wen; Walter, Steffen; Traue, Harald C.
2016-01-01
Affective computing aims at the detection of users’ mental states, in particular, emotions and dispositions during human-computer interactions. Detection can be achieved by measuring multimodal signals, namely, speech, facial expressions and/or psychobiology. Over the past years, one major approach was to identify the best features for each signal using different classification methods. Although this is of high priority, other subject-specific variables should not be neglected. In our study, we analyzed the effect of gender, age, personality and gender roles on the extracted psychobiological features (derived from skin conductance level, facial electromyography and heart rate variability) as well as the influence on the classification results. In an experimental human-computer interaction, five different affective states with picture material from the International Affective Picture System and ULM pictures were induced. A total of 127 subjects participated in the study. Among all potentially influencing variables (gender has been reported to be influential), age was the only variable that correlated significantly with psychobiological responses. In summary, the conducted classification processes resulted in 20% classification accuracy differences according to age and gender, especially when comparing the neutral condition with four other affective states. We suggest taking age and gender specifically into account for future studies in affective computing, as these may lead to an improvement of emotion recognition accuracy. PMID:26939129
CAT scan - leg; Computed axial tomography scan - leg; Computed tomography scan - leg; CT scan - leg ... CT scan makes detailed pictures of the body very quickly. The test may help look for: An abscess ...
75 FR 2511 - Manual for Courts-Martial; Proposed Amendments
Federal Register 2010, 2011, 2012, 2013, 2014
2010-01-15
... persons of the same or opposite sex; (b) Bestiality; (c) Masturbation; (d) Sadistic or masochistic abuse...'' includes any developed or undeveloped photograph, picture, film or video; any digital or computer image, picture, film or video made by any means, including those transmitted by any means including streaming...
Pictures from Words, Pictures from Text: Constructing Pictorial Representations of Meaning from Text
2009-11-02
characteristics of language symbolism is its arbitrariness, as Saussure pointed out [17]. Recently there has been a resurgence of interest in the...Kingdom, 20-22 November 2000. The British Computer Society. [17] Saussure , Ferdinand de. 1959. Course in General Linguistics. New York, NY: McGraw
Effects of prosodically-modulated sub-phonetic variation on lexical competition
Salverda, Anne Pier; Dahan, Delphine; Tanenhaus, Michael K.; Crosswhite, Katherine; Masharov, Mikhail; McDonough, Joyce
2007-01-01
Eye movements were monitored as participants followed spoken instructions to manipulate one of four objects pictured on a computer screen. Target words occurred in utterance-medial (e.g., Put the cap next to the square) or utterance-final position (e.g., Now click on the cap). Displays consisted of the target picture (e.g., a cap), a monosyllabic competitor picture (e.g., a cat), a polysyllabic competitor picture (e.g., a captain) and a distractor (e.g., a beaker). The relative proportion of fixations to the two types of competitor pictures changed as a function of the position of the target word in the utterance, demonstrating that lexical competition is modulated by prosodically-conditioned phonetic variation. PMID:17141751
Rapidly assessing changes in bone mineral balance using natural stable calcium isotopes
Morgan, Jennifer L. L.; Skulan, Joseph L.; Gordon, Gwyneth W.; Romaniello, Stephen J.; Smith, Scott M.; Anbar, Ariel D.
2012-01-01
The ability to rapidly detect changes in bone mineral balance (BMB) would be of great value in the early diagnosis and evaluation of therapies for metabolic bone diseases such as osteoporosis and some cancers. However, measurements of BMB are hampered by difficulties with using biochemical markers to quantify the relative rates of bone resorption and formation and the need to wait months to years for altered BMB to produce changes in bone mineral density large enough to resolve by X-ray densitometry. We show here that, in humans, the natural abundances of Ca isotopes in urine change rapidly in response to changes in BMB. In a bed rest experiment, use of high-precision isotope ratio MS allowed the onset of bone loss to be detected in Ca isotope data after about 1 wk, long before bone mineral density has changed enough to be detectable with densitometry. The physiological basis of the relationship between Ca isotopes and BMB is sufficiently understood to allow quantitative translation of changes in Ca isotope abundances to changes in bone mineral density using a simple model. The rate of change of bone mineral density inferred from Ca isotopes is consistent with the rate observed by densitometry in long-term bed rest studies. Ca isotopic analysis provides a powerful way to monitor bone loss, potentially making it possible to diagnose metabolic bone disease and track the impact of treatments more effectively than is currently possible. PMID:22652567
Picture archiving and computing systems: the key to enterprise digital imaging.
Krohn, Richard
2002-09-01
The utopian view of the electronic medical record includes the digital transformation of all aspects of patient information. Historically, imagery from the radiology, cardiology, ophthalmology, and pathology departments, as well as the emergency room, has been a morass of paper, film, and other media, isolated within each department's system architecture. In answer to this dilemma, picture archiving and computing systems have become the focal point of efforts to create a single platform for the collection, storage, and distribution of clinical imagery throughout the health care enterprise.
NASA Astrophysics Data System (ADS)
Balac, Stéphane; Fernandez, Arnaud
2016-02-01
The computer program SPIP is aimed at solving the Generalized Non-Linear Schrödinger equation (GNLSE), involved in optics e.g. in the modelling of light-wave propagation in an optical fibre, by the Interaction Picture method, a new efficient alternative method to the Symmetric Split-Step method. In the SPIP program a dedicated costless adaptive step-size control based on the use of a 4th order embedded Runge-Kutta method is implemented in order to speed up the resolution.
Michalski, Andrew S; Edwards, W Brent; Boyd, Steven K
2017-10-17
Quantitative computed tomography has been posed as an alternative imaging modality to investigate osteoporosis. We examined the influence of computed tomography convolution back-projection reconstruction kernels on the analysis of bone quantity and estimated mechanical properties in the proximal femur. Eighteen computed tomography scans of the proximal femur were reconstructed using both a standard smoothing reconstruction kernel and a bone-sharpening reconstruction kernel. Following phantom-based density calibration, we calculated typical bone quantity outcomes of integral volumetric bone mineral density, bone volume, and bone mineral content. Additionally, we performed finite element analysis in a standard sideways fall on the hip loading configuration. Significant differences for all outcome measures, except integral bone volume, were observed between the 2 reconstruction kernels. Volumetric bone mineral density measured using images reconstructed by the standard kernel was significantly lower (6.7%, p < 0.001) when compared with images reconstructed using the bone-sharpening kernel. Furthermore, the whole-bone stiffness and the failure load measured in images reconstructed by the standard kernel were significantly lower (16.5%, p < 0.001, and 18.2%, p < 0.001, respectively) when compared with the image reconstructed by the bone-sharpening kernel. These data suggest that for future quantitative computed tomography studies, a standardized reconstruction kernel will maximize reproducibility, independent of the use of a quantitative calibration phantom. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
The role of beliefs in lexical alignment: evidence from dialogs with humans and computers.
Branigan, Holly P; Pickering, Martin J; Pearson, Jamie; McLean, Janet F; Brown, Ash
2011-10-01
Five experiments examined the extent to which speakers' alignment (i.e., convergence) on words in dialog is mediated by beliefs about their interlocutor. To do this, we told participants that they were interacting with another person or a computer in a task in which they alternated between selecting pictures that matched their 'partner's' descriptions and naming pictures themselves (though in reality all responses were scripted). In both text- and speech-based dialog, participants tended to repeat their partner's choice of referring expression. However, they showed a stronger tendency to align with 'computer' than with 'human' partners, and with computers that were presented as less capable than with computers that were presented as more capable. The tendency to align therefore appears to be mediated by beliefs, with the relevant beliefs relating to an interlocutor's perceived communicative capacity. Copyright © 2011 Elsevier B.V. All rights reserved.
Tips for Socializing with Aphasia
... or a picture communication book, or even a computer communication system. Family members can facilitate communication with ... for Aphasia Actions Speak as Loud as Words Computers & Language Rehab From Singing to Speaking When the ...
Can light-field photography ease focusing on the scalp and oral cavity?
Taheri, Arash; Feldman, Steven R
2013-08-01
Capturing a well-focused image using an autofocus camera can be difficult in oral cavity and on a hairy scalp. Light-field digital cameras capture data regarding the color, intensity, and direction of rays of light. Having information regarding direction of rays of light, computer software can be used to focus on different subjects in the field after the image data have been captured. A light-field camera was used to capture the images of the scalp and oral cavity. The related computer software was used to focus on scalp or different parts of oral cavity. The final pictures were compared with pictures taken with conventional, compact, digital cameras. The camera worked well for oral cavity. It also captured the pictures of scalp easily; however, we had to repeat clicking between the hairs on different points to choose the scalp for focusing. A major drawback of the system was the resolution of the resulting pictures that was lower than conventional digital cameras. Light-field digital cameras are fast and easy to use. They can capture more information on the full depth of field compared with conventional cameras. However, the resolution of the pictures is relatively low. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
ERIC Educational Resources Information Center
Willing, Kathlene R.; Girard, Suzanne
Intended for young children just becoming familiar with computers, this naming book introduces and reinforces new computer vocabulary and concepts. The 20 words are presented alphabetically, along with illustrations, providing room for different activities in which children can match and name the pictures and words. The 20 vocabulary items are…
CAT scan - lumbar spine; Computed axial tomography scan - lumbar spine; Computed tomography scan - lumbar spine; CT - lower back ... CT scans rapidly makes detailed pictures of the lower back. The test may be used to look for: ...
3D motion picture of transparent gas flow by parallel phase-shifting digital holography
NASA Astrophysics Data System (ADS)
Awatsuji, Yasuhiro; Fukuda, Takahito; Wang, Yexin; Xia, Peng; Kakue, Takashi; Nishio, Kenzo; Matoba, Osamu
2018-03-01
Parallel phase-shifting digital holography is a technique capable of recording three-dimensional (3D) motion picture of dynamic object, quantitatively. This technique can record single hologram of an object with an image sensor having a phase-shift array device and reconstructs the instantaneous 3D image of the object with a computer. In this technique, a single hologram in which the multiple holograms required for phase-shifting digital holography are multiplexed by using space-division multiplexing technique pixel by pixel. We demonstrate 3D motion picture of dynamic and transparent gas flow recorded and reconstructed by the technique. A compressed air duster was used to generate the gas flow. A motion picture of the hologram of the gas flow was recorded at 180,000 frames/s by parallel phase-shifting digital holography. The phase motion picture of the gas flow was reconstructed from the motion picture of the hologram. The Abel inversion was applied to the phase motion picture and then the 3D motion picture of the gas flow was obtained.
Modifying a Rodenstock scanning laser ophthalmoscope for imaging densitometry.
Tornow, R P; Beuel, S; Zrenner, E
1997-08-01
The necessary modifications and technical requirements are described for using a commercially available scanning laser ophthalmoscope (Rodenstock Model 101 SLO) as an imaging densitometer to assess human photopigment distribution. The main requirements are a linear detector amplifier, fast shutters for the laser beams, and a trigger unit. Images must be compensated for varying laser intensity. Both rod and cone photopigments are measured with the 514-nm argon laser of the SLO. Discrimination is possible owing to the different spatial distribution. The cone pigment density peaks in the foveal center (D = 0.40) with a steep decrease with increasing eccentricity E (full width at half-maximum, 2.5 degrees ). Rod photopigment increases with increasing eccentricity (D = 0.23 for E = 11 degrees ). These values are in agreement with previous reported results obtained with scanning laser ophthalmoscopes specially designed for retinal densitometry and high stability.
Hughes, V K; Ellis, P S; Langlois, N E I
2006-05-10
The age of a bruise may be of interest to forensic investigators. Previous research has demonstrated that an alternative light source may assist in the visualisation of faint or non-visible bruises. This project aimed to determine if an alternative light source could be utilised to assist investigators estimate the age of a bruise. Forty braises, sustained from blunt force trauma, were examined from 30 healthy subjects. The age of the bruises ranged from 2 to 231 h (mean = 74.6, median = 69.0). Alternative light source (polilight) illumination at 415 and 450 nm was used. The black and white photographs obtained were assessed using densitometry. A statistical analysis indicated that there was no correlation between time and the mean densitometry values. The alternative light source used in this study was unable to assist in determining the age of a bruise.
Bojić, Mirza; Simon Haas, Vicente; Maleš, Željan
2013-01-01
Raw material, different formulations of foods, and dietary supplements of mate demands control of the content of bioactive substances for which high performance thin layer chromatography (TLC), described here, presents simple and rapid approach for detections as well as quantification. Using TLC densitometry, the following bioactive compounds were identified and quantified: chlorogenic acid (2.1 mg/g), caffeic acid (1.5 mg/g), rutin (5.2 mg/g), quercetin (2.2 mg/g), and kaempferol (4.5 mg/g). The results obtained with TLC densitometry for caffeine (5.4 mg/g) and theobromine (2.7 mg/g) show no statistical difference to the content of total xanthines (7.6 mg/g) obtained by UV-Vis spectrophotometry. Thus, TLC remains a technique of choice for simple and rapid analysis of great number of samples as well as a primary screening technique in plant analysis. PMID:23841023
Measuring Speed Using a Computer--Several Techniques.
ERIC Educational Resources Information Center
Pearce, Jon M.
1988-01-01
Introduces three different techniques to facilitate the measurement of speed and the associated kinematics and dynamics using a computer. Discusses sensing techniques using optical or ultrasonic sensors, interfacing with a computer, software routines for the interfaces, and other applications. Provides circuit diagrams, pictures, and a program to…
ERIC Educational Resources Information Center
Ozen, Arzu; Ergenekon, Yasemin; Ulke-Kurkcuoglu, Burcu
2017-01-01
The current study investigated the relation between simultaneous prompting (SP), computer-assisted instruction (CAI), and the receptive identification of target pictures (presented on laptop computer) for four preschool students with developmental disabilities. The students' acquisition of nontarget information through observational learning also…
Diagnostic Radiology--The Impact of New Technology.
ERIC Educational Resources Information Center
Harrison, R. M.
1989-01-01
Discussed are technological advances applying computer techniques for image acquisition and processing, including digital radiography, computed tomography, and nuclear magnetic resonance imaging. Several diagrams and pictures showing the use of each technique are presented. (YP)
Experimental and Computational Study of Sonic and Supersonic Jet Plumes
NASA Technical Reports Server (NTRS)
Venkatapathy, E.; Naughton, J. W.; Fletcher, D. G.; Edwards, Thomas A. (Technical Monitor)
1994-01-01
Study of sonic and supersonic jet plumes are relevant to understanding such phenomenon as jet-noise, plume signatures, and rocket base-heating and radiation. Jet plumes are simple to simulate and yet, have complex flow structures such as Mach disks, triple points, shear-layers, barrel shocks, shock-shear-layer interaction, etc. Experimental and computational simulation of sonic and supersonic jet plumes have been performed for under- and over-expanded, axisymmetric plume conditions. The computational simulation compare very well with the experimental observations of schlieren pictures. Experimental data such as temperature measurements with hot-wire probes are yet to be measured and will be compared with computed values. Extensive analysis of the computational simulations presents a clear picture of how the complex flow structure develops and the conditions under which self-similar flow structures evolve. From the computations, the plume structure can be further classified into many sub-groups. In the proposed paper, detail results from the experimental and computational simulations for single, axisymmetric, under- and over-expanded, sonic and supersonic plumes will be compared and the fluid dynamic aspects of flow structures will be discussed.
Akkaya Turhan, Semra; Toker, Ebru
2017-11-01
To determine and compare the changes in corneal density after 2 different protocols of accelerated corneal collagen cross-linking (A-CXL) in patients with progressive keratoconus. Two groups of eyes received A-CXL treatment; 20 eyes received A-CXL using continuous UVA light exposure at 9 mW/cm for 10 minutes with a total energy dose of 5.4 J/cm, and 24 eyes received A-CXL using continuous UVA light exposure at 30 mW/cm for 4 minutes with a total energy dose of 7.2 J/cm. Corneal density was measured with Scheimpflug tomography at 1, 3, 6, and 12 months of follow-up. Densitometry peaked at 1 month (mean: 16.34 ± 3.80, P = 0.006, 9-mW/cm A-CXL; mean: 20.90 ± 2.81, P < 0.0001, 30-mw/cm A-CXL) in both groups, and it decreased over time in 30-mW/cm A-CXL. However, in 9-mW/cm A-CXL, increased corneal densitometry plateaued until 6 months postoperatively and started to decrease thereafter. Densitometry completely returned to baseline after 12 months in both groups. The mean change in density at 1- and 3-month follow-up was higher in the 30-mW A-CXL group than in the 9-mW A-CXL group (P = 0.003, P = 0.044; respectively). High-energy exposure tends to induce more haze in the early posttreatment period, but it is reversible.
Densitometric and biochemical values of broiler tibias at different ages.
Barreiro, F R; Sagula, A L; Junqueira, O M; Pereira, G T; Baraldi-Artoni, S M
2009-12-01
The objective of this experiment was to determine the normal values of bone radiographic density (BRD) by using the optical densitometry in radiographic images and the biochemical values represented by serum calcium, ash percentage, and minerals (calcium, phosphorus, and magnesium) from tibia ash of Cobb broilers at 8, 22, and 43 d of age. A total of 14 broilers were used for densitometric analysis, and 15 were used for biochemical dosages. The BRD values increased (P < 0.05) with age and in all tibia regions (proximal epiphysis, diaphysis, and distal epiphysis), concluding that growth was a determinative factor for bone performance, demanding a higher BRD during broiler development. Tibia proximal epiphysis presented higher BRD values in relation to the other bone regions (P < 0.05), as a result of a possible biomechanical adaptation to ligaments and tension of the muscle tendons at this region, allowing the support of the muscle mass increase. The serum calcium values were kept constant, as a result of the appropriate nutritional levels of the diet that supported the animal homeostasis. The bone ash and mineral percentage increased (P < 0.05) at 22 d of age, due to the higher mineral requirement in this age. The correlation between bone densitometry and the invasive techniques showed that the bone densitometry can substitute the determination of mineral percentage in the ash. This experiment presented normal values of the noninvasive and invasive methods more used in aviculture, allowing us to compare, subsequently, pathological and physiological values or results of broilers fed with different diets.
New Wrinkles in Retinal Densitometry
Masella, Benjamin D.; Hunter, Jennifer J.; Williams, David R.
2014-01-01
Purpose. Retinal densitometry provides objective information about retinal function. But, a number of factors, including retinal reflectance changes that are not directly related to photopigment depletion, complicate its interpretation. We explore these factors and suggest a method to minimize their impact. Methods. An adaptive optics scanning light ophthalmoscope (AOSLO) was used to measure changes in photoreceptor reflectance in monkeys before and after photopigment bleaching with 514-nm light. Reflectance measurements at 514 nm and 794 nm were recorded simultaneously. Several methods of normalization to extract the apparent optical density of the photopigment were compared. Results. We identified stimulus-related fluctuations in 794-nm reflectance that are not associated with photopigment absorptance and occur in both rods and cones. These changes had a magnitude approaching those associated directly with pigment depletion, precluding the use of infrared reflectance for normalization. We used a spatial normalization method instead, which avoided the fluctuations in the near infrared, as well as a confocal AOSLO designed to minimize light from layers other than the receptors. However, these methods produced a surprisingly low estimate of the apparent rhodopsin density (animal 1: 0.073 ± 0.006, animal 2: 0.032 ± 0.003). Conclusions. These results confirm earlier observations that changes in photopigment absorption are not the only source of retinal reflectance change during dark adaptation. It appears that the stray light that has historically reduced the apparent density of cone photopigment in retinal densitometry arises predominantly from layers near the photoreceptors themselves. Despite these complications, this method provides a valuable, objective measure of retinal function. PMID:25316726
Steele, C Brooke; Townsend, Julie S; Tai, Eric; Thomas, Cheryll C
2014-03-01
Published literature on receipt of preventive healthcare services among Asian American and Pacific Islander (API) cancer survivors is scarce. We describe patterns in receipt of preventive services among API long-term colorectal cancer (CRC) survivors. Surveillance, Epidemiology, and End Results registry-Medicare data were used to identify 9,737 API and white patients who were diagnosed with CRC during 1996-2000 and who survived 5 or more years beyond their diagnoses. We examined receipt of vaccines, mammography (females), bone densitometry (females), and cholesterol screening among the survivors and how the physician specialties they visited for follow-up care correlated to services received. APIs were less likely than whites to receive mammography (52.0 vs. 69.3 %, respectively; P < 0.0001) but more likely to receive influenza vaccine, cholesterol screening, and bone densitometry. These findings remained significant in our multivariable model, except for receipt of bone densitometry. APIs visited PCPs only and both PCPs and oncologists more frequently than whites (P < 0.0001). Women who visited both PCPs and oncologists compared with PCPs only were more likely to receive mammography (odds ratio = 1.40; 95 % confidence interval, 1.05-1.86). Visits to both PCPs and oncologists were associated with increased use of mammography. Although API survivors visited these specialties more frequently than white survivors, API women may need culturally appropriate outreach to increase their use of this test. Long-term cancer survivors need to be aware of recommended preventive healthcare services, as well as who will manage their primary care and cancer surveillance follow-up.
Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A; Moayyeri, Alireza; Adler, Robert A; Hans, Didier B; Kendler, David L; Diez-Perez, Adolfo; Krieg, Marc-Antoine; Masri, Basel K; Lorenc, Roman R; Bauer, Douglas C; Blake, Glen M; Josse, Robert G; Clark, Patricia; Khan, Aliya A
2011-01-01
Tools to predict fracture risk are useful for selecting patients for pharmacological therapy in order to reduce fracture risk and redirect limited healthcare resources to those who are most likely to benefit. FRAX® is a World Health Organization fracture risk assessment algorithm for estimating the 10-year probability of hip fracture and major osteoporotic fracture. Effective application of FRAX® in clinical practice requires a thorough understanding of its limitations as well as its utility. For some patients, FRAX® may underestimate or overestimate fracture risk. In order to address some of the common issues encountered with the use of FRAX® for individual patients, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) assigned task forces to review the medical evidence and make recommendations for optimal use of FRAX® in clinical practice. Among the issues addressed were the use of bone mineral density (BMD) measurements at skeletal sites other than the femoral neck, the use of technologies other than dual-energy X-ray absorptiometry, the use of FRAX® without BMD input, the use of FRAX® to monitor treatment, and the addition of the rate of bone loss as a clinical risk factor for FRAX®. The evidence and recommendations were presented to a panel of experts at the Joint ISCD-IOF FRAX® Position Development Conference, resulting in the development of Joint ISCD-IOF Official Positions addressing FRAX®-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Effects of Prosodically Modulated Sub-Phonetic Variation on Lexical Competition
ERIC Educational Resources Information Center
Salverda, Anne Pier; Dahan, Delphine; Tanenhaus, Michael K.; Crosswhite, Katherine; Masharov, Mikhail; McDonough, Joyce
2007-01-01
Eye movements were monitored as participants followed spoken instructions to manipulate one of four objects pictured on a computer screen. Target words occurred in utterance-medial (e.g., "Put the cap next to the square") or utterance-final position (e.g., "Now click on the cap"). Displays consisted of the target picture (e.g., a cap), a…
Boundary and object detection in real world images. [by means of algorithms
NASA Technical Reports Server (NTRS)
Yakimovsky, Y.
1974-01-01
A solution to the problem of automatic location of objects in digital pictures by computer is presented. A self-scaling local edge detector which can be applied in parallel on a picture is described. Clustering algorithms and boundary following algorithms which are sequential in nature process the edge data to locate images of objects.
A Catalog of Selected Viking Orbiter Images
NASA Technical Reports Server (NTRS)
Turner, R. L.; Carroll, R. D.
1983-01-01
This collection of Viking Orbiter photomosaics is designed to facilitate identification and location of the various pictures with respect to the surface of Mars. Only a representative set of the nearly 50,000 images taken by the two Viking Orbiters, and computer-processed prior to December 1978, are contained in the mosaics and in the picture listings.
Using Graphic Organizers to Improve Reading Comprehension Skills for the Middle School ESL Students
ERIC Educational Resources Information Center
Praveen, Sam D.; Rajan, Premalatha
2013-01-01
"A picture is worth a thousand words." In a modern-day classroom, students are surrounded by visual imagery through textbooks, notice boards, television, videos, or computers. Many middle school classrooms are filled with colorful pictures and photographs. However, it is unclear how--or if --these images impact the middle school ESL…
Sociocultural Aspects of Computers in Education.
ERIC Educational Resources Information Center
Yeaman, Andrew R. J.
The data reported in this paper gives depth to the picture of computers in society, in work, and in schools. The prices have dropped but computer corporations sell to schools, as they do to any other customer, to increase profits for themselves. Computerizing is a vehicle for social stratification. Computers are not easy to use and are hard to…
Teaching Computer Science: A Problem Solving Approach that Works.
ERIC Educational Resources Information Center
Allan, V. H.; Kolesar, M. V.
The typical introductory programming course is not an appropriate first computer science course for many students. Initial experiences with programming are often frustrating, resulting in a low rate of successful completion, and focus on syntax rather than providing a representative picture of computer science as a discipline. The paper discusses…
NASA Astrophysics Data System (ADS)
Jung, E.
1984-05-01
A color recording unit was designed for output and control of digitized picture data within computer controlled reproduction and picture processing systems. In order to get a color proof picture of high quality similar to a color print, together with reduced time and material consumption, a photographic color film material was exposed pixelwise by modulated laser beams of three wavelengths for red, green and blue light. Components of different manufacturers for lasers, acousto-optic modulators and polygon mirrors were tested, also different recording methods as (continuous tone mode or screened mode and with a drum or flatbed recording principle). Besides the application for the graphic arts - the proof recorder CPR 403 with continuous tone color recording with a drum scanner - such a color hardcopy peripheral unit with large picture formats and high resolution can be used in medicine, communication, and satellite picture processing.
Parallel processing for digital picture comparison
NASA Technical Reports Server (NTRS)
Cheng, H. D.; Kou, L. T.
1987-01-01
In picture processing an important problem is to identify two digital pictures of the same scene taken under different lighting conditions. This kind of problem can be found in remote sensing, satellite signal processing and the related areas. The identification can be done by transforming the gray levels so that the gray level histograms of the two pictures are closely matched. The transformation problem can be solved by using the packing method. Researchers propose a VLSI architecture consisting of m x n processing elements with extensive parallel and pipelining computation capabilities to speed up the transformation with the time complexity 0(max(m,n)), where m and n are the numbers of the gray levels of the input picture and the reference picture respectively. If using uniprocessor and a dynamic programming algorithm, the time complexity will be 0(m(3)xn). The algorithm partition problem, as an important issue in VLSI design, is discussed. Verification of the proposed architecture is also given.
Gidzenko in Service Module with laptop computers
2001-03-30
ISS-01-E-5070 (December 2000) --- Astronaut Yuri P. Gidzenko, Expedition One Soyuz commander, works with computers in the Zvezda or Service Module aboard the Earth-orbiting International Space Station (ISS). The picture was taken with a digital still camera.
The Role of Prosodic Boundaries in the Resolution of Lexical Embedding in Speech Comprehension
ERIC Educational Resources Information Center
Salverda, Anne Pier; Dahan, Delphine; McQueen, James M.
2003-01-01
Participants' eye movements were monitored as they heard sentences and saw four pictured objects on a computer screen. Participants were instructed to click on the object mentioned in the sentence. There were more transitory fixations to pictures representing monosyllabic words (e.g. "ham") when the first syllable of the target word (e.g.…
Mariner 9 television pictures: Microfiche library user's guide. MTC/MTVS real-time pictures
NASA Technical Reports Server (NTRS)
Becker, R. A.
1973-01-01
This document describes the content and organization of the Mariner 9 Mission Test Computer/Mission Test Video System microfiche library. This 775 card library is intended to supply the user with a complete record of the images received from Mars orbit during the Mariner 9 mission operations, from 15 Nov. 1971 to 1 Nov. 1972.
ERIC Educational Resources Information Center
Cheng, Kun-Hung; Tsai, Chin-Chung
2016-01-01
Following a previous study (Cheng & Tsai, 2014. "Computers & Education"), this study aimed to probe the interaction of child-parent shared reading with the augmented reality (AR) picture book in more depth. A series of sequential analyses were thus conducted to infer the behavioral transition diagrams and visualize the continuity…
ERIC Educational Resources Information Center
Dell, Gary S.; Martin, Nadine; Schwartz, Myrna F.
2007-01-01
Lexical access in language production, and particularly pathologies of lexical access, are often investigated by examining errors in picture naming and word repetition. In this article, we test a computational approach to lexical access, the two-step interactive model, by examining whether the model can quantitatively predict the repetition-error…
ERIC Educational Resources Information Center
Seok, Soonhwa; DaCosta, Boaventura; Yu, Byeong Min
2015-01-01
The present study compared a spelling practice intervention using a tablet personal computer (PC) and picture cards with three students diagnosed with developmental disabilities. An alternating-treatments design with a non-concurrent multiple-baseline across participants was used. The aims of the present study were: (a) to determine if…
Low agreement of visual rating for detailed quantification of pulmonary emphysema in whole-lung CT.
Mascalchi, Mario; Diciotti, Stefano; Sverzellati, Nicola; Camiciottoli, Gianna; Ciccotosto, Cesareo; Falaschi, Fabio; Zompatori, Maurizio
2012-02-01
Multidetector spiral computed tomography (CT) has opened the possibility of quantitative evaluation of emphysema extent in the whole lung. Visual assessment can be used for such a purpose, but its reproducibility has not been established. To assess agreement of detailed assessment of pulmonary emphysema on whole-lung CT using a visual scale. Thirty patients with chronic obstructive pulmonary disease underwent whole-lung inspiratory CT. Four chest radiologists rated the same 22 ± 2 thin sections using a visual scale which defines a range of emphysema extent between 0 and 100. Two of them repeated the rating two months later. Inter- and intra-operator agreement was evaluated with the Bland and Altman method. In addition, the percentage of emphysema at -950 Hounsfield units in the whole lung was determined using fully automated commercially available software for 3D densitometry. In three of six operator pairs and in one of two intra-operator pairs the Kendall τ test showed a significant correlation between the difference and the average magnitude of visual scores. Among different operators the half-width of 95% limits of agreement (95% LoA) was wide ranging between a score of 14.2-27.7 for an average visual score of 20 and between 18.5-36.8 for an average visual score of 80. Within the same operator the half-width of 95% LoA ranged between a score of 10.9-21.0 for an average visual score of 20 and between 25.1-30.1 for an average visual score of 80. The visual scores of the four radiologists were correlated with the results of densitometry (P < 0.001; r = 0.65-0.81). The inter- and intra-operator agreement of detailed assessment of emphysema in the whole lung using a visual scale is low and decreases with increasing emphysema extent.
Tsaparina, Diana; Bonin, Patrick; Méot, Alain
2011-12-01
The aim of the present study was to provide Russian normative data for the Snodgrass and Vanderwart (Behavior Research Methods, Instruments, & Computers, 28, 516-536, 1980) colorized pictures (Rossion & Pourtois, Perception, 33, 217-236, 2004). The pictures were standardized on name agreement, image agreement, conceptual familiarity, imageability, and age of acquisition. Objective word frequency and objective visual complexity measures are also provided for the most common names associated with the pictures. Comparative analyses between our results and the norms obtained in other, similar studies are reported. The Russian norms may be downloaded from the Psychonomic Society supplemental archive.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Uhr, L.
1987-01-01
This book is written by research scientists involved in the development of massively parallel, but hierarchically structured, algorithms, architectures, and programs for image processing, pattern recognition, and computer vision. The book gives an integrated picture of the programs and algorithms that are being developed, and also of the multi-computer hardware architectures for which these systems are designed.
Sharp-Focus Composite Microscope Imaging by Computer
NASA Technical Reports Server (NTRS)
Wall, R. J.
1983-01-01
Enhanced depth of focus aids medical analysis. Computer image-processing system synthesizes sharply-focused composite picture from series of photomicrographs of same object taken at different depths. Computer rejects blured parts of each photomicrograph. Remaining in focus portions form focused composite. System used to study alveolar lung tissue and has applications in medicine and physical sciences.
Developing Educational Computer Animation Based on Human Personality Types
ERIC Educational Resources Information Center
Musa, Sajid; Ziatdinov, Rushan; Sozcu, Omer Faruk; Griffiths, Carol
2015-01-01
Computer animation in the past decade has become one of the most noticeable features of technology-based learning environments. By its definition, it refers to simulated motion pictures showing movement of drawn objects, and is often defined as the art in movement. Its educational application known as educational computer animation is considered…
Realizing the Promise of Visualization in the Theory of Computing
ERIC Educational Resources Information Center
Cogliati, Joshua J.; Goosey, Frances W.; Grinder, Michael T.; Pascoe, Bradley A.; Ross, Rockford J.; Williams, Cheston J.
2005-01-01
Progress on a hypertextbook on the theory of computing is presented. The hypertextbook is a novel teaching and learning resource built around web technologies that incorporates text, sound, pictures, illustrations, slide shows, video clips, and--most importantly--active learning models of the key concepts of the theory of computing into an…
Sonic and Supersonic Jet Plumes
NASA Technical Reports Server (NTRS)
Venkatapathy, E.; Naughton, J. W.; Flethcher, D. G.; Edwards, Thomas A. (Technical Monitor)
1994-01-01
Study of sonic and supersonic jet plumes are relevant to understanding such phenomenon as jet-noise, plume signatures, and rocket base-heating and radiation. Jet plumes are simple to simulate and yet, have complex flow structures such as Mach disks, triple points, shear-layers, barrel shocks, shock- shear- layer interaction, etc. Experimental and computational simulation of sonic and supersonic jet plumes have been performed for under- and over-expanded, axisymmetric plume conditions. The computational simulation compare very well with the experimental observations of schlieren pictures. Experimental data such as temperature measurements with hot-wire probes are yet to be measured and will be compared with computed values. Extensive analysis of the computational simulations presents a clear picture of how the complex flow structure develops and the conditions under which self-similar flow structures evolve. From the computations, the plume structure can be further classified into many sub-groups. In the proposed paper, detail results from the experimental and computational simulations for single, axisymmetric, under- and over-expanded, sonic and supersonic plumes will be compared and the fluid dynamic aspects of flow structures will be discussed.
Proposal of an Algorithm to Synthesize Music Suitable for Dance
NASA Astrophysics Data System (ADS)
Morioka, Hirofumi; Nakatani, Mie; Nishida, Shogo
This paper proposes an algorithm for synthesizing music suitable for emotions in moving pictures. Our goal is to support multi-media content creation; web page design, animation films and so on. Here we adopt a human dance as a moving picture to examine the availability of our method. Because we think the dance image has high affinity with music. This algorithm is composed of three modules. The first is the module for computing emotions from an input dance image, the second is for computing emotions from music in the database and the last is for selecting music suitable for input dance via an interface of emotion.
A Computer Analysis of Library Postcards. (CALP)
ERIC Educational Resources Information Center
Stevens, Norman D.
1974-01-01
A description of a sophisticated application of computer techniques to the analysis of a collection of picture postcards of library buildings in an attempt to establish the minimum architectural requirements needed to distinguish one style of library building from another. (Author)
The microcomputer in cell and neurobiology research
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mize, R.R.
1985-01-01
This book contains 21 chapters. They are divided into the following sections: The Microcomputer as a Research Tool, Microcomputer Uses in Light and Electron Microscopy, Microcomputer Uses in Morphometry, Serial Section Reconstruction, Microcomputer Uses in Imaging and Densitometry, and Microcomputer Uses in Electrophysiology.
Baranowski, Tom; Baranowski, Janice C; Watson, Kathleen B; Martin, Shelby; Beltran, Alicia; Islam, Noemi; Dadabhoy, Hafza; Adame, Su-heyla; Cullen, Karen; Thompson, Debbe; Buday, Richard; Subar, Amy
2011-03-01
To test the effect of image size and presence of size cues on the accuracy of portion size estimation by children. Children were randomly assigned to seeing images with or without food size cues (utensils and checked tablecloth) and were presented with sixteen food models (foods commonly eaten by children) in varying portion sizes, one at a time. They estimated each food model's portion size by selecting a digital food image. The same food images were presented in two ways: (i) as small, graduated portion size images all on one screen or (ii) by scrolling across large, graduated portion size images, one per sequential screen. Laboratory-based with computer and food models. Volunteer multi-ethnic sample of 120 children, equally distributed by gender and ages (8 to 13 years) in 2008-2009. Average percentage of correctly classified foods was 60·3 %. There were no differences in accuracy by any design factor or demographic characteristic. Multiple small pictures on the screen at once took half the time to estimate portion size compared with scrolling through large pictures. Larger pictures had more overestimation of size. Multiple images of successively larger portion sizes of a food on one computer screen facilitated quicker portion size responses with no decrease in accuracy. This is the method of choice for portion size estimation on a computer.
Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A
2011-01-01
FRAX(®) is a fracture risk assessment algorithm developed by the World Health Organization in cooperation with other medical organizations and societies. Using easily available clinical information and femoral neck bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA), when available, FRAX(®) is used to predict the 10-year probability of hip fracture and major osteoporotic fracture. These values may be included in country specific guidelines to aid clinicians in determining when fracture risk is sufficiently high that the patient is likely to benefit from pharmacological therapy to reduce that risk. Since the introduction of FRAX(®) into clinical practice, many practical clinical questions have arisen regarding its use. To address such questions, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundations (IOF) assigned task forces to review the best available medical evidence and make recommendations for optimal use of FRAX(®) in clinical practice. Questions were identified and divided into three general categories. A task force was assigned to investigating the medical evidence in each category and developing clinically useful recommendations. The BMD Task Force addressed issues that included the potential use of skeletal sites other than the femoral neck, the use of technologies other than DXA, and the deletion or addition of clinical data for FRAX(®) input. The evidence and recommendations were presented to a panel of experts at the ISCD-IOF FRAX(®) Position Development Conference, resulting in the development of ISCD-IOF Official Positions addressing FRAX(®)-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Sepúlveda-Rivera, Vanessa; Donato-Santana, Christian; Diaz-Vega, Gil
2017-12-01
This study was meant to be the first step in bridging a gap in the literature concerning Puerto Rican geriatric patients' levels of knowledge concerning 4 preventive care screening tests: mammography, bone densitometry, colonoscopy, and lipid panels. Patients 65 years old and older were interviewed at the University of Puerto Rico (UPR), Medical Sciences Campus, primary care clinics. Fisher's exact test was used to assess knowledge status for each screening test. Fifty-three participants, 53% being women, took part in the study. All the women (100%) reported having knowledge about mammography screening as well as about bone densitometry scans (71%); 91% of the participants reported having knowledge concerning colonoscopy. Only 34% understood what information results from a lipid panel. The majority of the participants were not aware of precisely when each of the screening tests under discussion should be undertaken. For all the screenings, level of education and provider recommendation were associated with increased levels of knowledge (though statistically significant only for bone densitometry and lipid panels). Elderly Puerto Ricans appear to have knowledge about screening tests; however, there is an overall lack of knowledge about the timing of screening. Risk factors for this lack of knowledge are having a relatively lower level of education, the lack of healthcare-provider recommendation, and the lack of patient education. Understanding when to have tests is vital for interventions, in order to improve patient outcomes, which can include death from treatable conditions or diseases. Future research should include larger samples as well as studies of outcomes associated with these screening tests. These will help researchers and policymakers better understand this issue and aid in the development and implementation of interventions for both patients and physicians.
Barnes, K; Lanz, O; Werre, S; Clapp, K; Gilley, R
2015-01-01
To compare optical values in the osteotomy gap created after a tibial tuberosity advancement (TTA) treated with autogenous cancellous bone graft, extracorporeal shock wave therapy, a combination of autogenous cancellous bone graft and extracorporeal shock wave therapy, and absence of both autogenous cancellous bone graft and extracorporeal shock wave therapy using densitometry. Dogs that were presented for surgical repair of a cranial cruciate ligament rupture were randomly assigned to one of four groups: TTA with autogenous cancellous bone graft (TTA-G), TTA with autogenous cancellous bone graft and extracorporeal shock wave therapy (TTA-GS), TTA with extracorporeal shock wave therapy (TTA-S), and TTA with no additional therapy (TTA-O). Mediolateral radiographs at zero, four and eight weeks after surgery were evaluated to compare healing of the osteotomy gap via densitometry. An analysis of variance was used to compare the densitometric values between groups. At four weeks after surgery, a significant difference in osteotomy gap density was noted between TTA-GS (8.4 millimetres of aluminium equivalent [mmAleq]) and TTA-S (6.1 mmAleq), and between TTA-GS (8.4 mmAleq) and TTA-O (6.4 mmAleq). There were no significant differences noted between any groups at the eight week re-evaluation. There were no significant differences in the osteotomy gap density at eight weeks after surgery regardless of the treatment modality used. The combination of autogenous cancellous bone graft and extracorporeal shock wave therapy may lead to increased radiographic density of the osteotomy gap in the first four weeks after surgery. Densitometry using an aluminium step wedge is a feasible method for comparison of bone density after TTA in dogs.
Bošković, Lidija; Gašparić, Maja; Petković, Marija; Gugić, Damir; Lovasić, Ingrid Belac; Soldić, Željko; Miše, Branka Petrić; Dabelić, Nina; Vazdar, Ljubica; Vrdoljak, Eduard
2017-02-01
Randomized trials involving aromatase inhibitors (AIs) in the adjuvant treatment of breast cancer patients have reported increased osteoporosis risk. Bone loss can be reduced with appropriate life style, vitamin D and calcium supplements, and with bisphosphonate therapy. The aim of this analysis was to investigate adherence to vitamin D and calcium in postmenopausal breast cancer patients receiving adjuvant non-steroidal AIs, and oncologists' adherence to the bone health guidelines. This prospective study included 438 newly diagnosed patients and those who have already been receiving non-steroidal AIs for up to 3.5 years. Median endocrine therapy duration before recruitment in the study was 10.5 months (interquartile 4.8-26.6). Densitometry was performed on 142 patients (32.4%) before initiation of endocrine therapy, and on additional 38 (8.6%) patients at second study visit. Densitometry was not performed on 258 (59%) patients. Vitamin D and calcium were prescribed to 329/438 (75.1%) patients at some point during the study. Patients who took more than 80% of the prescribed dose were considered adherent. Self-reported adherence was 88.4%. Osteoporosis was diagnosed in 24 patients (5.5%) of the total study population, bearing in mind that 258/438 (59%) patients did not have densitometry. Bisphosphonates were prescribed to 54/438 (12.3%) patients, whilst only 19 (35.2%) of those had osteoporosis. In this analysis, lack of oncologists' adherence to the bone health guidelines was observed. In addition, a significant proportion of the patients did not adhere to the vitamin D and calcium. Copyright © 2016 Elsevier Ltd. All rights reserved.
A motion picture presentation of magnetic pulsations
NASA Technical Reports Server (NTRS)
Suzuki, A.; Kim, J. S.; Sugura, M.; Nagano, H.
1981-01-01
Using the data obtained from the IMS North American magnetometer network stations at high latitudes, a motion picture was made by a computer technique, describing time changes of Pc5 and Pi3 magnetic pulsation vectors. Examples of pulsation characteristics derived from this presentation are regional polarization changes including shifts of polarization demarcation lines, changes in the extent of an active region and its movement with time.
Lorah, Elizabeth R; Parnell, Ashley; Whitby, Peggy Schaefer; Hantula, Donald
2015-12-01
Powerful, portable, off-the-shelf handheld devices, such as tablet based computers (i.e., iPad(®); Galaxy(®)) or portable multimedia players (i.e., iPod(®)), can be adapted to function as speech generating devices for individuals with autism spectrum disorders or related developmental disabilities. This paper reviews the research in this new and rapidly growing area and delineates an agenda for future investigations. In general, participants using these devices acquired verbal repertoires quickly. Studies comparing these devices to picture exchange or manual sign language found that acquisition was often quicker when using a tablet computer and that the vast majority of participants preferred using the device to picture exchange or manual sign language. Future research in interface design, user experience, and extended verbal repertoires is recommended.
2001-09-01
The high-tech art of digital signal processing (DSP) was pioneered at NASA's Jet Propulsion Laboratory (JPL) in the mid-1960s for use in the Apollo Lunar Landing Program. Designed to computer enhance pictures of the Moon, this technology became the basis for the Landsat Earth resources satellites and subsequently has been incorporated into a broad range of Earthbound medical and diagnostic tools. DSP is employed in advanced body imaging techniques including Computer-Aided Tomography, also known as CT and CATScan, and Magnetic Resonance Imaging (MRI). CT images are collected by irradiating a thin slice of the body with a fan-shaped x-ray beam from a number of directions around the body's perimeter. A tomographic (slice-like) picture is reconstructed from these multiple views by a computer. MRI employs a magnetic field and radio waves, rather than x-rays, to create images.
The Computer-Job Salary Picture.
ERIC Educational Resources Information Center
Basta, Nicholas
1987-01-01
Discusses starting salaries for graduates with various degrees in computer science and electrical engineering. Summarizes the results of a recent study by the Institute of Electrical and Electronics Engineers (IEEE) which provides salary estimates for graduates in different specialties and in different geographical locations. (TW)
A Very Tentative Computer System Model. Occasional Paper No. 3.
ERIC Educational Resources Information Center
Breslow, Martin P.
The developmental paper, one of a series written as the Management Information System for Occupational Education (MISOE) was conceptualized, is a first attempt to picture the computer system necessary to carry out the project's goals. It describes the basic structure and the anticipated strategies of development of the computer system to be used.…
Going Around On Circles: Mathematics and Computer Art. Part 2.
ERIC Educational Resources Information Center
Gordon, Sheldon P.; Gordon, Florence S.
1984-01-01
Discusses properties of epicycloids. (The easiest way to picture them is to think of a piece of radioactive bubble gum attached to a wheel which is rolling around the outside of a larger wheel.) Includes a computer program (TRS-80 color computer) that will graph any epicycloid with integer values for the radii. (JN)
Pyka, Alina; Budzisz, Marika; Dołowy, Małgorzata
2013-01-01
Adsorption thin layer chromatography (NP-TLC) with densitometry has been established for the identification and the quantification of acetaminophen in three leading commercial products of pharmaceutical tablets coded as brand: P1 (Product no. 1), P2 (Product no. 2), and P3 (Product no. 3). Applied chromatographic conditions have separated acetaminophen from its related substances, namely, 4-aminophenol and and 4′-chloroacetanilide. UV densitometry was performed in absorbance mode at 248 nm. The presented method was validated by specificity, range, linearity, accuracy, precision, detection limit, quantitative limit, and robustness. The TLC-densitometric method was also compared with a pharmacopeial UV-spectrophotometric method for the assay of acetaminophen, and the results confirmed statistically that the NP-TLC-densitometric method can be used as a substitute method. It could be said that the validated NP-TLC-densitometric method is suitable for the routine analysis of acetaminophen in quantity control laboratories. PMID:24063006
NASA Astrophysics Data System (ADS)
Stovall, Stephanie; Midgett, Madeline; Thornburg, Kent; Rugonyi, Sandra
2016-11-01
Abnormal blood flow during early cardiovascular development has been identified as a key factor in the pathogenesis of congenital heart disease; however, the mechanisms by which altered hemodynamics induce cardiac malformations are poorly understood. This study used outflow tract (OFT) banding to model increased afterload, pressure, and blood flow velocities at tubular stages of heart development and characterized the immediate changes in cardiac wall motion due to banding in chicken embryo models with light microscopy-based video densitometry. Optical videos were used to acquire two-dimensional heart image sequences over the cardiac cycle, from which intensity data were extracted along the heart centerline at several locations in the heart ventricle and OFT. While no changes were observed in the synchronous contraction of the ventricle with banding, the peristaltic-like wall motion in the OFT was significantly affected. Our data provide valuable insight into early cardiac biomechanics and its characterization using a simple light microscopy-based imaging modality.
Affonso, Raphael S; Lima, Josélia A; Lessa, Bruno M; Caetano, João V O; Obara, Marcos T; Nóbrega, Andréa B; Nepovimova, Eugenie; Musilek, Kamil; Kuca, Kamil; Slana, Gláucia B C A; França, Tanos C C
2018-02-01
The rise of the mosquitoes-transmitted diseases, like dengue, zika and chikungunya in Brazil in the last years has increased concerns on protection against mosquitoes bites. However, the prohibitive prices of the commercially available repellents for the majority of the Brazilian population has provoked a search for cheaper solutions, like the use of the homemade ethanolic extract of Indian clove (Syzygium aromaticum L.) as repellent, which has been reported as quite efficient by the local press. In order to verify this, we performed here the quantification of the main components of this extract through high-performance thin-layer chromatography (HPTLC)-densitometry and evaluated its efficiency as a repellent and its acetylcholinesterase (AChE) inhibition capacity. Our results have proved HPTLC-densitometry as an efficient and appropriate method for this quantification and confirmed the repellency activity, as well as its capacity of AChE inhibition. Copyright © 2017 John Wiley & Sons, Ltd.
Jeffery, Nicholas W; Gregory, T Ryan
2014-10-01
Crustaceans are enormously diverse both phylogenetically and ecologically, but they remain substantially underrepresented in the existing genome size database. An expansion of this dataset could be facilitated if it were possible to obtain genome size estimates from ethanol-preserved specimens. In this study, two tests were performed in order to assess the reliability of genome size data generated using preserved material. First, the results of estimates based on flash-frozen versus ethanol-preserved material were compared across 37 species of crustaceans that differ widely in genome size. Second, a comparison was made of specimens from a single species that had been stored in ethanol for 1-14 years. In both cases, the use of gill tissue in Feulgen image analysis densitometry proved to be a very viable approach. This finding is of direct relevance to both new studies of field-collected crustaceans as well as potential studies based on existing collections. © 2014 International Society for Advancement of Cytometry.
Zhou, Bin; Chang, Jun; Wang, Ping; Li, Jie; Cheng, Dan; Zheng, Peng-Wu
2014-01-01
The quality of Morindaofficinalis, which has been used as a Yang-tonic agent for a long time in China, can be evaluated. A double-development high performance thin layer chromatography (HPTLC) method has been established to simultaneously analyze quality and quantity of seven inulin-type oligosaccharides (DP=3-9) in Morindaofficinalis. The chromatography was performed on a silica gel 60 plate with the 7:5:2:1 proportion (v/v) of n-butanol-isopropanol-water-acetic acid for the first and second developments, respectively. The bands were visualized by the reaction with aniline-diphenylamine-phosphoric acid solution and analyzed by densitometric TLC at 540 nm. Quantification of seven oligosaccharides was achieved by densitometry at 540 nm. The investigated standard sugar had good linearity (R2>0.99) within test ranges. The amounts of seven oligosaccharides were calculated by the relative correction factor (RCF). Therefore, the developed TLC method could be used for quality control of Morindaofficinalis.
Gallo-Oller, Gabriel; Ordoñez, Raquel; Dotor, Javier
2018-06-01
Since its first description, Western blot has been widely used in molecular labs. It constitutes a multistep method that allows the detection and/or quantification of proteins from simple to complex protein mixtures. Western blot quantification method constitutes a critical step in order to obtain accurate and reproducible results. Due to the technical knowledge required for densitometry analysis together with the resources availability, standard office scanners are often used for the imaging acquisition of developed Western blot films. Furthermore, the use of semi-quantitative software as ImageJ (Java-based image-processing and analysis software) is clearly increasing in different scientific fields. In this work, we describe the use of office scanner coupled with the ImageJ software together with a new image background subtraction method for accurate Western blot quantification. The proposed method represents an affordable, accurate and reproducible approximation that could be used in the presence of limited resources availability. Copyright © 2018 Elsevier B.V. All rights reserved.
Dimai, Hans P; Chandran, Manju
2011-01-01
The worldwide prevalence of smoking has been estimated at about 50% in men, and 10% in women, with larger variations among different populations studied. Smoking has been shown to affect many organ systems resulting in severe morbidity and increased mortality. In addition, smoking has been identified as a predictor of ten-year fracture risk in men and women, largely independent of an individual's bone mineral density. This finding has eventually lead to incorporation of this risk factor into FRAX®, an algorithm that has been developed to calculate an individual's ten-year fracture risk. However, only little, or conflicting data is available on a possible association between smoking dose, duration, length of time after cessation, type of tobacco and fracture risk, limiting this risk factor's applicability in the context of FRAX®. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Cue reactivity and its inhibition in pathological computer game players.
Lorenz, Robert C; Krüger, Jenny-Kathinka; Neumann, Britta; Schott, Björn H; Kaufmann, Christian; Heinz, Andreas; Wüstenberg, Torsten
2013-01-01
Despite a rising social relevance of pathological computer game playing, it remains unclear whether the neurobiological basis of this addiction-like behavioral disorder and substance-related addiction are comparable. In substance-related addiction, attentional bias and cue reactivity are often observed. We conducted a functional magnetic resonance study using a dot probe paradigm with short-presentation (attentional bias) and long-presentation (cue reactivity) trials in eight male pathological computer game players (PCGPs) and nine healthy controls (HCs). Computer game-related and neutral computer-generated pictures, as well as pictures from the International Affective Picture System with positive and neutral valence, served as stimuli. PCGPs showed an attentional bias toward both game-related and affective stimuli with positive valence. In contrast, HCs showed no attentional bias effect at all. PCGPs showed stronger brain responses in short-presentation trials compared with HCs in medial prefrontal cortex (MPFC) and anterior cingulate gyrus and in long-presentation trials in lingual gyrus. In an exploratory post hoc functional connectivity analyses, for long-presentation trials, connectivity strength was higher between right inferior frontal gyrus, which was associated with inhibition processing in previous studies, and cue reactivity-related regions (left orbitofrontal cortex and ventral striatum) in PCGPs. We observed behavioral and neural effects in PCGPs, which are comparable with those found in substance-related addiction. However, cue-related brain responses were depending on duration of cue presentation. Together with the connectivity result, these findings suggest that top-down inhibitory processes might suppress the cue reactivity-related neural activity in long-presentation trials. © 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction.
Electromagnetic Induction: A Computer-Assisted Experiment
ERIC Educational Resources Information Center
Fredrickson, J. E.; Moreland, L.
1972-01-01
By using minimal equipment it is possible to demonstrate Faraday's Law. An electronic desk calculator enables sophomore students to solve a difficult mathematical expression for the induced EMF. Polaroid pictures of the plot of induced EMF, together with the computer facility, enables students to make comparisons. (PS)
Simulation of forming a flat forging
NASA Astrophysics Data System (ADS)
Solomonov, K.; Tishchuk, L.; Fedorinin, N.
2017-11-01
The metal flow in some of the metal shaping processes (rolling, pressing, die forging) is subjected to the regularities which determine the scheme of deformation in the metal samples upsetting. The object of the study was the research of the metal flow picture including the contour of the part, the demarcation lines of the metal flow and the flow lines. We have created an algorithm for constructing the metal flow picture, which is based on the representation of the metal flow demarcation line as an equidistant. Computer and physical simulation of the metal flow picture with the help of various software systems confirms the suggested hypothesis.
New low noise CCD cameras for Pi-of-the-Sky project
NASA Astrophysics Data System (ADS)
Kasprowicz, G.; Czyrkowski, H.; Dabrowski, R.; Dominik, W.; Mankiewicz, L.; Pozniak, K.; Romaniuk, R.; Sitek, P.; Sokolowski, M.; Sulej, R.; Uzycki, J.; Wrochna, G.
2006-10-01
Modern research trends require observation of fainter and fainter astronomical objects on large areas of the sky. This implies usage of systems with high temporal and optical resolution with computer based data acquisition and processing. Therefore Charge Coupled Devices (CCD) became so popular. They offer quick picture conversion with much better quality than film based technologies. This work is theoretical and practical study of the CCD based picture acquisition system. The system was optimized for "Pi of The Sky" project. But it can be adapted to another professional astronomical researches. The work includes issue of picture conversion, signal acquisition, data transfer and mechanical construction of the device.
Photography/Digital Imaging: Parallel & Paradoxical Histories.
ERIC Educational Resources Information Center
Witte, Mary Stieglitz
With the introduction of photography and photomechanical printing processes in the 19th century, the first age of machine pictures and reproductions emerged. The 20th century introduced computer image processing systems, creating a digital imaging revolution. Rather than concentrating on the adversarial aspects of the computer's influence on…
2001-01-01
The high-tech art of digital signal processing (DSP) was pioneered at NASA's Jet Propulsion Laboratory (JPL) in the mid-1960s for use in the Apollo Lunar Landing Program. Designed to computer enhance pictures of the Moon, this technology became the basis for the Landsat Earth resources satellites and subsequently has been incorporated into a broad range of Earthbound medical and diagnostic tools. DSP is employed in advanced body imaging techniques including Computer-Aided Tomography, also known as CT and CATScan, and Magnetic Resonance Imaging (MRI). CT images are collected by irradiating a thin slice of the body with a fan-shaped x-ray beam from a number of directions around the body's perimeter. A tomographic (slice-like) picture is reconstructed from these multiple views by a computer. MRI employs a magnetic field and radio waves, rather than x-rays, to create images. In this photograph, a patient undergoes an open MRI.
Small Interactive Image Processing System (SMIPS) users manual
NASA Technical Reports Server (NTRS)
Moik, J. G.
1973-01-01
The Small Interactive Image Processing System (SMIP) is designed to facilitate the acquisition, digital processing and recording of image data as well as pattern recognition in an interactive mode. Objectives of the system are ease of communication with the computer by personnel who are not expert programmers, fast response to requests for information on pictures, complete error recovery as well as simplification of future programming efforts for extension of the system. The SMIP system is intended for operation under OS/MVT on an IBM 360/75 or 91 computer equipped with the IBM-2250 Model 1 display unit. This terminal is used as an interface between user and main computer. It has an alphanumeric keyboard, a programmed function keyboard and a light pen which are used for specification of input to the system. Output from the system is displayed on the screen as messages and pictures.
Use of cone beam computed tomography in identifying postmenopausal women with osteoporosis.
Brasileiro, C B; Chalub, L L F H; Abreu, M H N G; Barreiros, I D; Amaral, T M P; Kakehasi, A M; Mesquita, R A
2017-12-01
The aim of this study is to correlate radiometric indices from cone beam computed tomography (CBCT) images and bone mineral density (BMD) in postmenopausal women. Quantitative CBCT indices can be used to screen for women with low BMD. Osteoporosis is a disease characterized by the deterioration of bone tissue and the consequent decrease in BMD and increase in bone fragility. Several studies have been performed to assess radiometric indices in panoramic images as low-BMD predictors. The aim of this study is to correlate radiometric indices from CBCT images and BMD in postmenopausal women. Sixty postmenopausal women with indications for dental implants and CBCT evaluation were selected. Dual-energy X-ray absorptiometry (DXA) was performed, and the patients were divided into normal, osteopenia, and osteoporosis groups, according to the World Health Organization (WHO) criteria. Cross-sectional images were used to evaluate the computed tomography mandibular index (CTMI), the computed tomography index (inferior) (CTI (I)) and computed tomography index (superior) (CTI (S)). Student's t test was used to compare the differences between the indices of the groups' intraclass correlation coefficient (ICC). Statistical analysis showed a high degree of interobserver and intraobserver agreement for all measurements (ICC > 0.80). The mean values of CTMI, CTI (S), and CTI (I) were lower in the osteoporosis group than in osteopenia and normal patients (p < 0.05). In comparing normal patients and women with osteopenia, there was no statistically significant difference in the mean value of CTI (I) (p = 0.075). Quantitative CBCT indices may help dentists to screen for women with low spinal and femoral bone mineral density so that they can refer postmenopausal women for bone densitometry.
Automated Production of Movies on a Cluster of Computers
NASA Technical Reports Server (NTRS)
Nail, Jasper; Le, Duong; Nail, William L.; Nail, William
2008-01-01
A method of accelerating and facilitating production of video and film motion-picture products, and software and generic designs of computer hardware to implement the method, are undergoing development. The method provides for automation of most of the tedious and repetitive tasks involved in editing and otherwise processing raw digitized imagery into final motion-picture products. The method was conceived to satisfy requirements, in industrial and scientific testing, for rapid processing of multiple streams of simultaneously captured raw video imagery into documentation in the form of edited video imagery and video derived data products for technical review and analysis. In the production of such video technical documentation, unlike in production of motion-picture products for entertainment, (1) it is often necessary to produce multiple video derived data products, (2) there are usually no second chances to repeat acquisition of raw imagery, (3) it is often desired to produce final products within minutes rather than hours, days, or months, and (4) consistency and quality, rather than aesthetics, are the primary criteria for judging the products. In the present method, the workflow has both serial and parallel aspects: processing can begin before all the raw imagery has been acquired, each video stream can be subjected to different stages of processing simultaneously on different computers that may be grouped into one or more cluster(s), and the final product may consist of multiple video streams. Results of processing on different computers are shared, so that workers can collaborate effectively.
Secure Distributed Human Computation
NASA Astrophysics Data System (ADS)
Gentry, Craig; Ramzan, Zulfikar; Stubblebine, Stuart
In Peha’s Financial Cryptography 2004 invited talk, he described the Cyphermint PayCash system (see www.cyphermint.com), which allows people without bank accounts or credit cards (a sizeable segment of the U.S. population) to automatically and instantly cash checks, pay bills, or make Internet transactions through publicly-accessible kiosks. Since PayCash offers automated financial transactions and since the system uses (unprotected) kiosks, security is critical. The kiosk must decide whether a person cashing a check is really the person to whom the check was made out, so it takes a digital picture of the person cashing the check and transmits this picture electronically to a central office, where a human worker compares the kiosk’s picture to one that was taken when the person registered with Cyphermint. If both pictures are of the same person, then the human worker authorizes the transaction.
A user's guide for DTIZE an interactive digitizing and graphical editing computer program
NASA Technical Reports Server (NTRS)
Thomas, C. C.
1981-01-01
A guide for DTIZE, a two dimensional digitizing program with graphical editing capability, is presented. DTIZE provides the capability to simultaneously create and display a picture on the display screen. Data descriptions may be permanently saved in three different formats. DTIZE creates the picture graphics in the locator mode, thus inputting one coordinate each time the terminator button is pushed. Graphic input devices (GIN) are also used to select function command menu. These menu commands and the program's interactive prompting sequences provide a complete capability for creating, editing, and permanently recording a graphical picture file. DTIZE is written in FORTRAN IV language for the Tektronix 4081 graphic system utilizing the Plot 80 Distributed Graphics Library (DGL) subroutines. The Tektronix 4953/3954 Graphic Tablet with mouse, pen, or joystick are used as graphics input devices to create picture graphics.
NASA Technical Reports Server (NTRS)
Morris, E. C.
1985-01-01
The Viking Lander 1 and 2 cameras acquired many high-resolution pictures of the Chryse Planitia and Utopia Planitia landing sites. Based on computer-processed data of a selected number of these pictures, eight high-resolution mosaics were published by the U.S. Geological Survey as part of the Atlas of Mars, Miscellaneous Investigation Series. The mosaics are composites of the best picture elements (pixels) of all the Lander pictures used. Each complete mosaic extends 342.5 deg in azimuth, from approximately 5 deg above the horizon to 60 deg below, and incorporates approximately 15 million pixels. Each mosaic is shown in a set of five sheets. One sheet contains the full panorama from one camera taken in either morning or evening. The other four sheets show sectors of the panorama at an enlarged scale; when joined together they make a panorama approximately 2' X 9'.
Linear Dichroism Characteristics of Ethidium and Proflavine Supercoiled DNA Complexes
1990-01-01
of Ethidium-and Proflavine -Supercoi led DNA Complexes CHARLES E. SWENBERG, 1 SUSAN E. CARBERRV, 2 * and NICHOLAS E. GEACINTOV’ SRadliationl Biochenitr...drug were stained with EB, photographed under uv light, molecules, EB and proflavine (PF) (Figure 1), and the bands were quantitated by densitometry
NASA Astrophysics Data System (ADS)
Beltran, J.; Maia, N. T.; Pimentel, B. M.
2018-04-01
Scalar Quantum Electrodynamics is investigated in the Heisenberg picture via the Duffin-Kemmer-Petiau gauge theory. On this framework, a perturbative method is used to compute the vacuum polarization tensor and its corresponding induced current for the case of a charged scalar field in the presence of an external electromagnetic field. Charge renormalization is brought into discussion for the interpretation of the results for the vacuum polarization.
Pees, Michael; Kiefer, Ingmar; Thielebein, Jens; Oechtering, Gerhard; Krautwald-Junghanns, Maria-Elisabeth
2009-01-01
Thirty-nine healthy boid snakes representing six different species (Python regius, Boa constrictor, Python reticulatus, Morelia viridis, Epicrates cenchria, and Morelia spilota) were examined using computed tomography (CT) to characterize the normal appearance of the respiratory tissue. Assessment was done subjectively and densitometry was performed using a defined protocol. The length of the right lung was calculated to be 11.1% of the body length, without a significant difference between species. The length of the left lung in proportion to the right was dependent on the species examined. The most developed left lung was in P. regius (81.2%), whereas in B. constrictor, the left lung was vestigial or absent (24.7%). A median attenuation of -814.6 HU and a variability of 45.9 HU were calculated for all species with no significant difference between species. Within the species, a significantly higher attenuation was found for P. regius in the dorsal and cranial aspect of the lung compared with the ventral and caudal part. In B. constrictor, the reduced left lung was significantly hyperattenuating compared with the right lung. Results of this study emphasize the value of CT and provide basic reference data for assessment of the snake lung in these species. Veterinary Radiology &
Volume adjustment of lung density by computed tomography scans in patients with emphysema.
Shaker, S B; Dirksen, A; Laursen, L C; Skovgaard, L T; Holstein-Rathlou, N H
2004-07-01
To determine how to adjust lung density measurements for the volume of the lung calculated from computed tomography (CT) scans in patients with emphysema. Fifty patients with emphysema underwent 3 CT scans at 2-week intervals. The scans were analyzed with a software package that detected the lung in contiguous images and subsequently generated a histogram of the pixel attenuation values. The total lung volume (TLV), lung weight, percentile density (PD), and relative area of emphysema (RA) were calculated from this histogram. RA and PD are commonly applied measures of pulmonary emphysema derived from CT scans. These parameters are markedly influenced by changes in the level of inspiration. The variability of lung density due to within-subject variation in TLV was explored by plotting TLV against PD and RA. The coefficients for volume adjustment for PD were relatively stable over a wide range from the 10th to the 80th percentile, whereas for RA the coefficients showed large variability especially in the lower range, which is the most relevant for quantitation of pulmonary emphysema. Volume adjustment is mandatory in repeated CT densitometry and is more robust for PD than for RA. Therefore, PD seems more suitable for monitoring the progression of emphysema.
Van Cauwenberge, Valerie; Sonuga-Barke, Edmund J S; Hoppenbrouwers, Karel; Van Leeuwen, Karla; Wiersema, Jan R
2017-03-01
Studies have demonstrated inefficient use of antecedent-focused emotion regulation strategies in children with ADHD attention-deficit/hyperactivity disorder (ADHD). In the current study we tested for the first time if ADHD is also associated with difficulties in response-focused strategies by measuring the ability to override action tendencies induced by emotional information. Performance data on a computer-based approach-avoidance paradigm of 28 children with ADHD and 38 typically developing children between 8 and 15 years of age were analyzed, by comparing a congruent condition in which they were instructed to approach positive and avoid negative pictures and an incongruent condition where they had to override these automatic reactions and approach negative and avoid positive pictures. Children also rated the valence and salience of the pictures. Children with ADHD and typically developing children rated the emotional valence of the pictures appropriately and similarly, while positive pictures were rated as more arousing by children with ADHD. Solid congruency effects were found indicating that the task measured response-focused emotion regulation; however groups did not differ in this respect. Our findings do not support a deficit in emotion regulation in ADHD in terms of the ability to override natural tendencies to approach positive and avoid negative pictures.
ERIC Educational Resources Information Center
Williams, E. D.
1989-01-01
Discussed is a radionuclide imaging technique, including the gamma camera, image analysis computer, radiopharmaceuticals, and positron emission tomography. Several pictures showing the use of this technique are presented. (YP)
Interactive graphics system for IBM 1800 computer
NASA Technical Reports Server (NTRS)
Carleton, T. P.; Howell, D. R.; Mish, W. H.
1972-01-01
A FORTRAN compatible software system that has been developed to provide an interactive graphics capability for the IBM 1800 computer is described. The interactive graphics hardware consists of a Hewlett-Packard 1300A cathode ray tube, Sanders photopen, digital to analog converters, pulse counter, and necessary interface. The hardware is available from IBM as several related RPQ's. The software developed permits the application programmer to use IBM 1800 FORTRAN to develop a display on the cathode ray tube which consists of one or more independent units called pictures. The software permits a great deal of flexibility in the manipulation of these pictures and allows the programmer to use the photopen to interact with the displayed data and make decisions based on information returned by the photopen.
Exploration of Mars by Mariner 9 - Television sensors and image processing.
NASA Technical Reports Server (NTRS)
Cutts, J. A.
1973-01-01
Two cameras equipped with selenium sulfur slow scan vidicons were used in the orbital reconnaissance of Mars by the U.S. Spacecraft Mariner 9 and the performance characteristics of these devices are presented. Digital image processing techniques have been widely applied in the analysis of images of Mars and its satellites. Photometric and geometric distortion corrections, image detail enhancement and transformation to standard map projection have been routinely employed. More specializing applications included picture differencing, limb profiling, solar lighting corrections, noise removal, line plots and computer mosaics. Information on enhancements as well as important picture geometric information was stored in a master library. Display of the library data in graphic or numerical form was accomplished by a data management computer program.
A comparison of communication using the Apple iPad and a picture-based system.
Flores, Margaret; Musgrove, Kate; Renner, Scott; Hinton, Vanessa; Strozier, Shaunita; Franklin, Susan; Hil, Doris
2012-06-01
Augmentative and alternative communication (AAC) interventions have been shown to improve both communication and social skills in children and youth with autism spectrum disorders and other developmental disabilities. AAC applications have become available for personal devices such as cell phones, MP3 Players, and personal computer tablets. It is critical that these new forms of AAC are explored and evaluated. The purpose of this study was to investigate the utility of the Apple iPad™ as a communication device by comparing its use to a communication system using picture cards. Five elementary students with autism spectrum disorders and developmental disabilities who used a picture card system participated in the study. The results were mixed; communication behaviors either increased when using the iPad or remained the same as when using picture cards. The implications of these findings are discussed.
mPano: cloud-based mobile panorama view from single picture
NASA Astrophysics Data System (ADS)
Li, Hongzhi; Zhu, Wenwu
2013-09-01
Panorama view provides people an informative and natural user experience to represent the whole scene. The advances on mobile augmented reality, mobile-cloud computing, and mobile internet can enable panorama view on mobile phone with new functionalities, such as anytime anywhere query where a landmark picture is and what the whole scene looks like. To generate and explore panorama view on mobile devices faces significant challenges due to the limitations of computing capacity, battery life, and memory size of mobile phones, as well as the bandwidth of mobile Internet connection. To address the challenges, this paper presents a novel cloud-based mobile panorama view system that can generate and view panorama-view on mobile devices from a single picture, namely "Pano". In our system, first, we propose a novel iterative multi-modal image retrieval (IMIR) approach to get spatially adjacent images using both tag and content information from the single picture. Second, we propose a cloud-based parallel server synthing approach to generate panorama view in cloud, against today's local-client synthing approach that is almost impossible for mobile phones. Third, we propose predictive-cache solution to reduce latency of image delivery from cloud server to the mobile client. We have built a real mobile panorama view system and perform experiments. The experimental results demonstrated the effectiveness of our system and the proposed key component technologies, especially for landmark images.
16 CFR 23.2 - Misleading illustrations.
Code of Federal Regulations, 2014 CFR
2014-01-01
... representation, picture, televised or computer image, illustration, diagram, or other depiction which, either alone or in conjunction with any accompanying words or phrases, misrepresents the type, kind, grade...
16 CFR 23.2 - Misleading illustrations.
Code of Federal Regulations, 2011 CFR
2011-01-01
... representation, picture, televised or computer image, illustration, diagram, or other depiction which, either alone or in conjunction with any accompanying words or phrases, misrepresents the type, kind, grade...
16 CFR 23.2 - Misleading illustrations.
Code of Federal Regulations, 2012 CFR
2012-01-01
... representation, picture, televised or computer image, illustration, diagram, or other depiction which, either alone or in conjunction with any accompanying words or phrases, misrepresents the type, kind, grade...
16 CFR 23.2 - Misleading illustrations.
Code of Federal Regulations, 2013 CFR
2013-01-01
... representation, picture, televised or computer image, illustration, diagram, or other depiction which, either alone or in conjunction with any accompanying words or phrases, misrepresents the type, kind, grade...
George Leonard's View of the Computer in Education.
ERIC Educational Resources Information Center
Bork, Alfred
Relatively few individuals have attempted to view the future of computers in education, and those who have done so often tend to focus too much upon present capabilities rather than thinking about the changes that new technology will introduce in the future. George Leonard's book "Education and Ecstasy" provides an interesting picture of…
Teaching through Interactive Pictures: Computer, Video and Human Realities.
ERIC Educational Resources Information Center
Strauss, Andre
A technique designed to make the classroom use of videotapes for second language teaching for specific purposes more efficient is described. The technique begins with a classroom review of basic vocabulary and structures, which is then tested with a computer exercise. A second stage requires discussion and memorization of vocabulary and phrases…
What Is A Picture Archiving And Communication System (PACS)?
NASA Astrophysics Data System (ADS)
Marceau, Carla
1982-01-01
A PACS is a digital system for acquiring, storing, moving and displaying picture or image information. It is an alternative to film jackets that has been made possible by recent breakthroughs in computer technology: telecommunications, local area nets and optical disks. The fundamental concept of the digital representation of image information is introduced. It is shown that freeing images from a material representation on film or paper leads to a dramatic increase in flexibility in our use of the images. The ultimate goal of a medical PACS system is a radiology department without film jackets. The inherent nature of digital images and the power of the computer allow instant free "copies" of images to be made and thrown away. These copies can be transmitted to distant sites in seconds, without the "original" ever leaving the archives of the radiology department. The result is a radiology department with much freer access to patient images and greater protection against lost or misplaced image information. Finally, images in digital form can be treated as data for the computer in image processing, which includes enhancement, reconstruction and even computer-aided analysis.
Investigation of television transmission using adaptive delta modulation principles
NASA Technical Reports Server (NTRS)
Schilling, D. L.
1976-01-01
The results are presented of a study on the use of the delta modulator as a digital encoder of television signals. The computer simulation of different delta modulators was studied in order to find a satisfactory delta modulator. After finding a suitable delta modulator algorithm via computer simulation, the results were analyzed and then implemented in hardware to study its ability to encode real time motion pictures from an NTSC format television camera. The effects of channel errors on the delta modulated video signal were tested along with several error correction algorithms via computer simulation. A very high speed delta modulator was built (out of ECL logic), incorporating the most promising of the correction schemes, so that it could be tested on real time motion pictures. Delta modulators were investigated which could achieve significant bandwidth reduction without regard to complexity or speed. The first scheme investigated was a real time frame to frame encoding scheme which required the assembly of fourteen, 131,000 bit long shift registers as well as a high speed delta modulator. The other schemes involved the computer simulation of two dimensional delta modulator algorithms.
[In vitro study with techniques of imaging of the composition of urinary calculi].
Tellez Martínez-Fornés, M; Burgos Revilla, F J; Sáez Garrido, J C; Soria Descalzo, J; Barbero González, J; Sánchez Corral, J; Minaya Minaya, A; Vallejo Herrador, J
1997-02-01
Pre-treatment knowledge of the lithiasic composition can be useful to design the most appropriate therapeutic scheme for each kind of stone. The relationship between the stone's densitometry information provided by the different imaging techniques, conventional radiology (RX), computerized axial tomography (CAT) and dual energy radiographic densitometry (DO) is analyzed, as well as the elemental composition determined by the microanalysis of fragments obtained post-lithotrity using a scanning electronic microscope (SEM) associated to X-ray dispersion energy (XDE). 60 stones, 12 for each pure composition selected (calcium oxalate mono and dihydro, phosphocarbonate, magnesium ammonium phosphate and uric acid), were studied with XR, CAT and DO and were later subjected to lithofragmentation in vitro. Fragments analysis was carried out post-lithotrity with SEM associated to XDE. The X-ray does not allow to establish the composition of some calculi. CAT quantifies the mineral contents of the oxalocalcic and infective calculi and differentiates the uric acid from the other compositions because the mean density values are under 500 Hounsfield Units. DO evaluates the lithiasic content in phosphocarbonate salts which are structurally similar to bone hydroxyapatite.
National protocol for quality assurance in DXA-bone densitometry
NASA Astrophysics Data System (ADS)
Slavchev, A.; Avramova-Cholakova, S.; Vassileva, J.
2008-01-01
Osteoporosis becomes largely one of the most important socially significant and costly diseases. Modern techniques (DXA, US) are applied for bone densitometry. The paper presents a protocol for quality assurance especially of DXA-bone densitometers including quality control made in compliance with international standards (ISCD, IOF). The methodology has been tested in practice by measurements on site-functional assessment, entrance dose, radiation protection, calibration,
Day, J Michael; Franklin, Dean E.; Brown, Bonnie L.
2000-09-01
This study was undertaken to develop a quantitative polymerase chain reaction assay that would improve the utility of PCR for detecting Haplosporidium nelsoni (MSX), a serious parasite of the eastern oyster Crassostrea virginica. A competitive PCR sequence was generated from the H. nelsoni small subunit ribosomal DNA fragment, originally described by Stokes and colleagues, that was amplified by the same PCR primers and had similar amplification performance. Assays performed using competitor dilutions ranging from 0.05 to 500 pg/µl DNA were used to test oyster samples designated using histological techniques as having "light" or "heavy" MSX infections. Visual diagnoses were confirmed equally well with three methods: densitometry of ethidium-bromide-stained agarose, densitometry of SYBRGreen-stained polyacrylamide gels, and analysis by GeneScan 3.0 of fluorescent products detected in ultrathin gels. Oysters diagnosed as negative for MSX tested as negative or light by PCR. Oysters with light MSX infections generally had less than 5 pg/µl infectious DNA. Oysters with heavy infections generally corresponded to 5 pg/µl or greater competitor dilutions.
McCloskey, Eugene V; Binkley, Neil
2011-01-01
The World Health Organization fracture risk assessment tool, FRAX(®), is an advance in clinical care that can assist in clinical decision-making. However, with increasing clinical utilization, numerous questions have arisen regarding how to best estimate fracture risk in an individual patient. Recognizing the need to assist clinicians in optimal use of FRAX(®), the International Osteoporosis Foundation (IOF) in conjunction with the International Society for Clinical Densitometry (ISCD) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX(®) usage. As part of the process, the charge of the FRAX(®) Clinical Task Force was to review and synthesize data surrounding a number of recognized clinical risk factors including rheumatoid arthritis, smoking, alcohol, prior fracture, falls, bone turnover markers and glucocorticoid use. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the Clinical Task Force composition and charge is presented here. Copyright © 2011. Published by Elsevier Inc.
NASA Technical Reports Server (NTRS)
1978-01-01
The marine turbine pump pictured is the Jacuzzi 12YJ, a jet propulsion system for pleasure or commercial boating. Its development was aided by a NASA computer program made available by the Computer Software Management and Information Center (COSMIC) at the University of Georgia. The manufacturer, Jacuzzi Brothers, Incorporated, Little Rock, Arkansas, used COSMIC'S Computer Program for Predicting Turbopump Inducer Loading, which enabled substantial savings in development time and money through reduction of repetitive testing.
Computational Biochemistry-Enzyme Mechanisms Explored.
Culka, Martin; Gisdon, Florian J; Ullmann, G Matthias
2017-01-01
Understanding enzyme mechanisms is a major task to achieve in order to comprehend how living cells work. Recent advances in biomolecular research provide huge amount of data on enzyme kinetics and structure. The analysis of diverse experimental results and their combination into an overall picture is, however, often challenging. Microscopic details of the enzymatic processes are often anticipated based on several hints from macroscopic experimental data. Computational biochemistry aims at creation of a computational model of an enzyme in order to explain microscopic details of the catalytic process and reproduce or predict macroscopic experimental findings. Results of such computations are in part complementary to experimental data and provide an explanation of a biochemical process at the microscopic level. In order to evaluate the mechanism of an enzyme, a structural model is constructed which can be analyzed by several theoretical approaches. Several simulation methods can and should be combined to get a reliable picture of the process of interest. Furthermore, abstract models of biological systems can be constructed combining computational and experimental data. In this review, we discuss structural computational models of enzymatic systems. We first discuss various models to simulate enzyme catalysis. Furthermore, we review various approaches how to characterize the enzyme mechanism both qualitatively and quantitatively using different modeling approaches. © 2017 Elsevier Inc. All rights reserved.
Two-Dimensional Grammars And Their Applications To Artificial Intelligence
NASA Astrophysics Data System (ADS)
Lee, Edward T.
1987-05-01
During the past several years, the concepts and techniques of two-dimensional grammars1,2 have attracted growing attention as promising avenues of approach to problems in picture generation as well as in picture description3 representation, recognition, transformation and manipulation. Two-dimensional grammar techniques serve the purpose of exploiting the structure or underlying relationships in a picture. This approach attempts to describe a complex picture in terms of their components and their relative positions. This resembles the way a sentence is described in terms of its words and phrases, and the terms structural picture recognition, linguistic picture recognition, or syntactic picture recognition are often used. By using this approach, the problem of picture recognition becomes similar to that of phrase recognition in a language. However, describing pictures using a string grammar (one-dimensional grammar), the only relation between sub-pictures and/or primitives is the concatenation; that is each picture or primitive can be connected only at the left or right. This one-dimensional relation has not been very effective in describing two-dimensional pictures. A natural generaliza-tion is to use two-dimensional grammars. In this paper, two-dimensional grammars and their applications to artificial intelligence are presented. Picture grammars and two-dimensional grammars are introduced and illustrated by examples. In particular, two-dimensional grammars for generating all possible squares and all possible rhombuses are presented. The applications of two-dimensional grammars to solving region filling problems are discussed. An algorithm for region filling using two-dimensional grammars is presented together with illustrative examples. The advantages of using this algorithm in terms of computation time are also stated. A high-level description of a two-level picture generation system is proposed. The first level is the picture primitive generation using two-dimensional grammars. The second level is picture generation using either string description or entity-relationship (ER) diagram description. Illustrative examples are also given. The advantages of ER diagram description together with its comparison to string description are also presented. The results obtained in this paper may have useful applications in artificial intelligence, robotics, expert systems, picture processing, pattern recognition, knowledge engineering and pictorial database design. Furthermore, examples related to satellite surveillance and identifications are also included.
Encyclopedia of software components
NASA Technical Reports Server (NTRS)
Vanwarren, Lloyd (Inventor); Beckman, Brian C. (Inventor)
1991-01-01
Intelligent browsing through a collection of reusable software components is facilitated with a computer having a video monitor and a user input interface such as a keyboard or a mouse for transmitting user selections, by presenting a picture of encyclopedia volumes with respective visible labels referring to types of software, in accordance with a metaphor in which each volume includes a page having a list of general topics under the software type of the volume and pages having lists of software components for each one of the generic topics, altering the picture to open one of the volumes in response to an initial user selection specifying the one volume to display on the monitor a picture of the page thereof having the list of general topics and altering the picture to display the page thereof having a list of software components under one of the general topics in response to a next user selection specifying the one general topic, and then presenting a picture of a set of different informative plates depicting different types of information about one of the software components in response to a further user selection specifying the one component.
Using Eye Movement Analysis to Study Auditory Effects on Visual Memory Recall
Marandi, Ramtin Zargari; Sabzpoushan, Seyed Hojjat
2014-01-01
Recent studies in affective computing are focused on sensing human cognitive context using biosignals. In this study, electrooculography (EOG) was utilized to investigate memory recall accessibility via eye movement patterns. 12 subjects were participated in our experiment wherein pictures from four categories were presented. Each category contained nine pictures of which three were presented twice and the rest were presented once only. Each picture presentation took five seconds with an adjoining three seconds interval. Similarly, this task was performed with new pictures together with related sounds. The task was free viewing and participants were not informed about the task's purpose. Using pattern recognition techniques, participants’ EOG signals in response to repeated and non-repeated pictures were classified for with and without sound stages. The method was validated with eight different participants. Recognition rate in “with sound” stage was significantly reduced as compared with “without sound” stage. The result demonstrated that the familiarity of visual-auditory stimuli can be detected from EOG signals and the auditory input potentially improves the visual recall process. PMID:25436085
Encyclopedia of Software Components
NASA Technical Reports Server (NTRS)
Warren, Lloyd V. (Inventor); Beckman, Brian C. (Inventor)
1997-01-01
Intelligent browsing through a collection of reusable software components is facilitated with a computer having a video monitor and a user input interface such as a keyboard or a mouse for transmitting user selections, by presenting a picture of encyclopedia volumes with respective visible labels referring to types of software, in accordance with a metaphor in which each volume includes a page having a list of general topics under the software type of the volume and pages having lists of software components for each one of the generic topics, altering the picture to open one of the volumes in response to an initial user selection specifying the one volume to display on the monitor a picture of the page thereof having the list of general topics and altering the picture to display the page thereof having a list of software components under one of the general topics in response to a next user selection specifying the one general topic, and then presenting a picture of a set of different informative plates depicting different types of information about one of the software components in response to a further user selection specifying the one component.
Fazel, Farhad; Ghoreishi, Mohammad; Ashtari, Alireza; Arefpour, Reza; Namgar, Mohammad
2017-01-01
Since thin and high-quality flaps produce more satisfactory surgical outcomes, flaps created by mechanical microkeratomes are more economical as compared with femtosecond lasers, and no Iranian study has concentrated laser in situ keratomileusis (LASIK) flap peculiarities between Moria Sub-Bowman keratoplasty (SBK) microkeratomes and LDV femtoseconds, the present study compares and contrasts them. This cross-sectional study was done on all patients who underwent LASIK surgery 1-month before this study. Thirty eyes were divided into per group. Flaps in the first group and second group were created, respectively, using Moria SBK microkeratome and LDV femtosecond laser. The other stages of LASIK were done equally in both groups. One month after surgery, the thickness of flaps was measured by anterior segment optical coherence tomography in five regions of flaps. Corneal anterior density was calculated and recorded 1-month after surgery using pentacam and by employing optical densitometry in a distance in the limit range of 0-6 mm from cornea center. Densitometry measurements were obtained and expressed in standardized grayscale units (GSUs). Postsurgery densitometry results reveal that anterior densities of cornea in limit range of 0-2 mm in groups of LDV femtosecond laser and Moria microkeratome are 21.35 ± 0.87 GSU and 22.85 ± 1.25 GSU, respectively. Accordingly, these two groups are significantly different in this regard ( P < 0.001). Moreover, anterior densities of the cornea in the limit range of 2-6 mm in these groups are 19.66 ± 0.99 GSU and 20.73 ± 1.24 GSU, respectively. Accordingly, these two groups are significantly different in this regard ( P = 0.04). There is a lower mean of flap thickness in the case of LDV femtosecond laser. Femtosecond laser method is greatly preferred as compared with Moria microkeratome because of greater homogeneity in flap thickness, smaller thickness, and lower density in optical zone.
Cauley, Jane A; El-Hajj Fuleihan, Ghada; Luckey, Marjorie M
2011-01-01
Osteoporosis is a serious worldwide epidemic. FRAX® is a web-based tool developed by the Sheffield WHO Collaborating Center team, that integrates clinical risk factors and femoral neck BMD and calculates the 10 year fracture probability in order to help health care professionals identify patients who need treatment. However, only 31 countries have a FRAX® calculator. In the absence of a FRAX® model for a particular country, it has been suggested to use a surrogate country for which the epidemiology of osteoporosis most closely approximates the index country. More specific recommendations for clinicians in these countries are not available. In North America, concerns have also been raised regarding the assumptions used to construct the US ethnic specific FRAX® calculators with respect to the correction factors applied to derive fracture probabilities in Blacks, Asians and Hispanics in comparison to Whites. In addition, questions were raised about calculating fracture risk in other ethnic groups e.g., Native Americans and First Canadians. The International Society for Clinical Densitometry (ISCD) in conjunction with the International Osteoporosis Foundation (IOF) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX® usage. As part of the process, the charge of the FRAX® International Task Force was to review and synthesize data regarding geographic and race/ethnic variability in hip fractures, non-hip osteoporotic fractures, and make recommendations about the use of FRAX® in ethnic groups and countries without a FRAX® calculator. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the International Task Force composition and charge is presented here. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Computed tomography scan - abdomen; CT scan - abdomen; CT abdomen and pelvis ... An abdominal CT scan makes detailed pictures of the structures inside your belly very quickly. This test may be used to look ...
2011-09-02
ISS028-E-036705 (2 Sept. 2011) --- Japan Aerospace Exploration Agency astronaut Satoshi Furukawa, Expedition 28 flight engineer, is pictured near a computer in the Destiny laboratory of the International Space Station.
Dombert, Beate; Mokros, Andreas; Brückner, Eva; Schlegl, Verena; Antfolk, Jan; Bäckström, Anna; Zappalà, Angelo; Osterheider, Michael; Santtila, Pekka
2013-12-01
The implicit assessment of pedophilic sexual interest through viewing-time methods necessitates visual stimuli. There are grave ethical and legal concerns against using pictures of real children, however. The present report is a summary of findings on a new set of 108 computer-generated stimuli. The images vary in terms of gender (female/male), explicitness (naked/clothed), and physical maturity (prepubescent, pubescent, and adult) of the persons depicted. A series of three studies tested the internal and external validity of the picture set. Studies 1 and 2 yielded good-to-high estimates of observer agreement with regard to stimulus maturity levels by two methods (categorization and paired comparison). Study 3 extended these findings with regard to judgments made by convicted child sexual offenders.
Guidelines for Designing User Interface Software
1986-08-01
2.4.4 Bar Graphs 150 2.4.5 Pie Charts 154 2.4.6 Pictures and Diagrams 156 2.4.7 Flowcharts 159 2.4.8 Maps and Situation Displays 163 2.5 Format...Pictures and diagrams 156 2.4.7 Flowcharts 159 2.4.8 Maps and situation displays 163 2.5 Format refers to the organization of different types of...computer aids for calculating area, volume, center of gravity, modes of vibration, stresses, heat transfer, etc. 158 DATA DISPLAY Flowcharts
28 CFR 75.7 - Exemption statement.
Code of Federal Regulations, 2011 CFR
2011-07-01
..., periodical, film, videotape, digitally- or computer-manipulated image, digital image, picture, or other... pubic area of any person, made before March 18, 2009; (3) The matter contains only some combination of...
28 CFR 75.7 - Exemption statement.
Code of Federal Regulations, 2010 CFR
2010-07-01
..., periodical, film, videotape, digitally- or computer-manipulated image, digital image, picture, or other... pubic area of any person, made before March 18, 2009; (3) The matter contains only some combination of...
Applications of computer-aided text analysis in natural resources.
David N. Bengston
2000-01-01
Ten contributed papers describe the use of a variety of approaches to computer-aided text analysis and their application to a wide range of research questions related to natural resources and the environment. Taken together, these papers paint a picture of a growing and vital area of research on the human dimensions of natural resource management.
ERIC Educational Resources Information Center
Johnson, Erin Phinney; Perry, Justin; Shamir, Haya
2010-01-01
This study examines the effects on early reading skills of three different methods of presenting material with computer-assisted instruction (CAI): (1) learner-controlled picture menu, which allows the student to choose activities, (2) linear sequencer, which progresses the students through lessons at a pre-specified pace, and (3) mastery-based…
The visual attention saliency map for movie retrospection
NASA Astrophysics Data System (ADS)
Rogalska, Anna; Napieralski, Piotr
2018-04-01
The visual saliency map is becoming important and challenging for many scientific disciplines (robotic systems, psychophysics, cognitive neuroscience and computer science). Map created by the model indicates possible salient regions by taking into consideration face presence and motion which is essential in motion pictures. By combining we can obtain credible saliency map with a low computational cost.
Graphical Man/Machine Communications
Progress is reported concerning the use of computer controlled graphical displays in the areas of radiaton diffusion and hydrodynamics, general...ventricular dynamics. Progress is continuing on the use of computer graphics in architecture. Some progress in halftone graphics is reported with no basic...developments presented. Colored halftone perspective pictures are being used to represent multivariable situations. Nonlinear waveform processing is
Home Media and Children's Achievement and Behavior
ERIC Educational Resources Information Center
Hofferth, Sandra L.
2010-01-01
This study provides a national picture of the time American 6- to 12-year-olds spent playing video games, using the computer, and watching TV at home in 1997 and 2003, and the association of early use with their achievement and behavior as adolescents. Girls benefited from computer use more than boys, and Black children benefited more than White…
Quantum Dynamics of Helium Clusters
1993-03-01
the structure of both these and the HeN clusters in the body fixed frame by computing principal moments of inertia, thereby avoiding the...8217 of helium clusters, with the modification that we subtract 0.96 K from the computed values so that lor sufficiently large clusters we recover the...phonon spectrum of liquid He. To get a picture of these spectra one needs to compute the structure functions 51. Monte Carlo random walk simulations
The Coast Artillery Journal. Volume 68, Number 2, February 1928
1928-02-01
presentation makes it possible for the uninitated to picture readily a wiring diagram in its full meaning. For those who would compute rapidly, and to a...probably organic army artillery, thus computed , would be better, with, in addition, quotas of G. H. Q. Artillery provided for various sized groups of...the computation of antiaircraft deflections, and it is to satisfy their very natural curiosity with regard particularly to the improving factor and the
Factors Influencing Quality of Life of Hungarian Postmenopausal Women Screened by Osteodensitometry
ERIC Educational Resources Information Center
Maroti-Nagy, Agnes; Paulik, Edit
2011-01-01
The aim of our study was to evaluate factors influencing health related quality of life in Hungarian postmenopausal women who underwent osteodensitometry. A questionnaire-based cross-sectional study was carried out; 359 women aged over 40 years were involved, attending the outpatient Bone Densitometry Centre of Szeged. Two kinds of tools were…
2012-10-01
ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1
... the patient. Because ultrasound images are captured in real-time, they can show the structure and movement of ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
... the patient. Because ultrasound images are captured in real-time, they can show the structure and movement of ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
... the patient. Because ultrasound images are captured in real-time, they can show the structure and movement of ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
... the patient. Because ultrasound images are captured in real-time, they can show the structure and movement of ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
... the patient. Because ultrasound images are captured in real-time, they can show the structure and movement of ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
Thermodynamics of computation and information distance
NASA Astrophysics Data System (ADS)
Bennett, Charles H.; Gacs, Peter; Li, Ming; Vitanyi, Paul M. R. B.; Zurek, Wojciech H.
1993-06-01
Intuitively, the minimal information distance between x and y is the length of the shortest program for a universal computer to transform x into y and y into x. This measure is shown to be, up to a logarithmic additive term, equal to the maximum of the conditional Kolmogorov complexities E(sub 1)(x,y) = max(K(y/x), K(x/y)). Any reasonable distance to measure similarity of pictures should be an effectively approximable, symmetric, positive function of x and y satisfying a reasonable normalization condition and obeying the triangle inequality. It turns out that E(sub 1) is minimal up to an additive constant among all such distances. Hence it is a universal 'picture distance', which accounts for any effective similarity between pictures. A third information distance, based on the ideal that the aim should be for dissipationless computations, and hence for reversible ones, is given by the length E(sub 2)(x,y) = KR(y/x) = KR(x/y) of the shortest reversible program that transforms x into y and y into x on a universal reversible computer. It is shown that also E(sub 2) = E(sub 1), up to a logarithmic additive term. It is remarkable that three so differently motivated definitions turn out to define one and the same notion. Another information distance, E(sub 3), is obtained by minimizing the total amount of information flowing in and out during a reversible computation in which the program is not retained, in other words the number of extra bits (apart from x) that must be irreversibly supplied at the beginning, plus the number of garbage bits (apart from y) that must be irreversibly erased at the end of the computation to obtain a 'clean' y. This distance is within a logarithmic additive term of the sum of the conditional complexities, E(sub 3)(x, y) = K(y/x) + K(x/y). Using the physical theory of reversible computation, the simple difference K(x) - K(y) is shown to be an appropriate (universal, antisymmetric, and transitive) measure of the amount of thermodynamic work required to transform string x into string y by the most efficient process.
... reflect off body structures. A computer receives the waves and uses them to create a picture. Unlike with an x-ray or CT scan, this test does not use ionizing radiation. The test is done in the ultrasound ...
Venous Ultrasound (Extremities)
... the patient. Because ultrasound images are captured in real-time, they can show the structure and movement of ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
... the patient. Because ultrasound images are captured in real-time, they can show the structure and movement of ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
Bone Cancer: Questions and Answers
... which uses a powerful magnet linked to a computer to create detailed pictures of areas inside the body without using x-rays. A positron emission tomography (PET) scan , in which a small amount of ...
... into your blood and travels to your heart. Nuclear heart scans use single photon emission computed tomography (SPECT) or cardiac positron emission tomography (PET) to detect the energy from the tracer to make pictures of your ...
Real-time colour hologram generation based on ray-sampling plane with multi-GPU acceleration.
Sato, Hirochika; Kakue, Takashi; Ichihashi, Yasuyuki; Endo, Yutaka; Wakunami, Koki; Oi, Ryutaro; Yamamoto, Kenji; Nakayama, Hirotaka; Shimobaba, Tomoyoshi; Ito, Tomoyoshi
2018-01-24
Although electro-holography can reconstruct three-dimensional (3D) motion pictures, its computational cost is too heavy to allow for real-time reconstruction of 3D motion pictures. This study explores accelerating colour hologram generation using light-ray information on a ray-sampling (RS) plane with a graphics processing unit (GPU) to realise a real-time holographic display system. We refer to an image corresponding to light-ray information as an RS image. Colour holograms were generated from three RS images with resolutions of 2,048 × 2,048; 3,072 × 3,072 and 4,096 × 4,096 pixels. The computational results indicate that the generation of the colour holograms using multiple GPUs (NVIDIA Geforce GTX 1080) was approximately 300-500 times faster than those generated using a central processing unit. In addition, the results demonstrate that 3D motion pictures were successfully reconstructed from RS images of 3,072 × 3,072 pixels at approximately 15 frames per second using an electro-holographic reconstruction system in which colour holograms were generated from RS images in real time.
Efficient burst image compression using H.265/HEVC
NASA Astrophysics Data System (ADS)
Roodaki-Lavasani, Hoda; Lainema, Jani
2014-02-01
New imaging use cases are emerging as more powerful camera hardware is entering consumer markets. One family of such use cases is based on capturing multiple pictures instead of just one when taking a photograph. That kind of a camera operation allows e.g. selecting the most successful shot from a sequence of images, showing what happened right before or after the shot was taken or combining the shots by computational means to improve either visible characteristics of the picture (such as dynamic range or focus) or the artistic aspects of the photo (e.g. by superimposing pictures on top of each other). Considering that photographic images are typically of high resolution and quality and the fact that these kind of image bursts can consist of at least tens of individual pictures, an efficient compression algorithm is desired. However, traditional video coding approaches fail to provide the random access properties these use cases require to achieve near-instantaneous access to the pictures in the coded sequence. That feature is critical to allow users to browse the pictures in an arbitrary order or imaging algorithms to extract desired pictures from the sequence quickly. This paper proposes coding structures that provide such random access properties while achieving coding efficiency superior to existing image coders. The results indicate that using HEVC video codec with a single reference picture fixed for the whole sequence can achieve nearly as good compression as traditional IPPP coding structures. It is also shown that the selection of the reference frame can further improve the coding efficiency.
Visual ergonomic aspects of glare on computer displays: glossy screens and angular dependence
NASA Astrophysics Data System (ADS)
Brunnström, Kjell; Andrén, Börje; Konstantinides, Zacharias; Nordström, Lukas
2007-02-01
Recently flat panel computer displays and notebook computer are designed with a so called glare panel i.e. highly glossy screens, have emerged on the market. The shiny look of the display appeals to the costumers, also there are arguments that the contrast, colour saturation etc improves by using a glare panel. LCD displays suffer often from angular dependent picture quality. This has been even more pronounced by the introduction of Prism Light Guide plates into displays for notebook computers. The TCO label is the leading labelling system for computer displays. Currently about 50% of all computer displays on the market are certified according to the TCO requirements. The requirements are periodically updated to keep up with the technical development and the latest research in e.g. visual ergonomics. The gloss level of the screen and the angular dependence has recently been investigated by conducting user studies. A study of the effect of highly glossy screens compared to matt screens has been performed. The results show a slight advantage for the glossy screen when no disturbing reflexes are present, however the difference was not statistically significant. When disturbing reflexes are present the advantage is changed into a larger disadvantage and this difference is statistically significant. Another study of angular dependence has also been performed. The results indicates a linear relationship between the picture quality and the centre luminance of the screen.
Enter Words and Pictures the Easy Way--Scan Them.
ERIC Educational Resources Information Center
Olivas, Jerry
1989-01-01
Discusses image scanning and optical character recognition. Describes how computer scanners work. Summarizes scan quality, scanning speed requirements, and hardware requirements for scanners. Surveys the range of scanners currently available. (MVL)
Cranial Ultrasound/Head Ultrasound
... the patient. Because ultrasound images are captured in real-time, they can show the structure and movement of ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
A Hidden Surface Algorithm for Computer Generated Halftone Pictures
converting data describing three-dimensional objects into data that can be used to generate two-dimensional halftone images. It deals with some problems that arise in black and white, and color shading.
Computed Tomography (CT) Scans and Cancer
... an imaging procedure that uses special x-ray equipment to create detailed pictures, or scans, of areas ... at the center ( 10 ). In addition, all imaging equipment purchased by NIH must provide data on exposure ...
Dietary coral calcium and zeolite protects bone in a mouse model for postmenopausal bone loss.
Banu, Jameela; Varela, Erika; Guerra, Juan M; Halade, Ganesh; Williams, Paul J; Bahadur, Ali N; Hanaoka, Kokichi; Fernandes, Gabriel
2012-12-01
In patients diagnosed with osteoporosis, calcium is lost from bones making them weaker and easily susceptible to fractures. Supplementation of calcium is highly recommended for such conditions. However, the source of calcium plays an important role in the amount of calcium that is assimilated into bone. We hypothesize that naturally occurring coral calcium and zeolite may prevent ovariectomy-induced bone loss. We have measured bone loss in ovariectomized mice supplemented with coral calcium and Zeolite. Female C57BL/6 mice were either sham-operated or ovariectomized and fed diets containing coral calcium or zeolite for 6 months. Serum was analyzed for bone biochemical markers and cytokines. Bones were analyzed using dual x-ray absorbtiometry, peripheral quantitative computed tomography, and micro-computed tomography densitometry. In the distal femoral metaphysis, total bone and cortical bone mass was restored and the endocortical surface was significantly decreased in coral calcium and zeolite fed ovariectomized (OVX) mice. Trabecular number and the ratio of bone volume to total volume was higher in OVX mice after coral calcium and zeolite feeding, while trabecular separation decreased in the different treatment OVX groups. Coral calcium protected bone to a lesser extent in the proximal tibia and lumbar vertebrae. Overall, coral calcium and zeolite may protect postmenopausal bone loss. Copyright © 2012 Elsevier Inc. All rights reserved.
The Role of Beliefs in Lexical Alignment: Evidence from Dialogs with Humans and Computers
ERIC Educational Resources Information Center
Branigan, Holly P.; Pickering, Martin J.; Pearson, Jamie; McLean, Janet F.; Brown, Ash
2011-01-01
Five experiments examined the extent to which speakers' alignment (i.e., convergence) on words in dialog is mediated by beliefs about their interlocutor. To do this, we told participants that they were interacting with another person or a computer in a task in which they alternated between selecting pictures that matched their "partner's"…
Müller, Birgit H; Kull, Sandra; Wilhelm, Frank H; Michael, Tanja
2011-06-01
Computer-based self-help treatments have been proposed to provide greater access to treatment while requiring minimum input from a therapist. The authors employed a randomised controlled trial to investigate the efficacy of one-session computer-based exposure (CBE) as a self-help treatment for spider-fearful individuals. Spider-fearful participants in a CBE group underwent one 27-min session of standardised exposure to nine fear-eliciting spider pictures. Treatment outcome was compared to spider-fearful control participants exposed to nine neutral pictures. Fear reduction was quantified on a subjective level by the Fear of Spiders Questionnaire (FSQ) and complemented with a behavioural approach test (BAT). Results demonstrate that compared to control participants, CBE participants showed greater fear reduction from pre- to posttreatment on both the subjective level (FSQ) and the behavioural level (BAT). Moreover, in contrast to the control group, the obtained subjective fear reduction effect remained stable in the CBE group at 1-month follow-up. These findings highlight the role of computer-based self-help as a minimal but effective intervention to reduce fear of spiders. Copyright © 2010 Elsevier Ltd. All rights reserved.
What Is Seen Is Who You Are: Are Cues in Selfie Pictures Related to Personality Characteristics?
Musil, Bojan; Preglej, Andrej; Ropert, Tadevž; Klasinc, Lucia; Babič, Nenad Č.
2017-01-01
Developments and innovation in the areas of mobile information technology, digital media and social networks foster new reflections on computer-mediated communication research, especially in the field of self-presentation. In this context, the selfie as a self-portrait photo is interesting, because as a meaningful gesture, it actively and directly relates the content of the photo to the author of the picture. From the perspective of the selfie as an image and the impression it forms, in the first part of the research we explored the distinctive characteristics of selfie pictures; moreover, from the perspective of the potential reflection of a selfie image on the personality of its author, in the second part we related the characteristics of selfie pictures to various personality constructs (e.g., Big Five personality traits narcissism and femininity-masculinity). Important aspects of selfies especially in relation to gender include the tilt of the head, the side of the face exhibited, mood and head position, later related also to the context of the selfie picture. We found no significant relations between selfie cues and personality constructs. The face-ism index was related to entitlement, and selfie availability to neuroticism. PMID:28197113
What Is Seen Is Who You Are: Are Cues in Selfie Pictures Related to Personality Characteristics?
Musil, Bojan; Preglej, Andrej; Ropert, Tadevž; Klasinc, Lucia; Babič, Nenad Č
2017-01-01
Developments and innovation in the areas of mobile information technology, digital media and social networks foster new reflections on computer-mediated communication research, especially in the field of self-presentation. In this context, the selfie as a self-portrait photo is interesting, because as a meaningful gesture, it actively and directly relates the content of the photo to the author of the picture. From the perspective of the selfie as an image and the impression it forms, in the first part of the research we explored the distinctive characteristics of selfie pictures; moreover, from the perspective of the potential reflection of a selfie image on the personality of its author, in the second part we related the characteristics of selfie pictures to various personality constructs (e.g., Big Five personality traits narcissism and femininity-masculinity). Important aspects of selfies especially in relation to gender include the tilt of the head, the side of the face exhibited, mood and head position, later related also to the context of the selfie picture. We found no significant relations between selfie cues and personality constructs. The face-ism index was related to entitlement, and selfie availability to neuroticism.
Television animation store: Recording pictures on a parallel transfer magnetic disc
NASA Astrophysics Data System (ADS)
Durey, A. J.
1984-12-01
The recording and replaying of digital video signals using a computer-type magnetic disc-drive as part of an electronic rostrum camera animation system is described. The system was developed to enable picture sequences to be generated directly as television signals, instead of using cine film. The characteristics of the disc-drive are described together with data processing, error protection and signal synchronization systems, which enable digital television YUV component signals, sampled at 12 MHz, 4 MHz and 4 MHz respectively, to be recorded and replayed in real time.
Radial growth and wood density of white pine in relation to fossil-fired power plant operations
W. T. Lawhon; F. W. Woods
1976-01-01
The objectives of this study were twofold: (1) to develop a gamma densitometry technique for measuring the relative wood density and radial growth of trees from 12 mm increment cores; and (2) to determine whether changes in the relative wood density and radial growth of "resistant" eastern white pine (Pinus strobus L.) occurred after...
Modeling corewood-outerwood transition in loblolly pine using wood specific gravity
Christian R. Mora; H. Lee Allen; Richard F. Daniels; Alexander Clark
2007-01-01
A modified logistic function was used for modeling specific-gravity profiles obtained from X-ray densitometry analysis in 675 loblolly pine (Pinus taeda L.) trees in four regeneration trials. Trees were 21 or 22 years old at the time of the study. The function was used for demarcating corewood, transitional, and outerwood zones. Site and silvicultural effects were...
Long-term therapy in COPD: any evidence of adverse effect on bone?
Langhammer, Arnulf; Forsmo, Siri; Syversen, Unni
2009-01-01
Patients with COPD have high risk for osteoporosis and fractures. Hip and vertebral fractures might impair mobility, and vertebral fractures further reduce lung function. This review discusses the evidence of bone loss due to medical treatment opposed to disease severity and risk factors for COPD, and therapeutic options for the prevention and treatment of osteoporosis in these patients. A review of the English-language literature was conducted using the MEDLINE database until June 2009. Currently used bronchodilators probably lack adverse effect on bone. Oral corticosteroids (OCS) increase bone resorption and decrease bone formation in a dose response relationship, but the fracture risk is increased more than reflected by bone densitometry. Inhaled corticosteroids (ICS) have been associated with both increased bone loss and fracture risk. This might be a result of confounding by disease severity, but high doses of ICS have similar effects as equipotent doses of OCS. The life-style factors should be modified, use of regular OCS avoided and use of ICS restricted to those with evidenced effect and probably kept at moderate doses. The health care should actively reveal risk factors, include bone densitometry in fracture risk evaluation, and give adequate prevention and treatment for osteoporosis. PMID:19888355
[Epidemiologic variables in postmenopausal women].
Murillo-Uribe, A; Carranza-Lira, S; Martínez-Trejo, N A; Santos González, J E
1999-10-01
The objective was to know the characteristics of presentation, its clinical aspects and the modification in the diagnostic tools in a selected population of Mexican women with spontaneous menopause. The age at menarche, age at menopause, marital status, age at marriage, number of pregnancies and occupation of 1,099 women with spontaneous menopause were studied. In 619 women which were not receiving nor had received hormone replacement therapy the clinical, laboratory such as glucose, lipids, hormones, bone remodeling biochemistry; and X ray studies such as densitometry and mammography were analyzed. The age average of menarche presentation was at 13 years, and that of spontaneous menopause at 48.1 years 78% were married, with an age at marriage of 23 years, 66% had home duties. The screening tests showed that 30% of patients required cardiovascular evaluation, 40% showed alterations on lipids levels and at least 40% had some alteration on bone remodeling biochemistry or in densitometry. The mammography was normal in 81%. This study showed that most of the data in these group of women were similar to those of other populations, and many of them need intensive surveillance and adequate therapeutic prescriptions to diminish risk factors.
Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone
de Mesquita, Alessandro Queiroz; Barbieri, Giuliano; Barbieri, Claudio Henrique
2016-01-01
OBJECTIVE: To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. METHODS: The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. RESULTS: Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. CONCLUSION: We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density. PMID:27982167
Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone.
Mesquita, Alessandro Queiroz de; Barbieri, Giuliano; Barbieri, Claudio Henrique
2016-11-01
To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density.
Consensus of official position of IOF/ISCD FRAX initiatives in Asia-Pacific region.
Wu, Chih-Hsing; McCloskey, Eugene V; Lee, Joon Kiong; Itabashi, Akira; Prince, Richard; Yu, Wei; Li-Yu, Julie; Chionh, Siok Bee; Zhao, Yanling; Shin, Chan Soo; Gunawan, Tirtarahardja; Tsai, Keh-Sung; Chieng, Poon-Ung; Changlai, Sheng-Pin; Chan, Ding-Cheng; Chen, Jung-Fu; Tanner, S Bobo; Hans, Didier B; Kanis, John A; Chang, Yin-Fan; Sun, Zih-Jie; Yang, Rong-Sen
2014-01-01
The fracture risk assessment tool (FRAX(®)) has been developed for the identification of individuals with high risk of fracture in whom treatment to prevent fractures would be appropriate. FRAX models are not yet available for all countries or ethnicities, but surrogate models can be used within regions with similar fracture risk. The International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) are nonprofit multidisciplinary international professional organizations. Their visions are to advance the awareness, education, prevention, and treatment of osteoporosis. In November 2010, the IOF/ISCD FRAX initiative was held in Bucharest, bringing together international experts to review and create evidence-based official positions guiding clinicians for the practical use of FRAX. A consensus meeting of the Asia-Pacific (AP) Panel of the ISCD recently reviewed the most current Official Positions of the Joint Official Positions of ISCD and IOF on FRAX in view of the different population characteristics and health standards in the AP regions. The reviewed position statements included not only the key spectrum of positions but also unique concerns in AP regions. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Kunz, Peter; Bricault, Pierre; Dombsky, Marik; Erdmann, Nicole; Hanemaayer, Vicky; Wong, John; Lützenkirchen, Klaus
2013-09-01
The production of radioactive ion beams (RIB) from spallation targets by irradiation with a continuous 500 MeV proton beam, has been routine at TRIUMF for several years. Based on the experience with composite refractory carbide targets a procedure for the fabrication of UC2/C targets was developed. It includes the preparation of UC2 by carbothermal reduction of UO2, the slip-casting of fine-grained UC2/C slurry on graphite foil under inert gas atmosphere and the cutting of composite target discs which are stacked up to a lamellar structure. The thermal properties of such an arrangement are adequate to withstand the high power deposition of an intense, continuous proton beam and also beneficial for the fast release of short-lived radioactive isotopes. Molecular structure, particle size and the impact of sintering of the target discs were investigated via XRD and SEM. Thickness and mass distribution were measured with position-sensitive LIII-edge densitometry. The results confirm that the properties of the UC2/C target material are well suited for RIB production at TRIUMF while there is still room for improvement with regard to uniformity of mass distribution in target disc thickness.
Chen, Yisheng; Schwack, Wolfgang
2014-02-28
In the European Union (EU), sulfonamides are among the most widely administrated groups of antibiotics in animal husbandry. Therefore, monitoring their residues in edible animal tissues plays an important role in the EU food safety framework. In this work, a simple and efficient method for the rapid screening of twelve prior sulfonamides frequently prescribed as veterinary drugs by high-performance thin-layer chromatography (HPTLC) was established. Sample extracts obtained with acetonitrile were tenfold concentrated and applied to HPTLC without any further cleanup. Following separation and fluram derivatization, sensitive and selective quantitation of the analytes can readily be accomplished with fluorescent densitometry. Limits of detection and quantitation were 15-40 and 35-70μg/kg, respectively. Additionally, a confirmative detection by HPTLC-electrospray ionization mass spectrometry (HPTLC-ESI/MS) was optimized, offering straightforward identification of target zones. Therefore, the risk of potential false positive findings can efficiently be reduced. The method was validated to meet the enforced commission regulation (EU) No. 37/2010, regarding different matrix complexities (bovine milk, porcine liver and kidney). Copyright © 2014 Elsevier B.V. All rights reserved.
... symptoms. They may test your senses, balance, reflexes, memory, and thinking. In some cases, the doctor will order tests to scan your brain. These include a computed tomography (CT) or magnetic resonance imaging (MRI) scan. They take a picture of your ...
Ultrasound- and MRI-Guided Prostate Biopsy
... which the MR images are fused with the real-time ultrasound images — an approach known as MRI/TRUS ... by a computer, which in turn creates a real-time picture on the monitor. One or more frames ...
Quantitative evaluation of low-cost frame-grabber boards for personal computers.
Kofler, J M; Gray, J E; Fuelberth, J T; Taubel, J P
1995-11-01
Nine moderately priced frame-grabber boards for both Macintosh (Apple Computers, Cupertino, CA) and IBM-compatible computers were evaluated using a Society of Motion Pictures and Television Engineers (SMPTE) pattern and a video signal generator for dynamic range, gray-scale reproducibility, and spatial integrity of the captured image. The degradation of the video information ranged from minor to severe. Some boards are of reasonable quality for applications in diagnostic imaging and education. However, price and quality are not necessarily directly related.
2014-05-01
fusion, space and astrophysical plasmas, but still the general picture can be presented quite well with the fluid approach [6, 7]. The microscopic...purpose computing CPU for algorithms where processing of large blocks of data is done in parallel. The reason for that is the GPU’s highly effective...parallel structure. Most of the image and video processing computations involve heavy matrix and vector op- erations over large amounts of data and
Understanding Coreference in a System for Solving Physics Word Problems.
NASA Astrophysics Data System (ADS)
Bulko, William Charles
In this thesis, a computer program (BEATRIX) is presented which takes as input an English statement of a physics problem and a figure associated with it, understands the two kinds of input in combination, and produces a data structure containing a model of the physical objects described and the relationships between them. BEATRIX provides a mouse-based graphic interface with which the user sketches a picture and enters English sentences; meanwhile, BEATRIX creates a neutral internal representation of the picture similar to the which might be produced as the output of a vision system. It then parses the text and the picture representation, resolves the references between objects common to the two data sources, and produces a unified model of the problem world. The correctness and completeness of this model has been validated by applying it as input to a physics problem-solving program currently under development. Two descriptions of a world are said to be coreferent when they contain references to overlapping sets of objects. Resolving coreferences to produce a correct world model is a common task in scientific and industrial problem-solving: because English is typically not a good language for expressing spatial relationships, people in these fields frequently use diagrams to supplement textual descriptions. Elementary physics problems from college-level textbooks provide a useful and convenient domain for exploring the mechanisms of coreference. Because flexible, opportunistic control is necessary in order to recognize coreference and to act upon it, the understanding module of BEATRIX uses a blackboard control structure. The blackboard knowledge sources serve to identify physical objects in the picture, parse the English text, and resolve coreferences between the two. We believed that BEATRIX demonstrates a control structure and collection of knowledge that successfully implements understanding of text and picture by computer. We also believe that this organization can be applied successfully to similar understanding tasks in domains other than physics problem -solving, where data such as the output from vision systems and speech understanders can be used in place of text and pictures.
When and where in aging: the role of music on source monitoring.
Palumbo, Rocco; Mammarella, Nicola; Di Domenico, Alberto; Fairfield, Beth
2018-06-01
Difficulties in source monitoring (SM) tasks observed in healthy older adults may be linked to associative memory deficits since SM requires individuals to correctly bind and later remember these bound features to discriminate the origin of a memory. Therefore, focusing attention on discriminating factors that may attenuate older adults' difficulties in attributing contextual information to memories is necessary. We investigated the effect of affective information on source monitoring in younger and older adults by manipulating the type of affective information (pictures and music) and assessing the ability to remember spatial and temporal source details for affective pictures encoded while listening to classical music. Older and younger adults viewed a series of affective IAPS pictures presented on the left or right side of the computer screen in two different lists. At test, participants were asked to remember if the picture was seen (right/left), in which list (list1/list2) or whether it was new. Results showed that spatial information was attributed better than temporal information and emotional pictures were attributed better than neutral pictures in both younger and older adults. In addition, although music significantly increased source memory performance in both younger and older participants compared to the white noise condition, the pleasantness of music differentially affected memory for source details. The authors discuss findings in terms of an interaction between music, emotion and cognition in aging.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoban, Matty J.; Department of Computer Science, University of Oxford, Wolfson Building, Parks Road, Oxford OX1 3QD; Wallman, Joel J.
We consider general settings of Bell inequality experiments with many parties, where each party chooses from a finite number of measurement settings each with a finite number of outcomes. We investigate the constraints that Bell inequalities place upon the correlations possible in local hidden variable theories using a geometrical picture of correlations. We show that local hidden variable theories can be characterized in terms of limited computational expressiveness, which allows us to characterize families of Bell inequalities. The limited computational expressiveness for many settings (each with many outcomes) generalizes previous results about the many-party situation each with a choice ofmore » two possible measurements (each with two outcomes). Using this computational picture we present generalizations of the Popescu-Rohrlich nonlocal box for many parties and nonbinary inputs and outputs at each site. Finally, we comment on the effect of preprocessing on measurement data in our generalized setting and show that it becomes problematic outside of the binary setting, in that it allows local hidden variable theories to simulate maximally nonlocal correlations such as those of these generalized Popescu-Rohrlich nonlocal boxes.« less
A computer graphics system for visualizing spacecraft in orbit
NASA Technical Reports Server (NTRS)
Eyles, Don E.
1989-01-01
To carry out unanticipated operations with resources already in space is part of the rationale for a permanently manned space station in Earth orbit. The astronauts aboard a space station will require an on-board, spatial display tool to assist the planning and rehearsal of upcoming operations. Such a tool can also help astronauts to monitor and control such operations as they occur, especially in cases where first-hand visibility is not possible. A computer graphics visualization system designed for such an application and currently implemented as part of a ground-based simulation is described. The visualization system presents to the user the spatial information available in the spacecraft's computers by drawing a dynamic picture containing the planet Earth, the Sun, a star field, and up to two spacecraft. The point of view within the picture can be controlled by the user to obtain a number of specific visualization functions. The elements of the display, the methods used to control the display's point of view, and some of the ways in which the system can be used are described.
Visual Complexity and Affect: Ratings Reflect More Than Meets the Eye.
Madan, Christopher R; Bayer, Janine; Gamer, Matthias; Lonsdorf, Tina B; Sommer, Tobias
2017-01-01
Pictorial stimuli can vary on many dimensions, several aspects of which are captured by the term 'visual complexity.' Visual complexity can be described as, "a picture of a few objects, colors, or structures would be less complex than a very colorful picture of many objects that is composed of several components." Prior studies have reported a relationship between affect and visual complexity, where complex pictures are rated as more pleasant and arousing. However, a relationship in the opposite direction, an effect of affect on visual complexity, is also possible; emotional arousal and valence are known to influence selective attention and visual processing. In a series of experiments, we found that ratings of visual complexity correlated with affective ratings, and independently also with computational measures of visual complexity. These computational measures did not correlate with affect, suggesting that complexity ratings are separately related to distinct factors. We investigated the relationship between affect and ratings of visual complexity, finding an 'arousal-complexity bias' to be a robust phenomenon. Moreover, we found this bias could be attenuated when explicitly indicated but did not correlate with inter-individual difference measures of affective processing, and was largely unrelated to cognitive and eyetracking measures. Taken together, the arousal-complexity bias seems to be caused by a relationship between arousal and visual processing as it has been described for the greater vividness of arousing pictures. The described arousal-complexity bias is also of relevance from an experimental perspective because visual complexity is often considered a variable to control for when using pictorial stimuli.
Visual Complexity and Affect: Ratings Reflect More Than Meets the Eye
Madan, Christopher R.; Bayer, Janine; Gamer, Matthias; Lonsdorf, Tina B.; Sommer, Tobias
2018-01-01
Pictorial stimuli can vary on many dimensions, several aspects of which are captured by the term ‘visual complexity.’ Visual complexity can be described as, “a picture of a few objects, colors, or structures would be less complex than a very colorful picture of many objects that is composed of several components.” Prior studies have reported a relationship between affect and visual complexity, where complex pictures are rated as more pleasant and arousing. However, a relationship in the opposite direction, an effect of affect on visual complexity, is also possible; emotional arousal and valence are known to influence selective attention and visual processing. In a series of experiments, we found that ratings of visual complexity correlated with affective ratings, and independently also with computational measures of visual complexity. These computational measures did not correlate with affect, suggesting that complexity ratings are separately related to distinct factors. We investigated the relationship between affect and ratings of visual complexity, finding an ‘arousal-complexity bias’ to be a robust phenomenon. Moreover, we found this bias could be attenuated when explicitly indicated but did not correlate with inter-individual difference measures of affective processing, and was largely unrelated to cognitive and eyetracking measures. Taken together, the arousal-complexity bias seems to be caused by a relationship between arousal and visual processing as it has been described for the greater vividness of arousing pictures. The described arousal-complexity bias is also of relevance from an experimental perspective because visual complexity is often considered a variable to control for when using pictorial stimuli. PMID:29403412
Learning to Live with Neuromuscular Disease: A Message for Parents
... Little League team and taking him to Phillies games. I pictured myself watching Jack perform in his ... with his schoolwork. Jack hopes for new computer games. He hopes we’ll take him places The ...
Fundamental Quantum Mechanics--A Graphic Presentation
ERIC Educational Resources Information Center
Wise, M. N.; Kelley, T. G.
1977-01-01
Describes a presentation of basic quantum mechanics for nonscience majors that relies on a computer-generated graphic display to circumvent the usual mathematical difficulties. It allows a detailed treatment of free-particle motion in a wave picture. (MLH)
Curiosity Landscape Portrait in Context
2012-08-07
This picture from NASA Curiosity rover puts a color view obtained by the rover in the context of a computer simulation derived from images acquired from orbiting spacecraft. The view looks north, showing the distant ridge of Gale Crater.
A generalized approach to computer synthesis of digital holograms
NASA Technical Reports Server (NTRS)
Hopper, W. A.
1973-01-01
Hologram is constructed by taking number of digitized sample points and blending them together to form ''continuous'' picture. New system selects better set of sample points resulting in improved hologram from same amount of information.
Picture This... Developing Standards for Electronic Images at the National Library of Medicine
Masys, Daniel R.
1990-01-01
New computer technologies have made it feasible to represent, store, and communicate high resolution biomedical images via electronic means. Traditional two dimensional medical images such as those on printed pages have been supplemented by three dimensional images which can be rendered, rotated, and “dissected” from any point of view. The library of the future will provide electronic access not only to words and numbers, but to pictures, sounds, and other nontextual information. There currently exist few widely-accepted standards for the representation and communication of complex images, yet such standards will be critical to the feasibility and usefulness of digital image collections in the life sciences. The National Library of Medicine is embarked on a project to develop a complete digital volumetric representation of an adult human male and female. This “Visible Human Project” will address the issue of standards for computer representation of biological structure.
Satellite Imagery Via Personal Computer
NASA Technical Reports Server (NTRS)
1989-01-01
Automatic Picture Transmission (APT) was incorporated by NASA in the Tiros 8 weather satellite. APT included an advanced satellite camera that immediately transmitted a picture as well as low cost receiving equipment. When an advanced scanning radiometer was later introduced, ground station display equipment would not readily adjust to the new format until GSFC developed an APT Digital Scan Converter that made them compatible. A NASA Technical Note by Goddard's Vermillion and Kamoski described how to build a converter. In 1979, Electro-Services, using this technology, built the first microcomputer weather imaging system in the U.S. The company changed its name to Satellite Data Systems, Inc. and now manufactures the WeatherFax facsimile display graphics system which converts a personal computer into a weather satellite image acquisition and display workstation. Hardware, antennas, receivers, etc. are also offered. Customers include U.S. Weather Service, schools, military, etc.
The Goddard Profiling Algorithm (GPROF): Description and Current Applications
NASA Technical Reports Server (NTRS)
Olson, William S.; Yang, Song; Stout, John E.; Grecu, Mircea
2004-01-01
Atmospheric scientists use different methods for interpreting satellite data. In the early days of satellite meteorology, the analysis of cloud pictures from satellites was primarily subjective. As computer technology improved, satellite pictures could be processed digitally, and mathematical algorithms were developed and applied to the digital images in different wavelength bands to extract information about the atmosphere in an objective way. The kind of mathematical algorithm one applies to satellite data may depend on the complexity of the physical processes that lead to the observed image, and how much information is contained in the satellite images both spatially and at different wavelengths. Imagery from satellite-borne passive microwave radiometers has limited horizontal resolution, and the observed microwave radiances are the result of complex physical processes that are not easily modeled. For this reason, a type of algorithm called a Bayesian estimation method is utilized to interpret passive microwave imagery in an objective, yet computationally efficient manner.
Welter, Petra; Riesmeier, Jörg; Fischer, Benedikt; Grouls, Christoph; Kuhl, Christiane; Deserno, Thomas M
2011-01-01
It is widely accepted that content-based image retrieval (CBIR) can be extremely useful for computer-aided diagnosis (CAD). However, CBIR has not been established in clinical practice yet. As a widely unattended gap of integration, a unified data concept for CBIR-based CAD results and reporting is lacking. Picture archiving and communication systems and the workflow of radiologists must be considered for successful data integration to be achieved. We suggest that CBIR systems applied to CAD should integrate their results in a picture archiving and communication systems environment such as Digital Imaging and Communications in Medicine (DICOM) structured reporting documents. A sample DICOM structured reporting template adaptable to CBIR and an appropriate integration scheme is presented. The proposed CBIR data concept may foster the promulgation of CBIR systems in clinical environments and, thereby, improve the diagnostic process.
Riesmeier, Jörg; Fischer, Benedikt; Grouls, Christoph; Kuhl, Christiane; Deserno (né Lehmann), Thomas M
2011-01-01
It is widely accepted that content-based image retrieval (CBIR) can be extremely useful for computer-aided diagnosis (CAD). However, CBIR has not been established in clinical practice yet. As a widely unattended gap of integration, a unified data concept for CBIR-based CAD results and reporting is lacking. Picture archiving and communication systems and the workflow of radiologists must be considered for successful data integration to be achieved. We suggest that CBIR systems applied to CAD should integrate their results in a picture archiving and communication systems environment such as Digital Imaging and Communications in Medicine (DICOM) structured reporting documents. A sample DICOM structured reporting template adaptable to CBIR and an appropriate integration scheme is presented. The proposed CBIR data concept may foster the promulgation of CBIR systems in clinical environments and, thereby, improve the diagnostic process. PMID:21672913
Electron transfer beyond the static picture: A TDDFT/TD-ZINDO study of a pentacene dimer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reslan, Randa; Lopata, Kenneth; Arntsen, Christopher
2012-12-14
We use time-dependent density functional theory and time-dependent ZINDO (a semi-empirical method) to study transfer of an extra electron between a pair of pentacene molecules. A measure of the electronic transfer integral is computed in a dynamic picture via the vertical excitation energy from a delocalized anionic ground state. With increasing dimer separation, this dynamical measurement of charge transfer is shown to be significantly larger than the commonly used static approximation (i.e., LUMO+1–LUMO of the neutral dimer, or HOMO–LUMO of the charged dimer), up to an order of magnitude higher at 6 Å. These results offer a word of cautionmore » for calculations involving large separations, as in organic photovoltaics, where care must be taken when using a static picture to model charge transfer.« less
Electron transfer beyond the static picture: A TDDFT/TD-ZINDO study of a pentacene dimer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reslan, Randa; Lopata, Kenneth A.; Arntsen, Christopher D.
2012-12-14
We use time-dependent density functional theory and time-dependent ZINDO (a semi-empirical method) to study transfer of an extra electron between a pair of pentacene dimers. A measure of the electronic transfer integral is computed in a dynamic picture via the vertical excitation energy from a delocalized anionic ground state. With increasing dimer separation, this dynamical measurement of charge transfer is shown to be significantly larger than the commonly used static approximation (i.e., LUMO+1 - LUMO of the neutral dimer, or HOMO - LUMO of the charged dimer), up to an order of magnitude higher at 6 Å. These results offermore » a word of caution for calculations involving large separations, as in organic photovoltaics, where care must be taken when using a static picture to model charge transfer.« less
III. NIH Toolbox Cognition Battery (CB): measuring episodic memory.
Bauer, Patricia J; Dikmen, Sureyya S; Heaton, Robert K; Mungas, Dan; Slotkin, Jerry; Beaumont, Jennifer L
2013-08-01
One of the most significant domains of cognition is episodic memory, which allows for rapid acquisition and long-term storage of new information. For purposes of the NIH Toolbox, we devised a new test of episodic memory. The nonverbal NIH Toolbox Picture Sequence Memory Test (TPSMT) requires participants to reproduce the order of an arbitrarily ordered sequence of pictures presented on a computer. To adjust for ability, sequence length varies from 6 to 15 pictures. Multiple trials are administered to increase reliability. Pediatric data from the validation study revealed the TPSMT to be sensitive to age-related changes. The task also has high test-retest reliability and promising construct validity. Steps to further increase the sensitivity of the instrument to individual and age-related variability are described. © 2013 The Society for Research in Child Development, Inc.
Conformational diversity and computational enzyme design
Lassila, Jonathan K.
2010-01-01
The application of computational protein design methods to the design of enzyme active sites offers potential routes to new catalysts and new reaction specificities. Computational design methods have typically treated the protein backbone as a rigid structure for the sake of computational tractability. However, this fixed-backbone approximation introduces its own special challenges for enzyme design and it contrasts with an emerging picture of natural enzymes as dynamic ensembles with multiple conformations and motions throughout a reaction cycle. This review considers the impact of conformational variation and dynamics on computational enzyme design and it highlights new approaches to addressing protein conformational diversity in enzyme design including recent advances in multistate design, backbone flexibility, and computational library design. PMID:20829099
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCormick, B.H.; Narasimhan, R.
1963-01-01
The overall computer system contains three main parts: an input device, a pattern recognition unit (PRU), and a control computer. The bubble chamber picture is divided into a grid of st run. Concent 1-mm squares on the film. It is then processed in parallel in a two-dimensional array of 1024 identical processing modules (stalactites) of the PRU. The array can function as a two- dimensional shift register in which results of successive shifting operations can be accumulated. The pattern recognition process is generally controlled by a conventional arithmetic computer. (A.G.W.)
Dean S. DeBell; Ryan Singleton; Barbara L. Gartner; David D. Marshall
2004-01-01
Breast-high stem sections were sampled from 56 western hemlock (Tsuga heterophylla (Raf.) Sarg.) trees growing in 15 plots representing a wide range of tree and site conditions in northwestern Oregon. Growth and wood density traits of individual rings were measured via X-ray densitometry, and relationships of ring density and its components to age...
NASA Technical Reports Server (NTRS)
1976-01-01
The recommendations, procedures, and techniques are summarized which provided by the Kodak Apparatus Division to the Ames Research Center to support the Earth Resources Aircraft Program at that facility. Recommendations, procedures, and calibration data are included for sensitometry, densitometry, laboratory cleanliness, and determination of camera exposure. Additional comments are made regarding process control procedures and general laboratory operations.
Smith, Scott M; Heer, Martina A; Shackelford, Linda C; Sibonga, Jean D; Ploutz-Snyder, Lori; Zwart, Sara R
2012-09-01
Exercise has shown little success in mitigating bone loss from long-duration spaceflight. The first crews of the International Space Station (ISS) used the "interim resistive exercise device" (iRED), which allowed loads of up to 297 lb(f) (or 1337 N) but provided little protection of bone or no greater protection than aerobic exercise. In 2008, the Advanced Resistive Exercise Device (ARED), which allowed absolute loads of up to 600 lb(f) (1675 N), was launched to the ISS. We report dietary intake, bone densitometry, and biochemical markers in 13 crewmembers on ISS missions from 2006 to 2009. Of these 13, 8 had access to the iRED and 5 had access to the ARED. In both groups, bone-specific alkaline phosphatase tended to increase during flight toward the end of the mission (p = 0.06) and increased 30 days after landing (p < 0.001). Most markers of bone resorption were also increased in both groups during flight and 30 days after landing (p < 0.05). Bone densitometry revealed significant interactions (time and exercise device) for pelvis bone mineral density (BMD) and bone mineral content (p < 0.01), hip femoral neck BMD (p < 0.05), trochanter BMD (p < 0.05), and total hip BMD (p < 0.05). These variables were unchanged from preflight only for ARED crewmembers, who also returned from flight with higher percent lean mass and lower percent fat mass. Body mass was unchanged after flight in both groups. All crewmembers had nominal vitamin D status (75 ± 17 nmol/L) before and during flight. These data document that resistance exercise, coupled with adequate energy intake (shown by maintenance of body mass determined by dual-energy X-ray absorptiometry [DXA]) and vitamin D, can maintain bone in most regions during 4- to 6-month missions in microgravity. This is the first evidence that improving nutrition and resistance exercise during spaceflight can attenuate the expected BMD deficits previously observed after prolonged missions. Copyright © 2012 American Society for Bone and Mineral Research.
Flöter, Michelle; Bittar, Cíntia Kelly; Zabeu, José Luis; Carneiro, Ana Carolina
2011-01-01
To assess the utility of quantitative ultrasound (QUS) of the calcaneus for diagnosing osteoporosis compared to the gold standard, bone densitometry using dual-emission X-ray absorptiometry (DXA), according to published reports. In this systematic review, the Medline/PUBMED, Medline Ovid and Journals@Ovid, and Wilson General Sciences Full Text database were used. The search strategy involved use of the following MeSH descriptors: [osteoporosis AND (densitometry OR ultrasonography)], and 39 articles published between 2001 and April 2010 were assessed. However, only six articles met the inclusion criteria: sensitivity and specificity of QUS, sample (women or men with no treatment or other disease likely to change bone mass index), devices used, comparative T-score between QUS of the calcaneus and DXA. The GE-Lunar Achilles and Hologic Sahara devices were used in most of the tests reported and were effective. All studies assessed compared QUS of the calcaneus to DXA of the lumbar spine or femoral neck, as the gold standard. QUS sensitivity ranged from 79% to 93% and specificity ranged from 28% to 90% when at the lower threshold. It is a controversial parameter, because the gold-standard threshold (T-score < -2.5, DXA) could not be used for QUS without errors in osteoporosis diagnosis. All studies had a threshold determined by the authors’ criteria, with a variability of -1.7 (pDXA T--score) and -2.4 for QUS, leading to the same prevalence of osteoporosis, and a T-score of < -3.65 for QUS was equivalent to a T-score < -2.5 for DXA. Based on the analysis of seven studies, we conclude that QUS of the calcaneus still cannot be used to confirm diagnosis of osteoporosis by comparing the results to those of patients who had already received such a diagnosis based on DXA. However, further research should be conducted in this area, because it is possible to improve the number diagnoses by varying the cutoff T-score. Furthermore, using QUS of the calcaneus was a helpful tool for assessing pathological fractures, whether or not they were associated with osteoporosis.
Smilic, Tanja N; Novakovic, Tatjana R; Markovic-Jovanovic, Snezana R; Smilic, Ljiljana L J; Mitic, Javorka S; Radunovic, Miodrag L
2017-11-02
In general, markers of bone formation and markers of bone resorption are changing synergistically, so the monitoring of any osteoclastic and any osteoblastic marker should reflect the rate of bone transformation. The aim of the study is to monitor the bone metabolism markers in postmenopausal women with osteoporosis and osteopenia along with the variations caused by the effects of bisphosphonate therapy. The study involved 55 women of average age of 57.95 years, with osteopenia or osteoporosis. The patients with osteoporosis were treated with bisphosphonates (75 mg once a week); the laboratory tests were performed before the treatment and 6 months later. Patients with osteopenia were evaluated at the first assessment and 6 months later. The tests included bone densitometry, dual-energy X-ray absorptiometry, osteocalcin, alkaline phosphatase, collagen 1 N-terminal pro-peptide (P1NP), and beta C telopeptide of type I collagen (CTX). The mean T-score was -2.80 ± 0.63 before therapy and -2.64 ± 0.45 6 months later (p < 0.001). Women with osteoporosis had elevated levels of osteocalcin and P1NP at the first assessment, whereas the alkaline phosphatase level did not change with the treatment. After the introduction of antiresorptive therapy, the levels of osteocalcin and P1NP significantly decreased (p < 0.001). In the group with osteopenia, the biochemical markers activity were increased in both assessments. In patients with osteoporosis, Beta-CTX was increased in the first evaluation, and decreased after treatment (p = 0.001). The results indicate that the assessment of biochemical markers of bone metabolism show excellent results in the assessment of prognosis, monitoring the course and the response to various treatment regimens of osteoporosis and evince strong correlation with standard densitometry and dual-energy X-ray absorptiometry procedures. P1NP and CTX show better diagnostic applicability compared with osteocalcin and alkaline phosphatase. The analysis of the activity of biochemical markers may obtain early information on the therapeutic response, before definitive assessment by bone density measurements. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Cai, David J; Zhao, Yongdong; Glasier, Jennifer; Cullen, Diane; Barnes, Stephen; Turner, Charles H; Wastney, Meryl; Weaver, Connie M
2005-05-01
This study provided a comprehensive investigation on the effect of soy protein and soy isoflavones on both calcium and bone metabolism in virgin adult rats. The measurements included bone histology, calcium kinetic modeling, calcium balance, bone densitometry, and whole body densitometry. Results confirmed the bone-preserving effect of estrogen but did not support a bone-sparing role of soy isoflavones. Several animal and short-term human studies have indicated that soy protein isolate enriched with isoflavones may be used as an alternative therapy to estrogen replacement therapy. However, none of the previous studies have investigated this estrogenic effect on both calcium and bone metabolism in animals or humans, which is essential in ascertaining the mode of action of isoflavones. This study was designed to determine the effects of soy protein versus isoflavones on calcium and bone metabolism in an ovariectomized rat model. Unmated 6-month-old ovariectomized and sham-operated female Sprague-Dawley rats were randomly assigned to nine groups (16 rats/group) and pair-fed soy- or casein-based diets with or without isoflavones for 8 weeks. A reference group was administered estrogen through subcutaneous implants (20-35 pg/liter plasma). Bone densitometry, histomorphometry, and mechanical testing were used to study bone metabolism and quality. Calcium metabolism was studied using calcium tracer balance and kinetics. After ovariectomy, estrogen prevented bone loss in trabecular bone and suppressed formation on both trabecular and cortical bone surfaces. Isoflavones given as enriched soy protein isolate or supplements did not prevent trabecular bone loss. Combining isoflavones with estrogen had no additional benefits over estrogen alone. There were no differences in response to isoflavones caused by protein source. None of the treatments significantly affected either total Ca balance or (45)Ca absorption. However, soy protein showed significant effects on reducing urinary loss of Ca in animals, irrespective of isoflavone level, perhaps because of the lower amount of sulfur-containing amino acids in soy protein. Estrogen, but not isoflavones at the levels tested, suppressed bone remodeling in both trabecular and cortical bone after ovariectomy.
Ibrahim, Heba K; Abdel-Moety, Mona M; Abdel-Gawad, Sherif A; Al-Ghobashy, Medhat A; Kawy, Mohamed Abdel
2017-03-01
Realistic implementation of ion selective electrodes (ISEs) into environmental monitoring programs has always been a challenging task. This could be largely attributed to difficulties in validation of ISE assay results. In this study, the electrochemical response of amoxicillin trihydrate (AMX), ciprofloxacin hydrochloride (CPLX), trimethoprim (TMP), and norfloxacin (NFLX) was studied by the fabrication of sensitive membrane electrodes belonging to two types of ISEs, which are polyvinyl chloride (PVC) membrane electrodes and glassy carbon (GC) electrodes. Linear response for the membrane electrodes was in the concentration range of 10 -5 -10 -2 mol/L. For the PVC membrane electrodes, Nernstian slopes of 55.1, 56.5, 56.5, and 54.0 mV/decade were achieved over a pH 4-8 for AMX, CPLX, and NFLX, respectively, and pH 3-6 for TMP. On the other hand, for GC electrodes, Nernstian slopes of 59.1, 58.2, 57.0, and 58.2 mV/decade were achieved over pH 4-8 for AMX, CPLX, and NFLX, respectively, and pH 3-6 for TMP. In addition to assay validation to international industry standards, the fabricated electrodes were also cross-validated relative to conventional separation techniques; high performance liquid chromatography (HPLC), and thin layer chromatography (TLC)-densitometry. The HPLC assay was applied in concentration range of 0.5-10.0 μg/mL, for all target analytes. The TLC-densitometry was adopted over a concentration range of 0.3-1.0 μg/band, for AMX, and 0.1-0.9 μg/band, for CPLX, NFLX, and TMP. The proposed techniques were successfully applied for quantification of the selected drugs either in pure form or waste water samples obtained from pharmaceutical plants. The actual waste water samples were subjected to solid phase extraction (SPE) for pretreatment prior to the application of chromatographic techniques (HPLC and TLC-densitometry). On the other hand, the fabricated electrodes were successfully applied for quantification of the antibiotic residues in actual waste water samples without any pretreatment. This finding assures the suitability of the fabricated ISEs for environmental analysis.
NCI scientists at forefront of new prostate cancer diagnostics
Introduction of the UroNav was the result of nearly a decade’s research and development, principally conducted at NCI. Resembling a stylized computer workstation on wheels, the system electronically fuses together pictures from magnetic resonance imaging
ERIC Educational Resources Information Center
Murphy, Patti
2007-01-01
Frequently linked to sophisticated speech communication devices resembling laptop computers, augmentative and alternative communication (AAC) encompasses a spectrum of tools and strategies ranging from pointing, writing, gestures, and facial expressions to sign language, manual alphabet boards, picture symbols, and photographs used to convey…
25 CFR 542.13 - What are the minimum internal control standards for gaming machines?
Code of Federal Regulations, 2014 CFR
2014-04-01
.... (j) Player tracking system. (1) The following standards apply if a player tracking system is utilized... image on the computer screen; (B) Comparing the customer to image on customer's picture ID; or (C...
25 CFR 542.13 - What are the minimum internal control standards for gaming machines?
Code of Federal Regulations, 2012 CFR
2012-04-01
.... (j) Player tracking system. (1) The following standards apply if a player tracking system is utilized... image on the computer screen; (B) Comparing the customer to image on customer's picture ID; or (C...
25 CFR 542.13 - What are the minimum internal control standards for gaming machines?
Code of Federal Regulations, 2013 CFR
2013-04-01
.... (j) Player tracking system. (1) The following standards apply if a player tracking system is utilized... image on the computer screen; (B) Comparing the customer to image on customer's picture ID; or (C...
25 CFR 542.13 - What are the minimum internal control standards for gaming machines?
Code of Federal Regulations, 2010 CFR
2010-04-01
.... (j) Player tracking system. (1) The following standards apply if a player tracking system is utilized... image on the computer screen; (B) Comparing the customer to image on customer's picture ID; or (C...
25 CFR 542.13 - What are the minimum internal control standards for gaming machines?
Code of Federal Regulations, 2011 CFR
2011-04-01
.... (j) Player tracking system. (1) The following standards apply if a player tracking system is utilized... image on the computer screen; (B) Comparing the customer to image on customer's picture ID; or (C...
... CT scan may be done at the same time. This is called a PET-CT . MRI (magnetic resonance imaging) : A procedure that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. ...
Treatment Option Overview (Esophageal Cancer)
... CT scan may be done at the same time. This is called a PET-CT . MRI (magnetic resonance imaging) : A procedure that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. ...
... CT scan may be done at the same time. This is called a PET-CT. MRI (magnetic resonance imaging) : A procedure that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. ...
Mariner 9 control net of Mars, August 1972
NASA Technical Reports Server (NTRS)
Davies, M. E.
1972-01-01
Results are presented for a planet-wide geodetic control net of Mars which is based on Mariner 9 pictures as of August 1972. Aerocentric and aerographic coordinate of 809 control points were computed from 407 television frames. Photogrammetric parameters and methodology used in the computations are discussed. The coordinates of the features are given and figures that show the locations of the control points on the surface of Mars are included.
Firearms in major motion pictures, 1995-2004.
Binswanger, Ingrid A; Cowan, John A
2009-03-01
Firearms are a major cause of injury and death. We sought to determine (1) the prevalence of movie scenes that depicted firearms and verbal firearm safety messages; (2) the context and health outcomes in firearm scenes; and (3) the association between the Motion Picture Association of America ratings and firearm scene characteristics. Ten top revenue-grossing motion pictures were selected for each year from 1995 to 2004 in descending order of gross revenues. Data on firearm scenes were collected by movie coders using dual-monitor computer workstations and real-time collection tools. Seventy of the 100 movies had scenes with firearms and the majority of movies with firearms were rated PG-13. Firearm scenes (N = 624) accounted for 17% of screen time in movies with firearms. Among firearm scenes, crime or illegal activity was involved in 45%, deaths occurred in 19%, and injuries occurred in 12%. A verbal reference to safety was made in 0.8%. Depictions of firearms in top revenue-grossing movies were common, but safety messages were exceedingly rare. Major motion pictures present an under-used opportunity for education about firearm safety.
NASA Technical Reports Server (NTRS)
1977-01-01
This picture of a crescent-shaped Earth and Moon -- the first of its kind ever taken by a spacecraft -- was recorded Sept. 18, 1977, by NASA's Voyager 1 when it was 7.25 million miles (11.66 million kilometers) from Earth. The Moon is at the top of the picture and beyond the Earth as viewed by Voyager. In the picture are eastern Asia, the western Pacific Ocean and part of the Arctic. Voyager 1 was directly above Mt. Everest (on the night side of the planet at 25 degrees north latitude) when the picture was taken. The photo was made from three images taken through color filters, then processed by the Jet Propulsion Laboratory's Image Processing Lab. Because the Earth is many times brighter than the Moon, the Moon was artificially brightened by a factor of three relative to the Earth by computer enhancement so that both bodies would show clearly in the print. Voyager 2 was launched Aug. 20, 1977, followed by Voyager 1 on Sept. 5, 1977, en route to encounters at Jupiter in 1979 and Saturn in 1980 and 1981. JPL manages the Voyager mission for NASA's Office of Space Science.
Crescent-shaped Earth and Moon
NASA Technical Reports Server (NTRS)
1978-01-01
This picture of a crescent-shaped Earth and Moon -- the first of its kind ever taken by a spacecraft -- was recorded Sept. 18, 1977, by NASA's Voyager 1 when it was 7.25 million miles (11.66 million kilometers) from Earth. The Moon is at the top of the picture and beyond the Earth as viewed by Voyager. In the picture are eastern Asia, the western Pacific Ocean and part of the Arctic. Voyager 1 was directly above Mt. Everest (on the night side of the planet at 25 degrees north latitude) when the picture was taken. The photo was made from three images taken through color filters, then processed by the Jet Propulsion Laboratory's Image Processing Lab. Because the Earth is many times brighter than the Moon, the Moon was artificially brightened by a factor of three relative to the Earth by computer enhancement so that both bodies would show clearly in the print. Voyager 2 was launched Aug. 20, 1977, followed by Voyager 1 on Sept. 5, 1977, en route to encounters at Jupiter in 1979 and Saturn in 1980 and 1981. JPL manages the Voyager mission for NASA.
NASA Astrophysics Data System (ADS)
Manjanaik, N.; Parameshachari, B. D.; Hanumanthappa, S. N.; Banu, Reshma
2017-08-01
Intra prediction process of H.264 video coding standard used to code first frame i.e. Intra frame of video to obtain good coding efficiency compare to previous video coding standard series. More benefit of intra frame coding is to reduce spatial pixel redundancy with in current frame, reduces computational complexity and provides better rate distortion performance. To code Intra frame it use existing process Rate Distortion Optimization (RDO) method. This method increases computational complexity, increases in bit rate and reduces picture quality so it is difficult to implement in real time applications, so the many researcher has been developed fast mode decision algorithm for coding of intra frame. The previous work carried on Intra frame coding in H.264 standard using fast decision mode intra prediction algorithm based on different techniques was achieved increased in bit rate, degradation of picture quality(PSNR) for different quantization parameters. Many previous approaches of fast mode decision algorithms on intra frame coding achieved only reduction of computational complexity or it save encoding time and limitation was increase in bit rate with loss of quality of picture. In order to avoid increase in bit rate and loss of picture quality a better approach was developed. In this paper developed a better approach i.e. Gaussian pulse for Intra frame coding using diagonal down left intra prediction mode to achieve higher coding efficiency in terms of PSNR and bitrate. In proposed method Gaussian pulse is multiplied with each 4x4 frequency domain coefficients of 4x4 sub macro block of macro block of current frame before quantization process. Multiplication of Gaussian pulse for each 4x4 integer transformed coefficients at macro block levels scales the information of the coefficients in a reversible manner. The resulting signal would turn abstract. Frequency samples are abstract in a known and controllable manner without intermixing of coefficients, it avoids picture getting bad hit for higher values of quantization parameters. The proposed work was implemented using MATLAB and JM 18.6 reference software. The proposed work measure the performance parameters PSNR, bit rate and compression of intra frame of yuv video sequences in QCIF resolution under different values of quantization parameter with Gaussian value for diagonal down left intra prediction mode. The simulation results of proposed algorithm are tabulated and compared with previous algorithm i.e. Tian et al method. The proposed algorithm achieved reduced in bit rate averagely 30.98% and maintain consistent picture quality for QCIF sequences compared to previous algorithm i.e. Tian et al method.
Facilitation and interference in naming: A consequence of the same learning process?
Hughes, Julie W; Schnur, Tatiana T
2017-08-01
Our success with naming depends on what we have named previously, a phenomenon thought to reflect learning processes. Repeatedly producing the same name facilitates language production (i.e., repetition priming), whereas producing semantically related names hinders subsequent performance (i.e., semantic interference). Semantic interference is found whether naming categorically related items once (continuous naming) or multiple times (blocked cyclic naming). A computational model suggests that the same learning mechanism responsible for facilitation in repetition creates semantic interference in categorical naming (Oppenheim, Dell, & Schwartz, 2010). Accordingly, we tested the predictions that variability in semantic interference is correlated across categorical naming tasks and is caused by learning, as measured by two repetition priming tasks (picture-picture repetition priming, Exp. 1; definition-picture repetition priming, Exp. 2, e.g., Wheeldon & Monsell, 1992). In Experiment 1 (77 subjects) semantic interference and repetition priming effects were robust, but the results revealed no relationship between semantic interference effects across contexts. Critically, learning (picture-picture repetition priming) did not predict semantic interference effects in either task. We replicated these results in Experiment 2 (81 subjects), finding no relationship between semantic interference effects across tasks or between semantic interference effects and learning (definition-picture repetition priming). We conclude that the changes underlying facilitatory and interfering effects inherent to lexical access are the result of distinct learning processes where multiple mechanisms contribute to semantic interference in naming. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
1986-01-01
Mallinckrodt Institute of Radiology (MIR) is using a digital image processing system which employs NASA-developed technology. MIR's computer system is the largest radiology system in the world. It is used in diagnostic imaging. Blood vessels are injected with x-ray dye, and the images which are produced indicate whether arteries are hardened or blocked. A computer program developed by Jet Propulsion Laboratory known as Mini-VICAR/IBIS was supplied to MIR by COSMIC. The program provides the basis for developing the computer imaging routines for data processing, contrast enhancement and picture display.
ERIC Educational Resources Information Center
Physics Education, 1989
1989-01-01
Described are the purposes, laboratory set-ups, and procedures of four classroom experiments: ultrasound speedometer; vibrating-bar depth gauge; folding three-dimensional model of equipotential surfaces; and a simple optical system for the reconstruction of images from computer-generated holograms. Diagrams and pictures are provided. (YP)
ERIC Educational Resources Information Center
Rosengrant, David
2011-01-01
Multiple representations are a valuable tool to help students learn and understand physics concepts. Furthermore, representations help students learn how to think and act like real scientists. These representations include: pictures, free-body diagrams, energy bar charts, electrical circuits, and, more recently, computer simulations and…
The Exponential Expansion of Simulation in Research
2012-12-01
exponential growth of computing power. Although other analytic approaches also benefit from this trend, keyword searches of several scholarly search ... engines reveal that the reliance on simulation is increasing more rapidly. A descriptive analysis paints a compelling picture: simulation is frequently
Chandelier: Picturing Potential
ERIC Educational Resources Information Center
Tebbs, Trevor J.
2014-01-01
The author--artist, scientist, educator, and visual-spatial thinker--describes the genesis of, and provides insight into, an innovative, strength-based, visually dynamic computer-aided communication system called Chandelier©. This system is the powerful combination of a sophisticated, user-friendly software program and an organizational…
28 CFR 75.2 - Maintenance of records.
Code of Federal Regulations, 2014 CFR
2014-07-01
... Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CHILD PROTECTION RESTORATION AND PENALTIES ENHANCEMENT ACT OF 1990; PROTECT ACT; ADAM WALSH CHILD PROTECTION AND SAFETY ACT OF 2006; RECORDKEEPING AND..., periodical, film, videotape, digitally- or computer-manipulated image, digital image, picture, or other...
28 CFR 75.2 - Maintenance of records.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CHILD PROTECTION RESTORATION AND PENALTIES ENHANCEMENT ACT OF 1990; PROTECT ACT; ADAM WALSH CHILD PROTECTION AND SAFETY ACT OF 2006; RECORDKEEPING AND..., periodical, film, videotape, digitally- or computer-manipulated image, digital image, picture, or other...
28 CFR 75.2 - Maintenance of records.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CHILD PROTECTION RESTORATION AND PENALTIES ENHANCEMENT ACT OF 1990; PROTECT ACT; ADAM WALSH CHILD PROTECTION AND SAFETY ACT OF 2006; RECORDKEEPING AND..., periodical, film, videotape, digitally- or computer-manipulated image, digital image, picture, or other...
28 CFR 75.2 - Maintenance of records.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CHILD PROTECTION RESTORATION AND PENALTIES ENHANCEMENT ACT OF 1990; PROTECT ACT; ADAM WALSH CHILD PROTECTION AND SAFETY ACT OF 2006; RECORDKEEPING AND..., periodical, film, videotape, digitally- or computer-manipulated image, digital image, picture, or other...
28 CFR 75.2 - Maintenance of records.
Code of Federal Regulations, 2012 CFR
2012-07-01
... Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CHILD PROTECTION RESTORATION AND PENALTIES ENHANCEMENT ACT OF 1990; PROTECT ACT; ADAM WALSH CHILD PROTECTION AND SAFETY ACT OF 2006; RECORDKEEPING AND..., periodical, film, videotape, digitally- or computer-manipulated image, digital image, picture, or other...
Treatment Option Overview (Primary CNS Lymphoma)
... CT scan may be done at the same time. This is called a PET-CT. MRI (magnetic resonance imaging) : A procedure that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. ...
Treatment Options for Primary CNS Lymphoma
... CT scan may be done at the same time. This is called a PET-CT. MRI (magnetic resonance imaging) : A procedure that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. ...
Treatment Options by Stage (Esophageal Cancer)
... CT scan may be done at the same time. This is called a PET-CT . MRI (magnetic resonance imaging) : A procedure that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. ...
NASA Astrophysics Data System (ADS)
Hewawasam, Kuravi; Mendillo, Christopher B.; Howe, Glenn A.; Martel, Jason; Finn, Susanna C.; Cook, Timothy A.; Chakrabarti, Supriya
2017-09-01
The Planetary Imaging Concept Testbed Using a Recoverable Experiment - Coronagraph (PICTURE-C) mission will directly image debris disks and exozodiacal dust around nearby stars from a high-altitude balloon using a vector vortex coronagraph. The PICTURE-C low-order wavefront control (LOWC) system will be used to correct time-varying low-order aberrations due to pointing jitter, gravity sag, thermal deformation, and the gondola pendulum motion. We present the hardware and software implementation of the low-order ShackHartmann and reflective Lyot stop sensors. Development of the high-speed image acquisition and processing system is discussed with the emphasis on the reduction of hardware and computational latencies through the use of a real-time operating system and optimized data handling. By characterizing all of the LOWC latencies, we describe techniques to achieve a framerate of 200 Hz with a mean latency of ˜378 μs
Unprompted generation of obesity stereotypes.
Horsburgh-McLeod, G; Latner, J D; O'Brien, K S
2009-01-01
Prejudice towards obese people is widespread and has negative consequences for individuals with obesity. The present study covertly examined whether participants spontaneously generate different written transcript content (i.e., more negative stereotypes) when presented with a picture of an obese person or a normal-weight person. Two pictures of young women were computer generated to appear identical in all features except for body shape, which was either obese or normal-weight. Forty-nine women blind to the nature of the study were randomized to receive either the obese or normal-weight picture and asked to write a free-response description of a typical "day in the life" of the woman depicted. Independent coding of the transcripts revealed more frequent negative stereotypes and more negative valence generated by participants asked to describe a typical day of the obese target. These differences are consistent with the prevalent negative stereotypes of obese individuals.
Communication: A difference density picture for the self-consistent field ansatz.
Parrish, Robert M; Liu, Fang; Martínez, Todd J
2016-04-07
We formulate self-consistent field (SCF) theory in terms of an interaction picture where the working variable is the difference density matrix between the true system and a corresponding superposition of atomic densities. As the difference density matrix directly represents the electronic deformations inherent in chemical bonding, this "difference self-consistent field (dSCF)" picture provides a number of significant conceptual and computational advantages. We show that this allows for a stable and efficient dSCF iterative procedure with wholly single-precision Coulomb and exchange matrix builds. We also show that the dSCF iterative procedure can be performed with aggressive screening of the pair space. These approximations are tested and found to be accurate for systems with up to 1860 atoms and >10 000 basis functions, providing for immediate overall speedups of up to 70% in the heavily optimized TeraChem SCF implementation.
Communication: A difference density picture for the self-consistent field ansatz
NASA Astrophysics Data System (ADS)
Parrish, Robert M.; Liu, Fang; Martínez, Todd J.
2016-04-01
We formulate self-consistent field (SCF) theory in terms of an interaction picture where the working variable is the difference density matrix between the true system and a corresponding superposition of atomic densities. As the difference density matrix directly represents the electronic deformations inherent in chemical bonding, this "difference self-consistent field (dSCF)" picture provides a number of significant conceptual and computational advantages. We show that this allows for a stable and efficient dSCF iterative procedure with wholly single-precision Coulomb and exchange matrix builds. We also show that the dSCF iterative procedure can be performed with aggressive screening of the pair space. These approximations are tested and found to be accurate for systems with up to 1860 atoms and >10 000 basis functions, providing for immediate overall speedups of up to 70% in the heavily optimized TeraChem SCF implementation.
[A new concept for integration of image databanks into a comprehensive patient documentation].
Schöll, E; Holm, J; Eggli, S
2001-05-01
Image processing and archiving are of increasing importance in the practice of modern medicine. Particularly due to the introduction of computer-based investigation methods, physicians are dealing with a wide variety of analogue and digital picture archives. On the other hand, clinical information is stored in various text-based information systems without integration of image components. The link between such traditional medical databases and picture archives is a prerequisite for efficient data management as well as for continuous quality control and medical education. At the Department of Orthopedic Surgery, University of Berne, a software program was developed to create a complete multimedia electronic patient record. The client-server system contains all patients' data, questionnaire-based quality control, and a digital picture archive. Different interfaces guarantee the integration into the hospital's data network. This article describes our experiences in the development and introduction of a comprehensive image archiving system at a large orthopedic center.
Three Dimensional Cross-Sectional Properties From Bone Densitometry
NASA Technical Reports Server (NTRS)
Cleek, Tammy M.; Whalen, Robert T.; Dalton, Bonnie P. (Technical Monitor)
2001-01-01
Bone densitometry has previously been used to obtain cross-sectional properties of bone in a single scan plane. Using three non-coplanar scans, we have extended the method to obtain the principal area Moments of inertia and orientations of the principal axes at each cross-section along the length of the scan. Various 5 aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of mass distribution. Factors considered included X-ray photon energy, initial scan orientation, the included angle of the 3 scans, and Imin/Imax ratios. Principal moments of inertia were accurate to within 3.1% and principal angles were within 1 deg. of the expected value for phantoms scanned with included angles of 60 deg. and 90 deg. at the higher X-ray photon energy. Low standard deviations in error also 10 indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 deg. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (Imin/Imax) values when various included angles are used make this technique viable for future in vivo studies.
Variation in sensitivity, absorption and density of the central rod distribution with eccentricity.
Tornow, R P; Stilling, R
1998-01-01
To assess the human rod photopigment distribution and sensitivity with high spatial resolution within the central +/-15 degrees and to compare the results of pigment absorption, sensitivity and rod density distribution (number of rods per square degree). Rod photopigment density distribution was measured with imaging densitometry using a modified Rodenstock scanning laser ophthalmoscope. Dark-adapted sensitivity profiles were measured with green stimuli (17' arc diameter, 1 degrees spacing) using a T ubingen manual perimeter. Sensitivity profiles were plotted on a linear scale and rod photopigment optical density distribution profiles were converted to absorption profiles of the rod photopigment layer. Both the absorption profile of the rod photopigment and the linear sensitivity profile for green stimuli show a minimum at the foveal center and increase steeply with eccentricity. The variation with eccentricity corresponds to the rod density distribution. Rod photopigment absorption profiles, retinal sensitivity profiles, and the rod density distribution are linearly related within the central +/-15 degrees. This is in agreement with theoretical considerations. Both methods, imaging retinal densitometry using a scanning laser ophthalmoscope and dark-adapted perimetry with small green stimuli, are useful for assessing the central rod distribution and sensitivity. However, at present, both methods have limitations. Suggestions for improving the reliability of both methods are given.
NASA Astrophysics Data System (ADS)
Tsuchiya, H.; Harada, H.; Koizumi, M.; Kitatani, F.; Takamine, J.; Kureta, M.; Iimura, H.
2013-11-01
Neutron resonance densitometry (NRD) has been proposed to quantify nuclear materials in melted fuel (MF) that will be removed from the Fukushima Daiichi nuclear power plant. The problem is complex due to the expected presence of strong neutron absorbing impurities such as 10B and high radiation field that is mainly caused by 137Cs. To identify the impurities under the high radiation field, NRD is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). We investigated with Geant4 the performance of a gamma-ray detector for NRCA in NRD. The gamma-ray detector has a well shape, consisting of cylindrical and tube type LaBr3 scintillators. We show how it measures 478 keV gamma rays derived from 10B(n, αγ) reaction in MF under a high 137Cs-radiation environment. It was found that the gamma-ray detector was able to well suppress the Compton edge of 662-keV gamma rays of 137Cs and had a high peak-to-Compton continuum ratio, by using the tube type scintillator as a back-catcher detector. Then, we demonstrate that with this ability, detection of 478-keV gamma rays from 10B is accomplished in realistic measuring time.
Outcomes of bone density measurements in coeliac disease.
Bolland, Mark J; Grey, Andrew; Rowbotham, David S
2016-01-29
Some guidelines recommend that patients with newly diagnosed coeliac disease undergo bone density scanning. We assessed the bone density results in a cohort of patients with coeliac disease. We searched bone density reports over two 5-year periods in all patients from Auckland District Health Board (2008-12) and in patients under 65 years from Counties Manukau District Health Board (2009-13) for the term 'coeliac.' Reports for 137 adults listed coeliac disease as an indication for bone densitometry. The average age was 47 years, body mass index (BMI) 25 kg/m(2), and 77% were female. The median time between coeliac disease diagnosis and bone densitometry was 261 days. The average bone density Z-score was slightly lower than expected (Z-score -0.3 to 0.4) at the lumbar spine, total hip and femoral neck, but 88-93% of Z-scores at each site lay within the normal range. Low bone density was strongly related to BMI: the proportions with Z-score <-2 for BMI <20, 20-25, 25-30, and >30 kg/m(2) were 28%, 15%, 6% and 0% respectively. Average bone density was normal, suggesting that bone density measurement is not indicated routinely in coeliac disease, but could be considered on a case-by-case basis for individuals with strong risk factors for fracture.
Iconographic dental typography. A dental character font for computer graphics.
McCormack, J
1991-06-08
The recent massive increase in available memory for microcomputers now allows multiple font faces to be stored in computer RAM memory for instant access to the screen and for printed output. Fonts can be constructed in which the characters are not just letters or numbers, but are miniature graphic icons--in this instance pictures of teeth. When printed on an appropriate laser printer, this produces printed graphics of publishing quality.
2017-03-01
Responsibility AWS Amazon Web Services C2 Command and Control C4ISR Command, Control, Communications, Computers and Intelligence, Surveillance...and Reconnaissance C5F Commander Fifth Fleet C6F Commander Sixth Fleet C7F Commander Seventh Fleet CAMTES Computer -Assisted Maritime...capabilities. C. SCOPE AND LIMITATIONS The scope of this study is considerable and encompasses numerous agencies and classification levels. Some
ERIC Educational Resources Information Center
Adams, Linda; Lehman, Linda
2007-01-01
In this article, the authors describe a project that integrated computer technology skills with art history, photography, and layout/design. Approximately 160 fourth graders became photographers and created books on the following concepts: position words, numbers, colors, alphabet, shapes, and patterns. The books were professionally bound and…
Desktop Publishing: A Powerful Tool for Advanced Composition Courses.
ERIC Educational Resources Information Center
Sullivan, Patricia
1988-01-01
Examines the advantages of using desktop publishing in advanced writing classes. Explains how desktop publishing can spur creativity, call attention to the interaction between words and pictures, encourage the social dimensions of computing and composing, and provide students with practical skills. (MM)
Computer Animation of a Chemical Reaction.
ERIC Educational Resources Information Center
Eaker, Charles W.; Jacobs, Edwin L.
1982-01-01
Taking a prototype chemical reaction (molecular hydrogen plus hydrogen atom), constructs an accurate semiempirical, generalized diatomics-in-molecules potential energy surface, calculates motions of these atoms on this surface using REACTS trajectory program, and presents results as moving picture on a microcomputer graphics system. Provides…
Audio-Tutorial Instruction in Medicine.
ERIC Educational Resources Information Center
Boyle, Gloria J.; Herrick, Merlyn C.
This progress report concerns an audio-tutorial approach used at the University of Missouri-Columbia School of Medicine. Instructional techniques such as slide-tape presentations, compressed speech audio tapes, computer-assisted instruction (CAI), motion pictures, television, microfiche, and graphic and printed materials have been implemented,…
ERIC Educational Resources Information Center
Halse, M. R.; Hudson, W. J.
1986-01-01
Describes an X-Y scanner used to create acoustic holograms. Scanner is computer controlled and can be adapted to digitize pictures. Scanner geometry is discussed. An appendix gives equipment details. The control program in ATOM BASIC and 6502 machine code is available from the authors. (JM)
Stages of Adult Soft Tissue Sarcoma
... that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. This procedure is also called nuclear magnetic resonance imaging (NMRI). PET scan (positron emission tomography scan) : A procedure to find malignant tumor cells ...
Treatment Option Overview (Adult Soft Tissue Sarcoma)
... that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. This procedure is also called nuclear magnetic resonance imaging (NMRI). PET scan (positron emission tomography scan) : A procedure to find malignant tumor cells ...
Treatment Options for Adult Soft Tissue Sarcoma
... that uses a magnet, radio waves , and a computer to make a series of detailed pictures of areas inside the body. This procedure is also called nuclear magnetic resonance imaging (NMRI). PET scan (positron emission tomography scan) : A procedure to find malignant tumor cells ...
Nicholas, Marjorie; Sinotte, Michele P.; Helm-Estabrooks, Nancy
2011-01-01
Learning how to use a computer-based communication system can be challenging for people with severe aphasia even if the system is not word-based. This study explored cognitive and linguistic factors relative to how they affected individual patients’ ability to communicate expressively using C-Speak Aphasia, (CSA), an alternative communication computer program that is primarily picture-based. Ten individuals with severe non-fluent aphasia received at least six months of training with CSA. To assess carryover of training, untrained functional communication tasks (i.e., answering autobiographical questions, describing pictures, making telephone calls, describing a short video, and two writing tasks) were repeatedly probed in two conditions: 1) using CSA in addition to natural forms of communication, and 2) using only natural forms of communication, e.g., speaking, writing, gesturing, drawing. Four of the ten participants communicated more information on selected probe tasks using CSA than they did without the computer. Response to treatment also was examined in relation to baseline measures of non-linguistic executive function skills, pictorial semantic abilities, and auditory comprehension. Only nonlinguistic executive function skills were significantly correlated with treatment response. PMID:21506045
The effect of interference on delta modulation encoded video signals
NASA Technical Reports Server (NTRS)
Schilling, D. L.
1979-01-01
The results of a study on the use of the delta modulator as a digital encoder of television signals are presented. The computer simulation was studied of different delta modulators in order to find a satisfactory delta modulator. After finding a suitable delta modulator algorithm via computer simulation, the results are analyzed and then implemented in hardware to study the ability to encode real time motion pictures from an NTSC format television camera. The effects were investigated of channel errors on the delta modulated video signal and several error correction algorithms were tested via computer simulation. A very high speed delta modulator was built (out of ECL logic), incorporating the most promising of the correction schemes, so that it could be tested on real time motion pictures. The final area of investigation concerned itself with finding delta modulators which could achieve significant bandwidth reduction without regard to complexity or speed. The first such scheme to be investigated was a real time frame to frame encoding scheme which required the assembly of fourteen, 131,000 bit long shift registers as well as a high speed delta modulator. The other schemes involved two dimensional delta modulator algorithms.
Welsh, Christopher
2016-01-01
As part of a comprehensive plan to attempt to minimize the diversion of prescribed controlled substances, many professional organization and licensing boards are recommending the use of "pill counts." This study sought to evaluate acceptability of the use of cellular phone and computer pictures/video for "pill counts" by patients in buprenorphine maintenance treatment. Patients prescribed buprenorphine/naloxone were asked a series of questions related to the type(s) of electronic communication to which they had access as well as their willingness to use these for the purpose of performing a "pill/film count." Of the 80 patients, 4 (5 percent) did not have a phone at all. Only 28 (35 percent) had a "smart phone" with some sort of data plan and Internet access. Forty (50 percent) of the patients had a phone with no camera and 10 (12.5 percent) had a phone with a camera but no video capability. All patients said that they would be willing to periodically use the video or camera on their phone or computer to have buprenorphine/naloxone pills or film counted as long as the communication was protected from electronic tampering. With the advent of applications for smart phones that allow for Health Insurance Portability and Accountability Act of 1996-compliant picture/video communication, a number of things can now be done that can enhance patient care as well as reduce the chances of misuse/diversion of prescribed medications. This could be used in settings where a larger proportion of controlled substances are prescribed including medication assisted therapy for opioid use disorders and pain management programs.
Lifetime fluorescence spectroscopy for in situ investigation of osteogenic differentiation
NASA Astrophysics Data System (ADS)
Marcu, Laura; Elbarbary, Amir; Zuk, Patricia; De Ugarte, Daniel A.; Benhaim, Prosper; Kurt, Hamza; Hedrick, Marc H.; Ashjian, Peter
2003-07-01
Time-Resolved Laser-Induced Fluorescence Spectroscopy (TR-LIFS) represents a potential tool for the in-situ characterization of bioengineered tissues. In this study, we evaluate the application of TR-LIFS to non-intrusive monitoring of matrix composition during osteogenetic differentiation. Human adipose-derived stem cells, harvested from 3 patients, were induced in osteogenic media for 3, 5, and 7 weeks. Samples were subsequently collected and probed for time-resolved fluorescence emission with a pulsed nitrogen laser. Fluorescence parameters, derived from both spectral- and time-domain, were used for sample characterization. The samples were further analyzed using Western blot analysis and computer-based densitometry. A significant change in the fluorescence parameters was detected for samples beyond 3 weeks of osteogenic differentiation. The spectroscopic observations: 1) show increase of collagen I when contrasted against the time-resolved fluorescence spectra of commercially available collagens; and 2) are in agreement with Western blot analysis that demonstrated significant increase in collagen I content between 3- vs. 5-weeks and 3- vs. 7-weeks and no changes for collagens III, IV, and V. Our results suggest that TR-LIFS can be used as a non-invasive means for the detection of specific collagens in maturing connective tissues.
Delesma, Francisco A; Van den Bossche, Maxime; Grönbeck, Henrik; Calaminici, Patrizia; Köster, Andreas M; Pettersson, Lars G M
2018-01-19
In this paper we remind the reader of a simple, intuitive picture of chemical shifts in X-ray photoelectron spectroscopy (XPS) as the difference in chemical bonding between the probed atom and its neighbor to the right in the periodic table, the so called Z+1 approximation. We use the classical ESCA molecule, ethyl trifluoroacetate, and 4d-transition metals to explicitly demonstrate agreement between core-level shifts computed as differences between final core-hole states and the approach where each core-ionized atom is replaced by a Z+1 atom. In this final state, or total energy picture, the XPS shift arises due to the more or less unfavorable chemical bonding of the effective nitrogen in the carbon geometry for the ESCA molecule. Surface core level shifts in metals are determined by whether the Z+1 atom as an alloy segregates to the surface or is more soluble in the bulk. As further illustration of this more chemical picture, we compare the geometry of C 1s and O 1s core-ionized CO with that of, respectively, NO + and CF + . The scope is not to propose a new method to compute XPS shifts but rather to stress the validity of this simple interpretation. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Requirements for benchmarking personal image retrieval systems
NASA Astrophysics Data System (ADS)
Bouguet, Jean-Yves; Dulong, Carole; Kozintsev, Igor; Wu, Yi
2006-01-01
It is now common to have accumulated tens of thousands of personal ictures. Efficient access to that many pictures can only be done with a robust image retrieval system. This application is of high interest to Intel processor architects. It is highly compute intensive, and could motivate end users to upgrade their personal computers to the next generations of processors. A key question is how to assess the robustness of a personal image retrieval system. Personal image databases are very different from digital libraries that have been used by many Content Based Image Retrieval Systems.1 For example a personal image database has a lot of pictures of people, but a small set of different people typically family, relatives, and friends. Pictures are taken in a limited set of places like home, work, school, and vacation destination. The most frequent queries are searched for people, and for places. These attributes, and many others affect how a personal image retrieval system should be benchmarked, and benchmarks need to be different from existing ones based on art images, or medical images for examples. The attributes of the data set do not change the list of components needed for the benchmarking of such systems as specified in2: - data sets - query tasks - ground truth - evaluation measures - benchmarking events. This paper proposed a way to build these components to be representative of personal image databases, and of the corresponding usage models.
Phenomenological picture of fluctuations in branching random walks
NASA Astrophysics Data System (ADS)
Mueller, A. H.; Munier, S.
2014-10-01
We propose a picture of the fluctuations in branching random walks, which leads to predictions for the distribution of a random variable that characterizes the position of the bulk of the particles. We also interpret the 1 /√{t } correction to the average position of the rightmost particle of a branching random walk for large times t ≫1 , computed by Ebert and Van Saarloos, as fluctuations on top of the mean-field approximation of this process with a Brunet-Derrida cutoff at the tip that simulates discreteness. Our analytical formulas successfully compare to numerical simulations of a particular model of a branching random walk.
NASA Technical Reports Server (NTRS)
Kriegler, F. J.; Gordon, M. F.; Mclaughlin, R. H.; Marshall, R. E.
1975-01-01
The MIDAS (Multivariate Interactive Digital Analysis System) processor is a high-speed processor designed to process multispectral scanner data (from Landsat, EOS, aircraft, etc.) quickly and cost-effectively to meet the requirements of users of remote sensor data, especially from very large areas. MIDAS consists of a fast multipipeline preprocessor and classifier, an interactive color display and color printer, and a medium scale computer system for analysis and control. The system is designed to process data having as many as 16 spectral bands per picture element at rates of 200,000 picture elements per second into as many as 17 classes using a maximum likelihood decision rule.
Multi-Head Very High Power Strobe System For Motion Picture Special Effects
NASA Astrophysics Data System (ADS)
Lovoi, P. A.; Fink, Michael L.
1983-10-01
A very large camera synchronizable strobe system has been developed for motion picture special effects. This system, the largest ever built, was delivered to MGM/UA to be used in the movie "War Games". The system consists of 12 individual strobe heads and a power supply distribution system. Each strobe head operates independently and may be flashed up to 24 times per second under computer control. An energy of 480 Joules per flash is used in six strobe heads and 240 Joules per flash in the remaining six strobe heads. The beam pattern is rectangular with a FWHM of 60° x 48°.
Social Mathematics and Media: Using Pictures, Maps, Charts, and Graphs. Media Corner.
ERIC Educational Resources Information Center
Braun, Joseph A., Jr., Ed.
1993-01-01
Asserts that integrating disciplines is a goal of elementary social studies education. Presents a bibliographic essay describing instructional materials that can be used to integrate mathematics and social studies. Includes recommended photograph packages, computer databases, and data interpretation packages. (CFR)
Quantum Molecular Dynamics Simulations of Nanotube Tip Assisted Reactions
NASA Technical Reports Server (NTRS)
Menon, Madhu
1998-01-01
In this report we detail the development and application of an efficient quantum molecular dynamics computational algorithm and its application to the nanotube-tip assisted reactions on silicon and diamond surfaces. The calculations shed interesting insights into the microscopic picture of tip surface interactions.
Picture archiving and communication system--Part one: Filmless radiology and distance radiology.
De Backer, A I; Mortelé, K J; De Keulenaer, B L
2004-01-01
Picture archiving and communication system (PACS) is a collection of technologies used to carry out digital medical imaging. PACS is used to digitally acquire medical images from the various modalities, such as computed tomography (CT), magnetic resonance imaging (MRI), ultrasound, and digital projection radiography. The image data and pertinent information are transmitted to other and possibly remote locations over networks, where they may be displayed on computer workstations for soft copy viewing in multiple locations, thus permitting simultaneous consultations and almost instant reporting from radiologists at a distance. Data are secured and archived on digital media such as optical disks or tape, and may be automatically retrieved as necessary. Close integration with the hospital information system (HIS)--radiology information system (RIS) is critical for system functionality. Medical image management systems are maturing, providing access outside of the radiology department to images throughout the hospital via the Ethernet, at different hospitals, or from a home workstation if teleradiology has been implemented.
How does visual thinking work in the mind of a person with autism? A personal account.
Grandin, Temple
2009-05-27
My mind is similar to an Internet search engine that searches for photographs. I use language to narrate the photo-realistic pictures that pop up in my imagination. When I design equipment for the cattle industry, I can test run it in my imagination similar to a virtual reality computer program. All my thinking is associative and not linear. To form concepts, I sort pictures into categories similar to computer files. To form the concept of orange, I see many different orange objects, such as oranges, pumpkins, orange juice and marmalade. I have observed that there are three different specialized autistic/Asperger cognitive types. They are: (i) visual thinkers such as I who are often poor at algebra, (ii) pattern thinkers such as Daniel Tammet who excel in math and music but may have problems with reading or writing composition, and (iii) verbal specialists who are good at talking and writing but they lack visual skills.
The 1982 control network of Mars
NASA Technical Reports Server (NTRS)
Davies, M. E.; Katayama, F. Y.
1983-01-01
Attention is given to a planet-wide control network of Mars that was computed in September 1982 using a large single-block analytical triangulation with 47,524 measurements of 6853 control points on 1054 Mariner 9 and 757 Viking pictures. In all, 19,139 normal equations were solved, with a resulting standard error of measurement of 18.06 microns. The control points identified by name and letter designation are given, as are the aerographic coordinates of the control points. In addition, the coordinates of the Viking I lander site are given: latitude, 22.480 deg; longitude, 47.962 deg (radius, 3389.32 km). This study expands and updates the previously published network (1978). It is noted that the computation differs in many respects from standard aerial mapping photogrammetric practice. In comparison with aerial mapping photography, the television formats are small and the focal lengths are long; stereo coverage is rare, the scale of the pictures varies greatly, and the residual camera distortions are large.
Charting the Replica Symmetric Phase
NASA Astrophysics Data System (ADS)
Coja-Oghlan, Amin; Efthymiou, Charilaos; Jaafari, Nor; Kang, Mihyun; Kapetanopoulos, Tobias
2018-02-01
Diluted mean-field models are spin systems whose geometry of interactions is induced by a sparse random graph or hypergraph. Such models play an eminent role in the statistical mechanics of disordered systems as well as in combinatorics and computer science. In a path-breaking paper based on the non-rigorous `cavity method', physicists predicted not only the existence of a replica symmetry breaking phase transition in such models but also sketched a detailed picture of the evolution of the Gibbs measure within the replica symmetric phase and its impact on important problems in combinatorics, computer science and physics (Krzakala et al. in Proc Natl Acad Sci 104:10318-10323, 2007). In this paper we rigorise this picture completely for a broad class of models, encompassing the Potts antiferromagnet on the random graph, the k-XORSAT model and the diluted k-spin model for even k. We also prove a conjecture about the detection problem in the stochastic block model that has received considerable attention (Decelle et al. in Phys Rev E 84:066106, 2011).
The implications of free 3D scanning in the conservation state assessment of old wood painted icon
NASA Astrophysics Data System (ADS)
Munteanu, Marius; Sandu, Ion
2016-06-01
The present paper presents the conservation state and the making of a 3D model of a XVIII-th century orthodox icon on wood support, using free available software and cloud computing. In order to create the 3D model of the painting layer of the icon a number of 70 pictures were taken using a Nikon DSLR D3300, 24.2 MP in setup with a Hama Star 75 photo tripod, in loops 360° around the painting, at three different angles. The pictures were processed with Autodesk I23D Catch, which automatically finds and matches common features among all of the uploaded photographs in order to create the 3D scene, using the power and speed of cloud computing. The obtained 3D model was afterwards analyzed and processed in order to obtain a final version, which can now be use to better identify, to map and to prioritize the future conservation processes and finally can be shared online as an animation.
How does visual thinking work in the mind of a person with autism? A personal account
Grandin, Temple
2009-01-01
My mind is similar to an Internet search engine that searches for photographs. I use language to narrate the photo-realistic pictures that pop up in my imagination. When I design equipment for the cattle industry, I can test run it in my imagination similar to a virtual reality computer program. All my thinking is associative and not linear. To form concepts, I sort pictures into categories similar to computer files. To form the concept of orange, I see many different orange objects, such as oranges, pumpkins, orange juice and marmalade. I have observed that there are three different specialized autistic/Asperger cognitive types. They are: (i) visual thinkers such as I who are often poor at algebra, (ii) pattern thinkers such as Daniel Tammet who excel in math and music but may have problems with reading or writing composition, and (iii) verbal specialists who are good at talking and writing but they lack visual skills. PMID:19528028
BMDO Technology Applications in Biomedicine
1996-01-01
capacitance and low- noise detectors. NOVA’s systems could also be used for bone densitometry and panoramic dental X-rays. Potential Use to Medicine Dr...receiver coils, increasing signal-to- noise ratio by a factor of two in some cases. This change is especially important in low-strength MRI fields...ongoing in this area. Receivers for this technology must be even more sensitive than for conventional MRI, because the " noise " level in these tissue
Hernández-Domínguez, Laura; Ratté, Sylvie; Sierra-Martínez, Gerardo; Roche-Bergua, Andrés
2018-01-01
We present a methodology to automatically evaluate the performance of patients during picture description tasks. Transcriptions and audio recordings of the Cookie Theft picture description task were used. With 25 healthy elderly control (HC) samples and an information coverage measure, we automatically generated a population-specific referent. We then assessed 517 transcriptions (257 Alzheimer's disease [AD], 217 HC, and 43 mild cognitively impaired samples) according to their informativeness and pertinence against this referent. We extracted linguistic and phonetic metrics which previous literature correlated to early-stage AD. We trained two learners to distinguish HCs from cognitively impaired individuals. Our measures significantly ( P < .001) correlated with the severity of the cognitive impairment and the Mini-Mental State Examination score. The classification sensitivity was 81% (area under the curve of receiver operating characteristics = 0.79) and 85% (area under the curve of receiver operating characteristics = 0.76) between HCs and AD and between HCs and AD and mild cognitively impaired, respectively. An automated assessment of a picture description task could assist clinicians in the detection of early signs of cognitive impairment and AD.
Managing an archive of weather satellite images
NASA Technical Reports Server (NTRS)
Seaman, R. L.
1992-01-01
The author's experiences of building and maintaining an archive of hourly weather satellite pictures at NOAO are described. This archive has proven very popular with visiting and staff astronomers - especially on windy days and cloudy nights. Given access to a source of such pictures, a suite of simple shell and IRAF CL scripts can provide a great deal of robust functionality with little effort. These pictures and associated data products such as surface analysis (radar) maps and National Weather Service forecasts are updated hourly at anonymous ftp sites on the Internet, although your local Atsmospheric Sciences Department may prove to be a more reliable source. The raw image formats are unfamiliar to most astronomers, but reading them into IRAF is straightforward. Techniques for performing this format conversion at the host computer level are described which may prove useful for other chores. Pointers are given to sources of data and of software, including a package of example tools. These tools include shell and Perl scripts for downloading pictures, maps, and forecasts, as well as IRAF scripts and host level programs for translating the images into IRAF and GIF formats and for slicing & dicing the resulting images. Hints for displaying the images and for making hardcopies are given.
Historical perspective on computer development and glossary of terms.
Honeyman, J C; Dwyer, S J
1993-01-01
This article contains a concise history of the development of mechanical and electronic computers, descriptions of the milestones in software development, discussion of the introduction and adoption of computers in radiology, and a glossary of computer terms used frequently in radiology. One of the earliest devices designed to mechanize calculations was the calculating clock, built in 1623. The first programmable electronic computer, the ENIAC (electronic numerical integration and computer), was completed in 1945 at the University of Pennsylvania. Software has developed from early machine language through fourth-generation languages and graphic user interfaces used today. The computer was introduced to radiology initially in the 1960s in nuclear medicine and is now incorporated in many digital imaging modalities throughout radiology. The development of picture archiving and communication systems has resulted in the implementation of several totally digital departments of radiology.
The Exponential Expansion of Simulation: How Simulation has Grown as a Research Tool
2012-09-01
exponential growth of computing power. Although other analytic approaches also benefit from this trend, keyword searches of several scholarly search ... engines reveal that the reliance on simulation is increasing more rapidly. A descriptive analysis paints a compelling picture: simulation is frequently
1988-04-01
e.g., definitions, references, pictures) on the selected item in a separate window. For example, in a hyper- text document on astronomy , the reader...might arrive at the highlighted word " Copernicus ", select the word with the keyboard or mouse, and then be offered a number of related topics from
ERIC Educational Resources Information Center
Bracey, Gerald W.
2004-01-01
Correspondence schools, motion pictures, radio, educational television, and computer-assisted instruction have all been hailed as technological innovations that would revolutionize education, reducing, if not eliminating entirely, education's dependence on traditional schools and their teachers. The latest innovation is "virtual…
Principles of Managing Audiovisual Materials and Equipment. Second Revised Edition.
ERIC Educational Resources Information Center
California Univ., Los Angeles. Biomedical Library.
This manual offers information on a wide variety of health-related audiovisual materials (AVs) in many formats: video, motion picture, slide, filmstrip, audiocassette, transparencies, microfilm, and computer assisted instruction. Intended for individuals who are just learning about audiovisual materials and equipment management, the manual covers…
[A computer-aided image diagnosis and study system].
Li, Zhangyong; Xie, Zhengxiang
2004-08-01
The revolution in information processing, particularly the digitizing of medicine, has changed the medical study, work and management. This paper reports a method to design a system for computer-aided image diagnosis and study. Combined with some good idea of graph-text system and picture archives communicate system (PACS), the system was realized and used for "prescription through computer", "managing images" and "reading images under computer and helping the diagnosis". Also typical examples were constructed in a database and used to teach the beginners. The system was developed by the visual developing tools based on object oriented programming (OOP) and was carried into operation on the Windows 9X platform. The system possesses friendly man-machine interface.
Determination of Small Animal Long Bone Properties Using Densitometry
NASA Technical Reports Server (NTRS)
Breit, Gregory A.; Goldberg, BethAnn K.; Whalen, Robert T.; Hargens, Alan R. (Technical Monitor)
1996-01-01
Assessment of bone structural property changes due to loading regimens or pharmacological treatment typically requires destructive mechanical testing and sectioning. Our group has accurately and non-destructively estimated three dimensional cross-sectional areal properties (principal moments of inertia, Imax and Imin, and principal angle, Theta) of human cadaver long bones from pixel-by-pixel analysis of three non-coplanar densitometry scans. Because the scanner beam width is on the order of typical small animal diapbyseal diameters, applying this technique to high-resolution scans of rat long bones necessitates additional processing to minimize errors induced by beam smearing, such as dependence on sample orientation and overestimation of Imax and Imin. We hypothesized that these errors are correctable by digital image processing of the raw scan data. In all cases, four scans, using only the low energy data (Hologic QDR-1000W, small animal mode), are averaged to increase image signal-to-noise ratio. Raw scans are additionally processed by interpolation, deconvolution by a filter derived from scanner beam characteristics, and masking using a variable threshold based on image dynamic range. To assess accuracy, we scanned an aluminum step phantom at 12 orientations over a range of 180 deg about the longitudinal axis, in 15 deg increments. The phantom dimensions (2.5, 3.1, 3.8 mm x 4.4 mm; Imin/Imax: 0.33-0.74) were comparable to the dimensions of a rat femur which was also scanned. Cross-sectional properties were determined at 0.25 mm increments along the length of the phantom and femur. The table shows average error (+/- SD) from theory of Imax, Imin, and Theta) over the 12 orientations, calculated from raw and fully processed phantom images, as well as standard deviations about the mean for the femur scans. Processing of phantom scans increased agreement with theory, indicating improved accuracy. Smaller standard deviations with processing indicate increased precision and repeatability. Standard deviations for the femur are consistent with those of the phantom. We conclude that in conjunction with digital image enhancement, densitometry scans are suitable for non-destructive determination of areal properties of small animal bones of comparable size to our phantom, allowing prediction of Imax and Imin within 2.5% and Theta within a fraction of a degree. This method represents a considerable extension of current methods of analyzing bone tissue distribution in small animal bones.
Leib, Edward S; Saag, Kenneth G; Adachi, Jonathan D; Geusens, Piet P; Binkley, Neil; McCloskey, Eugene V; Hans, Didier B
2011-01-01
Given the significant impact the use of glucocorticoids can have on fracture risk independent of bone density, their use has been incorporated as one of the clinical risk factors for calculating the 10-year fracture risk in the World Health Organization's Fracture Risk Assessment Tool (FRAX(®)). Like the other clinical risk factors, the use of glucocorticoids is included as a dichotomous variable with use of steroids defined as past or present exposure of 3 months or more of use of a daily dose of 5 mg or more of prednisolone or equivalent. The purpose of this report is to give clinicians guidance on adjustments which should be made to the 10-year risk based on the dose, duration of use and mode of delivery of glucocorticoids preparations. A subcommittee of the International Society for Clinical Densitometry and International Osteoporosis Foundation joint Position Development Conference presented its findings to an expert panel and the following recommendations were selected. 1) There is a dose relationship between glucocorticoid use of greater than 3 months and fracture risk. The average dose exposure captured within FRAX(®) is likely to be a prednisone dose of 2.5-7.5 mg/day or its equivalent. Fracture probability is under-estimated when prednisone dose is greater than 7.5 mg/day and is over-estimated when the prednisone dose is less than 2.5 mg/day. 2) Frequent intermittent use of higher doses of glucocorticoids increases fracture risk. Because of the variability in dose and dosing schedule, quantification of this risk is not possible. 3) High dose inhaled glucocorticoids may be a risk factor for fracture. FRAX(®) may underestimate fracture probability in users of high dose inhaled glucocorticoids. 4) Appropriate glucocorticoid replacement in individuals with adrenal insufficiency has not been found to increase fracture risk. In such patients, use of glucocorticoids should not be included in FRAX(®) calculations. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
McNamara, Elizabeth A; Kilim, Holly P; Malabanan, Alan O; Whittaker, LaTarsha G; Rosen, Harold N
The International Society for Clinical Densitometry guidelines recommend using locally derived precision data for spine bone mineral densities (BMDs), but do not specify whether data derived from L1-L4 spines correctly reflect the precision for spines reporting fewer than 4 vertebrae. Our experience suggested that the decrease in precision with successively fewer vertebrae is progressive as more vertebrae are excluded and that the precision for the newer Horizon Hologic model might be better than that for the previous model, and we sought to quantify. Precision studies were performed on Hologic densitometers by acquiring spine BMD in fast array mode twice on 30 patients, according to International Society for Clinical Densitometry guidelines. This was done 10 different times on various Discovery densitometers, and once on a Horizon densitometer. When 1 vertebral body was excluded from analysis, there was no significant deterioration in precision. When 2 vertebrae were excluded, there was a nonsignificant trend to poorer precision, and when 3 vertebrae were excluded, there was significantly worse precision. When 3 or 4 vertebrae were reported, the precision of the spine BMD measurement was significantly better on the Hologic Horizon than on the Discovery, but the difference in precision between densitometers narrowed and was no longer significant when 1 or 2 vertebrae were reported. The results suggest that (1) the measurement of in vivo spine BMD on the new Hologic Horizon densitometer is significantly more precise than on the older Discovery model; (2) the difference in precision between the Horizon and Discovery models decreases as fewer vertebrae are included; (3) the measurement of spine BMD is less precise as more vertebrae are excluded, but still quite reasonable even when only 1 vertebral body is included; and (4) when 3 vertebrae are reported, L1-L4 precision data can reasonably be used to report significance of changes in BMD. When 1 or 2 vertebrae are reported, precision data for 1 or 2 vertebrae, respectively, should be used, because the exclusion of 2-3 vertebrae significantly worsens precision. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Photogrammetry of the Viking-Lander imagery.
Wu, S.S.C.; Schafer, F.J.
1982-01-01
We have solved the problem of photogrammetric mapping from the Viking Lander photography in two ways: 1) by converting the azimuth and elevation scanning imagery to the equivalent of a frame picture by means of computerized rectification; and 2) by interfacing a high-speed, general-purpose computer to the AS-11A analytical plotter so that all computations of corrections can be performed in real time during the process of model orientation and map compilation. Examples are presented of photographs and maps of Earth and Mars. -from Authors
Jeromin, Franziska; Nyenhuis, Nele; Barke, Antonia
2016-03-01
Background and aims Internet Gaming Disorder is included in the Diagnostic and statistical manual of mental disorders (5 th edition) as a disorder that merits further research. The diagnostic criteria are based on those for Substance Use Disorder and Gambling Disorder. Excessive gamblers and persons with Substance Use Disorder show attentional biases towards stimuli related to their addictions. We investigated whether excessive Internet gamers show a similar attentional bias, by using two established experimental paradigms. Methods We measured reaction times of excessive Internet gamers and non-gamers (N = 51, 23.7 ± 2.7 years) by using an addiction Stroop with computer-related and neutral words, as well as a visual probe with computer-related and neutral pictures. Mixed design analyses of variance with the between-subjects factor group (gamer/non-gamer) and the within-subjects factor stimulus type (computer-related/neutral) were calculated for the reaction times as well as for valence and familiarity ratings of the stimulus material. Results In the addiction Stroop, an interaction for group × word type was found: Only gamers showed longer reaction times to computer-related words compared to neutral words, thus exhibiting an attentional bias. In the visual probe, no differences in reaction time between computer-related and neutral pictures were found in either group, but the gamers were faster overall. Conclusions An attentional bias towards computer-related stimuli was found in excessive Internet gamers, by using an addiction Stroop but not by using a visual probe. A possible explanation for the discrepancy could lie in the fact that the visual probe may have been too easy for the gamers.
Jeromin, Franziska; Nyenhuis, Nele; Barke, Antonia
2016-01-01
Background and aims Internet Gaming Disorder is included in the Diagnostic and statistical manual of mental disorders (5th edition) as a disorder that merits further research. The diagnostic criteria are based on those for Substance Use Disorder and Gambling Disorder. Excessive gamblers and persons with Substance Use Disorder show attentional biases towards stimuli related to their addictions. We investigated whether excessive Internet gamers show a similar attentional bias, by using two established experimental paradigms. Methods We measured reaction times of excessive Internet gamers and non-gamers (N = 51, 23.7 ± 2.7 years) by using an addiction Stroop with computer-related and neutral words, as well as a visual probe with computer-related and neutral pictures. Mixed design analyses of variance with the between-subjects factor group (gamer/non-gamer) and the within-subjects factor stimulus type (computer-related/neutral) were calculated for the reaction times as well as for valence and familiarity ratings of the stimulus material. Results In the addiction Stroop, an interaction for group × word type was found: Only gamers showed longer reaction times to computer-related words compared to neutral words, thus exhibiting an attentional bias. In the visual probe, no differences in reaction time between computer-related and neutral pictures were found in either group, but the gamers were faster overall. Conclusions An attentional bias towards computer-related stimuli was found in excessive Internet gamers, by using an addiction Stroop but not by using a visual probe. A possible explanation for the discrepancy could lie in the fact that the visual probe may have been too easy for the gamers. PMID:28092198
Quantum Dynamics and a Semiclassical Description of the Photon.
ERIC Educational Resources Information Center
Henderson, Giles
1980-01-01
Uses computer graphics and nonstationary, superposition wave functions to reveal the dynamic quantum trajectories of several molecular and electronic transitions. These methods are then coupled with classical electromagnetic theory to provide a conceptually clear picture of the emission process and emitted radiation localized in time and space.…
2014-04-23
ISS039-E-014846 (22 April 2014) --- NASA astronaut Steve Swanson is pictured during a spacewalk to replace a failed backup computer relay box in the S0 truss of the International Space Station on April 22, 2014. He was accompanied on the spacewalk by fellow Flight Engineer Rick Mastracchio of NASA.
Where Are the Quadratic's Complex Roots?
ERIC Educational Resources Information Center
Páll-Szabó, Ágnes Orsolya
2015-01-01
A picture is worth more than a thousand words--in mathematics too. Many students fail in learning mathematics because, in some cases, teachers do not offer the necessary visualization. Nowadays technology overcomes this problem: computer aided instruction is one of the most efficients methods in teaching mathematics. In this article we try to…
VAMP: A computer program for calculating volume, area, and mass properties of aerospace vehicles
NASA Technical Reports Server (NTRS)
Norton, P. J.; Glatt, C. R.
1974-01-01
A computerized procedure developed for analyzing aerospace vehicles evaluates the properties of elemental surface areas with specified thickness by accumulating and combining them with arbitrarily specified mass elements to form a complete evaluation. Picture-like images of the geometric description are capable of being generated.
21st century environmental problems are wicked and require holistic systems thinking and solutions that integrate social and economic knowledge with knowledge of the environment. Computer-based technologies are fundamental to our ability to research and understand the relevant sy...
Computational Prosodic Markers for Autism
ERIC Educational Resources Information Center
Van Santen, Jan P.H.; Prud'hommeaux, Emily T.; Black, Lois M.; Mitchell, Margaret
2010-01-01
We present results obtained with new instrumental methods for the acoustic analysis of prosody to evaluate prosody production by children with Autism Spectrum Disorder (ASD) and Typical Development (TD). Two tasks elicit focal stress--one in a vocal imitation paradigm, the other in a picture-description paradigm; a third task also uses a vocal…
Saliency-aware food image segmentation for personal dietary assessment using a wearable computer
USDA-ARS?s Scientific Manuscript database
Image-based dietary assessment has recently received much attention in the community of obesity research. In this assessment, foods in digital pictures are specified, and their portion sizes (volumes) are estimated. Although manual processing is currently the most utilized method, image processing h...
Character Sets for PLATO/NovaNET: An Expository Catalog.
ERIC Educational Resources Information Center
Gilpin, John B.
The PLATO and NovaNET computer-based instructional systems use a fixed system character set ("normal font") and an author-definable character set ("alternate font"). The alternate font lets the author construct his own symbols and bitmapped pictures. This expository catalog allows users to determine quickly (1) whether there is…
ERIC Educational Resources Information Center
Crowther, Jim; Hemmi, Akiko; Martin, Ian; Scandrett, Eurig
2008-01-01
The UK Government's consultation on informal adult learning recognises the importance of self-directed learning, learning in social movements, and learning that involves the use of information and communication technologies (ICTs). There is a much clearer picture of how computers and the Internet are used by people in their everyday lives and for…
ERIC Educational Resources Information Center
Exceptional Parent, 2006
2006-01-01
The National Telerehabilitation Service System (NTSS) was created to provide access to quality rehabilitation services by researching new or existing telecommunications (communicating information, including data, text, pictures, voice, and video, over long distances) and computing technologies and modifying them to meet the needs of people with…
Mineral resource of the month: antimony
,
2008-01-01
The article describes the characteristics and industrial uses of antimony. Antimony, which is produced as a byproduct of mining other metals such as gold, lead or silver, is used in everything from flame retardants, batteries, ceramics and glass. It is also used in glass for television picture tubes, computer monitors, pigments and catalysts.
Toward a Quantification of the Information/Communication Industries. Publication No. 74-2.
ERIC Educational Resources Information Center
Lavey, Warren G.
A national survey was made to collect data about the information/communication industries in the United States today. Eleven industries were studied: television, radio, telephone, telegraph, postal service, newspaper, periodical, book publishing and printing, motion pictures, computer software, and cable television. The data collection scheme used…
21 CFR 1020.33 - Computed tomography (CT) equipment.
Code of Federal Regulations, 2013 CFR
2013-04-01
...-ray system. The phantom shall be a right circular cylinder of polymethl-methacrylate of density 1.19±0... the cross-sectional volume over which x-ray transmission data are collected. (12) Picture element..., respectively. (14) Scan increment means the amount of relative displacement of the patient with respect to the...
21 CFR 1020.33 - Computed tomography (CT) equipment.
Code of Federal Regulations, 2012 CFR
2012-04-01
...-ray system. The phantom shall be a right circular cylinder of polymethl-methacrylate of density 1.19±0... the cross-sectional volume over which x-ray transmission data are collected. (12) Picture element..., respectively. (14) Scan increment means the amount of relative displacement of the patient with respect to the...
21 CFR 1020.33 - Computed tomography (CT) equipment.
Code of Federal Regulations, 2014 CFR
2014-04-01
...-ray system. The phantom shall be a right circular cylinder of polymethl-methacrylate of density 1.19±0... the cross-sectional volume over which x-ray transmission data are collected. (12) Picture element..., respectively. (14) Scan increment means the amount of relative displacement of the patient with respect to the...
ERIC Educational Resources Information Center
Mahon, April
2009-01-01
In this article, the author describes an exciting project, written for first-graders, wherein students got to put themselves into their art using a camera and just one computer. In this project, students were challenged to invent their own fantasy place where anything could happen. Using the camera, the author took their picture in their chosen…
ERIC Educational Resources Information Center
Mayer, Richard E.; Moreno, Roxana
1998-01-01
Multimedia learners (n=146 college students) were able to integrate words and computer-presented pictures more easily when the words were presented aurally rather than visually. This split-attention effect is consistent with a dual-processing model of working memory. (SLD)
Electronic Technologies and Preservation.
ERIC Educational Resources Information Center
Waters, Donald J.
Digital imaging technology, which is used to take a computer picture of documents at the page level, has significant potential as a tool for preserving deteriorating library materials. Multiple reproductions can be made without loss of quality; the end product is compact; reproductions can be made in paper, microfilm, or CD-ROM; and access over…
Introduction to Forensics and the Use of the Helix Free Forensic Tool
2012-01-01
computer system belongs to and his personal activities, interests, and hobbies. An example presented in the paper was that pedophiles might keep...digital records like pictures or video of their delinquent activities. As we mentioned before, we must keep an accurate record of our investigation
ERIC Educational Resources Information Center
Kemp, Andy
2007-01-01
"Geomlab" is a functional programming language used to describe pictures that are made up of tiles. The beauty of "Geomlab" is that it introduces students to recursion, a very powerful mathematical concept, through a very simple and enticing graphical environment. Alongside the software is a series of eight worksheets which lead into producing…
Laser Based Color Film Recorder System With GaAs Microlaser
NASA Astrophysics Data System (ADS)
Difrancesco, David J.
1989-07-01
In 1984 Pixar's research and development group built and applied to the motion-picture arts at Lucasfilm's ILM facility a three color laser based film scanner/recorder system. The digital film printer is capable of reading and writing 35mm film formats on a variety of film stocks. The system has been used in award-winning special-effects work, and has been operated in a normal production environment since that time. The primary objective was to develop a full color high resolution system, free from scan artifacts, enabling traditionally photographed motion-picture film to be inter-cut with digital raster image photography. Its use is applied to the art of blue-screen traveling-matte cinematography for motion pic-ture special effects. The system was designed using the Pixar Image Computer and conventional gas laser technology as the illumination source. This paper will discuss recent experimental work in the application of GaAs microlaser technology to a digital film printing system of the future.
1994-08-25
Department of the Army position, policy or decision unless so designated by other documentation. 94-30800 IIV III !111 IiI I ’ I foron Appr •vedREPORT...copyrighted material is quoted, permission has been obtained to use such material. Where material from documents designated for limited distribution is...Laser Scanning Densitometry for quantitation of the color changes. (6) Narrative: a. Eperimental Methods: 1. Bacteria: Ten bacterial species
Journal of Special Operations Medicine. Volume 10, Edition 4, Fall 2010
2010-01-01
Prior To Ascent? ● Scapula Fracture Secondary to Static Line Injury in a 22 year-old Active Duty Soldier ● Public Health Foodborne Illness Case Study...Scapula Fracture Secondary to Static Line Injury in a 22 year-old Active Duty Soldier LTC K. David Thompson, MPAS, PA-C Public Health Foodborne Illness...consistent measurements were achieved. Predicted lung vol- ume and an appropriate densitometry equation were used to calculate percent body fat (% BF
Bennett, Herbert S; Dienstfrey, Andrew; Hudson, Lawrence T; Oreskovic, Tammy; Fuerst, Thomas; Shepherd, John
2006-01-01
This article reports and discusses the results of the recent ISCD-NIST Workshop on Standards and Measurements for Assessing Bone Health. The purpose of the workshop was to assess the status of efforts to standardize and compare results from dual-energy X-ray absorptiometry (DXA) scans, and then to identify and prioritize ongoing measurement and standards needs.
Van der Vorst, Sébastien; Dekairelle, Anne-France; Irenge, Léonid; Hamoir, Marc; Robert, Annie; Gala, Jean-Luc
2009-01-01
This study compared automated vs. manual tissue grinding in terms of RNA yield obtained from oral mucosa biopsies. A total of 20 patients undergoing uvulectomy for sleep-related disorders and 10 patients undergoing biopsy for head and neck squamous cell carcinoma were enrolled in the study. Samples were collected, snap-frozen in liquid nitrogen, and divided into two parts of similar weight. Sample grinding was performed on one sample from each pair, either manually or using an automated cell disruptor. The performance and efficacy of each homogenization approach was compared in terms of total RNA yield (spectrophotometry, fluorometry), mRNA quantity [densitometry of specific TP53 amplicons and TP53 quantitative reverse-transcribed real-time PCR (qRT-PCR)], and mRNA quality (functional analysis of separated alleles in yeast). Although spectrophotometry and fluorometry results were comparable for both homogenization methods, TP53 expression values obtained by amplicon densitometry and qRT-PCR were significantly and consistently better after automated homogenization (p<0.005) for both uvula and tumor samples. Functional analysis of separated alleles in yeast results was better with the automated technique for tumor samples. Automated tissue homogenization appears to be a versatile, quick, and reliable method of cell disruption and is especially useful in the case of small malignant samples, which show unreliable results when processed by manual homogenization.
2004-01-01
The International Society for Clinical Densitometry (ISCD) held a Position Development Conference in July 2003, at which time positions developed and researched by the organization's Scientific Advisory Committee were presented to a panel of international experts in the field of bone density testing. This panel reached agreement on a series of positions that were subsequently approved by the Board of Directors of the ISCD and are now official policy of the ISCD. These positions, which are outlined in this article and discussed in greater detail in subsequent articles in this journal, include (1) affirmation of the use of the World Health Organization classification for the diagnosis of osteoporosis in postmenopausal women; (2) the diagnosis of osteoporosis in men; (3) the diagnosis of osteoporosis in premenopausal women; (4) the diagnosis of osteoporosis in children; (5) technical standards for skeletal regions of interest by dual-energy X-ray absorptiometry (DXA); (6) the use of new technologies, such as vertebral fracture assessment; (7) technical standards for quality assurance, including phantom scanning and calibration; (8) technical standards for the performance of precision assessment at bone density testing centers, and for cross-calibration of DXA devices; (9) indications for bone density testing; (10) appropriate information for a bone density report; and (11) nomenclature and decimal places for bone density reporting.
Silverman, Stuart L; Cummings, Steven R; Watts, Nelson B
2008-01-01
A panel of experts representing ASBMR, NOF, and ISCD reviewed evidence and reached consensus that regulatory approval of treatments for osteoporosis should be based on trials with fracture endpoints, lasting 18-24 mo, and extending treatment to 5 yr; other indications could be approved based on BMD and turnover markers. In response to an FDA request for clinical trial guidance in osteoporosis, an expert panel was convened with representatives from the American Society of Bone and Mineral Research, the International Society of Clinical Densitometry, and the National Osteoporosis Foundation. The panel used a validated evidence-based expert panel process (the Rand Appropriateness Method) to address issues of trial duration, trial design, use of intermediate endpoints as outcomes, and use of placebo-controlled trials in high-risk patients. The panel concluded that placebo-controlled trials with fracture endpoints are appropriate and, with informed consent, are ethical for registration of new compounds. Trials may be 18-24 mo in duration for efficacy, assuming longer duration to 5 yr for safety and demonstration of sustained fracture reduction. Once fracture efficacy has been established for a particular agent, intermediate endpoints (e.g., BMD and bone turnover markers) may be used as outcomes for new indications other than corticosteroid-induced osteoporosis.
Cross-sectional structural parameters from densitometry
NASA Technical Reports Server (NTRS)
Cleek, Tammy M.; Whalen, Robert T.
2002-01-01
Bone densitometry has previously been used to obtain cross-sectional properties of bone from a single X-ray projection across the bone width. Using three unique projections, we have extended the method to obtain the principal area moments of inertia and orientations of the principal axes at each scan cross-section along the length of the scan. Various aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of cross-sectional properties. Factors considered included X-ray photon energy, initial scan orientation, the angle spanned by the three scans (included angle), and I(min)/I(max) ratios. Principal moments of inertia were accurate to within +/-3.1% and principal angles were within +/-1 degrees of the expected value for phantoms scanned with included angles of 60 degrees and 90 degrees at the higher X-ray photon energy (140 kVp). Low standard deviations in the error (0.68-1.84%) also indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 degrees. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (I(min)/I(max)) values when various included angles are used make this technique viable for future in vivo studies.
"Hidden Figures" Panel Discussion
2016-12-12
In the Press Site auditorium at the Kennedy Space Center in Florida, Ted Melfi, writer and director of the upcoming motion picture “Hidden Figures,” speaks to members of the media during a news conference with other key individuals involved in the upcoming motion picture. The movie is based on the book of the same title, by Margot Lee Shetterly. It chronicles the lives of Katherine Johnson, Dorothy Vaughan and Mary Jackson, three African-American women who worked for NASA as human "computers.” Their mathematical calculations were crucial to the success of Project Mercury missions including John Glenn’s orbital flight aboard Friendship 7 in 1962. The film is due in theaters in January 2017.
[Computer tomography in the diagnosis of persistent hyperplastic primary vitreous body].
Prokes, B; Rehůrek, J
1989-10-01
The authors described and evaluated clinical and CT pictures of five children with persistence of hyperplastic primary vitreous body originating due to regression of embryonal hyaloid vascular system. It becomes clinically manifest especially in leucocoria, reduced globe of the eye, prolonged ciliary processi and the formation of fibrovascular changes behind the lens. CT picture is characterized by a) increased density of vitreous body, b) dense stripes going in retrolental direction and in the course of the Cloquet canal, c) microphthalmus, d) absence of calcifications and e) facultative changes on the lens and anterior chamber. These signs represent an important criterium for differentiating persistence of hyperplastic primary vitreous body from retinoblastoma.
Khanna, Dinesh; Kaplan, Robert M.; Eckman, Mark H.; Hays, Ron D.; Leonard, Anthony C.; Ginsburg, Shaari S.; Tsevat, Joel
2009-01-01
Objective Assigning utilities to hypothetical health states requires that the health states be described in adequate detail, but there is no agreement on exactly how health states should be described. We assessed utilities from the general public for health states common in scleroderma (SSc) by describing the health states in writing alone vs. with photographs of patients with SSc. Methods Subjects rated several SSc health states on a 0-100 rating scale (RS) and completed computer-assisted time tradeoff (TTO, range: 0.0-1.0) and standard gamble (SG, range: 0.0-1.0) utility assessments. Half of the subjects were assigned to be shown photographs of patients with SSc health states in addition to written health state descriptions whereas the other half were given only the written descriptions. Results Of the 213 subjects, 133 (62%) were female, 138 (65%) were Caucasian, and 62 (29%) were African-Americans. Median RS, TTO, and SG scores for the 5 SSc health states ranged from 20-70; 0.28-0.94; and 0.50-0.90, respectively. In bivariate analyses, showing pictures was associated with lower RS scores for 2 of 5 health states and lower SG values for all 5 health states (P<0.05 for comparison of pictures vs. no pictures), but with no difference in TTO values. Multivariable analyses revealed negative associations between pictures and SG valuations for the 3 most severe SSc health states (R2 range: 0.04-0.08). Conclusion Adding pictures of people with SSc to written health state descriptions can affect valuations of SSc health states, although the effect differs by valuation measurement method and by health state severity. PMID:19015284
Hartfield, Kia N; Conture, Edward G
2006-01-01
The purpose of this study was to investigate the influence of conceptual and perceptual properties of words on the speed and accuracy of lexical retrieval of children who do (CWS) and do not stutter (CWNS) during a picture-naming task. Participants consisted of 13 3-5-year-old CWS and the same number of CWNS. All participants had speech, language, and hearing development within normal limits, with the exception of stuttering for CWS. Both talker groups participated in a picture-naming task where they named, one at a time, computer-presented, black-on-white drawings of common age-appropriate objects. These pictures were named during four auditory priming conditions: (a) a neutral prime consisting of a tone, (b) a word prime physically related to the target word, (c) a word prime functionally related to the target word, and (d) a word prime categorically related to the target word. Speech reaction time (SRT) was measured from the offset of presentation of the picture target to the onset of participant's verbal speech response. Results indicated that CWS were slower than CWNS across priming conditions (i.e., neutral, physical, function, category) and that the speed of lexical retrieval of CWS was more influenced by functional than perceptual aspects of target pictures named. Findings were taken to suggest that CWS tend to organize lexical information functionally more so than physically and that this tendency may relate to difficulties establishing normally fluent speech and language. The reader will learn about and be able to (1) communicate the relevance of examining lexical retrieval in relation to childhood stuttering and (2) describe the method of measuring speech reaction times of accurate and fluent responses during a picture-naming task as a means of assessing lexical retrieval skills.
Liu, Yan-Lin; Shih, Cheng-Ting; Chang, Yuan-Jen; Chang, Shu-Jun; Wu, Jay
2014-01-01
The rapid development of picture archiving and communication systems (PACSs) thoroughly changes the way of medical informatics communication and management. However, as the scale of a hospital's operations increases, the large amount of digital images transferred in the network inevitably decreases system efficiency. In this study, a server cluster consisting of two server nodes was constructed. Network load balancing (NLB), distributed file system (DFS), and structured query language (SQL) duplication services were installed. A total of 1 to 16 workstations were used to transfer computed radiography (CR), computed tomography (CT), and magnetic resonance (MR) images simultaneously to simulate the clinical situation. The average transmission rate (ATR) was analyzed between the cluster and noncluster servers. In the download scenario, the ATRs of CR, CT, and MR images increased by 44.3%, 56.6%, and 100.9%, respectively, when using the server cluster, whereas the ATRs increased by 23.0%, 39.2%, and 24.9% in the upload scenario. In the mix scenario, the transmission performance increased by 45.2% when using eight computer units. The fault tolerance mechanisms of the server cluster maintained the system availability and image integrity. The server cluster can improve the transmission efficiency while maintaining high reliability and continuous availability in a healthcare environment.
Chang, Shu-Jun; Wu, Jay
2014-01-01
The rapid development of picture archiving and communication systems (PACSs) thoroughly changes the way of medical informatics communication and management. However, as the scale of a hospital's operations increases, the large amount of digital images transferred in the network inevitably decreases system efficiency. In this study, a server cluster consisting of two server nodes was constructed. Network load balancing (NLB), distributed file system (DFS), and structured query language (SQL) duplication services were installed. A total of 1 to 16 workstations were used to transfer computed radiography (CR), computed tomography (CT), and magnetic resonance (MR) images simultaneously to simulate the clinical situation. The average transmission rate (ATR) was analyzed between the cluster and noncluster servers. In the download scenario, the ATRs of CR, CT, and MR images increased by 44.3%, 56.6%, and 100.9%, respectively, when using the server cluster, whereas the ATRs increased by 23.0%, 39.2%, and 24.9% in the upload scenario. In the mix scenario, the transmission performance increased by 45.2% when using eight computer units. The fault tolerance mechanisms of the server cluster maintained the system availability and image integrity. The server cluster can improve the transmission efficiency while maintaining high reliability and continuous availability in a healthcare environment. PMID:24701580
Henri, C J; Cox, R D; Bret, P M
1997-08-01
This article details our experience in developing and operating an ultrasound mini-picture archiving and communication system (PACS). Using software developed in-house, low-end Macintosh computers (Apple Computer Co. Cupertino, CA) equipped with framegrabbers coordinate the entry of patient demographic information, image acquisition, and viewing on each ultrasound scanner. After each exam, the data are transmitted to a central archive server where they can be accessed from anywhere on the network. The archive server also provides web-based access to the data and manages pre-fetch and other requests for data that may no longer be on-line. Archival is fully automatic and is performed on recordable compact disk (CD) without compression. The system has been filmless now for over 18 months. In the meantime, one film processor has been eliminated and the position of one film clerk has been reallocated. Previously, nine ultrasound machines produced approximately 150 sheets of laser film per day (at 14 images per sheet). The same quantity of data are now archived without compression onto a single CD. Start-up costs were recovered within six months, and the project has been extended to include computed tomography (CT) and magnetic resonance imaging (MRI).
Hartfield, Kia N.; Conture, Edward G.
2007-01-01
The purpose of this study was to investigate the influence of conceptual and perceptual properties of words on the speed and accuracy of lexical retrieval of children who do (CWS) and do not stutter (CWNS) during a picture-naming task. Participants consisted of 13 3- to 5-year-old CWS and the same number of CWNS. All participants had speech, language, and hearing development within normal limits, with the exception of stuttering for CWS. Both talker groups participated in a picture-naming task where they named, one at a time, computer-presented, black-on-white drawings of common age-appropriate objects. These pictures were named during four auditory priming conditions: (a) a neutral prime consisting of a tone, (b) a word prime physically related to the target word, (c) a word prime functionally related to the target word, and (d) a word prime categorically related to the target word. Speech reaction time (SRT) was measured from the offset of presentation of the picture target to the onset of participant’s verbal speech response. Results indicated that CWS were slower than CWNS across priming conditions (i.e., neutral, physical, function, category) and that the speed of lexical retrieval of CWS was more influenced by functional than perceptual aspects of target pictures named. Findings were taken to suggest that CWS tend to organize lexical information functionally more so than physically and that this tendency may relate to difficulties establishing normally fluent speech and language. PMID:17010422
Applications in Data-Intensive Computing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shah, Anuj R.; Adkins, Joshua N.; Baxter, Douglas J.
2010-04-01
This book chapter, to be published in Advances in Computers, Volume 78, in 2010 describes applications of data intensive computing (DIC). This is an invited chapter resulting from a previous publication on DIC. This work summarizes efforts coming out of the PNNL's Data Intensive Computing Initiative. Advances in technology have empowered individuals with the ability to generate digital content with mouse clicks and voice commands. Digital pictures, emails, text messages, home videos, audio, and webpages are common examples of digital content that are generated on a regular basis. Data intensive computing facilitates human understanding of complex problems. Data-intensive applications providemore » timely and meaningful analytical results in response to exponentially growing data complexity and associated analysis requirements through the development of new classes of software, algorithms, and hardware.« less
Bieńko, Marek; Radzki, Radosław Piotr; Wolski, Dariusz
2017-09-21
This study evaluates the effects of three different doses of chromium sulphate on bone density and the tomographic parameters of skeletal tissue of rats. The experiment was performed on 40 male Wistar rats which received, by gavage, during 90 days, a chromium sulphate in either a daily dose of 400, 600 or 800 µg/kg BW. At the end of experiment, the rats were scanned using the densitometry method (DXA) to determine the bone mineral density, bone mineral content of total skeleton and vertebral column (L2-L4) and parameters of body composition (Lean Mass and Fat Mass). The isolated femora were scanned using peripheral a quantitative computed tomography method (pQCT) for a separate analysis of the trabecular and cortical bone tissue. The ultimate strength, work to ultimate and the Young modulus of femora was also investigated by the three-point bending test. The negative impact of chromium was observed in relation to bone tissue. All doses significantly decreased total skeleton density and mineral content, and also had impact upon the isolated femora and vertebral column. Trabecular volumetric bone mineral density and trabecular bone mineral content measured by pQCT in distal femur metaphysis were significantly lower in the experimental groups than in the control. Higher doses of chromium also significantly decreased values of ultimate strength and Young modulus in the investigated femora. The results of the experiment demonstrate that chromium sulphate is dose dependent, and exerts a disadvantageous effect on the skeleton, as it decreases bone density and resistance.
Rantalainen, Timo; Chivers, Paola; Beck, Belinda R; Robertson, Sam; Hart, Nicolas H; Nimphius, Sophia; Weeks, Benjamin K; McIntyre, Fleur; Hands, Beth; Siafarikas, Aris
Most imaging methods, including peripheral quantitative computed tomography (pQCT), are susceptible to motion artifacts particularly in fidgety pediatric populations. Methods currently used to address motion artifact include manual screening (visual inspection) and objective assessments of the scans. However, previously reported objective methods either cannot be applied on the reconstructed image or have not been tested for distal bone sites. Therefore, the purpose of the present study was to develop and validate motion artifact classifiers to quantify motion artifact in pQCT scans. Whether textural features could provide adequate motion artifact classification performance in 2 adolescent datasets with pQCT scans from tibial and radial diaphyses and epiphyses was tested. The first dataset was split into training (66% of sample) and validation (33% of sample) datasets. Visual classification was used as the ground truth. Moderate to substantial classification performance (J48 classifier, kappa coefficients from 0.57 to 0.80) was observed in the validation dataset with the novel texture-based classifier. In applying the same classifier to the second cross-sectional dataset, a slight-to-fair (κ = 0.01-0.39) classification performance was observed. Overall, this novel textural analysis-based classifier provided a moderate-to-substantial classification of motion artifact when the classifier was specifically trained for the measurement device and population. Classification based on textural features may be used to prescreen obviously acceptable and unacceptable scans, with a subsequent human-operated visual classification of any remaining scans. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
A brain computer interface-based explorer.
Bai, Lijuan; Yu, Tianyou; Li, Yuanqing
2015-04-15
In recent years, various applications of brain computer interfaces (BCIs) have been studied. In this paper, we present a hybrid BCI combining P300 and motor imagery to operate an explorer. Our system is mainly composed of a BCI mouse, a BCI speller and an explorer. Through this system, the user can access his computer and manipulate (open, close, copy, paste, and delete) files such as documents, pictures, music, movies and so on. The system has been tested with five subjects, and the experimental results show that the explorer can be successfully operated according to subjects' intentions. Copyright © 2014 Elsevier B.V. All rights reserved.
Wendt, Dorothea; Brand, Thomas; Kollmeier, Birger
2014-01-01
An eye-tracking paradigm was developed for use in audiology in order to enable online analysis of the speech comprehension process. This paradigm should be useful in assessing impediments in speech processing. In this paradigm, two scenes, a target picture and a competitor picture, were presented simultaneously with an aurally presented sentence that corresponded to the target picture. At the same time, eye fixations were recorded using an eye-tracking device. The effect of linguistic complexity on language processing time was assessed from eye fixation information by systematically varying linguistic complexity. This was achieved with a sentence corpus containing seven German sentence structures. A novel data analysis method computed the average tendency to fixate the target picture as a function of time during sentence processing. This allowed identification of the point in time at which the participant understood the sentence, referred to as the decision moment. Systematic differences in processing time were observed as a function of linguistic complexity. These differences in processing time may be used to assess the efficiency of cognitive processes involved in resolving linguistic complexity. Thus, the proposed method enables a temporal analysis of the speech comprehension process and has potential applications in speech audiology and psychoacoustics.
Wendt, Dorothea; Brand, Thomas; Kollmeier, Birger
2014-01-01
An eye-tracking paradigm was developed for use in audiology in order to enable online analysis of the speech comprehension process. This paradigm should be useful in assessing impediments in speech processing. In this paradigm, two scenes, a target picture and a competitor picture, were presented simultaneously with an aurally presented sentence that corresponded to the target picture. At the same time, eye fixations were recorded using an eye-tracking device. The effect of linguistic complexity on language processing time was assessed from eye fixation information by systematically varying linguistic complexity. This was achieved with a sentence corpus containing seven German sentence structures. A novel data analysis method computed the average tendency to fixate the target picture as a function of time during sentence processing. This allowed identification of the point in time at which the participant understood the sentence, referred to as the decision moment. Systematic differences in processing time were observed as a function of linguistic complexity. These differences in processing time may be used to assess the efficiency of cognitive processes involved in resolving linguistic complexity. Thus, the proposed method enables a temporal analysis of the speech comprehension process and has potential applications in speech audiology and psychoacoustics. PMID:24950184
Effects of stress on human mating preferences: stressed individuals prefer dissimilar mates
Lass-Hennemann, Johanna; Deuter, Christian E.; Kuehl, Linn K.; Schulz, André; Blumenthal, Terry D.; Schachinger, Hartmut
2010-01-01
Although humans usually prefer mates that resemble themselves, mating preferences can vary with context. Stress has been shown to alter mating preferences in animals, but the effects of stress on human mating preferences are unknown. Here, we investigated whether stress alters men's preference for self-resembling mates. Participants first underwent a cold-pressor test (stress induction) or a control procedure. Then, participants viewed either neutral pictures or pictures of erotic female nudes whose facial characteristics were computer-modified to resemble either the participant or another participant, or were not modified, while startle eyeblink responses were elicited by noise probes. Erotic pictures were rated as being pleasant, and reduced startle magnitude compared with neutral pictures. In the control group, startle magnitude was smaller during foreground presentation of photographs of self-resembling female nudes compared with other-resembling female nudes and non-manipulated female nudes, indicating a higher approach motivation to self-resembling mates. In the stress group, startle magnitude was larger during foreground presentation of self-resembling female nudes compared with other-resembling female nudes and non-manipulated female nudes, indicating a higher approach motivation to dissimilar mates. Our findings show that stress affects human mating preferences: unstressed individuals showed the expected preference for similar mates, but stressed individuals seem to prefer dissimilar mates. PMID:20219732
ERIC Educational Resources Information Center
Mayer, Richard E.; Sims, Valerie K.
1994-01-01
In 2 experiments, 162 high- and low-spatial ability students viewed a computer-generated animation and heard a concurrent or successive explanation. The concurrent group generated more creative solutions to transfer problems and demonstrated a contiguity effect consistent with dual-coding theory. (SLD)
Image Segmentation via Fractal Dimension
1987-12-01
Contipany, 1986. 7. Harrington, Steven. Computer Graphics A Programming Aproach. New York: McGrawU-Hill Book Company, 1987. 8. Norev, Moshe. Picture...ITEX TORHS conversion program . My fazily has been a constant source of relaxation and enoouragement, and I wish to thank them for their understanding...Conclusion 29.... ....................... 9........... . -11 III. Experimental Method 3..-.1..................... .. ....... -1 Overviev
Three Dimensional Illustrating--Three-Dimensional Vision and Deception of Sensibility
ERIC Educational Resources Information Center
Szállassy, Noémi; Gánóczy, Anita; Kriska, György
2009-01-01
The wide-spread digital photography and computer use gave the opportunity for everyone to make three-dimensional pictures and to make them public. The new opportunities with three-dimensional techniques give chance for the birth of new artistic photographs. We present in detail the biological roots of three-dimensional visualization, the phenomena…
Using Computerized Outlines in Teaching American Government.
ERIC Educational Resources Information Center
Janda, Kenneth
Because writing an outline on the chalk board wastes time and space, a computer program, a videoprojector, and a standard motion picture screen were used to outline a lecture to a large history class. PC-Outline is an outline program for IBM-compatible microcomputers which aids in processing outlines by inserting Roman numerals, letters, and…
Mechanical Modeling and Computer Simulation of Protein Folding
ERIC Educational Resources Information Center
Prigozhin, Maxim B.; Scott, Gregory E.; Denos, Sharlene
2014-01-01
In this activity, science education and modern technology are bridged to teach students at the high school and undergraduate levels about protein folding and to strengthen their model building skills. Students are guided from a textbook picture of a protein as a rigid crystal structure to a more realistic view: proteins are highly dynamic…
Edge Detection and Geometric Methods in Computer Vision,
1985-02-01
enlightening discussion) Derivations or Eqs. 3.29, 3.31, 3.32 (some statistics) Experimental results (pictures)-- not very informative, extensive or useful. lie... neurophysiology and hardware design. If one views 9 the state space as a free vector space on the labels over the field of weights (which we take to be R), then
QR Codes in Higher Ed: Fad or Functional Tool?
ERIC Educational Resources Information Center
Gradel, Kathleen; Edson, Alden J.
2013-01-01
As higher education grapples with addressing the 21st century needs of learners, technology is a pervasive concern. Waters (2012) painted a picture of three historical "screens," namely the television screen, the computer monitor, and today's mobile device screen. As mobile devices become increasingly commonplace in the workplace and on the…
Monitoring invasive plants using hand-held GIS technology
Theresa M. Mau-Crimmins; Barron J. Orr
2005-01-01
Successful control of invasive species requires a clear picture of the spatial extent of infestations. The latest mapping technology involves coupling global position systems and handheld computers running geographic information systems software in the field. A series of workshops applying this technology to mapping weeds was developed and presented to Weed Management...
Fostering Multimedia Learning of Science: Exploring the Role of an Animated Agent's Image
ERIC Educational Resources Information Center
Dunsworth, Qi; Atkinson, Robert K.
2007-01-01
Research suggests that students learn better when studying a picture coupled with narration rather than on-screen text in a computer-based multimedia learning environment. Moreover, combining narration with the visual presence of an animated pedagogical agent may also encourage students to process information deeper than narration or on-screen…
High School Students' Use of Meiosis When Solving Genetics Problems.
ERIC Educational Resources Information Center
Wynne, Cynthia F.; Stewart, Jim; Passmore, Cindy
2001-01-01
Paints a different picture of students' reasoning with meiosis as they solved complex, computer-generated genetics problems, some of which required them to revise their understanding of meiosis in response to anomalous data. Students were able to develop a rich understanding of meiosis and can utilize that knowledge to solve genetics problems.…
Thunderstorm Research International Program (TRIP 77) report to management
NASA Technical Reports Server (NTRS)
Taiani, A. J.
1977-01-01
A post analysis of the previous day's weather, followed by the day's forecast and an outlook on weather conditions for the following day is given. The normal NOAA weather charts were used, complemented by the latest GOES satellite pictures, the latest rawinsonde sounding, and the computer-derived thunderstorm probability forecasts associated with the sounding.
The Use of Digitized Images in Developing Software for Young Children.
ERIC Educational Resources Information Center
Wright, June L.
1992-01-01
Parents and children interacted with computer-based representations of a park, one with animated picture graphics and one with digitized full motion video. Children who interacted with the digitized representation replayed the program more and showed a stronger cognitive focus on the representation than did the other children. (LB)
Different Futures of Adaptive Collaborative Learning Support
ERIC Educational Resources Information Center
Rummel, Nikol; Walker, Erin; Aleven, Vincent
2016-01-01
In this position paper we contrast a Dystopian view of the future of adaptive collaborative learning support (ACLS) with a Utopian scenario that--due to better-designed technology, grounded in research--avoids the pitfalls of the Dystopian version and paints a positive picture of the practice of computer-supported collaborative learning 25 years…
Bringing Manual Input into the 20th Century: New Keyboard Concepts.
ERIC Educational Resources Information Center
Montgomery, Edward B.
1982-01-01
Examines the typewriter keyboard--the major method of information entry for the computer--and describes efforts to rearrange keyboards to improve speed and ease of use. The Montgomery wipe-activated keyboard, based on the frequency of word use, is pictured and explained. (10662 Los Vaqueros Circle, Los Alamitos, CA 90720) (JJD)
A Sorting-to-Matching Method to Teach Compound Matching to Sample
ERIC Educational Resources Information Center
Farber, Rachel S.; Dube, William V.; Dickson, Chata A.
2016-01-01
Individuals with developmental disabilities may fail to attend to multiple features in compound stimuli (e.g., arrays of pictures, letters within words) with detrimental effects on learning. Participants were 5 children with autism spectrum disorder who had low to intermediate accuracy scores (35% to 84%) on a computer-presented compound matching…
Investigating Diffusion with Technology
ERIC Educational Resources Information Center
Miller, Jon S.; Windelborn, Augden F.
2013-01-01
The activities described here allow students to explore the concept of diffusion with the use of common equipment such as computers, webcams and analysis software. The procedure includes taking a series of digital pictures of a container of water with a webcam as a dye slowly diffuses. At known time points, measurements of the pixel densities…
The Use of Board Games in Child Psychotherapy
ERIC Educational Resources Information Center
Oren, Ayala
2008-01-01
Playing checkers, football or more recently, computer games, is an important part of the latency child's culture. The ability to play games demands a level of emotional development similar to that needed to cope with the emotional/developmental demands characteristic of latency. A game shared by the therapist and child provides a picture of the…
Defense Horizons. Number 11, April 2002. Computer Games and the Military: Two Views
2002-04-01
environmental knowledge). As a design and engineering challenge, Star Wars Galaxies rivals the con- struction of a space station in its sheer scale and... Rangers . (Picture Mark Messier and Ken Belanger, running down the halls with automatic weapons, out for blood—it was only a matter of time.) 8 Clan
The Importance of Technology Usage in the Classroom, Does Gender Gaps Exist
ERIC Educational Resources Information Center
Mims-Word, Marsha
2012-01-01
A decade ago, access to technology was limited and wiring schools was one of the nation's highest education priorities (NCREL, 2005). Ten years of substantial investments have vastly improved this picture. According to the Secretary's Fourth Annual Report on Teacher Quality, virtually every school with access to computers has Internet access…
Object-Oriented Programming in High Schools the Turing Way.
ERIC Educational Resources Information Center
Holt, Richard C.
This paper proposes an approach to introducing object-oriented concepts to high school computer science students using the Object-Oriented Turing (OOT) language. Students can learn about basic object-oriented (OO) principles such as classes and inheritance by using and expanding a collection of classes that draw pictures like circles and happy…
A perspective view of the plane mixing layer
NASA Technical Reports Server (NTRS)
Jimenez, J.; Cogollos, M.; Bernal, L. P.
1984-01-01
A three-dimensional model of the plane mixing layer is constructed by applying digital image processing and computer graphic techniques to laser fluorescent motion pictures of its transversal sections. A system of streamwise vortex pairs is shown to exist on top of the classical spanwise eddies. Its influence on mixing is examined.
Blurring Boundaries in Education: Context and Impact of MOOCs
ERIC Educational Resources Information Center
Loeckx, Johan
2016-01-01
The opinions on MOOCs go to extremes, covering a wide variety of topics, affecting economy, pedagogy, and computer science which makes it hard to keep oversight. Despite the many excellent research reports and articles, an overview of the bigger picture, providing a holistic qualitative summary of the different opinions, is still very welcome.…
Iodine imaging in thyroid by fluorescent X-ray CT with 0.05 mm spatial resolution
NASA Astrophysics Data System (ADS)
Takeda, T.; Yu, Q.; Yashiro, T.; Zeniya, T.; Wu, J.; Hasegawa, Y.; Thet-Thet-Lwin; Hyodo, K.; Yuasa, T.; Dilmanian, F. A.; Akatsuka, T.; Itai, Y.
2001-07-01
Fluorescent X-ray computed tomography (FXCT) at a 0.05 mm in-plane spatial resolution and 0.05 mm slice thickness depicted the cross sectional distribution of endogenous iodine within thyroid. The distribution obtained from the FXCT image correlated closely to that obtained from the pathological pictures.
Creating a STEM-Literate Society
ERIC Educational Resources Information Center
Dow, Mirah J.
2014-01-01
Picture a professor of library and information science working in her office on the fourth floor of the university library. She is away from student traffic and relatively isolated from other faculty on campus. Nevertheless, the professor has much to be proud of as she uses computer technology to reach, teach, and interact with enrolled students…
``Staying in Focus'' - An Online Optics Tutorial on the Eye
NASA Astrophysics Data System (ADS)
Hoeling, Barbara M.
2011-02-01
The human eye and its vision problems are often used as an entry subject and attention grabber in the teaching of geometrical optics. While this is a real-life application students can relate to, it is difficult to visualize how the eye forms images by studying the still pictures and drawings in a textbook. How to draw a principal ray diagram or how to calculate the image distance from a given object distance and focal length might be clear to most students after studying the book, but even then they often lack an understanding of the "big picture." Where is the image of a very far away object located? How come we can see both far away and close-by objects focused (although not simultaneously)? Computer animations,2 popular with our computer-game savvy students, provide considerably more information than the still images, especially if they allow the user to manipulate parameters and to observe the outcome of a "virtual" experiment. However, as stand-alone learning tools, they often don't provide the students with the necessary physics background or instruction on how to use them.
Measurement of Human Blood and Plasma Volumes
NASA Technical Reports Server (NTRS)
Greenleaf, J. E.; Szalkay, H. G. H.
1987-01-01
Report reviews techniques for measuring blood-plasma volume in humans. Common technique of using radioactive iodine isotope to label plasma albumin involves unwarranted risks from low-level radiation. Report emphasizes techniques using Evans-blue-dye (T-1824) labeling of albumin, hematocrit or hemoglobin/hematocrit measurements, or blood densitometry. In Evans-blue-dye technique, plasma volume determined from decrease in dye concentration occurring after small amount of dye solution injected into circulatory system. Subjection of Evans blue dye to test for carcinogenicity gave negative results.
Ultrasonic fluid densitometry and densitometer
Greenwood, Margaret S.; Lail, Jason C.
1998-01-01
The present invention is an ultrasonic fluid densitometer that uses a material wedge having an acoustic impedance that is near the acoustic impedance of the fluid, specifically less than a factor of 11 greater than the acoustic impedance of the fluid. The invention also includes a wedge having at least two transducers for transmitting and receiving ultrasonic signals internally reflected within the material wedge. Density of a fluid is determined by immersing the wedge into the fluid and measuring reflection of ultrasound at the wedge-fluid interface.
Ultrasonic fluid densitometry and densitometer
Greenwood, M.S.; Lail, J.C.
1998-01-13
The present invention is an ultrasonic fluid densitometer that uses a material wedge having an acoustic impedance that is near the acoustic impedance of the fluid, specifically less than a factor of 11 greater than the acoustic impedance of the fluid. The invention also includes a wedge having at least two transducers for transmitting and receiving ultrasonic signals internally reflected within the material wedge. Density of a fluid is determined by immersing the wedge into the fluid and measuring reflection of ultrasound at the wedge-fluid interface. 6 figs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biswas, Pratim; Al-Dahhan, Muthanna
2012-11-01
Tri-isotropic (TRISO) fuel particle coating is critical for the future use of nuclear energy produced byadvanced gas reactors (AGRs). The fuel kernels are coated using chemical vapor deposition in a spouted fluidized bed. The challenges encountered in operating TRISO fuel coaters are due to the fact that in modern AGRs, such as High Temperature Gas Reactors (HTGRs), the acceptable level of defective/failed coated particles is essentially zero. This specification requires processes that produce coated spherical particles with even coatings having extremely low defect fractions. Unfortunately, the scale-up and design of the current processes and coaters have been based on empiricalmore » approaches and are operated as black boxes. Hence, a voluminous amount of experimental development and trial and error work has been conducted. It has been clearly demonstrated that the quality of the coating applied to the fuel kernels is impacted by the hydrodynamics, solids flow field, and flow regime characteristics of the spouted bed coaters, which themselves are influenced by design parameters and operating variables. Further complicating the outlook for future fuel-coating technology and nuclear energy production is the fact that a variety of new concepts will involve fuel kernels of different sizes and with compositions of different densities. Therefore, without a fundamental understanding the underlying phenomena of the spouted bed TRISO coater, a significant amount of effort is required for production of each type of particle with a significant risk of not meeting the specifications. This difficulty will significantly and negatively impact the applications of AGRs for power generation and cause further challenges to them as an alternative source of commercial energy production. Accordingly, the proposed work seeks to overcome such hurdles and advance the scale-up, design, and performance of TRISO fuel particle spouted bed coaters. The overall objectives of the proposed work are to advance the fundamental understanding of the hydrodynamics by systematically investigating the effect of design and operating variables, to evaluate the reported dimensionless groups as scaling factors, and to establish a reliable scale-up methodology for the TRISO fuel particle spouted bed coaters based on hydrodynamic similarity via advanced measurement and computational techniques. An additional objective is to develop an on-line non-invasive measurement technique based on gamma ray densitometry (i.e. Nuclear Gauge Densitometry) that can be installed and used for coater process monitoring to ensure proper performance and operation and to facilitate the developed scale-up methodology. To achieve the objectives set for the project, the work will use optical probes and gamma ray computed tomography (CT) (for the measurements of solids/voidage holdup cross-sectional distribution and radial profiles along the bed height, spouted diameter, and fountain height) and radioactive particle tracking (RPT) (for the measurements of the 3D solids flow field, velocity, turbulent parameters, circulation time, solids lagrangian trajectories, and many other of spouted bed related hydrodynamic parameters). In addition, gas dynamic measurement techniques and pressure transducers will be utilized to complement the obtained information. The measurements obtained by these techniques will be used as benchmark data to evaluate and validate the computational fluid dynamic (CFD) models (two fluid model or discrete particle model) and their closures. The validated CFD models and closures will be used to facilitate the developed methodology for scale-up, design and hydrodynamic similarity. Successful execution of this work and the proposed tasks will advance the fundamental understanding of the coater flow field and quantify it for proper and safe design, scale-up, and performance. Such achievements will overcome the barriers to AGR applications and will help assure that the US maintains nuclear energy as a feasible option to meet the nation's needs for energy and environmental safety. In addition, the outcome of the proposed study will have a broader impact on other processes that utilize spouted beds, such as coal gasification, granulation, drying, catalytic reactions, etc.« less
Home Media and Children’s Achievement and Behavior
Hofferth, Sandra L.
2010-01-01
This study provides a national picture of the time American 6–12 year olds spent playing video games, using the computer, and watching television at home in 1997 and 2003 and the association of early use with their achievement and behavior as adolescents. Girls benefited from computers more than boys and Black children’s achievement benefited more from greater computer use than did that of White children. Greater computer use in middle childhood was associated with increased achievement for White and Black girls and Black boys, but not White boys. Greater computer play was also associated with a lower risk of becoming socially isolated among girls. Computer use does not crowd out positive learning-related activities, whereas video game playing does. Consequently, increased video game play had both positive and negative associations with the achievement of girls but not boys. For boys, increased video game play was linked to increased aggressive behavior problems. PMID:20840243
Reading Emotion From Mouse Cursor Motions: Affective Computing Approach.
Yamauchi, Takashi; Xiao, Kunchen
2018-04-01
Affective computing research has advanced emotion recognition systems using facial expressions, voices, gaits, and physiological signals, yet these methods are often impractical. This study integrates mouse cursor motion analysis into affective computing and investigates the idea that movements of the computer cursor can provide information about emotion of the computer user. We extracted 16-26 trajectory features during a choice-reaching task and examined the link between emotion and cursor motions. Participants were induced for positive or negative emotions by music, film clips, or emotional pictures, and they indicated their emotions with questionnaires. Our 10-fold cross-validation analysis shows that statistical models formed from "known" participants (training data) could predict nearly 10%-20% of the variance of positive affect and attentiveness ratings of "unknown" participants, suggesting that cursor movement patterns such as the area under curve and direction change help infer emotions of computer users. Copyright © 2017 Cognitive Science Society, Inc.
Model falsifiability and climate slow modes
NASA Astrophysics Data System (ADS)
Essex, Christopher; Tsonis, Anastasios A.
2018-07-01
The most advanced climate models are actually modified meteorological models attempting to capture climate in meteorological terms. This seems a straightforward matter of raw computing power applied to large enough sources of current data. Some believe that models have succeeded in capturing climate in this manner. But have they? This paper outlines difficulties with this picture that derive from the finite representation of our computers, and the fundamental unavailability of future data instead. It suggests that alternative windows onto the multi-decadal timescales are necessary in order to overcome the issues raised for practical problems of prediction.
Photo-reconnaissance applications of computer processing of images.
NASA Technical Reports Server (NTRS)
Billingsley, F. C.
1972-01-01
Discussion of imaging processing techniques for enhancement and calibration of Jet Propulsion Laboratory imaging experiment pictures returned from NASA space vehicles such as Ranger, Mariner and Surveyor. Particular attention is given to data transmission, resolution vs recognition, and color aspects of digital data processing. The effectiveness of these techniques in applications to images from a wide variety of sources is noted. It is anticipated that the use of computer processing for enhancement of imagery will increase with the improvement and cost reduction of these techniques in the future.
Computer-generated Model of Purine Nucleoside Phosphorylase (PNP)
NASA Technical Reports Server (NTRS)
1987-01-01
Purine Nucleoside Phosphorylase (PNP) is an important target enzyme for the design of anti-cancer and immunosuppressive drugs. Bacterial PNP, which is slightly different from the human enzyme, is used to synthesize chemotherapuautic agents. Knowledge of the three-dimensional structure of the bacterial PNP molecule is useful in efforts to engineer different types of PNP enzymes, that can be used to produce new chemotherapeutic agents. This picture shows a computer model of bacterial PNP, which looks a lot like a display of colorful ribbons. Principal Investigator was Charles Bugg.
NASA Technical Reports Server (NTRS)
Russell, P. B.; Pueschel, R. F.; Livingston, J. M.; Bergstrom, R.; Lawless, James G. (Technical Monitor)
1994-01-01
This paper brings together experimental. evidence required to build realistic models of the global evolution of physical, chemical, and optical properties of the aerosol resulting from the 1991 Pinatubo volcanic eruption. Such models are needed to compute the effects of the aerosol on atmospheric chemistry, dynamics, radiation, and temperature. Whereas there is now a large and growing body of post-Pinatubo measurements by a variety of techniques, some results are in conflict, and a self-consistent, unified picture is needed, along with an assessment of remaining uncertainties. This paper examines data from photometers, radiometers, impactors, optical counters/sizers, and lidars operated on the ground, aircraft, balloons, and spacecraft.
Gaussification and entanglement distillation of continuous-variable systems: a unifying picture.
Campbell, Earl T; Eisert, Jens
2012-01-13
Distillation of entanglement using only Gaussian operations is an important primitive in quantum communication, quantum repeater architectures, and distributed quantum computing. Existing distillation protocols for continuous degrees of freedom are only known to converge to a Gaussian state when measurements yield precisely the vacuum outcome. In sharp contrast, non-Gaussian states can be deterministically converted into Gaussian states while preserving their second moments, albeit by usually reducing their degree of entanglement. In this work-based on a novel instance of a noncommutative central limit theorem-we introduce a picture general enough to encompass the known protocols leading to Gaussian states, and new classes of protocols including multipartite distillation. This gives the experimental option of balancing the merits of success probability against entanglement produced.
Picture processing analysis of the optical structure of NGC 5128 /Centaurus A/
NASA Technical Reports Server (NTRS)
Dufour, R. J.; Harvel, C. A.; Martins, D. M.; Schiffer, F. H., III; Talent, D. L.; Wells, D. C.; Van Den Bergh, S.; Talbot, R. J., Jr.
1979-01-01
Results are presented for a detailed study of the peculiar elliptical galaxy NGC 5128 (Cen A), based on computer video analysis of several photographic plates of exceptional quality reduced to the standard UBV system. The picture-processing results and the measured properties of the elliptical and gaseous-disk components of NGC 5128 are examined, along with the distribution, spectral characteristics, and chemical composition of the H II regions in the disk. The data show that NGC 5128 consists of a giant E2 galaxy containing a significant amount of gas and dust situated predominantly in an equatorial disk where vigorous star formation is occurring. Reasons why NGC 5128 is so different from giant ellipticals in clusters are considered.
Study of efficient video compression algorithms for space shuttle applications
NASA Technical Reports Server (NTRS)
Poo, Z.
1975-01-01
Results are presented of a study on video data compression techniques applicable to space flight communication. This study is directed towards monochrome (black and white) picture communication with special emphasis on feasibility of hardware implementation. The primary factors for such a communication system in space flight application are: picture quality, system reliability, power comsumption, and hardware weight. In terms of hardware implementation, these are directly related to hardware complexity, effectiveness of the hardware algorithm, immunity of the source code to channel noise, and data transmission rate (or transmission bandwidth). A system is recommended, and its hardware requirement summarized. Simulations of the study were performed on the improved LIM video controller which is computer-controlled by the META-4 CPU.
NASA Astrophysics Data System (ADS)
Davies, Merton E.; Rogers, Patricia G.; Colvin, Tim R.
1991-08-01
A control network for Triton has been computed using a bundle-type analytical triangulation program. The network contains 105 points that were measured on 57 Voyager-2 pictures. The adjustment contained 1010 observation equations and 382 normal equations and resulted in a standard measurement error of 13.36 microns. The coordinates of the control points, the camera orientation angles at the times when the pictures were taken, and Triton's mean radius were determined. A separate statistical analysis confirmed Triton's radius to be 1352.6 + or - 2.4 km. Attempts to tie the control network around the satellite were unsuccessful because discontinuities exist in high-resolution coverage between 66 deg and 289 deg longitude, north of 38 deg latitude, and south of 78 deg latitude.
NASA Astrophysics Data System (ADS)
Manabe, Yoshitsugu; Imura, Masataka; Tsuchiya, Masanobu; Yasumuro, Yoshihiro; Chihara, Kunihiro
2003-01-01
Wearable 3D measurement realizes to acquire 3D information of an objects or an environment using a wearable computer. Recently, we can send voice and sound as well as pictures by mobile phone in Japan. Moreover it will become easy to capture and send data of short movie by it. On the other hand, the computers become compact and high performance. And it can easy connect to Internet by wireless LAN. Near future, we can use the wearable computer always and everywhere. So we will be able to send the three-dimensional data that is measured by wearable computer as a next new data. This paper proposes the measurement method and system of three-dimensional data of an object with the using of wearable computer. This method uses slit light projection for 3D measurement and user"s motion instead of scanning system.
Kidd, I M; Clark, D A; Emery, V C
2000-06-01
Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.
Quantitative tomographic measurements of opaque multiphase flows
DOE Office of Scientific and Technical Information (OSTI.GOV)
GEORGE,DARIN L.; TORCZYNSKI,JOHN R.; SHOLLENBERGER,KIM ANN
2000-03-01
An electrical-impedance tomography (EIT) system has been developed for quantitative measurements of radial phase distribution profiles in two-phase and three-phase vertical column flows. The EIT system is described along with the computer algorithm used for reconstructing phase volume fraction profiles. EIT measurements were validated by comparison with a gamma-densitometry tomography (GDT) system. The EIT system was used to accurately measure average solid volume fractions up to 0.05 in solid-liquid flows, and radial gas volume fraction profiles in gas-liquid flows with gas volume fractions up to 0.15. In both flows, average phase volume fractions and radial volume fraction profiles from GDTmore » and EIT were in good agreement. A minor modification to the formula used to relate conductivity data to phase volume fractions was found to improve agreement between the methods. GDT and EIT were then applied together to simultaneously measure the solid, liquid, and gas radial distributions within several vertical three-phase flows. For average solid volume fractions up to 0.30, the gas distribution for each gas flow rate was approximately independent of the amount of solids in the column. Measurements made with this EIT system demonstrate that EIT may be used successfully for noninvasive, quantitative measurements of dispersed multiphase flows.« less
Wong, A.K.O.
2016-01-01
The choice of an appropriate imaging technique to quantify bone, muscle, or muscle adiposity needs to be guided by a thorough understanding of its competitive advantages over other modalities balanced by its limitations. This review details the technical machinery and methods behind peripheral quantitative computed tomography (pQCT), high-resolution (HR)-pQCT, and magnetic resonance imaging (MRI) that drive successful depiction of bone and muscle morphometry, densitometry, and structure. It discusses a number of image acquisition settings, the challenges associated with using one versus another, and compares the risk-benefits across the different modalities. Issues related to all modalities including partial volume artifact, beam hardening, calibration, and motion assessment are also detailed. The review further provides data and images to illustrate differences between methods to better guide the reader in selecting an imaging method strategically. Overall, investigators should be cautious of the impact of imaging parameters on image signal or contrast-to-noise-ratios, and the need to report these settings in future publications. The effect of motion should be assessed on images and a decision made to exclude prior to segmentation. A more standardized approach to imaging bone and muscle on pQCT and MRI could enhance comparability across studies and could improve the quality of meta-analyses. PMID:27973379
Automated brain computed tomographic densitometry of early ischemic changes in acute stroke
Stoel, Berend C.; Marquering, Henk A.; Staring, Marius; Beenen, Ludo F.; Slump, Cornelis H.; Roos, Yvo B.; Majoie, Charles B.
2015-01-01
Abstract. The Alberta Stroke Program Early CT score (ASPECTS) scoring method is frequently used for quantifying early ischemic changes (EICs) in patients with acute ischemic stroke in clinical studies. Varying interobserver agreement has been reported, however, with limited agreement. Therefore, our goal was to develop and evaluate an automated brain densitometric method. It divides CT scans of the brain into ASPECTS regions using atlas-based segmentation. EICs are quantified by comparing the brain density between contralateral sides. This method was optimized and validated using CT data from 10 and 63 patients, respectively. The automated method was validated against manual ASPECTS, stroke severity at baseline and clinical outcome after 7 to 10 days (NIH Stroke Scale, NIHSS) and 3 months (modified Rankin Scale). Manual and automated ASPECTS showed similar and statistically significant correlations with baseline NIHSS (R=−0.399 and −0.277, respectively) and with follow-up mRS (R=−0.256 and −0.272), except for the follow-up NIHSS. Agreement between automated and consensus ASPECTS reading was similar to the interobserver agreement of manual ASPECTS (differences <1 point in 73% of cases). The automated ASPECTS method could, therefore, be used as a supplementary tool to assist manual scoring. PMID:26158082
Wong, A K
2016-12-14
The choice of an appropriate imaging technique to quantify bone, muscle, or muscle adiposity needs to be guided by a thorough understanding of its competitive advantages over other modalities balanced by its limitations. This review details the technical machinery and methods behind peripheral quantitative computed tomography (pQCT), high-resolution (HR)-pQCT, and magnetic resonance imaging (MRI) that drive successful depiction of bone and muscle morphometry, densitometry, and structure. It discusses a number of image acquisition settings, the challenges associated with using one versus another, and compares the risk-benefits across the different modalities. Issues related to all modalities including partial volume artifact, beam hardening, calibration, and motion assessment are also detailed. The review further provides data and images to illustrate differences between methods to better guide the reader in selecting an imaging method strategically. Overall, investigators should be cautious of the impact of imaging parameters on image signal or contrast-to-noise-ratios, and the need to report these settings in future publications. The effect of motion should be assessed on images and a decision made to exclude prior to segmentation. A more standardized approach to imaging bone and muscle on pQCT and MRI could enhance comparability across studies and could improve the quality of meta-analyses.
Toward Impactful Collaborations on Computing and Mental Health
Dinakar, Karthik; Picard, Rosalind; Christensen, Helen; Torous, John
2018-01-01
We describe an initiative to bring mental health researchers, computer scientists, human-computer interaction researchers, and other communities together to address the challenges of the global mental ill health epidemic. Two face-to-face events and one special issue of the Journal of Medical Internet Research were organized. The works presented in these events and publication reflect key state-of-the-art research in this interdisciplinary collaboration. We summarize the special issue articles and contextualize them to present a picture of the most recent research. In addition, we describe a series of collaborative activities held during the second symposium and where the community identified 5 challenges and their possible solutions. PMID:29426812
Evaluative conditioning: A brief computer-delivered intervention to reduce college student drinking.
Tello, Nina; Bocage-Barthélémy, Yvana; Dandaba, Meira; Jaafari, Nematollah; Chatard, Armand
2018-07-01
Recent research suggests that a brief computer-delivered intervention based on evaluative conditioning (EC) can change the implicit evaluation of alcohol and reduce drinking behaviors among college students. We tested whether we could obtain similar findings in a high-powered preregistered study and whether hazardous drinking moderates these effects. Before the intervention, 122 French college students were screened for hazardous drinking using the Alcohol Use Disorder Identification Test (AUDIT). Implicit evaluation of alcohol was assessed before and immediately after the intervention using an Implicit Association Test (IAT). Drinking behavior was assessed before the intervention and approximately two weeks after using the TimeLine Follow Back (TLFB) method. The EC consisted of 120 trials of words (related to alcoholic beverages, soft drinks or neutral) paired with pictures (neutral, positive or negative). In the EC condition, alcohol-related words were systematically paired with negative pictures. In the control condition, alcohol-related words were systematically paired with neutral pictures. The EC did not change the implicit evaluation of alcohol, Cohen's d = 0.01, 95CI [-0.35, 0.35]. However, the EC reduced drinking behavior, Cohen's d = 0.37, 95CI [0.01, 0.72]. This effect was independent of hazardous drinking behavior, but it was especially pronounced among participants with the most positive implicit evaluation of alcohol before the intervention. This preregistered study suggests that evaluative conditioning can successfully reduce drinking behavior among college students by 31% (compared to 4% in the control condition) without causing an immediate change in the implicit evaluation of alcohol. Copyright © 2018 Elsevier Ltd. All rights reserved.
New architecture for dynamic frame-skipping transcoder.
Fung, Kai-Tat; Chan, Yui-Lam; Siu, Wan-Chi
2002-01-01
Transcoding is a key technique for reducing the bit rate of a previously compressed video signal. A high transcoding ratio may result in an unacceptable picture quality when the full frame rate of the incoming video bitstream is used. Frame skipping is often used as an efficient scheme to allocate more bits to the representative frames, so that an acceptable quality for each frame can be maintained. However, the skipped frame must be decompressed completely, which might act as a reference frame to nonskipped frames for reconstruction. The newly quantized discrete cosine transform (DCT) coefficients of the prediction errors need to be re-computed for the nonskipped frame with reference to the previous nonskipped frame; this can create undesirable complexity as well as introduce re-encoding errors. In this paper, we propose new algorithms and a novel architecture for frame-rate reduction to improve picture quality and to reduce complexity. The proposed architecture is mainly performed on the DCT domain to achieve a transcoder with low complexity. With the direct addition of DCT coefficients and an error compensation feedback loop, re-encoding errors are reduced significantly. Furthermore, we propose a frame-rate control scheme which can dynamically adjust the number of skipped frames according to the incoming motion vectors and re-encoding errors due to transcoding such that the decoded sequence can have a smooth motion as well as better transcoded pictures. Experimental results show that, as compared to the conventional transcoder, the new architecture for frame-skipping transcoder is more robust, produces fewer requantization errors, and has reduced computational complexity.
Fan-beam densitometry of the growing skeleton: are we measuring what we think we are?
Cole, Jacqueline H; Scerpella, Tamara A; van der Meulen, Marjolein C H
2005-01-01
Magnification error in fan-beam densitometers varies with distance from the X-ray source to the bone measured and might obscure bone mineral changes in the growing skeleton. Magnification was examined by scanning aluminum rods of different shapes (square, rectangular, solid round, and hollow round) at four distances above the X-ray source in two orientations, with rods aligned parallel (SI) and perpendicular (ML) to the longitudinal axis of the scanning table. Measured area (cm(2)) decreased linearly with distance above the X-ray source for all rods in the SI orientation (p < 0.005). Measured mineral content (g) decreased linearly with distance but only for SI round rods (p < 0.0001) and for ML hollow round rods (p < 0.005). Area and mineral content decreased 1.6-1.8% per centimeter above the source for round rods. Measured mineral density (g/cm(2)) decreased linearly with distance from the source only for ML hollow round rods (p < 0.005). Variation in area, mineral content, and mineral density measurements was 6.6-6.9%, 6.9-7.5%, and 1.9-2.3%, respectively, for SI round rods. Magnification errors of this magnitude are problematic for clinical studies using fan-beam densitometry. Particularly in pediatric subjects, increases in soft tissue during normal growth could increase a bone's distance from the fan-beam source and result in apparent reductions in area and bone mineral content.
30years of DXA technology innovations.
Glüer, Claus-C
2017-11-01
As the successor of Dual Photon Absorptiometry (DPA), Dual X-ray Absorptiometry (DXA) has seen 30years of continuous technological innovations. Implementation of measures for standardization and quality assurance made DXA a reliable and clinically useful approach. Its use in clinical multicenter drug studies in osteoporosis lead to general acceptance as the standard technique of bone densitometry. The limitations of DXA are well established. As a measure of areal bone mineral density (aBMD) it depends on bone size and is biased by overlaying soft tissue and calcified structures. To some extent these errors can be reduced by estimation of bone depth and/or lateral imaging. DXA based aBMD can be supplemented by additional information obtainable from DXA scans: geometric indices such as hip axis length or complex models like 2-D finite element analysis have been developed and tested. Given the drastic improvement in image quality current DXA scans can be used for Vertebral Fracture Analysis (VFA) or grading of Abdominal Aortic Calcifications. A textural measure, Trabecular Bone Score (TBS) provides independent information on fracture risk. DXA devices can also be used for assessments beyond bone density. Periprosthetic aBMD changes can be monitored to study the mechanical fitting of bone implants. Total body composition measurements are increasingly being used in studies on nutrition, obesity, and sarcopenia. 30years after its inception DXA is the undisputed standard imaging technique for the assessment of osteoporotic fracture risk with new applications beyond bone densitometry adding to its value. Copyright © 2017 Elsevier Inc. All rights reserved.
Kim, Y-H
2008-03-01
This study reviewed the results of a cementless anatomical femoral component to give immediate post-operative stability, and with a narrow distal section in order not to contact the femoral cortex in the diaphysis, ensuring exclusively metaphyseal loading. A total of 471 patients (601 hips) who had a total hip replacement between March 1995 and February 2002 were included in the study. There were 297 men and 174 women. The mean age at the time of operation was 52.7 years (28 to 63). Clinical and radiological evaluation were performed at each follow-up. Bone densitometry was carried out on all patients two weeks after operation and at the final follow-up examination. The mean follow-up was 8.8 years (5 to 12). The mean pre-operative Harris hip score was 41 points (16 to 54), which improved to a mean of 96 (68 to 100) at the final follow-up. No patient complained of thigh pain at any stage. No acetabular or femoral osteolysis was observed and no hip required revision for aseptic loosening of either component. Deep infection occurred in two hips (0.3%) which required revision. One hip (0.2%) required revision of the acetabular component for recurrent dislocation. Bone mineral densitometry revealed a minimal bone loss in the proximal femur. This cementless anatomical femoral component with metaphyseal loading but without distal fixation produced satisfactory fixation and encourages proximal femoral loading.
Shawky, Eman; Sallam, Shaimaa M
2017-11-01
A new high-throughput method was developed for the simultaneous analysis of isoflavones and soyasaponnins in Soy (Glycine max L.) products by high-performance thin-layer chromatography with densitometry and multiple detection. Silica gel was used as the stationary phase and ethyl acetate:methanol:water:acetic acid (100:20:16:1, v/v/v/v) as the mobile phase. After chromatographic development, multi-wavelength scanning was carried out by: (i) UV-absorbance measurement at 265 nm for genistin, daidzin and glycitin, (ii) Vis-absorbance measurement at 650 nm for Soyasaponins I and III, after post-chromatographic derivatization with anisaldehyde/sulfuric acid reagent. Validation of the developed method was found to meet the acceptance criteria delineated by ICH guidelines with respect to linearity, accuracy, precision, specificity and robustness. Calibrations were linear with correlation coefficients of >0.994. Intra-day precisions relative standard deviation (RSD)% of all substances in matrix were determined to be between 0.7 and 0.9%, while inter-day precisions (RSD%) ranged between 1.2 and 1.8%. The validated method was successfully applied for determination of the studied analytes in soy-based infant formula and soybean products. The new method compares favorably to other reported methods in being as accurate and precise and in the same time more feasible and cost-effective. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Is bone mineral density measurement using dual-energy X-ray absorptiometry affected by gamma rays?
Xie, Liang-Jun; Li, Jian-Fang; Zeng, Feng-Wei; Jiang, Hang; Cheng, Mu-Hua; Chen, Yi
2013-01-01
The objective of this study was to determine whether the gamma rays emitted from the radionuclide effect bone mineral density (BMD) measurement. Nine subjects (mean age: 56 ± 17.96 yr) scheduled for bone scanning underwent BMD measurement using dual-energy X-ray absorptiometry (DXA) (Hologic/Discovery A) before and 1, 2, and 4 h after injection of technetium-99m-methylene diphosphonate (99mTc-MDP). Ten subjects (mean age: 41 ± 15.47 yr) scheduled for therapy of differentiated thyroid carcinoma with iodine-131 underwent BMD measurement before and 2 h after therapeutic radionuclide administration. All patients were given whole body BMD measurement, including head, arm, ribs, lumbar spine, pelvis, and leg sites. Besides, patients who referred to radioiodine therapy were given total hip and femoral neck BMD measurement as well. No statistically significant changes in BMD values were detected after 99mTc-MDP and iodine-131 administration for all measurement sites (p > 0.05), and individual difference of BMD before and after radionuclide imaging or therapy was less than the least significant change in lumbar spine, total hip, and femoral neck. In conclusion, BMD measurements are not influenced by the gamma rays emitted from technetium-99m and iodine-131. DXA bone densitometry may be performed simultaneously with bone scanning and radioiodine therapy. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Masud, Tahir; Binkley, Neil; Boonen, Steven; Hannan, Marian T
2011-01-01
Risk factors for fracture can be purely skeletal, e.g., bone mass, microarchitecture or geometry, or a combination of bone and falls risk related factors such as age and functional status. The remit of this Task Force was to review the evidence and consider if falls should be incorporated into the FRAX® model or, alternatively, to provide guidance to assist clinicians in clinical decision-making for patients with a falls history. It is clear that falls are a risk factor for fracture. Fracture probability may be underestimated by FRAX® in individuals with a history of frequent falls. The substantial evidence that various interventions are effective in reducing falls risk was reviewed. Targeting falls risk reduction strategies towards frail older people at high risk for indoor falls is appropriate. This Task Force believes that further fracture reduction requires measures to reduce falls risk in addition to bone directed therapy. Clinicians should recognize that patients with frequent falls are at higher fracture risk than currently estimated by FRAX® and include this in decision-making. However, quantitative adjustment of the FRAX® estimated risk based on falls history is not currently possible. In the long term, incorporation of falls as a risk factor in the FRAX® model would be ideal. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Wahyuni, D. S. C.; Artanti, A. N.; Rinanto, Y.
2018-04-01
Curcuminoid, consisting of curcumin, demethoxycurcumin and bis demethoxycurcumin, is the active compound in Curcuma longa L. rhizome. It yielded vary depend on the environment and varieties. Curcumin has been known to have a potent antioxidants activity. The present work was conducted to assess the curcuminoid content and antioxidant capacity in the crude extracts of C. longa L. collected from eight different locations in Indonesia. Samples were collected from eight locations including Java island, Sumatera island and Nusa Tenggara island. All samples were extracted using 96% ethanol and analyzed quantitatively using TLC-Densitometry. Antioxidant activity was assessed using diphenylpicrylhydrazyl (DPPH) radical scavenging assay and analyzed at 517 nm using a spectrophotometer. Curcuminoid content in C. longa varied among eight different locations (0.53±0.05 - 5.33±0.12 % w/w). The highest curcumin, demethoxycurcumin and bisdemethoxycurcumin yield were found in the samples from Magetan (5.33±0.12%, 1.54±0.05%, 0.46±0.02% w/w, respectively). In contrast, the lowest curcumin, demethoxycurcumin and bisdemethoxycurcumin yield were found in the sample from Demak (0.53±0.05%, 0.17±0.05%, 0.17±0.05% w/w, respectively). Antioxidant capacity showed similar for all places unless sample from Magetan which exhibited two times lower than other locations. It is apparently curcuminoid content and antioxidant activity varied among places. These results are useful information for curcuminoid standardization method in pharmaceutical products.
Nguyen-Kim, Thi Dan Linh; Maurer, Britta; Suliman, Yossra A; Morsbach, Fabian; Distler, Oliver; Frauenfelder, Thomas
2018-04-01
To evaluate usability of slice-reduced sequential computed tomography (CT) compared to standard high-resolution CT (HRCT) in patients with systemic sclerosis (SSc) for qualitative and quantitative assessment of interstitial lung disease (ILD) with respect to (I) detection of lung parenchymal abnormalities, (II) qualitative and semiquantitative visual assessment, (III) quantification of ILD by histograms and (IV) accuracy for the 20%-cut off discrimination. From standard chest HRCT of 60 SSc patients sequential 9-slice-computed tomography (reduced HRCT) was retrospectively reconstructed. ILD was assessed by visual scoring and quantitative histogram parameters. Results from standard and reduced HRCT were compared using non-parametric tests and analysed by univariate linear regression analyses. With respect to the detection of parenchymal abnormalities, only the detection of intrapulmonary bronchiectasis was significantly lower in reduced HRCT compared to standard HRCT (P=0.039). No differences were found comparing visual scores for fibrosis severity and extension from standard and reduced HRCT (P=0.051-0.073). All scores correlated significantly (P<0.001) to histogram parameters derived from both, standard and reduced HRCT. Significant higher values of kurtosis and skewness for reduced HRCT were found (both P<0.001). In contrast to standard HRCT histogram parameters from reduced HRCT showed significant discrimination at cut-off 20% fibrosis (sensitivity 88% kurtosis and skewness; specificity 81% kurtosis and 86% skewness; cut-off kurtosis ≤26, cut-off skewness ≤4; both P<0.001). Reduced HRCT is a robust method to assess lung fibrosis in SSc with minimal radiation dose with no difference in scoring assessment of lung fibrosis severity and extension in comparison to standard HRCT. In contrast to standard HRCT histogram parameters derived from the approach of reduced HRCT could discriminate at a threshold of 20% lung fibrosis with high sensitivity and specificity. Hence it might be used to detect early disease progression of lung fibrosis in context of monitoring and treatment of SSc patients.
CD-based image archival and management on a hybrid radiology intranet.
Cox, R D; Henri, C J; Bret, P M
1997-08-01
This article describes the design and implementation of a low-cost image archival and management solution on a radiology network consisting of UNIX, IBM personal computer-compatible (IBM, Purchase, NY) and Macintosh (Apple Computer, Cupertino, CA) workstations. The picture archiving and communications system (PACS) is modular, scaleable and conforms to the Digital Imaging and Communications in Medicine (DICOM) 3.0 standard for image transfer, storage and retrieval. Image data is made available on soft-copy reporting workstations by a work-flow management scheme and on desktop computers through a World Wide Web (WWW) interface. Data archival is based on recordable compact disc (CD) technology and is automated. The project has allowed the radiology department to eliminate the use of film in magnetic resonance (MR) imaging, computed tomography (CT) and ultrasonography.
Scholarly literature and the press: scientific impact and social perception of physics computing
NASA Astrophysics Data System (ADS)
Pia, M. G.; Basaglia, T.; Bell, Z. W.; Dressendorfer, P. V.
2014-06-01
The broad coverage of the search for the Higgs boson in the mainstream media is a relative novelty for high energy physics (HEP) research, whose achievements have traditionally been limited to scholarly literature. This paper illustrates the results of a scientometric analysis of HEP computing in scientific literature, institutional media and the press, and a comparative overview of similar metrics concerning representative particle physics measurements. The picture emerging from these scientometric data documents the relationship between the scientific impact and the social perception of HEP physics research versus that of HEP computing. The results of this analysis suggest that improved communication of the scientific and social role of HEP computing via press releases from the major HEP laboratories would be beneficial to the high energy physics community.
Energy Awareness and Scheduling in Mobile Devices and High End Computing
ERIC Educational Resources Information Center
Pawaskar, Sachin S.
2013-01-01
In the context of the big picture as energy demands rise due to growing economies and growing populations, there will be greater emphasis on sustainable supply, conservation, and efficient usage of this vital resource. Even at a smaller level, the need for minimizing energy consumption continues to be compelling in embedded, mobile, and server…
Error-Correcting Parsing for Syntactic Pattern Recognition
1977-08-01
1971. 55. Slromoney, G., Slromoney, R., and K. Krlthlvasan, "Abstract Families of Matrices and Picture Langauges," Computer Graphic and Image...T112 111X1 121 Tine USLO FOR LINXirjG A THtt .186 SEC "INPUT CHARACTER IS A DISTANCE PORN N0*flAL A IS_ 3 TINE USED FOX PARSING S.l&l SEC
ERIC Educational Resources Information Center
Gamble-Risley, Michelle
2006-01-01
In the past, projection systems were large, heavy, and unwieldy and cost $3,000 to $5,000. Setup was fraught with the challenges of multiple wires plugged into the backs of desktop computers, often causing confusion about what went where. Systems were sometimes so difficult to set up that teachers had to spend pre-class time putting them together.…
The Estuary: A Special Place. Student Guide and Teacher Guide. OEAGLS Investigation 20.
ERIC Educational Resources Information Center
Fortner, Rosanne; Mischler, Ron
In this unit students examine Old Woman Creek National Estuarine Sanctuary on Lake Erie to study the characteristics and importance of estuaries in general. Activities include the analysis of a pictured plankton sample, a transect study using computer data, a consideration of the ecological roles of various estuarine species, and a discussion of…
The Growth of m-Learning and the Growth of Mobile Computing: Parallel Developments
ERIC Educational Resources Information Center
Caudill, Jason G.
2007-01-01
m-Learning is made possible by the existence and application of mobile hardware and networking technology. By exploring the capabilities of these technologies, it is possible to construct a picture of how different components of m-Learning can be implemented. This paper will explore the major technologies currently in use: portable digital…
ERIC Educational Resources Information Center
Linder, Sandra M.
2012-01-01
Teachers are using technological innovations--including interactive whiteboards--in pre-K-grade 3 classrooms across the country. An IWB is a wall-mounted, touch-sensitive flat screen. When connected to a computer (or another electronic device) and a projector, it displays enlarged instructional content (such as a math word problem, pictures or…
Modeling of Word Translation: Activation Flow from Concepts to Lexical Items
ERIC Educational Resources Information Center
Roelofs, Ardi; Dijkstra, Ton; Gerakaki, Svetlana
2013-01-01
Whereas most theoretical and computational models assume a continuous flow of activation from concepts to lexical items in spoken word production, one prominent model assumes that the mapping of concepts onto words happens in a discrete fashion (Bloem & La Heij, 2003). Semantic facilitation of context pictures on word translation has been taken to…
Performance of the Mayo-IBM PAC system
NASA Astrophysics Data System (ADS)
Persons, Kenneth R.; Reardon, Frank J.; Gehring, Dale G.; Hangiandreou, Nicholas J.
1994-05-01
The Mayo Clinic and IBM (at Rochester, Minnesota) have jointly developed a picture archived system for use with Mayo's MRI and CT imaging modalities. This PACS is made up of over 50 computers that work cooperatively to provide archival, retrieval and image distribution services for Mayo's Department of Radiology. This paper will examine the performance characteristics of the system.
Video enhancement of X-ray and neutron radiographs
NASA Technical Reports Server (NTRS)
Vary, A.
1973-01-01
System was devised for displaying radiographs on television screen and enhancing fine detail in picture. System uses analog-computer circuits to process television signal from low-noise television camera. Enhanced images are displayed in black and white and can be controlled to vary degree of enhancement and magnification of details in either radiographic transparencies or opaque photographs.
A Text Analysis of the Marine Corps Fitness Report
2017-06-01
difficulty in quantitatively analyzing textual. The study pulls 835 anonymous and non-attributable surveys between 2005 and 2009 from the Center for... quantitative assessments of performance. 14. SUBJECT TERMS natural language processing, fitness reports, computational linguistics, manpower 15. NUMBER...Corps provide word-picture guidance to distinguish talented Marines and promote conformity in issuing quantitative assessments of performance. vi
Out of the Picture, Out of the Club: Technology, Mass Media, Society, and Gender.
ERIC Educational Resources Information Center
Knupfer, Nancy Nelson; And Others
Images of society reflect the stereotypes and the realities of gender tracking, often separating males from females. The messages of gender separation begin early, laced throughout society in many ways. This paper expresses different points of view about the relationships between males and females, the computer culture, the influence of mass…
ERIC Educational Resources Information Center
Dekydtspotter, Laurent; Miller, A. Katherine
2013-01-01
Two experiments involving picture classifications investigated priming behavior in the context of "wh"-movement at clause edge and in indirect object position, respectively. In Experiment 1, intermediate L1-Chinese L2-English learners produced slower classification times (inhibitions) at clause edge, apparently induced by the computation of…
Parietal lesion effects on cued recall following pair associate learning.
Ben-Zvi, Shir; Soroker, Nachum; Levy, Daniel A
2015-07-01
We investigated the involvement of the posterior parietal cortex in episodic memory in a lesion-effects study of cued recall following pair-associate learning. Groups of patients who had experienced first-incident stroke, generally in middle cerebral artery territory, and exhibited damage that included lateral posterior parietal regions, were tested within an early post-stroke time window. In three experiments, patients and matched healthy comparison groups executed repeated study and cued recall test blocks of pairs of words (Experiment 1), pairs of object pictures (Experiment 2), or pairs of object pictures and environmental sounds (Experiment 3). Patients' brain CT scans were subjected to quantitative analysis of lesion volumes. Behavioral and lesion data were used to compute correlations between area lesion extent and memory deficits, and to conduct voxel-based lesion-symptom mapping. These analyses implicated lateral ventral parietal cortex, especially the angular gyrus, in cued recall deficits, most pronouncedly in the cross-modal picture-sound pairs task, though significant parietal lesion effects were also found in the unimodal word pairs and picture pairs tasks. In contrast to an earlier study in which comparable parietal lesions did not cause deficits in item recognition, these results indicate that lateral posterior parietal areas make a substantive contribution to demanding forms of recollective retrieval as represented by cued recall, especially for complex associative representations. Copyright © 2015 Elsevier Ltd. All rights reserved.