Comparison of carbon balance in Mediterranean pilot constructed wetlands vegetated with different C4 plant species.

PubMed

Barbera, Antonio C; Borin, Maurizio; Cirelli, Giuseppe L; Toscano, Attilio; Maucieri, Carmelo

2015-02-01

This study investigates carbon dioxide (CO2) and methane (CH4) emissions and carbon (C) budgets in a horizontal subsurface flow pilot-plant constructed wetland (CW) with beds vegetated with Cyperus papyrus L., Chrysopogon zizanioides (L.) Roberty, and Mischantus × giganteus Greef et Deu in the Mediterranean basin (Sicily) during the 1st year of plant growing season. At the end of the vegetative season, M. giganteus showed the higher biomass accumulation (7.4 kg m(-2)) followed by C. zizanioides (5.3 kg m(-2)) and C. papyrus (1.8 kg m(-2)). Significantly higher emissions of CO2 were detected in the summer, while CH4 emissions were maximum during spring. Cumulative CO2 emissions by C. papyrus and C. zizanioides during the monitoring period showed similar trends with final values of about 775 and 1,074 g m(-2), respectively, whereas M. giganteus emitted 3,395 g m(-2). Cumulative CH4 bed emission showed different trends for the three C4 plant species in which total gas release during the study period was for C. papyrus 12.0 g m(-2) and ten times higher for M. giganteus, while C. zizanioides bed showed the greatest CH4 cumulative emission with 240.3 g m(-2). The wastewater organic carbon abatement determined different C flux in the atmosphere. Gas fluxes were influenced both by plant species and monitored months with an average C-emitted-to-C-removed ratio for C. zizanioides, C. papyrus, and M. giganteus of 0.3, 0.5, and 0.9, respectively. The growing season C balances were positive for all vegetated beds with the highest C sequestered in the bed with M. giganteus (4.26 kg m(-2)) followed by C. zizanioides (3.78 kg m(-2)) and C. papyrus (1.89 kg m(-2)). To our knowledge, this is the first paper that presents preliminary results on CO2 and CH4 emissions from CWs vegetated with C4 plant species in Mediterranean basin during vegetative growth.

The C.A.M.S. 54 G.R. transatlantic seaplane (French)

NASA Technical Reports Server (NTRS)

Ide, John Jay

1928-01-01

Tested at the end of March, 1928, the C.A.M.S. 54 G.R. was built for the purpose of crossing the Atlantic from Europe by way of the azores. It has a biplane construction with wings mounted above the hull. It is powered by two new series 500 HP. geared Hispano Suiza V type engines.

GRACE-FO Spacecraft Artist Rendering

NASA Image and Video Library

2017-05-04

This artist's rendering shows the twin spacecraft of the Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission, a partnership between NASA and the German Research Centre for Geosciences (GFZ). GRACE-FO is a successor to the original GRACE mission, which began orbiting Earth on March 17, 2002. GRACE-FO will carry on the extremely successful work of its predecessor while testing a new technology designed to dramatically improve the already remarkable precision of its measurement system. The GRACE missions measure variations in gravity over Earth's surface, producing a new map of the gravity field every 30 days. Thus, GRACE shows how the planet's gravity differs not only from one location to another, but also from one period of time to another. https://photojournal.jpl.nasa.gov/catalog/PIA21607

364. J.G.M., Delineator February 1934 STATE OF CALIFORNIA; DEPARTMENT OF ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

364. J.G.M., Delineator February 1934 STATE OF CALIFORNIA; DEPARTMENT OF PUBLIC WORKS; SAN FRANCISCO - OAKLAND BAY BRIDGE; CONTRACT NO. 6; SUPERSTRUCTURE - WEST BAY CROSSING; SAN FRANCISCO ANCHORAGE CABLE BENT CASTING; AMERICAN BRIDGE CO.; AMBRIDGE PLANT; ORDER NO. G 4852 C; SHEET NO. 100 - San Francisco Oakland Bay Bridge, Spanning San Francisco Bay, San Francisco, San Francisco County, CA

A discrete event simulation model for evaluating the performances of an m/g/c/c state dependent queuing system.

PubMed

Khalid, Ruzelan; Nawawi, Mohd Kamal M; Kawsar, Luthful A; Ghani, Noraida A; Kamil, Anton A; Mustafa, Adli

2013-01-01

M/G/C/C state dependent queuing networks consider service rates as a function of the number of residing entities (e.g., pedestrians, vehicles, and products). However, modeling such dynamic rates is not supported in modern Discrete Simulation System (DES) software. We designed an approach to cater this limitation and used it to construct the M/G/C/C state-dependent queuing model in Arena software. Using the model, we have evaluated and analyzed the impacts of various arrival rates to the throughput, the blocking probability, the expected service time and the expected number of entities in a complex network topology. Results indicated that there is a range of arrival rates for each network where the simulation results fluctuate drastically across replications and this causes the simulation results and analytical results exhibit discrepancies. Detail results that show how tally the simulation results and the analytical results in both abstract and graphical forms and some scientific justifications for these have been documented and discussed.

A Discrete Event Simulation Model for Evaluating the Performances of an M/G/C/C State Dependent Queuing System

PubMed Central

Khalid, Ruzelan; M. Nawawi, Mohd Kamal; Kawsar, Luthful A.; Ghani, Noraida A.; Kamil, Anton A.; Mustafa, Adli

2013-01-01

M/G/C/C state dependent queuing networks consider service rates as a function of the number of residing entities (e.g., pedestrians, vehicles, and products). However, modeling such dynamic rates is not supported in modern Discrete Simulation System (DES) software. We designed an approach to cater this limitation and used it to construct the M/G/C/C state-dependent queuing model in Arena software. Using the model, we have evaluated and analyzed the impacts of various arrival rates to the throughput, the blocking probability, the expected service time and the expected number of entities in a complex network topology. Results indicated that there is a range of arrival rates for each network where the simulation results fluctuate drastically across replications and this causes the simulation results and analytical results exhibit discrepancies. Detail results that show how tally the simulation results and the analytical results in both abstract and graphical forms and some scientific justifications for these have been documented and discussed. PMID:23560037

The Value of Information from a GRACE-Enhanced Drought Severity Index

NASA Astrophysics Data System (ADS)

Kuwayama, Y.; Bernknopf, R.; Brookshire, D.; Macauley, M.; Zaitchik, B. F.; Rodell, M.; Vail, P.; Thompson, A.

2015-12-01

In this project, we develop a framework to estimate the economic value of information from the Gravity and Climate Experiment (GRACE) for drought monitoring and to understand how the GRACE Data Assimilation (GRACE-DA) system can inform decision making to improve regional economic outcomes. Specifically, we consider the potential societal value of further incorporating GRACE-DA information into the U.S. Drought Monitor mapmaking process. Research activities include (a) a literature review, (b) a series of listening sessions with experts and stakeholders, (c) the development of a conceptual economic framework based on a Bayesian updating procedure, and (d) an econometric analysis and retrospective case study to understand the GRACE-DA contribution to agricultural policy and production decisions. Taken together, the results from these research activities support our conclusion that GRACE-DA has the potential to lower the variance associated with our understanding of drought and that this improved understanding has the potential to change policy decisions that lead to tangible societal benefits.

Using surface displacement derived from GRACE to constrain the water loading signal in cGPS measurements in the Amazon Basin

NASA Astrophysics Data System (ADS)

Jose, L.; Bennett, R. A.; Harig, C.

2017-12-01

Currently, cGPS data is well suited to track vertical changes in the Earth's surface. However, there are annual, semi-annual, and interannual signals within cGPS time series that are not well constrained. We hypothesize that these signals are primarily due to water loading. If this is the case, the conventional method of modeling cGPS data as an annual or semiannual sinusoid falls short, as such models cannot accurately capture all variations in surface displacement, especially those due to extreme hydrologic events. We believe that we can better correct the cGPS time series with another method we are developing wherein we use a time series of surface displacement derived from the GRACE geopotential field instead of a sinusoidal model to correct the data. Currently, our analysis is constrained to the Amazon Basin, where the signal due to water loading is large enough to appear in both the GRACE and cGPS measurements. The vertical signal from cGPS stations across the Amazon Basin show an apparent spatial correlation, which further supports our idea that these signals are due to a regional water loading signal. In our preliminary research, we used tsview for Matlab to find that the WRMS of the corrected cGPS time series can be reduced as much as 30% from the model corrected data to the GRACE corrected data. The Amazon, like many places around the world, has experienced extreme drought, in 2005, 2010, and recently in 2015. In addition to making the cGPS vertical signal more robust, the method we are developing has the potential to help us understand the effects of these weather events and track trends in water loading.

Tone-assisted time delay interferometry on GRACE Follow-On

NASA Astrophysics Data System (ADS)

Francis, Samuel P.; Shaddock, Daniel A.; Sutton, Andrew J.; de Vine, Glenn; Ware, Brent; Spero, Robert E.; Klipstein, William M.; McKenzie, Kirk

2015-07-01

We have demonstrated the viability of using the Laser Ranging Interferometer on the Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) space mission to test key aspects of the interspacecraft interferometry proposed for detecting gravitational waves. The Laser Ranging Interferometer on GRACE-FO will be the first demonstration of interspacecraft interferometry. GRACE-FO shares many similarities with proposed space-based gravitational wave detectors based on the Laser Interferometer Space Antenna (LISA) concept. Given these similarities, GRACE-FO provides a unique opportunity to test novel interspacecraft interferometry techniques that a LISA-like mission will use. The LISA Experience from GRACE-FO Optical Payload (LEGOP) is a project developing tests of arm locking and time delay interferometry (TDI), two frequency stabilization techniques, that could be performed on GRACE-FO. In the proposed LEGOP TDI demonstration one GRACE-FO spacecraft will have a free-running laser while the laser on the other spacecraft will be locked to a cavity. It is proposed that two one-way interspacecraft phase measurements will be combined with an appropriate delay in order to produce a round-trip, dual one-way ranging (DOWR) measurement independent of the frequency noise of the free-running laser. This paper describes simulated and experimental tests of a tone-assisted TDI ranging (TDIR) technique that uses a least-squares fitting algorithm and fractional-delay interpolation to find and implement the delays needed to form the DOWR TDI combination. The simulation verifies tone-assisted TDIR works under GRACE-FO conditions. Using simulated GRACE-FO signals the tone-assisted TDIR algorithm estimates the time-varying interspacecraft range with a rms error of ±0.2 m , suppressing the free-running laser frequency noise by 8 orders of magnitude. The experimental results demonstrate the practicability of the technique, measuring the delay at the 6 ns level in the presence of a

Dose rate, mitotic cycle duration, and sensitivity of cell transitions from G1 $Yields$ S and G2 $Yields$ M to protracted gamma radiation in root meristems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evans, L.S.; Hof, J.V.

1975-11-01

Experiments were designed to determine the relative radiosensitivity of the cell transition points of G1 $Yields$ S and G2 $Yields$ M in root meristems of several plant species. Label and mitotic indices and microspectrophotometry were used to measure the proportions of cells in each mitotic cycle stage in root meristems after protracted gamma radiation. The criterion of radiosensitivity was the dose rate needed to produce a tissue with less than 1 percent cells in S and none in M after 3 days of continuous exposure. The results show that DNA is the primary radiation target in proliferative root meristems andmore » that the cycle duration stipulates the time interval of vulnerability. In each species, nonrandom reproducible cell proportions were established with 2C:4C:8C amounts of nuclear DNA after 3 days of exposure. Roots of Helianthus annuus, Crepis capillaris, and Tradescantia clone 02 had 80 percent cells with a 2C amount of DNA and 20 percent had a 4C amount of DNA. In these species the transition point of G1 $Yields$ S was more radiosensitive than G2 $Yields$ M. Roots of Pisum sativum and Triticum aestivum had cell proportions at 2C:4C:8C amounts of DNA in frequencies of 0.10 to 0.20:0.40 to 0.60:0.30 to 0.40. In these two species 0.30 to 0.40 cells underwent radiation-induced endoreduplication that resulted from a rapid inhibition of cell transit from G2 $Yields$ M and a slower impairment of G1 $Yields$ S. Cells increased from 2C to 4C and from 4C to 8C amounts of DNA during irradiation. The proportions of nuclei with 2C:4C:8C amounts of DNA were dependent in part upon the relative radiosensitivity of the G1 $Yields$ S and G2 $Yields$ M control points. The data show the relative radiosensitivity of the transition points from G1 $Yields$ S and from G2 $Yields$ M was species specific and unrelated to the cycle duration and mean nuclear DNA content of the plant species. (auth)« less

Effect of the improved accelerometer calibration method on AIUB's GRACE monthly gravity field solution

NASA Astrophysics Data System (ADS)

Jean, Yoomin; Meyer, Ulrich; Arnold, Daniel; Bentel, Katrin; Jäggi, Adrian

2017-04-01

The monthly global gravity field solutions derived using the measurements from the GRACE (Gravity Recovery and Climate Experiment) satellites have been continuously improved by the processing centers. One of the improvements in the processing method is a more detailed calibration of the on-board accelerometers in the GRACE satellites. The accelerometer data calibration is usually restricted to the scale factors and biases. It has been assumed that the three different axes are perfectly orthogonal in the GRACE science reference frame. Recently, it was shown by Klinger and Mayer-Gürr (2016) that a fully-populated scale matrix considering the non-orthogonality of the axes and the misalignment of the GRACE science reference frame and the GRACE accelerometer frame improves the quality of the C20 coefficient in the GRACE monthly gravity field solutions. We investigate the effect of the more detailed calibration of the GRACE accelerometer data on the C20 coefficient in the case of the AIUB (Astronomical Institute of the University of Bern) processing method using the Celestial Mechanics Approach. We also investigate the effect of the new calibration parameters on the stochastic parameters in the Celestial Mechanics Approach.

A SmallSat constellation mission architecture for a GRACE-type mission design

NASA Astrophysics Data System (ADS)

Deccia, C. M. A.; Nerem, R. S.; Yunck, T.

2017-12-01

The Gravity Recovery and Climate Experiment (GRACE) launched in 2002 and has been providing invaluable information of Earth's time-varying gravity field and GRACE-FO will continue this time series. For this work, we focus on architectures of future post-GRACE-FO like missions. Single pairs of satellites like GRACE and GRACE-FO are inherently limited in their spatio-temporal coverage. Full global coverage for a single pair can take up to 30 days for spatial resolutions of a few hundred kilometers, thus a single satellite pair is unable to observe sub-monthly signals in the Earth's time varying gravity field (e.g. hydrologic signals, etc.). Small satellite systems are becoming increasingly affordable and will soon allow a constellation of GRACE-type satellites to be deployed, with the capability to range between multiple satellites. Here, using simulation studies, we investigate the performance of such a constellation for different numbers of satellites (N) and different orbital configurations, in order to understand the improved performance that might be gained from such future mission architectures.

GRACE-FO Prelaunch Briefing

NASA Image and Video Library

2018-05-21

Phil Morton, NASA GRACE-FO project manager at JPL, second from right, discusses the Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission during a prelaunch media briefing, Monday, May 21, 2018, at Vandenberg Air Force Base in California. The twin GRACE-FO spacecraft will measure changes in how mass is redistributed within and among Earth's atmosphere, oceans, land and ice sheets, as well as within Earth itself. Photo Credit: (NASA/Bill Ingalls)

Global evaluation of new GRACE mascon products for hydrologic applications

NASA Astrophysics Data System (ADS)

Scanlon, Bridget R.; Zhang, Zizhan; Save, Himanshu; Wiese, David N.; Landerer, Felix W.; Long, Di; Longuevergne, Laurent; Chen, Jianli

2016-12-01

Recent developments in mascon (mass concentration) solutions for GRACE (Gravity Recovery and Climate Experiment) satellite data have significantly increased the spatial localization and amplitude of recovered terrestrial Total Water Storage anomalies (TWSA); however, land hydrology applications have been limited. Here we compare TWSA from April 2002 through March 2015 from (1) newly released GRACE mascons from the Center for Space Research (CSR-M) with (2) NASA JPL mascons (JPL-M), and with (3) CSR Tellus gridded spherical harmonics rescaled (sf) (CSRT-GSH.sf) in 176 river basins, ˜60% of the global land area. Time series in TWSA mascons (CSR-M and JPL-M) and spherical harmonics are highly correlated (rank correlation coefficients mostly >0.9). The signal from long-term trends (up to ±20 mm/yr) is much less than that from seasonal amplitudes (up to 250 mm). Net long-term trends, summed over all 176 basins, are similar for CSR and JPL mascons (66-69 km3/yr) but are lower for spherical harmonics (˜14 km3/yr). Long-term TWSA declines are found mostly in irrigated basins (-41 to -69 km3/yr). Seasonal amplitudes agree among GRACE solutions, increasing confidence in GRACE-based seasonal fluctuations. Rescaling spherical harmonics significantly increases agreement with mascons for seasonal fluctuations, but less for long-term trends. Mascons provide advantages relative to spherical harmonics, including (1) reduced leakage from land to ocean increasing signal amplitude, and (2) application of geophysical data constraints during processing with little empirical postprocessing requirements, making it easier for nongeodetic users. Results of this product intercomparison should allow hydrologists to better select suitable GRACE solutions for hydrologic applications.

Glacial isostatic adjustment on the Northern Hemisphere - new results from GRACE

NASA Astrophysics Data System (ADS)

Mueller, J.; Steffen, H.; Gitlein, O.; Denker, H.; Timmen, L.

2007-12-01

The Earth's gravity field mapped by the Gravity Recovery and Climate Experiment (GRACE) satellite mission shows variations due to the integral effect of mass variations in the atmosphere, hydrosphere and geosphere. The Earth's gravity field is provided in form of monthly solutions by several institutions, e.~g. GFZ Potsdam, CSR and JPL. During the GRACE standard processing of these analysis centers, oceanic and atmospheric contributions as well as tidal effects are reduced. The solutions of the analysis centers differ slightly, which is due the application of different reduction models and center-specific processing schemes. We present our investigation of mass variations in the areas of glacial isostatic adjustment (GIA) in North America and Northern Europe from GRACE data. One key issue is the separation of GIA parts and the reduction of the observed quantities by applying dedicated filters (e.~g. isotropic, non-isotropic, and destriping filters) and global models of hydrological variations (e.~g. WGHM, LaDWorld, GLDAS). In a further step, we analyze the results of both regions regarding their reliability, and finally present a comparison to results of a geodynamical modeling and absolute gravity measurements. Our results clearly show that the quality of the GRACE-derived gravity- change signal benefits from improved reduction models and chosen analysis techniques. Nevertheless, the comparison to results of geodynamic models still reveals differences, and thus further studies are in progress.

GRACE Status at Mission End

NASA Astrophysics Data System (ADS)

Tapley, B. D.; Flechtner, F. M.; Watkins, M. M.; Bettadpur, S. V.

2017-12-01

The twin satellites of the Gravity Recovery and Climate Experiment (GRACE) were launched on March 17, 2002 and have operated for nearly 16 years. The mission objectives are to observe the spatial and temporal variations of the Earth's mass through its effects on the gravity field at the GRACE satellite altitude. The mass changes observed are related to both the changes within the solid earth and the change within and between the Erath system components. A significant cause of the time varying mass is water motion and the GRACE mission has provided a continuous decade long measurement sequence which characterizes the seasonal cycle of mass transport between the oceans, land, cryosphere and atmosphere; its inter-annual variability; and the climate driven secular, or long period, mass transport signals. The fifth reanalysis on the mission data set, the RL05 data, were released in mid-2013. With the planned launch of GRACE Follow-On in early 2018, plans are underway for a reanalysis that will be consistent with the GRACE FO processing standards. The mission is entering the final phases of its operation life with mission end expected to occur in early 2018. The current mission operations strategy emphasizes extending the mission lifetime to obtain an overlap with the GRACE FO. This presentation will review the mission status and the projections for mission lifetime, describe the current operations philosophy and its impact on the science data, discuss the issues related to achieving the GRACE and GRACE FO connection and discuss issues related to science data products during this phase of the mission period.

Progress towards CSR RL06 GRACE gravity solutions

NASA Astrophysics Data System (ADS)

Save, Himanshu

2017-04-01

The GRACE project plans to re-processes the GRACE mission data in order to be consistent with the first gravity products released by the GRACE-FO project. The next generation Release-06 (RL06) gravity products from GRACE will include the improvements in GRACE Level-1 data products, background gravity models and the processing methodology. This paper will outline the planned improvements for CSR - RL06 and discuss the preliminary results. This paper will discuss the evolution of the quality of the GRACE solutions, especially over the past few years. We will also discuss the possible challenges we may face in connecting/extending the measurements of mass fluxes from the GRACE era to the GRACE-FO era due quality of the GRACE solutions from recent years.

Grace and Courtesy and Beyond

ERIC Educational Resources Information Center

Schaefer, Pat

2015-01-01

Taking up the cause of grace and courtesy across the planes of education, Pat Schaefer tells of the grace and courtesy of successive planes within a school culture and gives a glimpse of how the Montessori vision of a new society can look. Grace and courtesy go well beyond the practice of manners and into the topic of deep observation and…

A 1985-2015 data-driven global reconstruction of GRACE total water storage

NASA Astrophysics Data System (ADS)

Humphrey, Vincent; Gudmundsson, Lukas; Isabelle Seneviratne, Sonia

2016-04-01

After thirteen years of measurements, the Gravity Recovery and Climate Experiment (GRACE) mission has enabled for an unprecedented view on total water storage (TWS) variability. However, the relatively short record length, irregular time steps and multiple data gaps since 2011 still represent important limitations to a wider use of this dataset within the hydrological and climatological community especially for applications such as model evaluation or assimilation of GRACE in land surface models. To address this issue, we make use of the available GRACE record (2002-2015) to infer local statistical relationships between detrended monthly TWS anomalies and the main controlling atmospheric drivers (e.g. daily precipitation and temperature) at 1 degree resolution (Humphrey et al., in revision). Long-term and homogeneous monthly time series of detrended anomalies in total water storage are then reconstructed for the period 1985-2015. The quality of this reconstruction is evaluated in two different ways. First we perform a cross-validation experiment to assess the performance and robustness of the statistical model. Second we compare with independent basin-scale estimates of TWS anomalies derived by means of combined atmospheric and terrestrial water-balance using atmospheric water vapor flux convergence and change in atmospheric water vapor content (Mueller et al. 2011). The reconstructed time series are shown to provide robust data-driven estimates of global variations in water storage over large regions of the world. Example applications are provided for illustration, including an analysis of some selected major drought events which occurred before the GRACE era. References Humphrey V, Gudmundsson L, Seneviratne SI (in revision) Assessing global water storage variability from GRACE: trends, seasonal cycle, sub-seasonal anomalies and extremes. Surv Geophys Mueller B, Hirschi M, Seneviratne SI (2011) New diagnostic estimates of variations in terrestrial water storage

Ice loading model for Glacial Isostatic Adjustment in the Barents Sea constrained by GRACE gravity observations

NASA Astrophysics Data System (ADS)

Root, Bart; Tarasov, Lev; van der Wal, Wouter

2014-05-01

The global ice budget is still under discussion because the observed 120-130 m eustatic sea level equivalent since the Last Glacial Maximum (LGM) can not be explained by the current knowledge of land-ice melt after the LGM. One possible location for the missing ice is the Barents Sea Region, which was completely covered with ice during the LGM. This is deduced from relative sea level observations on Svalbard, Novaya Zemlya and the North coast of Scandinavia. However, there are no observations in the middle of the Barents Sea that capture the post-glacial uplift. With increased precision and longer time series of monthly gravity observations of the GRACE satellite mission it is possible to constrain Glacial Isostatic Adjustment in the center of the Barents Sea. This study investigates the extra constraint provided by GRACE data for modeling the past ice geometry in the Barents Sea. We use CSR release 5 data from February 2003 to July 2013. The GRACE data is corrected for the past 10 years of secular decline of glacier ice on Svalbard, Novaya Zemlya and Frans Joseph Land. With numerical GIA models for a radially symmetric Earth, we model the expected gravity changes and compare these with the GRACE observations after smoothing with a 250 km Gaussian filter. The comparisons show that for the viscosity profile VM5a, ICE-5G has too strong a gravity signal compared to GRACE. The regional calibrated ice sheet model (GLAC) of Tarasov appears to fit the amplitude of the GRACE signal. However, the GRACE data are very sensitive to the ice-melt correction, especially for Novaya Zemlya. Furthermore, the ice mass should be more concentrated to the middle of the Barents Sea. Alternative viscosity models confirm these conclusions.

Purification, cDNA cloning, and characterization of LysM-containing plant chitinase from horsetail (Equisetum arvense).

PubMed

Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki

2015-01-01

Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.

Evolution and characterization of drought events from GRACE and other satellite and observation.

NASA Astrophysics Data System (ADS)

Zhao, M.; A, G.; Velicogna, I.; Kimball, J. S.

2015-12-01

We use GRACE Terrestrial Water Storage (TWS) changes to calculate a newly developed global drought severity index (GRACE-DSI) for monthly monitoring of water supply changes during 2002-2015. We compare GRACE-DSI with Palmer Drought Severity Index (PDSI) and other ancillary data to characterize drought timing, evolution and magnitude in the continental US since 2002. Overall GRACE-DSI and PDSI show an excellent correspondence in the US. However PDSI is very sensitive to atmospheric moisture stress, while GRACE-DSI only responds to changes in terrestrial water storage. We use the complementary nature of these two indices together with temperature and precipitation observations to characterize drought evolution and its nature. For instance, during the 2012 flash drought in the Great Plains, the PDSI decreases several months earlier than the GRACE-DSI in response to the enhanced atmosphere moisture demand caused by unusual early season warming. When the drought peaks later in the summer, the PDSI indicates exceptional drought, while the GRACE-DSI observes moderate drought conditions in the underlying total water supply, implying a meteorological drought in nature. GRACE-DSI is based solely on satellite observations; hence it has the advantage of not being affected by uncertainty associated with variable that are not well known at the global scale (e.g. precipitation estimates) and by biases associated to global climate model outputs. We find that GRACE-DSI captures major drought events in the globe occurring during 2002-2015, including those in sub-Sahara Africa, Australia, Amazon, Asia, North America and the Arctic.

GRACE Accelerometer data transplant

NASA Astrophysics Data System (ADS)

Bandikova, T.; McCullough, C. M.; Kruizinga, G. L. H.

2017-12-01

The Gravity Recovery and Climate Experiment (GRACE) has recently celebrated its 15th anniversary. The aging of the satellites brings along new challenges for both mission operation and science data delivery. Since September 2016, the accelerometer (ACC) onboard GRACE-B has been permanently turned off in order to reduce the battery load. The absence of the information about the non-gravitational forces acting on the spacecraft dramatically decreases the accuracy of the monthly gravity field solutions. The missing GRACE-B accelerometer data, however, can be recovered from the GRACE-A accelerometer measurement with satisfactory accuracy. In the current GRACE data processing, simple ACC data transplant is used which includes only attitude and time correction. The full ACC data transplant, however, requires not only the attitude and time correction, but also modeling of the residual accelerations due to thruster firings, which is the most challenging part. The residual linear accelerations ("thruster spikes") are caused by thruster imperfections such as misalignment of thruster pair, force imbalance or differences in reaction time. The thruster spikes are one of the most dominant high-frequency signals in the ACC measurement. The shape and amplitude of the thruster spikes are unique for each thruster pair, for each firing duration (30 ms - 1000 ms), for each x,y,z component of the ACC linear acceleration, and for each spacecraft. In our approach, the thruster spike model is an analytical function obtained by inverse Laplace transform of the ACC transfer function. The model shape parameters (amplitude, width and time delay) are estimated using Least squares method. The ACC data transplant is validated for days when ACC data from both satellites were available. The fully transplanted data fits the original GRACE-B measurement very well. The full ACC data transplant results in significantly reduced high frequency noise compared to the simple ACC transplant (i.e. without

A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

Determination of groundwater abstractions by means of GRACE data and Artificial Neural Networks

NASA Astrophysics Data System (ADS)

Gemitzi, Alexandra; Tsagkarakis, Konstantinos; Lakshmi, Venkat

2017-04-01

The EU Water Framework Directive requires for each groundwater body the determination of annual average rates of abstraction from all points providing more than 10m3 per day as well as groundwater level monitoring, so as to ensure that the available groundwater resource is not exceeded by the long-term annual average rate of abstraction. In order to acquire such information in situ observation networks are necessary. However, there are cases, e.g. Greece where WFD monitoring programme has not yet become operational due to bureaucratic, socioeconomic and often political constraints. The present study aims at determining groundwater use at the aquifer scale by using Gravity Recovery and Climate Experiment (GRACE) satellite data coupled with readily available meteorological data. Traditionally, GRACE data have been used at the global and regional scale due to their coarse resolution and the difficulties in disaggregating the various Total Water Storage (TWS) components. Previous works have evaluated the subsurface anomalies (ΔGW), using supplementary data sets and hydrologic modeling results in order to disaggregate GRACE TWS anomalies into their various components. Recent works however, have shown that changes in groundwater storage are dominating the GRACE Total Water Storage (TWS) changes, therefore it was though reasonable to use changes in Grace derived TWS in order to quantify abstractions from a groundwater body. Statistical downscaling was performed using an Artificial Neural Network in the form a Multilayer Perceptron model, in conjunction with local meteorological data. An ensemble of 100 ANNs provided a means of quantifying uncertainty and improving generalization. The methodology was applied in Rhodope area (NE Greece) and proved to be an efficient way of downscaling GRACE data in order to estimate the monthly quantity of water extracted from a certain aquifer. Although our methodology does not aim at estimating abstractions at single points, it manages

What GRACE/GRACE-FO satellite gravity may tell about the atmosphere (and what not)

NASA Astrophysics Data System (ADS)

Eicker, Annette; Springer, Anne; Hense, Andreas; Panet, Isabelle; Kusche, Jürgen

2017-04-01

In this presentation we would like to discuss the present benefit and future potential of satellite gravity observations, as obtained from the satellite mission GRACE and its successor GRACE-Follow-On (GRACE-FO), for studying the atmospheric water cycle. In the first part of the presentation, we will show recent results of using GRACE to constrain atmospheric water budgets. GRACE-derived water storage changes (in combination with observed runoff) can be used to solve for the vertical water flux deficit of precipitation (P) minus evapotranspiration (E), which links the terrestrial and the atmospheric water balance equations. This relates gravity change to moisture flux divergence and water vapor change and thus provides, in principle, a link between GRACE/GRACE-FO and (area-averaged) GNSS integrated water vapor observations that may be exploited in the future. We will show that such an independent estimate of P minus E can be used to constrain land-atmosphere fluxes from monthly time scales to decadal trends and even provides meaningful flux information down to daily time steps. In the second part of the presentation, we would like to give an outlook towards the potential of using satellite gravity data directly for the estimation of atmospheric water mass changes. On the basis of ERA-Interim data, we provide a first assessment which suggests that an anticipated future double-pair gravity mission with enhanced temporal and spatial resolution would be sensitive to 'feeling' atmospheric water mass (water vapor) variations. However, whether these (faster) variations could be separated from dry air mass variations through modeling needs to be investigated. If possible, this would offer a completely new tool for validating atmospheric analyses and for improving engergy and mass budgets in models.

Cumulative Total Middle East/North Africa Freshwater Losses as Seen by NASA GRACE, 2002-15

NASA Image and Video Library

2015-12-08

Cumulative total freshwater losses in North Africa and the Middle East from 2002 to 2015 (in inches) observed by NASA's Gravity Recovery and Climate Experiment (GRACE) mission. Total water refers to all of the snow, surface water, soil water and groundwater combined. Groundwater depletion in Turkey, Syria, Iraq and Iran, and along the Arabian Peninsula, are leading to large changes in total water storage in the region. Likewise, drought and groundwater pumping is contributing to the drying of the Caspian Sea Region. The Northwest Sahara Aquifer System, which underlies Tunisia and Libya, is also experiencing increasing water stress as shown in the map. Image updated from Voss et al., 2013. Citation of Record: Voss, K. A., J. S. Famiglietti, M. Lo, C. R. de Linage, M. Rodell and S. C. Swenson, Groundwater depletion in the Middle East from GRACE with Implications for Transboundary Water Management in the Tigris-Euphrates-Western Iran Region, Wat. Resour. Res., 49(2), 904-914, DOI: 10.1002/wrcr.20078. http://photojournal.jpl.nasa.gov/catalog/PIA20207

Multicentre physiological reference intervals for serum concentrations of immunoglobulins A, G and M, complement C3c and C4 measured with Tina-Quant reagents systems.

PubMed

Fuentes-Arderiu, Xavier; Alonso-Gregorio, Eduardo; Alvarez-Funes, Virtudes; Ambrós-Marigómez, Carmen; Coca-Fábregas, Lluís; Cruz-Placer, Marta; Díaz-Fernández, Julián; Pinel-Julián, María Pilar; Gutiérrez-Cecchini, Beatriz; Herrero-Bernal, Pilar; Sempere-Alcocer, Marcos; García-Caballero, Francisca; Del Mar Larrea-Ortiz-Quintana, María; La-Torre-Marcellán, Pedro; Del Señor López-Vélez, María; Mar-Medina, Carmen; Martín-Oncina, Javier; Rodríguez-Hernández, María Victoria; Romero-Sotomayor, María Victoria; Serrano-López, Cándido; Sicilia-Enríquez-de-Salamanca, Adolfo; Velasco-Romero, Ana María; Juvé-Cuxart, Santiago

2007-01-01

Clinical laboratories seeking accreditation for compliance with ISO 15189:2003 need to demonstrate that the physiological reference intervals communicated to all users of the laboratory service are appropriate for the patient population served and for the measurement systems used. In the case of immunological quantities, few articles have been published in peer-reviewed journals. A total of 21 clinical laboratories in different regions of Spain collaborated in identifying reference individuals and determining adult reference intervals for some immunological quantities measured using RD/Hitachi Modular Analytics analysers and Tina-Quant reagent systems. These immunological quantities are the mass concentrations of immunoglobulin A, immunoglobulin G, immunoglobulin M, complement C3c and complement C4 in serum. All the logistic work was carried out in co-operation with the supplier of the reagents and analysers (Roche Diagnostics España, S.L., Sant Cugat del Vallès, Catalonia, Spain). From the set of reference values obtained by each laboratory, multicentre reference limits were estimated non-parametrically. The reference intervals estimated in this study for concentrations of serum components under consideration are: complement C3c, 0.62-1.64 g/L for women and men; complement C4, 0.14-0.72 g/L for women and men; immunoglobulin A, 0.89-4.80 g/L for women and men; immunoglobulin G, 6.5-14.3 g/L for women and men; and immunoglobulin M, 0.48-3.38 g/L for women and 0.41-2.46 g/L for men.

Integration of GRACE and GNET GPS in modeling the deglaciation of Greenland

NASA Astrophysics Data System (ADS)

Knudsen, P.; Madsen, F. B.; Khan, S. A.; Bevis, M. G.; van Dam, T. M.

2017-12-01

The use the monthly gravity fields from the Gravity Recovery and Climate Experiment (GRACE) has become essential when assessing and modeling the mass changes of the ice sheets. The recent degradation of the current mission, however, has hampered the continuous monitoring of ice sheet masses, at least until GRACE Follow-On mission will become operational. Through the recent years it has been demonstrated that mass changes can be observed by GPS receivers mounted on the adjacent bedrock. Especially, the Greenland GPS Network (GNET) has proven that GPS is a valuable technique for detecting mass changes through the Earths elastic response. An integration of GNET with other observations of the Greenland ice sheet, e.g. satellite altimetry and GRACE, has made studies of GIA progressing significantly. In this study, we aim at improving the monitoring of the ice sheet mass by utilizing the redundancy for reducing the influence of errors and to fill in at data voids and, not at least to bridge the gap between GRACE and GRACE FO. Initial analyses are carried out to link GRACE and GNET time series empirically. EOF analyses are carried out to extract the main part of the variability and to isolate errors. Subsequently, empirical covariance functions are derived and used in the integration. Preliminary results are derived and inter-compared.

Antarctic mass balance changes from GRACE

NASA Astrophysics Data System (ADS)

Kallenberg, B.; Tregoning, P.

2012-04-01

The Antarctic ice sheet contains ~30 million km3 of ice and constitutes a significant component of the global water balance with enough freshwater to raise global sea level by ~60 m. Altimetry measurements and climate models suggest variable behaviour across the Antarctic ice sheet, with thickening occurring in a vast area of East Antarctica and substantial thinning in West Antarctica caused by increased temperature gradients in the surrounding ocean. However, the rate at which the polar ice cap is melting is still poorly constrained. To calculate the mass loss of an ice sheet it is necessary to separate present day mass balance changes from glacial isostatic adjustment (GIA), the response of the Earth's crust to mass loss, wherefore it is essential to undertake sufficient geological and geomorphological sampling. As there is only a limited possibility for this in Antarctica, all models (i.e. geological, hydrological as well as atmospheric) are very poorly constrained. Therefore, space-geodetic observations play an important role in detecting changes in mass and spatial variations in the Earth's gravity field. The Gravity Recovery And Climate Experiment (GRACE) observed spatial variations in the Earth's gravity field over the past ten years. The satellite detects mass variations in the Earth system including geophysical, hydrological and atmospheric shifts. GRACE itself is not able to separate the GIA from mass balance changes and, due to the insufficient geological and geomorphological database, it is not possible to model the GIA effect accurately for Antarctica. However, the results from GRACE can be compared with other scientific results, coming from other geodetic observations such as satellite altimetry and GPS or by the use of geological observations. In our contribution we compare the GRACE data with recorded precipitation patterns and mass anomalies over East Antarctica to separate the observed GRACE signal into its two components: GIA as a result of mass

Progress towards daily "swath" solutions from GRACE

NASA Astrophysics Data System (ADS)

Save, H.; Bettadpur, S. V.; Sakumura, C.

2015-12-01

The GRACE mission has provided invaluable and the only data of its kind that measures the total water column in the Earth System over the past 13 years. The GRACE solutions available from the project have been monthly average solutions. There have been attempts by several groups to produce shorter time-window solutions with different techniques. There is also an experimental quick-look GRACE solution available from CSR that implements a sliding window approach while applying variable daily data weights. All of these GRACE solutions require special handling for data assimilation. This study explores the possibility of generating a true daily GRACE solution by computing a daily "swath" total water storage (TWS) estimate from GRACE using the Tikhonov regularization and high resolution monthly mascon estimation implemented at CSR. This paper discusses the techniques for computing such a solution and discusses the error and uncertainty characterization. We perform comparisons with official RL05 GRACE solutions and with alternate mascon solutions from CSR to understand the impact on the science results. We evaluate these solutions with emphasis on the temporal characteristics of the signal content and validate them against multiple models and in-situ data sets.

Estimation of the Earth's gravity field by combining normal equation matrices from GRACE and SLR

NASA Astrophysics Data System (ADS)

Haberkorn, Christoph; Bloßfeld, Mathis; Bouman, Johannes

2014-05-01

Since 2002, GRACE observes the Earth's gravity field with a spatial resolution up to 150 km. The main goal of this mission is the determination of temporal variations in the Earth's gravity field to detect mass displacements. The GRACE mission consists of two identical satellites, which observe the range along the line of sight of both satellites. GRACE observations can be linked with the Earth's gravitational potential, which is expressed in terms of spherical harmonics for global solutions. However, the estimation of low degree coefficients is difficult with GRACE. In contrast to gravity field missions, which observe the gravity field with high spectral resolution, SLR data allow to estimate the lower degree coefficients. Therefore, the coefficient C20 is often replaced by a value derived from Satellite Laser Ranging (SLR). Instead of replacing C20, it can be determined consistently by a combined estimation using GRACE and SLR data. We compute monthly normal equation (NEQ) matrices for GRACE and SLR. Coefficients from monthly GRACE gravity field models of different institutions (Center for Space Research (CSR), USA, Geoforschungszentrum Potsdam (GFZ), Germany and Jet Propulsion Laboratory (JPL), USA) and coefficients from monthly gravity field models of our SLR processing are then combined using the NEQ matrices from both techniques. We will evaluate several test scenarios with gravity field models from different institutions and with different set ups for the SLR NEQ matrices. The effect of the combination on the estimated gravity field will be analysed and presented.

Antarctic Ice Mass Balance from GRACE

NASA Astrophysics Data System (ADS)

Boening, C.; Firing, Y. L.; Wiese, D. N.; Watkins, M. M.; Schlegel, N.; Larour, E. Y.

2014-12-01

The Antarctic ice mass balance and rates of change of ice mass over the past decade are analyzed based on observations from the Gravity Recovery and Climate Experiment (GRACE) satellites, in the form of JPL RL05M mascon solutions. Surface mass balance (SMB) fluxes from ERA-Interim and other atmospheric reanalyses successfully account for the seasonal GRACE-measured mass variability, and explain 70-80% of the continent-wide mass variance at interannual time scales. Trends in the residual (GRACE mass - SMB accumulation) mass time series in different Antarctic drainage basins are consistent with time-mean ice discharge rates based on radar-derived ice velocities and thicknesses. GRACE also resolves accelerations in regional ice mass change rates, including increasing rates of mass gain in East Antarctica and accelerating ice mass loss in West Antarctica. The observed East Antarctic mass gain is only partially explained by anomalously large SMB events in the second half of the record, potentially implying that ice discharge rates are also decreasing in this region. Most of the increasing mass loss rate in West Antarctica, meanwhile, is explained by decreasing SMB (principally precipitation) over this time period, part of the characteristic decadal variability in regional SMB. The residual acceleration of 2+/-1 Gt/yr, which is concentrated in the Amundsen Sea Embayment (ASE) basins, represents the contribution from increasing ice discharge rates. An Ice Sheet System Model (ISSM) run with constant ocean forcing and stationary grounding lines both underpredicts the largest trends in the ASE and produces negligible acceleration or interannual variability in discharge, highlighting the potential importance of ocean forcing for setting ice discharge rates at interannual to decadal time scales.

Contributions of GRACE to Climate Monitoring

NASA Technical Reports Server (NTRS)

Rodell, Matthew; Famiglietti, James; Chambers, Don P.; Wahr, John

2011-01-01

The NASA/German Gravity Recovery and Climate Experiment (GRACE) was launched in March 2002. Rather than looking downward, GRACE continuously monitors the locations of and precise distance between twin satellites which orbit in tandem about 200 km apart. Variations in mass near Earth's surface cause heterogeneities in its gravity field, which in turn affect the orbits of satellites. Thus scientists can use GRACE data to map Earth's gravity field with enough accuracy to discern month to month changes caused by ocean circulation and redistribution of water stored on and in the land. Other gravitational influences, such as atmospheric circulation, post-glacial rebound, and solid earth movements are either independently determined and removed or are negligible on a monthly to sub-decadal timescale. Despite its coarse spatial (>150,000 sq km at mid-latitudes) and temporal (approx monthly) resolutions, GRACE has enabled significant advancements in the oceanic, hydrologic, and cryospheric science, and has great potential for climate monitoring, because it is the only global observing system able to measure ocean bottom pressures, total terrestrial water storage, and ice mass changes. The best known GRACE results are estimates of Greenland and Antarctic ice sheet loss rates. Previously, scientists had estimated ice mass losses using ground and satellite based altimetry and surface mass balance estimates based on snowfall accumulation and glacier discharge. While such measurements are still very useful for their spatial detail, they are imperfectly correlated with large-scale ice mass changes, due to snow and ice compaction and incomplete spatial coverage. GRACE enables scientists to generate monthly time series of Greenland and Antarctic ice mass, which have confirmed the shrinking of the polar ice sheets, one of the most obvious and indisputable manifestations of climate change. Further, GRACE has located and quantified hot spots of ice loss in southeastern Greenland and

Addressing the challenges of GRACE application in basins with hydraulic fracturing activity

NASA Astrophysics Data System (ADS)

Read, L.; Ruybal, C.; Hogue, T. S.; Hinojosa, M. P.

2016-12-01

Despite the growing number of studies that employ GRACE to quantify groundwater resources we have found no published studies on whether GRACE is also accounting for subsurface mass redistributions related to energy development activities from oil production, water production, and wastewater injection. Given the similar densities of water and crude oil (water is 1.0g/cc, crude oil is 0.8-0.9g/cc) and the fact that large volumes of oil and water are extracted on a monthly basis for hydraulic fracturing or reinjected as a means of waste disposal, it is important to determine whether GRACE is detecting mass redistributions from energy development to be able to correctly infer changes in water mass. The purpose of this study is to investigate whether GRACE measurements are impacted by energy development activities and offer a methodology for determining whether this activity should be considered when evaluating changes in terrestrial water storage, groundwater storage, or any other prediction involving quantification of groundwater. To address this question we compiled a dataset from the Bakken Play in North Dakota to use as a case study, where oil production was significant and increased exponentially from 2002-2015, and groundwater withdrawals for agriculture were relatively stable and limited. Preliminary results indicate that oil and gas production is of a similar scale and thus important to include when calculating groundwater changes. Broadly, this research addresses the challenges and uncertainties in applying GRACE to quantify groundwater or terrestrial water changes in energy-active basins, namely in accounting for oil reservoir changes, production, and injection rates, as well as the process of data collection in proprietary systems.

GRACE-FO Prelaunch Briefing

NASA Image and Video Library

2018-05-21

NASA Headquarters Public Affairs Officer Steve Cole moderates a Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission prelaunch media briefing, Monday, May 21, 2018, at Vandenberg Air Force Base in California. The twin GRACE-FO spacecraft will measure changes in how mass is redistributed within and among Earth's atmosphere, oceans, land and ice sheets, as well as within Earth itself. Photo Credit: (NASA/Bill Ingalls)

Basin-Scale Freshwater Storage Trends from GRACE

NASA Astrophysics Data System (ADS)

Famiglietti, J.; Kiel, B.; Frappart, F.; Syed, T. H.; Rodell, M.

2006-12-01

Four years have passed since the GRACE satellite tandem began recording variations in Earth's gravitational field. On monthly to annual timescales, variations in the gravity signal for a given location correspond primarily to changes in water storage. GRACE thus reveals, in a comprehensive, vertically-integrated manner, which areas and basins have experienced net increases or decreases in water storage. GRACE data (April 2002 to November 2005) released by the Center for Space Research at the University of Texas at Austin (RL01) is used for this study. Model-based data from GLDAS (Global Land Data Assimilation System) is integrated into this study for comparison with the CSR GRACE data. Basin-scale GLDAS storage trends are similar to those from GRACE, except in the Arctic, likely due to the GLDAS snow module. Outside of the Arctic, correlation of GRACE and GLDAS data confirms significant basin-scale storage trends across the GRACE data collection period. Sharp storage decreases are noted in the Congo, Zambezi, Mekong, Parana, and Yukon basins, among others. Significant increases are noted in the Niger, Lena, and Volga basins, and others. Current and future work involves assessment of these trends and their causes in the context of hydroclimatological variability.

Can GRACE detect winter snows in Japan?

NASA Astrophysics Data System (ADS)

Heki, Kosuke

2010-05-01

Current spatial resolution of the GRACE (Gravity Recovery and Climate Experiment) satellites is 300-400 km, and so its hydrological applications have been limited to continents and large islands. The Japanese Islands have width slightly smaller than this spatial resolution, but are known to show large amplitude seasonal changes in surface masses due mainly to winter snow. Such loads are responsible for seasonal crustal deformation observed with GEONET, a dense array of GPS (Global Positioning System) receivers in Japan (Heki, 2001). There is also a dense network of surface meteorological sensors for, e.g. snow depths, atmospheric pressures, etc. Heki (2004) showed that combined effects of surface loads, i.e. snow (predominant), atmosphere, soil moisture, dam impoundment, can explain seasonal crustal deformation observed by GPS to a large extent. The total weight of the winter snow in the Japanese Islands in its peak season may reach ~50 Gt. This is comparable to the annual loss of mountain glaciers in the Asian high mountains (Matsuo & Heki, 2010), and is above the detection level of GRACE. In this study, I use GRACE Level-2 Release-4 data from CSR, Univ. Texas, up to 2009 November, and evaluated seasonal changes in surface loads in and around the Japanese Islands. After applying a 350 km Gaussian filter and a de-striping filter, the peak-to-peak change of the water depth becomes ~4 cm in northern Japan. The maximum value is achieved in February-March. The region of large winter load spans from Hokkaido, Japan, to northeastern Honshu, which roughly coincides with the region of deep snow in Japan. Next I compiled snow depth data from surface meteorological observations, and converted them to loads using time-dependent snow density due to compaction. By applying the same spatial filter as the GRACE data, its spatial pattern becomes similar to the GRACE results. The present study suggests that GRACE is capable of detecting seasonal mass changes in an island arc not

C3G dynamically associates with nuclear speckles and regulates mRNA splicing.

PubMed

Shakyawar, Dhruv Kumar; Muralikrishna, Bhattiprolu; Radha, Vegesna

2018-05-01

C3G (Crk SH3 domain binding guanine nucleotide releasing factor) (Rap guanine nucleotide exchange factor 1), essential for mammalian embryonic development, is ubiquitously expressed and undergoes regulated nucleocytoplasmic exchange. Here we show that C3G localizes to SC35-positive nuclear speckles and regulates splicing activity. Reversible association of C3G with speckles was seen on inhibition of transcription and splicing. C3G shows partial colocalization with SC35 and is recruited to a chromatin and RNase-sensitive fraction of speckles. Its presence in speckles is dependent on intact cellular actin cytoskeleton and is lost on expression of the kinase Clk1. Rap1, a substrate of C3G, is also present in nuclear speckles, and inactivation of Rap signaling by expression of GFP-Rap1GAP alters speckle morphology and number. Enhanced association of C3G with speckles is seen on glycogen synthase kinase 3 beta inhibition or differentiation of C2C12 cells to myotubes. CRISPR/Cas9-mediated knockdown of C3G resulted in altered splicing activity of an artificial gene as well as endogenous CD44. C3G knockout clones of C2C12 as well as MDA-MB-231 cells showed reduced protein levels of several splicing factors compared with control cells. Our results identify C3G and Rap1 as novel components of nuclear speckles and a role for C3G in regulating cellular RNA splicing activity.

Bridging a possible gap of GRACE observations in the Arctic Ocean using existing GRACE data and in situ bottom pressure sensors

NASA Astrophysics Data System (ADS)

Peralta Ferriz, C.; Morison, J.

2014-12-01

Since 2003, the Gravity Recovery and Climate Experiment (GRACE) satellite system has provided the means of investigating month-to-month to inter-annual variability of, among many other things, Arctic Ocean circulation over the entire Arctic Basin. Such a comprehensive picture could not have been achieved with the limited in situ pressure observations available. Results from the first 10 years of ocean bottom pressure measurements from GRACE in the Arctic Ocean reveal distinct patterns of ocean variability that are strongly associated with changes in large-scale atmospheric circulation (Peralta-Ferriz et al., 2014): the leading mode of variability being a wintertime basin-coherent mass change driven by winds in the Nordic Seas; the second mode of variability corresponding to a mass signal coherent along the Siberian shelves, and driven by the Arctic Oscillation; and the third mode being a see-saw between western and eastern Arctic shelves, also driven by the large-scale wind patterns. In order to understand Arctic Ocean changes, it is fundamental to continue to track ocean bottom pressure. Our concern is what to do if the present GRACE system, which is already well beyond its design lifetime, should fail before its follow-on is launched, currently estimated to be in 2017. In this work, we regress time series of pressure from the existing and potential Arctic Ocean bottom pressure recorder locations against the fundamental modes of bottom pressure variation. Our aim is to determine the optimum combination of in situ measurements to represent the broader scale variability now observed by GRACE. With this understanding, we can be better prepared to use in situ observations to at least partially cover a possible gap in GRACE coverage. Reference:Peralta-Ferriz, Cecilia, James H. Morison, John M. Wallace, Jennifer A. Bonin, Jinlun Zhang, 2014: Arctic Ocean Circulation Patterns Revealed by GRACE. J. Climate, 27, 1445-1468. doi: http://dx.doi.org/10.1175/JCLI-D-13-00013.1

Grace and Courtesy: Empowering Children, Liberating Adults

ERIC Educational Resources Information Center

Sackett, Ginni

2015-01-01

Ginni Sackett delves into the many implications of grace and courtesy, from social relations and the basis of community to respect for the child's personality. Her point of departure is modern social living with grace and dignity. Hers is an exploration over two generations of seeing grace and courtesy as a comprehensive social view that is the…

High-resolution CSR GRACE RL05 mascons

NASA Astrophysics Data System (ADS)

Save, Himanshu; Bettadpur, Srinivas; Tapley, Byron D.

2016-10-01

The determination of the gravity model for the Gravity Recovery and Climate Experiment (GRACE) is susceptible to modeling errors, measurement noise, and observability issues. The ill-posed GRACE estimation problem causes the unconstrained GRACE RL05 solutions to have north-south stripes. We discuss the development of global equal area mascon solutions to improve the GRACE gravity information for the study of Earth surface processes. These regularized mascon solutions are developed with a 1° resolution using Tikhonov regularization in a geodesic grid domain. These solutions are derived from GRACE information only, and no external model or data is used to inform the constraints. The regularization matrix is time variable and will not bias or attenuate future regional signals to some past statistics from GRACE or other models. The resulting Center for Space Research (CSR) mascon solutions have no stripe errors and capture all the signals observed by GRACE within the measurement noise level. The solutions are not tailored for specific applications and are global in nature. This study discusses the solution approach and compares the resulting solutions with postprocessed results from the RL05 spherical harmonic solutions and other global mascon solutions for studies of Arctic ice sheet processes, ocean bottom pressure variation, and land surface total water storage change. This suite of comparisons leads to the conclusion that the mascon solutions presented here are an enhanced representation of the RL05 GRACE solutions and provide accurate surface-based gridded information that can be used without further processing.

Seismologic applications of GRACE time-variable gravity measurements

NASA Astrophysics Data System (ADS)

Li, Jin; Chen, Jianli; Zhang, Zizhan

2014-04-01

The Gravity Recovery and Climate Experiment (GRACE) has been measuring temporal and spatial variations of mass redistribution within the Earth system since 2002. As large earthquakes cause significant mass changes on and under the Earth's surface, GRACE provides a new means from space to observe mass redistribution due to earthquake deformations. GRACE serves as a good complement to other earthquake measurements because of its extensive spatial coverage and being free from terrestrial restriction. During its over 10 years mission, GRACE has successfully detected seismic gravitational changes of several giant earthquakes, which include the 2004 Sumatra-Andaman earthquake, 2010 Maule (Chile) earthquake, and 2011 Tohoku-Oki (Japan) earthquake. In this review, we describe by examples how to process GRACE time-variable gravity data to retrieve seismic signals, and summarize the results of recent studies that apply GRACE observations to detect co- and post-seismic signals and constrain fault slip models and viscous lithospheric structures. We also discuss major problems and give an outlook in this field of GRACE application.

Status of CSR RL06 GRACE reprocessing and preliminary results

NASA Astrophysics Data System (ADS)

Save, H.

2017-12-01

The GRACE project plans to re-processes the GRACE mission data in order to be consistent with the first gravity products released by the GRACE-FO project. The RL06 reprocessing will harmonize the GRACE time-series with the first release of GRACE-FO. This paper catalogues the changes in the upcoming RL06 release and discusses the quality improvements as compared to the current RL05 release. The processing and parameterization changes as compared to the current release are also discussed. This paper discusses the evolution of the quality of the GRACE solutions and characterize the errors over the past few years. The possible challenges associated with connecting the GRACE time series with that from GRACE-FO are also discussed.

GRACE-FO Spacecraft (Artist's Rendering)

NASA Image and Video Library

2018-04-25

Artist's rendering of the twin spacecraft of the Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission, scheduled to launch in May, 2018. GRACE-FO will track the evolution of Earth's water cycle by monitoring changes in the distribution of mass on Earth. https://photojournal.jpl.nasa.gov/catalog/PIA22431

Comparison of Decadal Water Storage Trends from Global Hydrological Models and GRACE Satellite Data

NASA Astrophysics Data System (ADS)

Scanlon, B. R.; Zhang, Z. Z.; Save, H.; Sun, A. Y.; Mueller Schmied, H.; Van Beek, L. P.; Wiese, D. N.; Wada, Y.; Long, D.; Reedy, R. C.; Doll, P. M.; Longuevergne, L.

2017-12-01

Global hydrology is increasingly being evaluated using models; however, the reliability of these global models is not well known. In this study we compared decadal trends (2002-2014) in land water storage from 7 global models (WGHM, PCR-GLOBWB, and GLDAS: NOAH, MOSAIC, VIC, CLM, and CLSM) to storage trends from new GRACE satellite mascon solutions (CSR-M and JPL-M). The analysis was conducted over 186 river basins, representing about 60% of the global land area. Modeled total water storage trends agree with those from GRACE-derived trends that are within ±0.5 km3/yr but greatly underestimate large declining and rising trends outside this range. Large declining trends are found mostly in intensively irrigated basins and in some basins in northern latitudes. Rising trends are found in basins with little or no irrigation and are generally related to increasing trends in precipitation. The largest decline is found in the Ganges (-12 km3/yr) and the largest rise in the Amazon (43 km3/yr). Differences between models and GRACE are greatest in large basins (>0.5x106 km2) mostly in humid regions. There is very little agreement in storage trends between models and GRACE and among the models with values of r2 mostly <0.1. Various factors can contribute to discrepancies in water storage trends between models and GRACE, including uncertainties in precipitation, model calibration, storage capacity, and water use in models and uncertainties in GRACE data related to processing, glacier leakage, and glacial isostatic adjustment. The GRACE data indicate that land has a large capacity to store water over decadal timescales that is underrepresented by the models. The storage capacity in the modeled soil and groundwater compartments may be insufficient to accommodate the range in water storage variations shown by GRACE data. The inability of the models to capture the large storage trends indicates that model projections of climate and human-induced changes in water storage may be

GRACE score predicts heart failure admission following acute coronary syndrome.

PubMed

McAllister, David A; Halbesma, Nynke; Carruthers, Kathryn; Denvir, Martin; Fox, Keith A

2015-04-01

Congestive heart failure (CHF) is a common and preventable complication of acute coronary syndrome (ACS). Nevertheless, ACS risk scores have not been shown to predict CHF risk. We investigated whether the at-discharge Global Registry of Acute Coronary Events (GRACE) score predicts heart failure admission following ACS. Five-year mortality and hospitalization data were obtained for patients admitted with ACS from June 1999 to September 2009 to a single centre of the GRACE registry. CHF was defined as any admission assigned WHO International Classification of Diseases 10 diagnostic code I50. The hazard ratio (HR) for CHF according to GRACE score was estimated in Cox models adjusting for age, gender and the presence of CHF on index admission. Among 1,956 patients, CHF was recorded on index admission in 141 patients (7%), and 243 (12%) were admitted with CHF over 3.8 median years of follow-up. Compared to the lowest quintile, patients in the highest GRACE score quintile had more CHF admissions (116 vs 17) and a shorter time to first admission (1.2 vs 2.0 years, HR 9.87, 95% CI 5.93-16.43). Per standard deviation increment in GRACE score, the instantaneous risk was more than two-fold higher (HR 2.28; 95% CI 2.02-2.57), including after adjustment for CHF on index admission, age and gender (HR 2.49; 95% CI 2.06-3.02). The C-statistic for CHF admission at 1-year was 0.74 (95% CI 0.70-0.79). The GRACE score predicts CHF admission, and may therefore be used to target ACS patients at high risk of CHF with clinical monitoring and therapies. © The European Society of Cardiology 2014.

Remote Sensing of Groundwater Storage Changes in Illinois using the Gravity Recovery and Climate Experiment (GRACE)

NASA Technical Reports Server (NTRS)

Yeh, Pat J.-F.; Swenson, S. C.; Famiglietti, J. S.; Rodell, M.

2007-01-01

Regional groundwater storage changes in Illinois are estimated from monthly GRACE total water storage change (TWSC) data and in situ measurements of soil moisture for the period 2002-2005. Groundwater storage change estimates are compared to those derived from the soil moisture and available well level data. The seasonal pattern and amplitude of GRACE-estimated groundwater storage changes track those of the in situ measurements reasonably well, although substantial differences exist in month-to-month variations. The seasonal cycle of GRACE TWSC agrees well with observations (correlation coefficient = 0.83), while the seasonal cycle of GRACE-based estimates of groundwater storage changes beneath 2 m depth agrees with observations with a correlation coefficient of 0.63. We conclude that the GRACE-based method of estimating monthly to seasonal groundwater storage changes performs reasonably well at the 200,000 sq km scale of Illinois.

Groundwater Storage Changes: Present Status from GRACE Observations

NASA Technical Reports Server (NTRS)

Chen, Jianli; Famiglietti, James S.; Scanlon, Bridget R.; Rodell, Matthew

2015-01-01

Satellite gravity measurements from the Gravity Recovery and Climate Experiment (GRACE) provide quantitative measurement of terrestrial water storage (TWS) changes with unprecedented accuracy. Combining GRACE-observed TWS changes and independent estimates of water change in soil and snow and surface reservoirs offers a means for estimating groundwater storage change. Since its launch in March 2002, GRACE time-variable gravity data have been successfully used to quantify long-term groundwater storage changes in different regions over the world, including northwest India, the High Plains Aquifer and the Central Valley in the USA, the North China Plain, Middle East, and southern Murray-Darling Basin in Australia, where groundwater storage has been significantly depleted in recent years (or decades). It is difficult to rely on in situ groundwater measurements for accurate quantification of large, regional-scale groundwater storage changes, especially at long timescales due to inadequate spatial and temporal coverage of in situ data and uncertainties in storage coefficients. The now nearly 13 years of GRACE gravity data provide a successful and unique complementary tool for monitoring and measuring groundwater changes on a global and regional basis. Despite the successful applications of GRACE in studying global groundwater storage change, there are still some major challenges limiting the application and interpretation of GRACE data. In this paper, we present an overview of GRACE applications in groundwater studies and discuss if and how the main challenges to using GRACE data can be addressed.

Earthquake Signal Visible in GRACE Data

NASA Technical Reports Server (NTRS)

2005-01-01

[figure removed for brevity, see original site] Figure1

This figure shows the effect of the December 2004 great Sumatra earthquake on the Earth's gravity field as observed by GRACE. The signal is expressed in terms of the relative acceleration of the two GRACE satellites, in this case a few nanometers per second squared, or about 1 billionth of the acceleration we experience everyday at the Earth's surface.GRACE observations show comparable signals in the region of the earthquake.

Other natural variations are also apparent in the expected places, whereas no other significant change would be expected in the region of the earthquake

GRACE, twin satellites launched in March 2002, are making detailed measurements of Earth's gravity field which will lead to discoveries about gravity and Earth's natural systems. These discoveries could have far-reaching benefits to society and the world's population.

Grace Nash: Nine Decades of Graceful Teaching.

ERIC Educational Resources Information Center

Cole, Judith

2000-01-01

Provides information on the life of Grace Nash, an influential educator and pioneer of Orff Schulwerk in the United States, focusing on issues such as her young life, experience as a prisoner-of-war, development of her interest in the Orff, Kodaly, and Laban methods, and her own work. Offers selected resources. (CMK)

Grace and Courtesy across the Planes of Development

ERIC Educational Resources Information Center

Ludick, Pat

2015-01-01

Pat Ludick's commentary on grace and courtesy is established by a philosophical orientation to development: Grace is oriented to the life of the interior that is consciousness and being, and courtesy moves outward to daily living where civility reflects on success with human interactions. Pat's projected grace and courtesy across the planes is…

Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

PubMed

Patel, D J; Canuel, L L

1977-07-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

PubMed Central

Patel, Dinshaw J.; Canuel, Lita L.

1977-01-01

The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

12 CFR 329.104 - Ten-day grace period.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Ten-day grace period. 329.104 Section 329.104... INTEREST ON DEPOSITS § 329.104 Ten-day grace period. This interpretive rule provides for 10-day grace periods during which interest may be paid on a deposit without violating § 329.2. (a) During the ten...

Possible association of 3' UTR +357 A>G, IVS11-nt 93 T>C, c.1311 C>T polymorphism with G6PD deficiency.

PubMed

Sirdah, Mahmoud M; Shubair, Mohammad E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Prchal, Josef T; Reading, N Scott

2017-07-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked inherited enzymopathic disorder affecting more than 500 million people worldwide. It has so far been linked to 217 distinct genetic variants in the exons and exon-intron boundaries of the G6PD gene, giving rise to a wide range of biochemical heterogeneity and clinical manifestations. Reports from different settings suggested the association of intronic and other mutations outside the reading frame of the G6PD gene with reduced enzyme activity and presenting clinical symptoms. The present study aimed to investigate any association of other variations apart of the exonic or exonic intronic boundaries in the development of G6PD deficiency. Sixty-seven unrelated Palestinian children admitted to the pediatric hospital with hemolytic crises due to G6PD deficiency were studied. In our Palestinian cohort of 67 [59 males (M) and 8 females (F)] G6PD-deficient children, previously hospitalized for acute hemolytic anemia due to favism, molecular sequencing of the G6PD gene revealed four cases (3M and 1F) that did not have any of the variants known to cause G6PD deficiency, but the 3' UTR c.*+357A>G (rs1050757) polymorphism in association with IVS 11 (c.1365-13T>C; rs2071429), and c.1311C>T (rs2230037). We now provide an additional evidence form Palestinian G6PD-deficient subjects for a possible role of 3' UTR c.*+357 A>G, c.1365-13T>C, and/or c.1311C>T polymorphism for G6PD deficiency, suggesting that not only a single variation in the exonic or exonic intronic boundaries, but also a haplotype of G6PD should considered as a cause for G6PD deficiency.

Assessing mass change trends in GRACE models

NASA Astrophysics Data System (ADS)

Siemes, C.; Liu, X.; Ditmar, P.; Revtova, E.; Slobbe, C.; Klees, R.; Zhao, Q.

2009-04-01

The DEOS Mass Transport model, release 1 (DMT-1), has been recently presented to the scientific community. The model is based on GRACE data and consists of sets of spherical harmonic coefficients to degree 120, which are estimated once per month. Currently, the DMT-1 model covers the time span from Feb. 2003 to Dec. 2006. The high spatial resolution of the model could be achieved by applying a statistically optimal Wiener-type filter, which is superior to standard filtering techniques. The optimal Wiener-type filter is a regularization-type filter which makes full use of the variance/covariance matrices of the sets of spherical harmonic coefficients. It can be shown that applying this filter is equivalent to introducing an additional set of observations: Each set of spherical harmonic coefficients is assumed to be zero. The variance/covariance matrix of this information is chosen according to the signal contained within the sets of spherical harmonic coefficients, expressed in terms of equivalent water layer thickness in the spatial domain, with respect to its variations in time. It will be demonstrated that DMT-1 provides a much better localization and more realistic amplitudes than alternative filtered models. In particular, we will consider a lower maximum degree of the spherical harmonic expansion (e.g. 70), as well as standard filters like an isotropic Gaussian filter. For the sake of a fair comparison, we will use the same GRACE observations as well as the same method for the inversion of the observations to obtain the alternative filtered models. For the inversion method, we will choose the three-point range combination approach. Thus, we will compare four different models: (1) GRACE solution with maximum degree 120, filtered by optimal Wiener-type filter (the DMT-1 model) (2) GRACE solution with maximum degree 120, filtered by standard filter (3) GRACE solution with maximum degree 70, filtered by optimal Wiener-type filter (4) GRACE solution with maximum

Investigating the relation between the geometric properties of river basins and the filtering parameters for regional land hydrology applications using GRACE models

NASA Astrophysics Data System (ADS)

Piretzidis, Dimitrios; Sideris, Michael G.

2016-04-01

This study investigates the possibilities of local hydrology signal extraction using GRACE data and conventional filtering techniques. The impact of the basin shape has also been studied in order to derive empirical rules for tuning the GRACE filter parameters. GRACE CSR Release 05 monthly solutions were used from April 2002 to August 2015 (161 monthly solutions in total). SLR data were also used to replace the GRACE C2,0 coefficient, and a de-correlation filter with optimal parameters for CSR Release 05 data was applied to attenuate the correlation errors of monthly mass differences. For basins located at higher latitudes, the effect of Glacial Isostatic Adjustment (GIA) was taken into account using the ICE-6G model. The study focuses on three geometric properties, i.e., the area, the convexity and the width in the longitudinal direction, of 100 basins with global distribution. Two experiments have been performed. The first one deals with the determination of the Gaussian smoothing radius that minimizes the gaussianity of GRACE equivalent water height (EWH) over the selected basins. The EWH kurtosis was selected as a metric of gaussianity. The second experiment focuses on the derivation of the Gaussian smoothing radius that minimizes the RMS difference between GRACE data and a hydrology model. The GLDAS 1.0 Noah hydrology model was chosen, which shows good agreement with GRACE data according to previous studies. Early results show that there is an apparent relation between the geometric attributes of the basins examined and the Gaussian radius derived from the two experiments. The kurtosis analysis experiment tends to underestimate the optimal Gaussian radius, which is close to 200-300 km in many cases. Empirical rules for the selection of the Gaussian radius have been also developed for sub-regional scale basins.

GRACE Follow-On Satellites (Artist's Concept)

NASA Image and Video Library

2018-04-30

Illustration of the twin spacecraft of the NASA/German Research Centre for Geosciences (GFZ) Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission. GRACE-FO will continue tracking the evolution of Earth's water cycle by monitoring changes in the distribution of mass on Earth. https://photojournal.jpl.nasa.gov/catalog/PIA22445

GRACE Follow-On Satellites (Artist's Concept)

NASA Image and Video Library

2018-04-30

Illustration of the twin spacecraft of the NASA/German Research Centre for Geosciences (GFZ) Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission. GRACE-FO will continue tracking the evolution of Earth's water cycle by monitoring changes in the distribution of mass on Earth. https://photojournal.jpl.nasa.gov/catalog/PIA22446

GRACE Follow-On Satellites (Artist's Concept)

NASA Image and Video Library

2018-04-30

Illustration of the twin spacecraft of the NASA/German Research Centre for Geosciences (GFZ) Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission. GRACE-FO will continue tracking the evolution of Earth's water cycle by monitoring changes in the distribution of mass on Earth. https://photojournal.jpl.nasa.gov/catalog/PIA22440

GRACE Follow-On Satellites (Artist's Concept)

NASA Image and Video Library

2018-04-30

Illustration of the twin spacecraft of the NASA/German Research Centre for Geosciences (GFZ) Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission. GRACE-FO will continue tracking the evolution of Earth's water cycle by monitoring changes in the distribution of mass on Earth. https://photojournal.jpl.nasa.gov/catalog/PIA22441

The development of a cancer genetic-specific measure of coping: the GRACE.

PubMed

Phelps, C; Bennett, P; Jones, H; Hood, K; Brain, K; Murray, A

2010-08-01

Generic measures of coping fail to capture the process of undergoing specific health processes such as cancer genetic risk assessment. The Genetic Risk Assessment Coping Evaluation (GRACE) has been developed to provide greater specificity of measurement. Based upon previous research findings, the GRACE measures the degree of stress associated with 11 recognised sources of stress for individuals undergoing the early stages of cancer genetic risk assessment, and the use of up to eight coping strategies they may elicit. This paper reports preliminary data from the piloting of the GRACE within a randomised trial of a coping intervention. Of the 265 participants who completed and returned their baseline questionnaire (prior to being informed of their level of genetic risk), 257 completed the GRACE. The most highly endorsed sources of stress involved concerns relating to family members, endorsed by over 60% of respondents, and concerns about how the participants would cope if found to be at increased risk (59%). Participants made use of multiple coping strategies across different sources of stress. The most frequently reported coping strategies were emotion-focused, which may reflect the stage of the assessment process. The completion rates for the matrix and specificity of responses provided suggest that the GRACE may be an acceptable measurement tool. Further data collection and validation is ongoing. (c) 2009 John Wiley & Sons, Ltd.

GRACE risk score: Sex-based validity of in-hospital mortality prediction in Canadian patients with acute coronary syndrome.

PubMed

Gong, Inna Y; Goodman, Shaun G; Brieger, David; Gale, Chris P; Chew, Derek P; Welsh, Robert C; Huynh, Thao; DeYoung, J Paul; Baer, Carolyn; Gyenes, Gabor T; Udell, Jacob A; Fox, Keith A A; Yan, Andrew T

2017-10-01

Although there are sex differences in management and outcome of acute coronary syndromes (ACS), sex is not a component of Global Registry of Acute Coronary Events (GRACE) risk score (RS) for in-hospital mortality prediction. We sought to determine the prognostic utility of GRACE RS in men and women, and whether its predictive accuracy would be augmented through sex-based modification of its components. Canadian men and women enrolled in GRACE and Canadian Registry of Acute Coronary Events were stratified as ST-segment elevation myocardial infarction (STEMI) or non-ST-segment elevation ACS (NSTE-ACS). GRACE RS was calculated as per original model. Discrimination and calibration were evaluated using the c-statistic and Hosmer-Lemeshow goodness-of-fit test, respectively. Multivariable logistic regression was undertaken to assess potential interactions of sex with GRACE RS components. For the overall cohort (n=14,422), unadjusted in-hospital mortality rate was higher in women than men (4.5% vs. 3.0%, p<0.001). Overall, GRACE RS c-statistic and goodness-of-fit test p-value were 0.85 (95% CI 0.83-0.87) and 0.11, respectively. While the RS had excellent discrimination for all subgroups (c-statistics >0.80), discrimination was lower for women compared to men with STEMI [0.80 (0.75-0.84) vs. 0.86 (0.82-0.89), respectively, p<0.05]. The goodness-of-fit test showed good calibration for women (p=0.86), but suboptimal for men (p=0.031). No significant interaction was evident between sex and RS components (all p>0.25). The GRACE RS is a valid predictor of in-hospital mortality for both men and women with ACS. The lack of interaction between sex and RS components suggests that sex-based modification is not required. Copyright © 2017 Elsevier B.V. All rights reserved.

42 CFR 408.8 - Grace period and termination date.

Code of Federal Regulations, 2010 CFR

2010-10-01

... MEDICARE PROGRAM PREMIUMS FOR SUPPLEMENTARY MEDICAL INSURANCE General Provisions § 408.8 Grace period and termination date. (a) Grace period. (1) For all initial premium payments (monthly or quarterly), and subsequent monthly or quarterly payments, the grace period ends with the last day of the third month after...

Instrument Noise Simulation for GRACE Follow-On

NASA Astrophysics Data System (ADS)

Darbeheshti, N.; Mueller, V.; Wegener, H.; Hewitson, M.; Heinzel, G.; Naeimi, M.; Flury, J.

2016-12-01

The quality of the temporal gravity field from GRACE Follow-On mission depends on its multi-sensor system consisting of inter-satellite ranging with microwave and laser ranging instrument, GNSS orbit tracking, accelerometry, and attitude sensing. In this presentation, the noise models for GRACE Follow-On major instruments are described and their effect on the estimation of Earth's gravity field accuracy are discussed. To do this the spectrum of the instruments noise models has been related to the spectrum of the disturbing potential of the Earth's gravity field. The instrument noise models are available to the geodesy community through GRACE Follow-On mock data challenges. The performance of gravity field recovery approaches can be tested by comparing observation residuals to the simulated instrument noises. The instrument noise models will also provide valuable insight for inter-satellite ranging configurations beyond GRACE Follow-On.

Antarctic Ocean Tides from GRACE Intersatellite Tracking Data and Hydrodynamic Assimilation

NASA Astrophysics Data System (ADS)

Erofeeva, S.; Han, S.; Ray, R.; Egbert, G.; Luthcke, S.

2007-12-01

Long-wavelength components of the oceanic tides surrounding Antarctica are estimated from over three years of GRACE satellite-to-satellite ranging measurements. An inversion is performed for the major constituents M2, O1, and S2, parameterized as localized average mass anomalies relative to a prior tidal model. Satellite state adjustments are made simultaneously. These long-wavelength anomalies are then assimilated into a high-resolution regional hydrodynamic tidal model. Comparisons to independent "ground truth" data, previously collected by King and Padman, show that assimilation of the GRACE inversions results in improved accuracy, for all three constituents.

Antarctic Circumpolar Current Transport Variability during 2003-05 from GRACE

NASA Technical Reports Server (NTRS)

Zlotnicki, Victor; Wahr, John; Fukumori, Ichiro; Song, Yuhe T.

2006-01-01

Gravity Recovery and Climate Experiment (GRACE) gravity data spanning January 2003 - November 2005 are used as proxies for ocean bottom pressure (BP) averaged over 1 month, spherical Gaussian caps 500 km in radius, and along paths bracketing the Antarctic Circumpolar Current's various fronts. The GRACE BP signals are compared with those derived from the Estimating the Circulation and Climate of the Ocean (ECCO) ocean modeling-assimilation system, and to a non-Boussinesq version of the Regional Ocean Model System (ROMS). The discrepancy found between GRACE and the models is 1.7 cm(sub H2O) (1 cm(sub H2O) similar to 1 hPa), slightly lower than the 1.9 cm(sub H2O) estimated by the authors independently from propagation of GRACE errors. The northern signals are weak and uncorrelated among basins. The southern signals are strong, with a common seasonality. The seasonal cycle GRACE data observed in the Pacific and Indian Ocean sectors of the ACC are consistent, with annual and semiannual amplitudes of 3.6 and 0.6 cm(sub H2O) (1.1 and 0.6 cm(sub H2O) with ECCO), the average over the full southern path peaks (stronger ACC) in the southern winter, on days of year 197 and 97 for the annual and semiannual components, respectively; the Atlantic Ocean annual peak is 20 days earlier. An approximate conversion factor of 3.1 Sv ( Sv equivalent to 10(exp 6) m(exp 3) s(exp -1)) of barotropic transport variability per cm(sub H2O) of BP change is estimated. Wind stress data time series from the Quick Scatterometer (QuikSCAT), averaged monthly, zonally, and over the latitude band 40 de - 65 deg S, are also constructed and subsampled at the same months as with the GRACE data. The annual and semiannual harmonics of the wind stress peak on days 198 and 82, respectively. A decreasing trend over the 3 yr is observed in the three data types.

Antarctic Circumpolar Current Transport Variability during 2003-05 from GRACE

NASA Technical Reports Server (NTRS)

Zlotnicki, Victor; Wahr, John; Fukumori, Ichiro; Song, Yuhe T.

2007-01-01

Gravity Recovery and Climate Experiment (GRACE) gravity data spanning January 2003-November 2005 are used as proxies for ocean bottom pressure (BP) averaged over 1 month, spherical Gaussian caps 500 km in radius, and along paths bracketing the Antarctic Circumpolar Current's various fronts. The GRACE BP signals are compared with those derived from the Estimating the Circulation and Climate of the Ocean (ECCO) ocean modeling-assimilation system, and to a non-Boussinesq version of the Regional Ocean Model System (ROMS). The discrepancy found between GRACE and the models is 1.7 cmH2O (1 cmH2O approx. 1 hPa), slightly lower than the 1.9 cmH2O estimated by the authors independently from propagation of GRACE errors. The northern signals are weak and uncorrelated among basins. The southern signals are strong, with a common seasonality. The seasonal cycle GRACE data observed in the Pacific and Indian Ocean sectors of the ACC are consistent, with annual and semiannual amplitudes of 3.6 and 0.6 cmH2O (1.1 and 0.6 cmH2O with ECCO), the average over the full southern path peaks (stronger ACC) in the southern winter, on days of year 197 and 97 for the annual and semiannual components, respectively; the Atlantic Ocean annual peak is 20 days earlier. An approximate conversion factor of 3.1 Sv (Sv equiv 10(exp 6)cu m/s) of barotropic transport variability per cmH2O of BP change is estimated. Wind stress data time series from the Quick Scatterometer (QuikSCAT), averaged monthly, zonally, and over the latitude band 40(deg)- 65(deg)S, are also constructed and subsampled at the same months as with the GRACE data. The annual and semiannual harmonics of the wind stress peak on days 198 and 82, respectively. A decreasing trend over the 3 yr is observed in the three data types.

Assessment of noise in non-tectonic displacement derived from GRACE time-variable gravity filed

NASA Astrophysics Data System (ADS)

Li, Weiwei; Shen, Yunzhong

2017-04-01

Many studies have been focusing on estimating the noises in GNSS monitoring time series. While the noises of GNSS time series after the correction with non-tectonic displacement should be re-estimated. Knowing the noises in the non-tectonic can help to better identify the sources of re-estimated noises. However, there is a lack of knowledge of noises in the non-tectonic displacement. The objective of this work is to assess the noise in the non-tectonic displacement. GRACE time-variable gravity is used to reflect the global mass variation. The GRACE stokes coefficients of the gravity field are used to calculate the non-tectonic surface displacement at any point on the surface. The Atmosphere and Ocean AOD1B de-aliasing model to the GRACE solutions is added because the complete mass variation is requested. The monthly GRACE solutions from CSR, JPL, GFZ and Tongji span from January 2003 to September 2015 are compared. The degree-1 coefficients derived by Swenson et al (2008) are added and also the C20 terms are replaced with those obtained from Satellite Laser Ranging. The P4M6 decorrelation and Fan filter with a radius of 300 km are adopted to reduce the stripe errors. Optimal noise models for the 1054 stations in ITRF2014 are presented. It is found that white noise only take up a small proportion: less than 18% in horizontal and less than 13% in vertical. The dominant models in up and north components are ARMA and flicker, while in east the power law noise shows significance. The local distribution comparison of the optimal noise models among different products is quite similar, which shows that there is little dependence on the different strategies adopted. In addition, the reasons that caused to different distributions of the optimal noise models are also investigated. Meanwhile different filtering methods such as Gaussian filters, Han filters are applied to see whether the noise is related with filters. Keyword: optimal noise model; non-tectonic displacement;GRACE

Searching for 3D Viscosity Models of Glacial Isostatic Adjustment in Support of the Global ICE-6G_C Ice History Model

NASA Astrophysics Data System (ADS)

LI, T., II; Wu, P.; Steffen, H.; Wang, H.

2017-12-01

The global ice history model ICE-6G_C was constructed based on the laterally homogeneous earth model VM5a. The combined model of glacial isostatic adjustment (GIA) called ICE-6G_C (VM5a) fits global observations of GIA simultaneously well. However, seismic and geological observations clearly show that the Earth's mantle is laterally heterogeneous. Our aim therefore is to search for the best laterally heterogeneous viscosity models with ICE-6G_C ice history that is able to fit the global relative sea-level (RSL) data, the peak uplift rates (from GNSS) and peak g-dot rates (from the GRACE satellite mission) in Laurentia and Fennoscandia simultaneously. The Coupled Laplace-Finite Element Method is used to compute gravitationally self-consistent sea levels with time dependent coastlines and rotational feedback in addition to changes in deformation, gravity and the state of stress. As a start, the VM5a Earth model is used as the radial background viscosity structure but other radial background viscosity models will also be investigated. Lateral mantle viscosity structure is obtained by the superposition of the radial background viscosity and the lateral viscosity perturbations logarithmically. The latter is inferred from a seismic tomography model using a scaling relationship that takes into account the effects of anharmonicity, anelasticity and non-thermal effects. We will show that several laterally heterogeneous mantle viscosity models can fit the global sea level, GPS and GRACE data better than laterally homogeneous models, provided that the scaling relationship for mantle heterogeneity under northern Europe is allowed to be different from that under Laurentia. In addition, the effects of laterally heterogeneous lithosphere, as inferred from seismic tomography, and the lateral changes in sub-lithospheric properties will also be presented.

Evaluation of the Geopotential value for the Local Vertical Datum of China using GRACE/GOCE GGMs and GPS/Leveling Data

NASA Astrophysics Data System (ADS)

He, Lin; Li, Jiancheng; Chu, Yonghai; Zhang, Tengxu

2017-04-01

National height reference systems have conventionally been linked to the coastal local mean sea level, observed at one tide gauge, such as the China national height datum 1985. Due to the effect of the local sea surface topography, the reference level surface of local datum is inconsistent with the global datum or other local datum. In order to unify or connect the local datum to the global height datum, it is necessary to obtain the zero-height geopotential value of local datum or the height offset with respect to the global datum. The GRACE and GOCE satellite mission are promising for purposes of unification of local vertical datums because they have brought a significant improvement in modeling of low-frequency or rather medium-frequency part of the Earth's static gravity field in the past ten years. The focus of this work is directed to the evaluation of most available Global Geopotential Models (GGMs) from GOCE and GRACE, both satellite only as well as combined ones. From the evaluation with the 649 GPS/Levelling benchmarks (BMs) in China, the GOCE/GRACE GGMs provide the accuracy at 42-52cm level, up to their max degree and order. The latest release 5 DIR, TIM GGMs improve the accuracies by 6-10cm compared to the release 1 models. The DIR_R1 is based on the fewer GOCE data performs equally well with the DIR_R4 and DIR_R5 model, this is attributed to the fact that during its development which used a priori information from EIGEN-51C. The zero-height geopotential value W0LVD for the China Local Vertical Datum (LVD) is 62636855.1606m2s-2 from the originally GOCE/GRACE GGMs. Taking into account the GPS/Levelling data contains the full spectral information, and the GOCE-only or GRACE-GOCE combined model are limited to the long wavelengths. To improve the accuracy of the GGMs, it is indispensable to account for the remaining signal above this maximum degree, known as the omission error of the GGM. The effect of GRACE/GOCE omission error is investigated by extending

JPL-20180420-GRACFOf-0001-GRACE Follow-On Media Reel 1

NASA Image and Video Library

2018-04-20

The original GRACE mission (Gravity Recovery and Climate Experiment) revolutionized our understanding of Earth's water cycle and how water and ice are distributed on the planet. The GRACE Follow-On satellites will continue GRACE's legacy.

The GRACE Mission: Meeting the Technical Challenges

NASA Technical Reports Server (NTRS)

Davis, E. S.; Dunn, C. E.; Stanton, R. H.; Thomas, J. B.

2000-01-01

The Gravity Recovery and Climate Experiment (GRACE) Mission is scheduled for launch in June 2001. Within the first year of the GRACE Mission, the project has a minimum science requirement to deliver a new model of the Earth's static geoid with an error of less than 1 cm to spherical harmonic degree seventy (70). However, the performance of the GRACE Mission is designed to exceed this minimum requirement by a factor of 25 or more. For spherical harmonic degrees of up to 40, we expect to improve the current knowledge of the gravity field by one thousand (1000x). The GRACE Mission uses the satellite-to-satellite tracking (SST) technique. The twin GRACE satellites are the instruments that measure the nonuniformities in the Earth's gravity field. Nonuniformities in the gravity field cause the relative distance between the centers-of-mass of the two satellites to vary as they fly over the Earth. Atmospheric drag is the largest non-gravitational disturbing force. Drag is measured and will be used to correct changes in the satellite-to-satellite range measured by an SST microwave link. The microwave link will measure changes in the range between the two GRACE satellites with an error approaching 1 micron. We will discuss how these instrumentation requirements affect the configuration, the mass balance, the thermal control and the aerodynamic design of the satellites, and the design of the microwave SST link and the accelerometer. Finally, the question of how noise in these components limits the overall accuracy of the gravity models will be addressed.

Study of Extreme Weather Hazards Using GRACE

NASA Astrophysics Data System (ADS)

Zhang, Y.; Shum, C. K.; Shang, K.; Guo, J.; Schwartz, F. W.; Akyılmaz, O.; Feng, W.; Forootan, E.; LIU, G.; Zhong, M.

2017-12-01

Extreme weather events significantly affect humans and economics in the region. Synoptic and timely observations of these abrupt meteoro-hydrological hazards would benefit disaster management and improve storm forecasting. Contemporary processing of the Gravity Recovery and Climate Experiment (GRACE) twin-satellite data at monthly sampling would miss or under-sample abrupt events such as large ice storms with durations much shorter than a month. Here, we employ the energy balance approach processing GRACE Level 1 data, which is flexible to allow sub-monthly solutions at daily sampling covering the genesis and evolution of large winter storms. We studied the 2008 Southeast China snow and ice storm, which lasted from mid-January to mid-February, and affected 21 out of China's 34 provinces with heavy snows, ice and freezing rains, caused extensive damage and transportation disruption, displaced nearly 1.7 million people, and claimed 129 lives. We also investigated the devastating North America blizzard which occurred during late January through mid-February 2010. The massive accumulations of snow and ice in both storms slightly changed the gravity field of the Earth, and were sensitive to the GRACE satellite measurements, manifested as transient terrestrial water storage (TWS) change. We compared our solutions with other available high temporal frequency GRACE solutions. The GRACE observed total storage change for both storms are in good agreement with in situ precipitation measurements, and with GRACE observations clearly show the complex genesis, decline, strengthening and melting phases depicting the detailed evolution of these example large snow storms.

Assimilation of GRACE Terrestrial Water Storage into a Land Surface Model: Evaluation 1 and Potential Value for Drought Monitoring in Western and Central Europe

NASA Technical Reports Server (NTRS)

Li, Bailing; Rodell, Matthew; Zaitchik, Benjamin F.; Reichle, Rolf H.; Koster, Randal D.; van Dam, Tonie M.

2012-01-01

A land surface model s ability to simulate states (e.g., soil moisture) and fluxes (e.g., runoff) is limited by uncertainties in meteorological forcing and parameter inputs as well as inadequacies in model physics. In this study, anomalies of terrestrial water storage (TWS) observed by the Gravity Recovery and Climate Experiment (GRACE) satellite mission were assimilated into the NASA Catchment land surface model in western and central Europe for a 7-year period, using a previously developed ensemble Kalman smoother. GRACE data assimilation led to improved runoff correlations with gauge data in 17 out of 18 hydrological basins, even in basins smaller than the effective resolution of GRACE. Improvements in root zone soil moisture were less conclusive, partly due to the shortness of the in situ data record. In addition to improving temporal correlations, GRACE data assimilation also reduced increasing trends in simulated monthly TWS and runoff associated with increasing rates of precipitation. GRACE assimilated root zone soil moisture and TWS fields exhibited significant changes in their dryness rankings relative to those without data assimilation, suggesting that GRACE data assimilation could have a substantial impact on drought monitoring. Signals of drought in GRACE TWS correlated well with MODIS Normalized Difference Vegetation Index (NDVI) data in most areas. Although they detected the same droughts during warm seasons, drought signatures in GRACE derived TWS exhibited greater persistence than those in NDVI throughout all seasons, in part due to limitations associated with the seasonality of vegetation.

Comparison of the Specificities of IgG, IgG-Subclass, IgA and IgM Reactivities in African and European HIV-Infected Individuals with an HIV-1 Clade C Proteome-Based Array

PubMed Central

Gallerano, Daniela; Ndlovu, Portia; Makupe, Ian; Focke-Tejkl, Margarete; Fauland, Kerstin; Wollmann, Eva; Puchhammer-Stöckl, Elisabeth; Keller, Walter; Sibanda, Elopy; Valenta, Rudolf

2015-01-01

A comprehensive set of recombinant proteins and peptides of the proteome of HIV-1 clade C was prepared and purified and used to measure IgG, IgG-subclass, IgA and IgM responses in HIV-infected patients from Sub-Saharan Africa, where clade C is predominant. As a comparison group, HIV-infected patients from Europe were tested. African and European patients showed an almost identical antibody reactivity profile in terms of epitope specificity and involvement of IgG, IgG subclass, IgA and IgM responses. A V3-peptide of gp120 was identified as major epitope recognized by IgG1>IgG2 = IgG4>IgG3, IgA>IgM antibodies and a C-terminal peptide represented another major peptide epitope for the four IgG subclasses. By contrast, gp41-derived-peptides were mainly recognized by IgG1 but not by the other IgG subclasses, IgA or IgM. Among the non-surface proteins, protease, reverse transcriptase+RNAseH, integrase, as well as the capsid and matrix proteins were the most frequently and strongly recognized antigens which showed broad IgG subclass and IgA reactivity. Specificities and magnitudes of antibody responses in African patients were stable during disease and antiretroviral treatment, and persisted despite severe T cell loss. Using a comprehensive panel of gp120, gp41 peptides and recombinant non-surface proteins of HIV-1 clade C we found an almost identical antibody recognition profile in African and European patients regarding epitopes and involved IgG-sublass, IgA- and IgM-responses. Immune recognition of gp120 peptides and non-surface proteins involved all four IgG subclasses and was indicative of a mixed Th1/Th2 immune response. The HIV-1 clade C proteome-based test allowed diagnosis and monitoring of antibody responses in the course of HIV-infections and assessment of isotype and subclass responses. PMID:25658330

Regional Deformation Studies with GRACE and GPS

NASA Technical Reports Server (NTRS)

Davis, J. L.; Elosequi, P.; Tamisiea, M.; Mitrovica, J. X.

2005-01-01

GRACE data indicate large seasonal variations in gravity that have been shown to be to be related to climate-driven fluxes of surface water. Seasonal redistribution of surface mass deforms the Earth, and our previous study using GRACE data demonstrate that annual radial deformations of +/-13 mm in the region of Amazon River Basin were observed by both GRACE and ten GPS sites in the region. For the GRACE determinations, we estimate in a least-squares solution for each Stokes coefficient parameters that represent the amplitudes of the annual variation. We then filter these parameters based on a statistical test that uses the scatter of the postfit residuals. We demonstrate by comparison to the GPS amplitudes that this method is more accurate, for this region, than Gaussian smoothing. Our model for the temporal behavior of the gravity coefficients includes a rate term, and although the time series are noisy, the glacial isostatic adjustment signal over Hudson s Bay can be observed. .

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

PubMed

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

2016-01-12

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

Remote Monitoring of Groundwater Overdraft Using GRACE and InSAR

NASA Astrophysics Data System (ADS)

Scher, C.; Saah, D.

2017-12-01

Gravity Recovery and Climate Experiment (GRACE) data paired with radar-derived analyses of volumetric changes in aquifer storage capacity present a viable technique for remote monitoring of aquifer depletion. Interferometric Synthetic Aperture Radar (InSAR) analyses of ground level subsidence can account for a significant portion of mass loss observed in GRACE data and provide information on point-sources of overdraft. This study summed one water-year of GRACE monthly mass change grids and delineated regions with negative water storage anomalies for further InSAR analyses. Magnitude of water-storage anomalies observed by GRACE were compared to InSAR-derived minimum volumetric changes in aquifer storage capacity as a result of measurable compaction at the surface. Four major aquifers were selected within regions where GRACE observed a net decrease in water storage (Central Valley, California; Mekong Delta, Vietnam; West Bank, occupied Palestinian Territory; and the Indus Basin, South Asia). Interferogram imagery of the extent and magnitude of subsidence within study regions provided estimates for net minimum volume of groundwater extracted between image acquisitions. These volumetric estimates were compared to GRACE mass change grids to resolve a percent contribution of mass change observed by GRACE likely due to groundwater overdraft. Interferograms revealed characteristic cones of depression within regions of net mass loss observed by GRACE, suggesting point-source locations of groundwater overdraft and demonstrating forensic potential for the use of InSAR and GRACE data in remote monitoring of aquifer depletion. Paired GRACE and InSAR analyses offer a technique to increase the spatial and temporal resolution of remote applications for monitoring groundwater overdraft in addition to providing a novel parameter - measurable vertical deformation at the surface - to global groundwater models.

Recent changes in terrestrial water storage in the Upper Nile Basin: an evaluation of commonly used gridded GRACE products

NASA Astrophysics Data System (ADS)

Shamsudduha, Mohammad; Taylor, Richard G.; Jones, Darren; Longuevergne, Laurent; Owor, Michael; Tindimugaya, Callist

2017-09-01

GRACE (Gravity Recovery and Climate Experiment) satellite data monitor large-scale changes in total terrestrial water storage (ΔTWS), providing an invaluable tool where in situ observations are limited. Substantial uncertainty remains, however, in the amplitude of GRACE gravity signals and the disaggregation of TWS into individual terrestrial water stores (e.g. groundwater storage). Here, we test the phase and amplitude of three GRACE ΔTWS signals from five commonly used gridded products (i.e. NASA's GRCTellus: CSR, JPL, GFZ; JPL-Mascons; GRGS GRACE) using in situ data and modelled soil moisture from the Global Land Data Assimilation System (GLDAS) in two sub-basins (LVB: Lake Victoria Basin; LKB: Lake Kyoga Basin) of the Upper Nile Basin. The analysis extends from January 2003 to December 2012, but focuses on a large and accurately observed reduction in ΔTWS of 83 km3 from 2003 to 2006 in the Lake Victoria Basin. We reveal substantial variability in current GRACE products to quantify the reduction of ΔTWS in Lake Victoria that ranges from 80 km3 (JPL-Mascons) to 69 and 31 km3 for GRGS and GRCTellus respectively. Representation of the phase in TWS in the Upper Nile Basin by GRACE products varies but is generally robust with GRGS, JPL-Mascons, and GRCTellus (ensemble mean of CSR, JPL, and GFZ time-series data), explaining 90, 84, and 75 % of the variance respectively in "in situ" or "bottom-up" ΔTWS in the LVB. Resolution of changes in groundwater storage (ΔGWS) from GRACE ΔTWS is greatly constrained by both uncertainty in changes in soil-moisture storage (ΔSMS) modelled by GLDAS LSMs (CLM, NOAH, VIC) and the low annual amplitudes in ΔGWS (e.g. 1.8-4.9 cm) observed in deeply weathered crystalline rocks underlying the Upper Nile Basin. Our study highlights the substantial uncertainty in the amplitude of ΔTWS that can result from different data-processing strategies in commonly used, gridded GRACE products; this uncertainty is disregarded in analyses of �

Analysis of canine herpesvirus gB, gC and gD expressed by a recombinant vaccinia virus.

PubMed

Xuan, X; Kojima, A; Murata, T; Mikami, T; Otsuka, H

1997-01-01

The genes encoding the canine herpesvirus (CHV) glycoprotein B (gB), gC and gD homologues have been reported already. However, products of these genes have not been identified yet. Previously, we have identified three CHV glycoproteins, gp 145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gB, gC or gD, the putative genes of gB, gC, and gD of CHV were inserted into the thymidine kinase gene of vaccinia virus LC16mO strain under the control of the early-late promoter for the vaccinia virus 7.5-kilodalton polypeptide. We demonstrated here that gp145/112, gp80 and gp47 were the translation products of the CHV gB, gC and gD genes, respectively. The antigenic authenticity of recombinant gB, gC and gD were confirmed by a panel of MAbs specific for each glycoprotein produced in CHV-infected cells. Immunization of mice with these recombinants produced high titers of neutralizing antibodies against CHV. These results suggest that recombinant vaccinia viruses expressing CHV gB, gC and gD may be useful to develop a vaccine to control CHV infection.

Regional ice-mass changes and glacial-isostatic adjustment in Antarctica from GRACE

NASA Astrophysics Data System (ADS)

Sasgen, Ingo; Martinec, Zdeněk; Fleming, Kevin

2007-12-01

We infer regional mass changes in Antarctica using ca. 4 years of Gravity Recovery and Climate Experiment (GRACE) level 2 data. We decompose the time series of the Stokes coefficients into their linear as well as annual and semi-annual components by a least-squares adjustment and apply a statistical reliability test to the Stokes potential-coefficients' linear temporal trends. Mass changes in three regions of Antarctica that display prominent geoid-height change are determined by adjusting predictions of glacier melting at the tip of the Antarctic Peninsula and in the Amundsen Sea Sector, and of the glacial-isostatic adjustment (GIA) over the Ronne Ice Shelf. We use the GFZ RL04, CNES RL01C, JPL RL04 and CSR RL04 potential-coefficient releases, and show that, although all data sets consistently reflect the prominent mass changes, differences in the mass-change estimates are considerably larger than the uncertainties estimated by the propagation of the GRACE errors. We then use the bootstrapping method based on the four releases and six time intervals, each with 3.5 years of data, to quantify the variability of the mean mass-change estimates. We find 95% of our estimates to lie within 0.08 and 0.09 mm/a equivalent sea-level (ESL) change for the Antarctic Peninsula and within 0.18 and 0.20 mm/a ESL for the Amundsen Sea Sector. Forward modelling of the GIA over the Ronne Ice Shelf region suggests that the Antarctic continent was covered by 8.4 to 9.4 m ESL of additional ice during the Last-Glacial Maximum (ca. 22 to 15 ka BP). With regards to the mantle-viscosity values and the glacial history used, this value is considered as a minimum estimate. The mass-change estimates derived from all GRACE releases and time intervals lie within ca. 20% (Amundsen Sea Sector), 30% (Antarctic Peninsula) and 50% (Ronne Ice Shelf region) of the bootstrap-estimated mean, demonstrating the reliability of results obtained using GRACE observations.

Grace buys aquatic quimica to boost water treatment stake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunter, D.

1993-02-17

How W.R. Grace (Boca Raton, FL) president and newly appointed CEO J.P. Bolduc plans to expand Grace's core businesses following his drastic portfolio pruning during the past 18 months is a key question for Grace watchers. Grace's acquisition of $70-million/year water treatment firm Aquatec Quimica (Sao Paulo) is one indicator. Grace's $300-million/year Dearborn water treatment business is currently a weak number three [in the world market], and we want to be number one or number two, nothing less, Bolduc insists. The Aquatc buy meets his criterion of a synergistic and strategic acquisition with which he plans to expand the business,more » backed by more focused R D. Disposal last month of Homco oil field services operation, for $98.5 million, takes Bolduc toward his $500-million target for the year for asset sales. These totaled $1.1 billion at the end of 1992. The final tally will be more than the $1.5-billion target previously stated, Bolduc says, due to higher realizations on certain sales and additions to the list, including Grace Culinary and Colowyo Coal.« less

Constraining Earth's Rheology of the Barents Sea Using Grace Gravity Change Observations

NASA Astrophysics Data System (ADS)

van der Wal, W.; Root, B. C.; Tarasov, L.

2014-12-01

The Barents Sea region was ice covered during last glacial maximum and experiences Glacial Isostatic Adjustment (GIA). Because of the limited amount of relevant geological and geodetic observations, it is difficult to constrain GIA models for this region. With improved ice sheet models and gravity observations from GRACE, it is possible to better constrain Earth rheology. This study aims to constrain the upper mantle viscosity and elastic lithosphere thickness from GRACE data in the Barents Sea region. The GRACE observations are corrected for current ice melting on Svalbard, Novaya Zemlya and Frans Joseph Land. A secular trend in gravity rate trend is estimated from the CSR release 5 GRACE data for the period of February 2003 to July 2013. Furthermore, long wavelength effects from distant large mass balance signals such as Greenland ice melting are filtered out. A new high-variance set of ice loading histories from calibrated glaciological modeling are used in the GIA modeling as it is found that ICE-5G over-estimates the observed GIA gravity change in the region. It is found that the rheology structure represented by VM5a results in over-estimation of the observed gravity change in the region for all ice sheet chronologies investigated. Therefore, other rheological Earth models were investigated. The best fitting upper mantle viscosity and elastic lithosphere thickness in the Barents Sea region are 4 (±0.5)*10^20 Pas and 110 (±20) km, respectively. The GRACE satellite mission proves to be a useful constraint in the Barents Sea Region for improving our knowledge on the upper mantle rheology.

Predictive values of D-dimer assay, GRACE scores and TIMI scores for adverse outcome in patients with non-ST-segment elevation myocardial infarction

PubMed Central

Satilmisoglu, Muhammet Hulusi; Ozyilmaz, Sinem Ozbay; Gul, Mehmet; Ak Yildirim, Hayriye; Kayapinar, Osman; Gokturk, Kadir; Aksu, Huseyin; Erkanli, Korhan; Eksik, Abdurrahman

2017-01-01

Purpose To determine the predictive values of D-dimer assay, Global Registry of Acute Coronary Events (GRACE) and Thrombolysis in Myocardial Infarction (TIMI) risk scores for adverse outcome in patients with non-ST-segment elevation myocardial infarction (NSTEMI). Patients and methods A total of 234 patients (mean age: 57.2±11.7 years, 75.2% were males) hospitalized with NSTEMI were included. Data on D-dimer assay, GRACE and TIMI risk scores were recorded. Logistic regression analysis was conducted to determine the risk factors predicting increased mortality. Results Median D-dimer levels were 349.5 (48.0–7,210.0) ng/mL, the average TIMI score was 3.2±1.2 and the GRACE score was 90.4±27.6 with high GRACE scores (>118) in 17.5% of patients. The GRACE score was correlated positively with both the D-dimer assay (r=0.215, P=0.01) and TIMI scores (r=0.504, P=0.000). Multivariate logistic regression analysis revealed that higher creatinine levels (odds ratio =18.465, 95% confidence interval: 1.059–322.084, P=0.046) constituted the only significant predictor of increased mortality risk with no predictive values for age, D-dimer assay, ejection fraction, glucose, hemoglobin A1c, sodium, albumin or total cholesterol levels for mortality. Conclusion Serum creatinine levels constituted the sole independent determinant of mortality risk, with no significant values for D-dimer assay, GRACE or TIMI scores for predicting the risk of mortality in NSTEMI patients. PMID:28408834

Accounting for spatial correlation errors in the assimilation of GRACE into hydrological models through localization

NASA Astrophysics Data System (ADS)

Khaki, M.; Schumacher, M.; Forootan, E.; Kuhn, M.; Awange, J. L.; van Dijk, A. I. J. M.

2017-10-01

Assimilation of terrestrial water storage (TWS) information from the Gravity Recovery And Climate Experiment (GRACE) satellite mission can provide significant improvements in hydrological modelling. However, the rather coarse spatial resolution of GRACE TWS and its spatially correlated errors pose considerable challenges for achieving realistic assimilation results. Consequently, successful data assimilation depends on rigorous modelling of the full error covariance matrix of the GRACE TWS estimates, as well as realistic error behavior for hydrological model simulations. In this study, we assess the application of local analysis (LA) to maximize the contribution of GRACE TWS in hydrological data assimilation. For this, we assimilate GRACE TWS into the World-Wide Water Resources Assessment system (W3RA) over the Australian continent while applying LA and accounting for existing spatial correlations using the full error covariance matrix. GRACE TWS data is applied with different spatial resolutions including 1° to 5° grids, as well as basin averages. The ensemble-based sequential filtering technique of the Square Root Analysis (SQRA) is applied to assimilate TWS data into W3RA. For each spatial scale, the performance of the data assimilation is assessed through comparison with independent in-situ ground water and soil moisture observations. Overall, the results demonstrate that LA is able to stabilize the inversion process (within the implementation of the SQRA filter) leading to less errors for all spatial scales considered with an average RMSE improvement of 54% (e.g., 52.23 mm down to 26.80 mm) for all the cases with respect to groundwater in-situ measurements. Validating the assimilated results with groundwater observations indicates that LA leads to 13% better (in terms of RMSE) assimilation results compared to the cases with Gaussian errors assumptions. This highlights the great potential of LA and the use of the full error covariance matrix of GRACE TWS

Drought Indicators Based on Model Assimilated GRACE Terrestrial Water Storage Observations

NASA Technical Reports Server (NTRS)

Houborg, Rasmus; Rodell, Matthew; Li, Bailing; Reichle, Rolf; Zaitchik, Benjamin F.

2012-01-01

The Gravity Recovery and Climate Experiment (GRACE) twin satellites observe time variations in Earth's gravity field which yield valuable information about changes in terrestrial water storage (TWS). GRACE is characterized by low spatial (greater than 150,000 square kilometers) and temporal (greater than 10 day) resolution but has the unique ability to sense water stored at all levels (including groundwater) systematically and continuously. The GRACE Data Assimilation System (GRACE-DAS), based on the Catchment Land Surface Model (CLSM) enhances the value of the GRACE water storage data by enabling spatial and temporal downscaling and vertical decomposition into moisture 39 components (i.e. groundwater, soil moisture, snow), which individually are more useful for scientific applications. In this study, GRACE-DAS was applied to North America and GRACE-based drought indicators were developed as part of a larger effort that investigates the possibility of more comprehensive and objective identification of drought conditions by integrating spatially, temporally and vertically disaggregated GRACE data into the U.S. and North American Drought Monitors. Previously, the Drought Monitors lacked objective information on deep soil moisture and groundwater conditions, which are useful indicators of drought. Extensive datasets of groundwater storage from USGS monitoring wells and soil moisture from the Soil Climate Analysis Network (SCAN) were used to assess improvements in the hydrological modeling skill resulting from the assimilation of GRACE TWS data. The results point toward modest, but statistically significant, improvements in the hydrological modeling skill across major parts of the United States, highlighting the potential value of GRACE assimilated water storage field for improving drought detection.

Antarctic Peninsula mass balance at present-day and over the past 150 years employing constraints from GRACE, GPS and other data

NASA Astrophysics Data System (ADS)

Ivins, E. R.; Wiese, D. N.; Watkins, M. M.; Landerer, F. W.; Simms, A.; Yuan, D.; Boening, C.

2013-12-01

Warming on the Antarctic Peninsula (AP) land mass and adjacent islands has been ocurring for more than 100 years. The rate of warming is at the extreme end of all Earth observations: during the 2nd half of the 20th century the rate is 3.5°C per century and has a dramatic effect of glaciers: west coast glaciers show diminishing outlet heights at a rate of 0.28 × 0.03 m/yr since the mid-1960s (Kunz et al., 2012). Since the late 1980's, notably on the northeastern edge of the AP, many of the outlet glaciers have experienced the loss of ice shelf buttressing forces that retard the outlet flow velocity (e.g., Berthier et al., 2012). The loss of these buttressing forces has caused outlet glaciers to speed up. It is clear from ice core and in situ records that the AP snow accumulation has also been increasing. While there is growing confidence that all space borne data are consistent with a net mass loss of the Antarctic Peninsula since 1990, there is relatively little convergence on the total mass loss, and its temporal variability, other than that measured by the Gravity Recovery and Climate Experiment (GRACE). Employing JPL mascon analyses, Ivins et al. (2011) employed 6.25 years of GRACE data, glacial isostatic adjustment (GIA) modeling with GPS data, to determine the mass trend of Graham Land (north of 67° S) at -32 × 6 Gt/yr and -9.5 × 3 Gt/yr for the remainder of the AP (74° S - 67° S). Neither region exhibited any significant non-secular signatures during 2003-2009.25. However, some outlet glaciers have shown both height and velocity changes over the period 2002-2012 that indicate increasing rates of loss - via laser altimetry and InSAR measurements (Anya Wendt, personal communication, 2012). In a combined examination of AP mass balance (with a slightly larger area for AP definition), recent work extended to mid 2013, indicates that the region of the Antarctic Peninsula has a loss rate of about -32.5 × 12 Gt/yr, with distinct and significant speed-up after

GRACE gravity field recovery using refined acceleration approach

NASA Astrophysics Data System (ADS)

Li, Zhao; van Dam, Tonie; Weigelt, Matthias

2017-04-01

Since 2002, the GRACE mission has yielded monthly gravity field solutions with such a high level of quality that we have been able to observe so many changes to the Earth mass system. Based on GRACE L1B observations, a number of official monthly gravity field models have been developed and published using different methods, e.g. the CSR RL05, JPL RL05, and GFZ RL05 are being computed by a dynamic approach, the ITSG and Tongji GRACE are generated using what is known as the short-arc approach, the AIUB models are computed using celestial mechanics approach, and the DMT-1 model is calculated by means of an acceleration approach. Different from the DMT-1 model, which links the gravity field parameters directly to the bias-corrected range measurements at three adjacent epochs, in this work we present an alternative acceleration approach which connects range accelerations and velocity differences to the gradient of the gravitational potential. Due to the fact that GPS derived velocity difference is provided at a lower precision, we must reduce this approach to residual quantities using an a priori gravity field which allows us to subsequently neglect the residual velocity difference term. We find that this assumption would cause a problem in the low-degree gravity field coefficient, particularly for degree 2 and also from degree 16 to 26. To solve this problem, we present a new way of handling the residual velocity difference term, that is to treat this residual velocity difference term as unknown but estimable quantity, as it depends on the unknown residual gravity field parameters and initial conditions. In other word, we regard the kinematic orbit position vectors as pseudo observations, and the corrections of orbits are estimated together with both the geopotential coefficients and the accelerometer scale/bias by using a weighted least square adjustment. The new approach is therefore a refinement of the existing approach but offers a better approximation to reality

A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

PubMed

Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

2015-04-10

Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

Complete mtDNA sequencing reveals mutations m.9185T>C and m.13513G>A in three patients with Leigh syndrome.

PubMed

Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna

2017-12-12

The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.

Characterizing hydrological activities over Yangtze River basin using the new HUST-Grace2016 model, MODIS, and NCEP/NCAR data

NASA Astrophysics Data System (ADS)

Zhou, H.; Luo, Z.; Tangdamrongsub, N.; He, L.

2017-12-01

Accurate TWS estimation is important to evaluate the situation of the water resource over the Yangtze River basin. This study exploits the TWS observation from the new gravity model, HUST-Grace06, which is developed by a new low-frequency noise processing strategy. A novel GRACE post-processing approach is proposed to enhance the quality of the TWS estimate, and the improved TWS is used to characterize the hydrological activities over the Yangtze River basin. The approach includes the effective noise reduction and the leakage error mitigation based on forward modeling. The HUST-Grace06 derived TWS presents good agreement with the CSR mascon solution as well as the PCR-GLOBWB hydrological model. Particularly, our solution provides remarkable performance in identifying the extreme climate events e.g., flood and drought over the Yangtze River basin. In addition, for the first time, the NCEP/NCAR reanalysis data is incorporated with GRACE in the exploration of the climate induced hydrological activities. The comparison between GRACE and the MODIS-derived NDVI data is also conducted to investigate their connection regarding temporal and spatial distribution. The analysis suggests that the terrestrial reflectance data can be used to represent the TWS information. Importantly, such information can be used to fill the missing data in case of the early termination of GRACE or during the prelaunch of the GRACE Follow-On mission.

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

PubMed Central

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

2016-01-01

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

A Multi-Satellite GRACE-like Mission Using Small Satellites

NASA Astrophysics Data System (ADS)

Stephens, M.; Bender, P. L.; Nerem, R.; Pierce, R.; Wiese, D. N.

2010-12-01

Measurement of global water variation provides information critical to climate change and water resource monitoring. The Gravity Recovery and Climate Experiment II (GRACE II) was chosen as a Tier III mission by National Research Council's decadal survey because of its unique ability to measure the global mass distributions and variations in the mass distribution caused primarily by water variation. We discuss a multi-satellite approach to a GRACE-like mission. Enhanced spatial resolution of mass variations over those provided by the current GRACE mission can be achieved by improving the ranging accuracy; an interferometric ranging concept that improves the ranging accuracy has been demonstrated[1]. However, recent calculations show that to obtain the full science improvement using interferometric ranging, temporal aliasing errors due to modeling and to undersampling of geophysical signals must be mitigated[2]. One approach is to improve the data analysis techniques and validation processes. Another approach is to fly two or more pairs of satellites, thereby sampling the Earth's gravitational field at shorter time intervals[3]. A multiple-pair mission is often dismissed as too expensive, but the mission costs of a multiple-pair GRACE-like mission could be greatly reduced by developing compact ranging systems so that the mass, power, and volume usage is consistent with small spacecraft buses. Such size reduction drastically reduces the launch costs by allowing the spacecraft to be launched as auxiliary payloads. We will discuss the technological challenges that are associated with a GRACE-like mission that uses smallsats to reduce costs of more than one pair of satellites, as well as the scientific benefits of the two or more satellite pairs. The technological challenges include reducing the size of the payload and developing a low-drag, low-pointing jitter spacecraft. [1]Pierce, R., J. Leitch, M. Stephens, P. Bender, and R. Nerem, “Intersatellite range monitoring

Constraints of Melting, Sea-Level and the Paleoclimate from GRACE

NASA Technical Reports Server (NTRS)

Davis, James L.

2005-01-01

To gauge the accuracy of the GRACE data, we have undertaken a study to compare deformations predicted by GRACE inferences of seasonal water loading to crustal position variations determined from GRACE data. Two manuscripts that resulted from this study are attached. We found a very high correlation between the GRACE and GPS determinations for South America [Duvis et al., 2004]. We also developed a statistical approach for choosing which Stokes coefficients to include. This approach proves to be somewhat more accurate than the traditional Gaussian filter [Duvis et al., 2005].

[Some similarities between the work of M.C. Escher and plastic surgery].

PubMed

Marck, K W

2002-12-21

At first sight there would appear to be no similarities between the work of the Dutch graphic artist M.C. Escher and plastic surgery. M.C. Escher was a gifted graphic artist who produced a large collection of work. Most of his fame is due to the works that play with symmetry, space and infinity and leave the viewer astounded. However, how Escher came to produce these works is less well known. A theory which he developed himself formed the basis of the regular plane division. It later became apparent that this theory almost completely agreed with the mathematics of plane division. Two movements (isometries) defined in mathematics, translation and rotation, are equivalent to two techniques for transferring local skin in plastic surgery, namely, advancement and transposition. Escher's performance on the plane of a sheet of paper and a plastic surgeon's performance on the plane of the skin, therefore have a similar mathematical background. Escher has visualised these mathematical rules in an unusual and artistic manner, whereas plastic surgeons apply these rules in the grace of an elastic and healing nature.

Grace and Courtesy in the Elementary Community

ERIC Educational Resources Information Center

Huneke-Stone, Elise

2015-01-01

Don't be fooled by Elise Huneke-Stone's disarming beginning where she implies that grace and courtesy is not normally associated with the elementary. She goes on to elaborate that grace and courtesy is indeed everywhere: in project-based learning, understanding of moral precepts, social and intellectual independence, in the utilization of empathy,…

Comparison of Analysis Results Between 2D/1D Synthesis and RAPTOR-M3G in the Korea Standard Nuclear Plant (KSNP)

NASA Astrophysics Data System (ADS)

Joung Lim, Mi; Maeng, Young Jae; Fero, Arnold H.; Anderson, Stanwood L.

2016-02-01

The 2D/1D synthesis methodology has been used to calculate the fast neutron (E > 1.0 MeV) exposure to the beltline region of the reactor pressure vessel. This method uses the DORT 3.1 discrete ordinates code and the BUGLE-96 cross-section library based on ENDF/B-VI. RAPTOR-M3G (RApid Parallel Transport Of Radiation-Multiple 3D Geometries) which performs full 3D calculations was developed and is based on domain decomposition algorithms, where the spatial and angular domains are allocated and processed on multi-processor computer architecture. As compared to traditional single-processor applications, this approach reduces the computational load as well as the memory requirement per processor. Both methods are applied to surveillance test results for the Korea Standard Nuclear Plant (KSNP)-OPR (Optimized Power Reactor) 1000 MW. The objective of this paper is to compare the results of the KSNP surveillance program between 2D/1D synthesis and RAPTOR-M3G. Each operating KSNP has a reactor vessel surveillance program consisting of six surveillance capsules located between the core and the reactor vessel in the downcomer region near the reactor vessel wall. In addition to the In-Vessel surveillance program, an Ex-Vessel Neutron Dosimetry (EVND) program has been implemented. In order to estimate surveillance test results, cycle-specific forward transport calculations were performed by 2D/1D synthesis and by RAPTOR-M3G. The ratio between measured and calculated (M/C) reaction rates will be discussed. The current plan is to install an EVND system in all of the Korea PWRs including the new reactor type, APR (Advanced Power Reactor) 1400 MW. This work will play an important role in establishing a KSNP-specific database of surveillance test results and will employ RAPTOR-M3G for surveillance dosimetry location as well as positions in the KSNP reactor vessel.

Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences

NASA Astrophysics Data System (ADS)

Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

2014-03-01

Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb = 11.5 × 103 M-1) to a weak binder of polydG-polydC (Kb = 5.02 × 103 M-1), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb = 8.18 × 103 M-1) to a weak one of polydG-dC (Kb = 2.18 × 103 M-1), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each

Improved methods for estimating local terrestrial water dynamics from GRACE in the Northern High Plains

NASA Astrophysics Data System (ADS)

Seyoum, Wondwosen M.; Milewski, Adam M.

2017-12-01

Investigating terrestrial water cycle dynamics is vital for understanding the recent climatic variability and human impacts in the hydrologic cycle. In this study, a downscaling approach was developed and tested, to improve the applicability of terrestrial water storage (TWS) anomaly data from the Gravity Recovery and Climate Experiment (GRACE) satellite mission for understanding local terrestrial water cycle dynamics in the Northern High Plains region. A non-parametric, artificial neural network (ANN)-based model, was utilized to downscale GRACE data by integrating it with hydrological variables (e.g. soil moisture) derived from satellite and land surface model data. The downscaling model, constructed through calibration and sensitivity analysis, was used to estimate TWS anomaly for watersheds ranging from 5000 to 20,000 km2 in the study area. The downscaled water storage anomaly data were evaluated using water storage data derived from an (1) integrated hydrologic model, (2) land surface model (e.g. Noah), and (3) storage anomalies calculated from in-situ groundwater level measurements. Results demonstrate the ANN predicts monthly TWS anomaly within the uncertainty (conservative error estimate = 34 mm) for most of the watersheds. Seasonal derived groundwater storage anomaly (GWSA) from the ANN correlated well (r = ∼0.85) with GWSAs calculated from in-situ groundwater level measurements for a watershed size as small as 6000 km2. ANN downscaled TWSA matches closely with Noah-based TWSA compared to standard GRACE extracted TWSA at a local scale. Moreover, the ANN-downscaled change in TWS replicated the water storage variability resulting from the combined effect of climatic and human impacts (e.g. abstraction). The implications of utilizing finer resolution GRACE data for improving local and regional water resources management decisions and applications are clear, particularly in areas lacking in-situ hydrologic monitoring networks.

Estimating continental water storage variations in Central Asia area using GRACE data

NASA Astrophysics Data System (ADS)

Dapeng, Mu; Zhongchang, Sun; Jinyun, Guo

2014-03-01

The goal of GRACE satellite is to determine time-variations of the Earth's gravity, and particularly the effects of fluid mass redistributions at the surface of the Earth. This paper uses GRACE Level-2 RL05 data provided by CSR to estimate water storage variations of four river basins in Asia area for the period from 2003 to 2011. We apply a two-step filtering method to reduce the errors in GRACE data, which combines Gaussian averaging function and empirical de-correlation method. We use GLDAS hydrology to validate the result from GRACE. Special averaging approach is preformed to reduce the errors in GLDAS. The results of former three basins from GRACE are consistent with GLDAS hydrology model. In the Tarim River basin, there is more discrepancy between GRACE and GLDAS. Precipitation data from weather station proves that the results of GRACE are more plausible. We use spectral analysis to obtain the main periods of GRACE and GLDAS time series and then use least squares adjustment to determine the amplitude and phase. The results show that water storage in Central Asia is decreasing.

Validation of the GRACE Risk score for hospital mortality in patients with acute coronary syndrome in the Arab Middle East.

PubMed

Yusufali, Afzalhussein; Zubaid, Mohammad; Al-Zakwani, Ibrahim; Alsheikh-Ali, Alawi A; Al-Mallah, Mouaz H; Al Suwaidi, Jassim; AlMahmeed, Wael; Rashed, Wafa; Sulaiman, Kadhim; Amin, Haitham

2011-07-01

Our objective was to validate the Global Registry of Acute Coronary Events (GRACE) risk score for in-hospital mortality in a Middle Eastern acute coronary syndrome (ACS) population enrolled in the Gulf Registry of Acute Coronary Events (Gulf RACE). Out of 8176, unselected, consecutive patients with ACS, during 6 months in 2006 and 2007 from 63 hospitals in 6 Arab countries in the Middle East Gulf region, 7709 (94.3%) with available data were included. The main outcome measures were discriminatory performance (using C-index) and calibration of the GRACE risk score (in-hospital mortality predicted by GRACE risk score versus the actual mortality). In-hospital mortality in the Gulf RACE was 3.09% (n = 238). The discriminatory performance of the GRACE risk scores in the Gulf RACE was good overall (C-index = 0.86). Observed and predicted risk corresponded well in each stratum of risk of in-hospital mortality. This suggests its suitability for clinical use in this patient population.

Estimating terrestrial water storage changes in the Tarim River Basin using GRACE data

NASA Astrophysics Data System (ADS)

Zhao, Kefei; Li, Xia

2017-12-01

Terrestrial water storage (TWS) plays a fundamental role in the arid Tarim River Basin, which is mainly fed by glacier and snow melt water. However, the significant scarcity of ground-based observations, especially in the high-altitude mountain areas, limits our understanding of TWS changes in this region. In this study, TWS variations in the Tarim River Basin were estimated using monthly GRACE Level 2 Release 5 (RL05) products from 2002 to August 2015. The GRACE results were validated against outputs of Global Land Data Assimilation System (GLDAS) including spatial and temporal correlation analysis. The correlation between the regional TWS time-series of GRACE and GLDAS is 0.7777. It was found that GRACE TWS shows a slightly decreasing trend of -1.4069 ± 0.5060 mm yr-1 in the entire Tarim River Basin during the study period and a significant spatial difference over the study area. An apparent decreasing trend in Tien Shan and the Taklamakan Desert, and a significant increasing trend in the Kunlun Mountains and eastern Pamirs Plateau were also detected. Moreover, seasonal analysis of regional TWS time-series, precipitation and the 0 °C isotherm height in summer showed that detrended TWS variations were consistent with precipitation while long-term trends of TWS were contrary to that of the 0 °C isotherm height in summer. It implied that the interannual TWS variations were dominated by precipitation and the long-term trend of TWS changes was affected by changes of the 0 °C isotherm height in summer. This information could enrich our knowledge about water storage changes, including glacier mass balance and groundwater, and its response to climate change in this vast but sparse in-situ measurements area.

Mascons, GRACE, and Time-variable Gravity

NASA Technical Reports Server (NTRS)

Lemoine, F.; Lutchke, S.; Rowlands, D.; Klosko, S.; Chinn, D.; Boy, J. P.

2006-01-01

The GRACE mission has been in orbit now for three years and now regularly produces snapshots of the Earth s gravity field on a monthly basis. The convenient standard approach has been to perform global solutions in spherical harmonics. Alternative local representations of mass variations using mascons show great promise and offer advantages in terms of computational efficiency, minimization of problems due to aliasing, and increased temporal resolution. In this paper, we discuss the results of processing the GRACE KBRR data from March 2003 through August 2005 to produce solutions for GRACE mass variations over mid-latitude and equatorial regions, such as South America, India and the United States, and over the polar regions (Antarctica and Greenland), with a focus on the methodology. We describe in particular mascon solutions developed on regular 4 degree x 4 degree grids, and those tailored specifically to drainage basins over these regions.

GRACE-Assimilated Drought Indicators for the U.S. Drought Monitor

NASA Technical Reports Server (NTRS)

Rui, Hualan; Vollmer, Bruce; Teng, Bill; Loeser, Carlee; Beaudoing, Hiroko; Rodell, Matt

2018-01-01

The Gravity Recovery and Climate Experiment (GRACE) mission detects changes in Earth's gravity field by precisely monitoring the changes in distance between two satellites orbiting the Earth in tandem. Scientists at NASA's Goddard Space Flight Center generate GRACE-assimilated groundwater and soil moisture drought indicators each week, for drought monitor-related studies and applications. The GRACE-assimilated Drought Indicator Version 2.0 data product (GRACE-DA-DM V2.0) is archived at, and distributed by, the NASA GES DISC (Goddard Earth Sciences Data and Information Services Center). More information about the data and data access is available on the data product landing page at https://disc.gsfc.nasa.gov/datasets /GRACEDADM_CLSM0125US_7D_2.0/summary. The GRACE-DA-DM V2.0 data product contains three drought indicators: Groundwater Percentile, Root Zone Soil Moisture Percentile, and Surface Soil Moisture Percentile. The drought indicators are of wet or dry conditions, expressed as a percentile, indicating the probability of occurrence within the period of record from 1948 to 2012. These GRACE-assimilated drought indicators, with improved spatial and temporal resolutions, should provide a more comprehensive and objective identification of drought conditions. This presentation describes the basic characteristics of the data and data services at NASA GES DISC and collaborative organizations, and uses a few examples to demonstrate the simple ways to explore the GRACE-assimilated drought indicator data.

Terrestrial Water Mass Load Changes from Gravity Recovery and Climate Experiment (GRACE)

NASA Technical Reports Server (NTRS)

Seo, K.-W.; Wilson, C. R.; Famiglietti, J. S.; Chen, J. L.; Rodell M.

2006-01-01

Recent studies show that data from the Gravity Recovery and Climate Experiment (GRACE) is promising for basin- to global-scale water cycle research. This study provides varied assessments of errors associated with GRACE water storage estimates. Thirteen monthly GRACE gravity solutions from August 2002 to December 2004 are examined, along with synthesized GRACE gravity fields for the same period that incorporate simulated errors. The synthetic GRACE fields are calculated using numerical climate models and GRACE internal error estimates. We consider the influence of measurement noise, spatial leakage error, and atmospheric and ocean dealiasing (AOD) model error as the major contributors to the error budget. Leakage error arises from the limited range of GRACE spherical harmonics not corrupted by noise. AOD model error is due to imperfect correction for atmosphere and ocean mass redistribution applied during GRACE processing. Four methods of forming water storage estimates from GRACE spherical harmonics (four different basin filters) are applied to both GRACE and synthetic data. Two basin filters use Gaussian smoothing, and the other two are dynamic basin filters which use knowledge of geographical locations where water storage variations are expected. Global maps of measurement noise, leakage error, and AOD model errors are estimated for each basin filter. Dynamic basin filters yield the smallest errors and highest signal-to-noise ratio. Within 12 selected basins, GRACE and synthetic data show similar amplitudes of water storage change. Using 53 river basins, covering most of Earth's land surface excluding Antarctica and Greenland, we document how error changes with basin size, latitude, and shape. Leakage error is most affected by basin size and latitude, and AOD model error is most dependent on basin latitude.

Development of daily "swath" mascon solutions from GRACE

NASA Astrophysics Data System (ADS)

Save, Himanshu; Bettadpur, Srinivas

2016-04-01

The Gravity Recovery and Climate Experiment (GRACE) mission has provided invaluable and the only data of its kind over the past 14 years that measures the total water column in the Earth System. The GRACE project provides monthly average solutions and there are experimental quick-look solutions and regularized sliding window solutions available from Center for Space Research (CSR) that implement a sliding window approach and variable daily weights. The need for special handling of these solutions in data assimilation and the possibility of capturing the total water storage (TWS) signal at sub-monthly time scales motivated this study. This study discusses the progress of the development of true daily high resolution "swath" mascon total water storage estimate from GRACE using Tikhonov regularization. These solutions include the estimates of daily total water storage (TWS) for the mascon elements that were "observed" by the GRACE satellites on a given day. This paper discusses the computation techniques, signal, error and uncertainty characterization of these daily solutions. We discuss the comparisons with the official GRACE RL05 solutions and with CSR mascon solution to characterize the impact on science results especially at the sub-monthly time scales. The evaluation is done with emphasis on the temporal signal characteristics and validated against in-situ data set and multiple models.

GRACE star camera noise

NASA Astrophysics Data System (ADS)

Harvey, Nate

2016-08-01

Extending results from previous work by Bandikova et al. (2012) and Inacio et al. (2015), this paper analyzes Gravity Recovery and Climate Experiment (GRACE) star camera attitude measurement noise by processing inter-camera quaternions from 2003 to 2015. We describe a correction to star camera data, which will eliminate a several-arcsec twice-per-rev error with daily modulation, currently visible in the auto-covariance function of the inter-camera quaternion, from future GRACE Level-1B product releases. We also present evidence supporting the argument that thermal conditions/settings affect long-term inter-camera attitude biases by at least tens-of-arcsecs, and that several-to-tens-of-arcsecs per-rev star camera errors depend largely on field-of-view.

Modes of Arctic Ocean Change from GRACE, ICESat and the PIOMAS and ECCO2 Models of the Arctic Ocean

NASA Astrophysics Data System (ADS)

Peralta Ferriz, C.; Morison, J. H.; Bonin, J. A.; Chambers, D. P.; Kwok, R.; Zhang, J.

2012-12-01

EOF analysis of month-to-month variations in GRACE derived Arctic Ocean bottom pressure (OBP) with trend and seasonal variation removed yield three dominant modes. The first mode is a basin wide variation in mass associated with high atmospheric pressure (SLP) over Scandinavia mainly in winter. The second mode is a shift of mass from the central Arctic Ocean to the Siberian shelves due to low pressure over the basins, associated with the Arctic Oscillation. The third mode is a shift in mass between the Eastern and Western Siberian shelves, related to strength of the Beaufort High mainly in summer, and to eastward alongshore winds on the Barents Sea in winter. The PIOMAS and ECCO2 modeled OBP show fair agreement with the form of these modes and provide context in terms of variations in sea surface height SSH. Comparing GRACE OBP from 2007 to 2011 with GRACE OBP from 2002 to 2006 reveals a rising trend over most of the Arctic Ocean but declines in the Kara Sea region and summer East Siberian Sea. ECCO2 bears a faint resemblance to the observed OBP change but appears to be biased negatively. In contrast, PIOMAS SSH and ECCO2 especially, show changes between the two periods that are muted but similar to ICESat dynamic ocean topography and GRACE-ICESat freshwater trends from 2005 through 2008 [Morison et al., 2012] with a rising DOT and freshening in the Beaufort Sea and a trough with decreased freshwater on the Russian side of the Arctic Ocean. Morison, J., R. Kwok, C. Peralta-Ferriz, M. Alkire, I. Rigor, R. Andersen, and M. Steele (2012), Changing Arctic Ocean freshwater pathways, Nature, 481(7379), 66-70.

Living Grace and Courtesy in the Primary

ERIC Educational Resources Information Center

Soholt, Polli

2015-01-01

Polli Soholt looks at grace and courtesy from the 3-6 classroom perspective with clear theory explanations as they pertain to the larger classroom culture. She discusses the link between older and young children and the presence of the teacher as a model for grace and takes a brief look to neural science for proof of the existence of social…

Arctic Ocean Tides from GRACE Satellite Accelerations

NASA Astrophysics Data System (ADS)

Killett, B.; Wahr, J. M.; Desai, S. D.; Yuan, D.; Watkins, M. M.

2010-12-01

Because missions such as TOPEX/POSEIDON don't extend to high latitudes, Arctic ocean tidal solutions aren't constrained by altimetry data. The resulting errors in tidal models alias into monthly GRACE gravity field solutions at all latitudes. Fortunately, GRACE inter-satellite ranging data can be used to solve for these tides directly. Seven years of GRACE inter-satellite acceleration data are inverted using a mascon approach to solve for residual amplitudes and phases of major solar and lunar tides in the Arctic ocean relative to FES 2004. Simulations are performed to test the inversion algorithm's performance, and uncertainty estimates are derived from the tidal signal over land. Truncation error magnitudes and patterns are compared to the residual tidal signals.

Combining GRACE and Altimetry to solve for present day mass changes and GIA

NASA Astrophysics Data System (ADS)

Rietbroek, R.; Lück, C.; Uebbing, B.; Kusche, J.; King, M. A.

2017-12-01

Past and present day sea level rise is closely linked to geoid and surface deformation changes from the ongoing glacial isostatic adjustment (GIA). Sea level, as detected by radar altimetry, senses the radial deformation of the ocean floor as mantle material slowly flows back to the locations of the former glacial domes. This manifests itself as a net subsidence when averaged over the entire ocean, but can regionally be seen as an uplift for locations close to the former ice sheets. Furthermore, mass driven sea level as derived from GRACE, is even more sensitive to GIA induced mass redistribution in the solid Earth. Consequently, errors in GIA corrections, most notably errors in mantle viscosity and ice histories, have a different leverage on regional sea level estimates from GRACE and altimetry. In this study, we discuss the abilities of a GRACE-altimetry combination to co-estimate GIA corrections together with present day contributors to sea level, rather than simply prescribing a GIA correction from a model. The data is combined in a joint inversion scheme which makes use of spatial patterns to parameterize present day loading effects and GIA. We show that the GRACE-altimetry combination requires constraints, but generally steers the Antarctic GIA signal towards a weaker present day signal in Antarctica compared to a ICE5-G(VM2) derived model. Furthermore, in light of the aging GRACE mission, we show sensitivity studies of how well one could estimate GIA corrections when using other low earth orbiters such as SWARM or CHAMP. Finally, we show whether the Antarctic GNSS station network may be useful in separating GIA from present day mass signals in this type of inversion schemes.

California Drought Recovery Assessment Using GRACE Satellite Gravimetry Information

NASA Astrophysics Data System (ADS)

Love, C. A.; Aghakouchak, A.; Madadgar, S.; Tourian, M. J.

2015-12-01

California has been experiencing its most extreme drought in recent history due to a combination of record high temperatures and exceptionally low precipitation. An estimate for when the drought can be expected to end is needed for risk mitigation and water management. A crucial component of drought recovery assessments is the estimation of terrestrial water storage (TWS) deficit. Previous studies on drought recovery have been limited to surface water hydrology (precipitation and/or runoff) for estimating changes in TWS, neglecting the contribution of groundwater deficits to the recovery time of the system. Groundwater requires more time to recover than surface water storage; therefore, the inclusion of groundwater storage in drought recovery assessments is essential for understanding the long-term vulnerability of a region. Here we assess the probability, for varying timescales, of California's current TWS deficit returning to its long-term historical mean. Our method consists of deriving the region's fluctuations in TWS from changes in the gravity field observed by NASA's Gravity Recovery and Climate Experiment (GRACE) satellites. We estimate the probability that meteorological inputs, precipitation minus evaporation and runoff, over different timespans will balance the current GRACE-derived TWS deficit (e.g. in 3, 6, 12 months). This method improves upon previous techniques as the GRACE-derived water deficit comprises all hydrologic sources, including surface water, groundwater, and snow cover. With this empirical probability assessment we expect to improve current estimates of California's drought recovery time, thereby improving risk mitigation.

High-frequency signal and noise estimates of CSR GRACE RL04

NASA Astrophysics Data System (ADS)

Bonin, Jennifer A.; Bettadpur, Srinivas; Tapley, Byron D.

2012-12-01

A sliding window technique is used to create daily-sampled Gravity Recovery and Climate Experiment (GRACE) solutions with the same background processing as the official CSR RL04 monthly series. By estimating over shorter time spans, more frequent solutions are made using uncorrelated data, allowing for higher frequency resolution in addition to daily sampling. Using these data sets, high-frequency GRACE errors are computed using two different techniques: assuming the GRACE high-frequency signal in a quiet area of the ocean is the true error, and computing the variance of differences between multiple high-frequency GRACE series from different centers. While the signal-to-noise ratios prove to be sufficiently high for confidence at annual and lower frequencies, at frequencies above 3 cycles/year the signal-to-noise ratios in the large hydrological basins looked at here are near 1.0. Comparisons with the GLDAS hydrological model and high frequency GRACE series developed at other centers confirm CSR GRACE RL04's poor ability to accurately and reliably measure hydrological signal above 3-9 cycles/year, due to the low power of the large-scale hydrological signal typical at those frequencies compared to the GRACE errors.

Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla

PubMed Central

Li, Xiu-Qing; Du, Donglei

2014-01-01

C+G content (GC content or G+C content) is known to be correlated with genome/chromosome size in bacteria but the relationship for other kingdoms remains unclear. This study analyzed genome size, chromosome size, and base composition in most of the available sequenced genomes in various kingdoms. Genome size tends to increase during evolution in plants and animals, and the same is likely true for bacteria. The genomic C+G contents were found to vary greatly in microorganisms but were quite similar within each animal or plant subkingdom. In animals and plants, the C+G contents are ranked as follows: monocot plants>mammals>non-mammalian animals>dicot plants. The variation in C+G content between chromosomes within species is greater in animals than in plants. The correlation between average chromosome C+G content and chromosome length was found to be positive in Proteobacteria, Actinobacteria (but not in other analyzed bacterial phyla), Ascomycota fungi, and likely also in some plants; negative in some animals, insignificant in two protist phyla, and likely very weak in Archaea. Clearly, correlations between C+G content and chromosome size can be positive, negative, or not significant depending on the kingdoms/groups or species. Different phyla or species exhibit different patterns of correlation between chromosome-size and C+G content. Most chromosomes within a species have a similar pattern of variation in C+G content but outliers are common. The data presented in this study suggest that the C+G content is under genetic control by both trans- and cis- factors and that the correlation between C+G content and chromosome length can be positive, negative, or not significant in different phyla. PMID:24551092

Constraining precipitation amount and distribution over cold regions using GRACE

NASA Astrophysics Data System (ADS)

Behrangi, A.; Reager, J. T., II; Gardner, A. S.; Fisher, J.

2017-12-01

Current quantitative knowledge on the amount and distribution of precipitation in high-elevation and high latitude regions is limited due to instrumental and retrieval shortcomings. Here we demonstrate how that satellite gravimetry (Gravity Recovery and Climate Experiment, GRACE) can be used to provide an independent estimate of monthly accumulated precipitation using mass balance. Results showed that the GRACE-based precipitation estimate has the highest agreement with most of the commonly used precipitation products in summer, but it deviates from them in cold months, when the other products are expected to have larger error. We also observed that as near surface temperature decreases products tend to underestimate accumulated precipitation retrieved from GRACE. The analysis performed using various products such as GPCP, GPCC, TRMM, and gridded station data over vast regions in high latitudes and two large endorheic basins in High Mountain Asia. Based on the analysis over High Mountain Asia it was found that most of the products capture about or less than 50% of the total precipitation estimated using GRACE in winter. Overall, GPCP showed better agreement with GRACE estimate than other products. Yet on average GRACE showed 30% more annual precipitation than GPCP in the study basin.

Investigating different filter and rescaling methods on simulated GRACE-like TWS variations for hydrological applications

NASA Astrophysics Data System (ADS)

Zhang, Liangjing; Dobslaw, Henryk; Dahle, Christoph; Thomas, Maik; Neumayer, Karl-Hans; Flechtner, Frank

2017-04-01

.1007/s00190-007-0143-3. Zhang L, Dobslaw H, Thomas M (2016) Globally gridded terrestrial water storage variations from GRACE satellite gravimetry for hydrometeorological applications. Geophysical Journal International 206(1):368-378, DOI 10.1093/gji/ggw153.

Stress Variation Caused by the Terrestrial Water Storage Inferred from GRACE Data

NASA Astrophysics Data System (ADS)

Yi, H.; Wen, L.

2014-12-01

We estimate stress variation caused by the terrestrial water storage (TWS) change from 2003 to 2013. We first infer the TWS change from the monthly gravity field change in the Gravity Recovery and Climate Experiment (GRACE). We then estimate the stress change at the Earth's surface caused by elastic loading of mass change associated with the inferred TWS change.The monthly spherical harmonics of the GRACE gravity solutions are processed using a decorrelation filter and Gaussian smoothing, to suppress the noise in high degree and order, following the approach of Swenson and Wahr [2006] and Chen et al. [2007]. The gravity variation associated with the glacial isostatic adjustment (GIA) is further removed from the GRACE solutions based on a geodynamical model by Paulson et al. [2007]. The inferred TWS changes exhibit a trend of increase from 2003 to 2013 in Amazon basin, southern Africa, the northern United State America (USA) and Queen Maud Land of Antarctica, and a trend of decrease in the same period in central Argentina, southern Chile, northern India, northern Iran, Alaska of the USA, Greenland and Marie Byrd Land of Antarctica.Surface stress variation due to the TWS loading is calculated, assuming an incompressible and self-gravitating Earth, with an elastic crust and a viscoelastic mantle overlying an inviscid core based on PREM model. We will present the geographical distribution of the stress variation caused by the TWS loading and discuss its possible implications. Chen, J. L., C. R. Wilson, B. D. Tapley, and S. Grand (2007), GRACE detects coseismic and postseismic deformation from the Sumatra-Andaman earthquake, Geophys Res Lett, 34(13), doi:10.1029/2007GL030356. Paulson, A., S. J. Zhong, and J. Wahr (2007), Inference of mantle viscosity from GRACE and relative sea level data, Geophys J Int, 171(2), 497-508, doi:10.1111/j.1365-246X.2007.03556.x. Swenson, S., and J. Wahr (2006), Post-processing removal of correlated errors in GRACE data, Geophys Res Lett, 33

Have GRACE Satellites Overestimated Groundwater Depletion in the Northwest India Aquifer?

NASA Technical Reports Server (NTRS)

Long, Di; Chen, Xi; Scanlon, Bridget R.; Wada, Yoshihide; Hong, Yang; Singh, Vijay P.; Chen, Yaning; Wang, Cunguang; Han, Zhongying; Yang, Wenting

2016-01-01

The Northwest India Aquifer (NWIA) has been shown to have the highest groundwater depletion (GWD) rate globally, threatening crop production and sustainability of groundwater resources. Gravity Recovery and Climate Experiment (GRACE) satellites have been emerging as a powerful tool to evaluate GWD with ancillary data. Accurate GWD estimation is, however, challenging because of uncertainties in GRACE data processing. We evaluated GWD rates over the NWIA using a variety of approaches, including newly developed constrained forward modeling resulting in a GWD rate of 3.1 plus or minus 0.1 centimeters per acre (or 14 plus or minus 0.4 cubic kilometers per acre) for Jan 2005-Dec 2010, consistent with the GWD rate (2.8 centimeters per acre or 12.3 cubic kilometers per acre) from groundwater-level monitoring data. Published studies (e.g., 4 plus or minus 1 centimeter per acre or 18 plus or minus 4.4 cubic kilometers per acre) may overestimate GWD over this region. This study highlights uncertainties in GWD estimates and the importance of incorporating a priori information to refine spatial patterns of GRACE signals that could be more useful in groundwater resource management and need to be paid more attention in future studies.

Have GRACE satellites overestimated groundwater depletion in the Northwest India Aquifer?

PubMed Central

Long, Di; Chen, Xi; Scanlon, Bridget R.; Wada, Yoshihide; Hong, Yang; Singh, Vijay P.; Chen, Yaning; Wang, Cunguang; Han, Zhongying; Yang, Wenting

2016-01-01

The Northwest India Aquifer (NWIA) has been shown to have the highest groundwater depletion (GWD) rate globally, threatening crop production and sustainability of groundwater resources. Gravity Recovery and Climate Experiment (GRACE) satellites have been emerging as a powerful tool to evaluate GWD with ancillary data. Accurate GWD estimation is, however, challenging because of uncertainties in GRACE data processing. We evaluated GWD rates over the NWIA using a variety of approaches, including newly developed constrained forward modeling resulting in a GWD rate of 3.1 ± 0.1 cm/a (or 14 ± 0.4 km3/a) for Jan 2005–Dec 2010, consistent with the GWD rate (2.8 cm/a or 12.3 km3/a) from groundwater-level monitoring data. Published studies (e.g., 4 ± 1 cm/a or 18 ± 4.4 km3/a) may overestimate GWD over this region. This study highlights uncertainties in GWD estimates and the importance of incorporating a priori information to refine spatial patterns of GRACE signals that could be more useful in groundwater resource management and need to be paid more attention in future studies. PMID:27075595

New Views of Earth's Gravity Field from GRACE

NASA Technical Reports Server (NTRS)

2003-01-01

[figure removed for brevity, see original site] [figure removed for brevity, see original site] Map 1Map 2

Gravity and the Earth's Shape Gravity is the force that is responsible for the weight of an object and is determined by how the material that makes up the Earth is distributed throughout the Earth. Because gravity changes over the surface of the Earth, the weight of an object changes along with it. One can define standard gravity as the value of gravity for an perfectly smooth 'idealized' Earth, and the gravity 'anomaly' is a measure of how actual gravity deviates from this standard. Gravity reflects the Earth's surface topography to a high degree and is associated with features that most people are familiar with such as large mountains and deep ocean trenches.

Progress in Measuring the Earth's Gravity Field Through GRACE Prior to GRACE, the Earth's gravity field was determined using measurements of varying quality from different satellites and of incomplete coverage. Consequently the accuracy and resolution of the gravity field were limited. As is shown in Figure 1, the long wavelength components of the gravity field determined from satellite tracking were limited to a resolution of approximately 700 km. At shorter wavelengths, the errors were too large to be useful. Only broad geophysical features of the Earth's structure could be detected (see map 1).

In contrast, GRACE, by itself, has provided accurate gravity information with a resolution of 200 km. Now, much more detail is clearly evident in the Earth's geophysical features (see map 2). High resolution features detected by GRACE that are representative of geophysical phenomena include the Tonga/Kermadec region (a zone where one tectonic plate slides under another), the Himalayan/Tibetan Plateau region (an area of uplift due to colliding plates), and the mid-Atlantic ridge (an active spreading center in the middle of the Atlantic ocean where new crust is being created). Future GRACE gravity

Admission glucose does not improve GRACE score at 6 months and 5 years after myocardial infarction.

PubMed

de Mulder, Maarten; van der Ploeg, Tjeerd; de Waard, Guus A; Boersma, Eric; Umans, Victor A

2011-01-01

Admission plasma glucose (APG) is a biomarker that predicts mortality in myocardial infarction (MI) patients. Therefore, APG may improve risk stratification based on the GRACE risk score. We collected data on baseline characteristics and long-term (median 55 months) outcome of 550 MI patients who entered our hospital in 2003 and 2006. We determined the GRACE risk score at admission for each patient, which was entered in a logistic regression model, together with APG, to evaluate their prognostic value for 6-month and 5-year mortality. Patients with APG ≥7.8 mmol/l had a higher mortality than those with APG levels <7.8 mmol/l; 6 months: 13.7 versus 3.6%, p value <0.001; 5 years: 20.4 versus 11.1%, p value 0.003. After adjustment for the GRACE risk score variables, APG appeared a significant predictor of 6-month and 5-year mortality, adjusted OR 1.17 (1.06-1.29) and 1.12 (1.03-1.22). The combination of the GRACE risk score and APG increased the model's performance (discrimination C-index 0.87 vs. 0.85), although the difference was not significant (p = 0.095). Combining the GRACE risk score and APG reclassified 12.9% of the patients, but the net reclassification improvement was nonsignificant (p = 0.146). APG is a predictor of 6-month and 5-year mortality, each mmol/l increase in APG being associated with a mortality increase of 17 and 12%, respectively, independent of the GRACE risk score. However, adding APG to the GRACE model did not result in significantly improved clinical risk stratification. Copyright © 2012 S. Karger AG, Basel.

Remote Sensing of Terrestrial Water Storage with GRACE and Future Gravimetry Missions

NASA Technical Reports Server (NTRS)

Rodell, Matt; Watkins, Mike; Famiglietti, Jay

2011-01-01

The Gravity Recovery and Climate Experiment (GRACE) has demonstrated that satellite gravimetry can be a valuable tool for regional to global water cycle observation. Studies of ice sheet and glacier mass losses, ocean bottom pressure and circulation, and variability of water stored on and in the land including groundwater all have benefited from GRACE observations, and the list of applications and discoveries continues to grow. As the mission approaches its tenth anniversary of launch on March 12,2012, it has nearly doubled its proposed lifetime but is showing some signs of age. In particular, degraded battery capacity limits the availability of power in certain orbital configurations, so that the accelerometers must be turned off for approximately one month out of six. The mission managers have decided to operate the spacecrafts in a manner that maximizes the remaining lifetime, so that the longest possible climate data record is available from GRACE. Nevertheless, it is not unlikely that there will be a data gap between GRACE and the GRACE Follow On mission, currently proposed for launch in 2016. In this presentation we will describe recent GRACE enabled science, GRACE mission health, and plans for GRACE Follow On and other future satellite gravimetry missions.

Using GRACE to constrain precipitation amount over cold mountainous basins

NASA Astrophysics Data System (ADS)

Behrangi, Ali; Gardner, Alex S.; Reager, John T.; Fisher, Joshua B.

2017-01-01

Despite the importance for hydrology and climate-change studies, current quantitative knowledge on the amount and distribution of precipitation in mountainous and high-elevation regions is limited due to instrumental and retrieval shortcomings. Here by focusing on two large endorheic basins in High Mountain Asia, we show that satellite gravimetry (Gravity Recovery and Climate Experiment (GRACE)) can be used to provide an independent estimate of monthly accumulated precipitation using mass balance equation. Results showed that the GRACE-based precipitation estimate has the highest agreement with most of the commonly used precipitation products in summer, but it deviates from them in cold months, when the other products are expected to have larger errors. It was found that most of the products capture about or less than 50% of the total precipitation estimated using GRACE in winter. Overall, Global Precipitation Climatology Project (GPCP) showed better agreement with GRACE estimate than other products. Yet on average GRACE showed 30% more annual precipitation than GPCP in the study basins. In basins of appropriate size with an absence of dense ground measurements, as is a typical case in cold mountainous regions, we find GRACE can be a viable alternative to constrain monthly and seasonal precipitation estimates from other remotely sensed precipitation products that show large bias.

Annual, Seasonal, and Secular Changes in Time-Variable Gravity from GRACE

NASA Astrophysics Data System (ADS)

Lemoine, F. G.; Luthcke, S. B.; Klosko, S. M.; Rowlands, D. D.; Chinn, D. S.; McCarthy, J. J.; Ray, R. D.; Boy, J.

2007-12-01

The NASA/DLR GRACE mission, launched in 2002, has now operated for more than five years, producing monthly and ten-day snapshots of the variations of the gravity field of the Earth. The available solutions, either from spherical harmonics or from mascons, allow us new insights into the variations of surface gravity on the Earth at annual, inter-annual, and secular time scales. Our baseline time series, based on GGM02C, NCEP Atmospheric Gravity with IB, and GOT00 tides now is extended to July 2007, spanning four+ years, and we analyze both mascon and spherical harmonic solutions from this time series with respect to global hydrology variations. Our 4degx4deg mascon solutions are extended to cover all continental regions of the globe. Comparisons with hydrology (land-surface) models can offer insights into how these models might be improved. We compare our baseline time series, with new time series that include an updated Goddard Ocean Tide (GOT) model, ECMWF- 3hr atmosphere de-aliasing data, and the MOG-2D ocean dealiasing product. Finally, we intercompare the spherical harmonic solutions at low degree from GRACE from the various product centers (e.g., GFZ, CSR, GRGS), and look for secular signals in both the GSFC mascon and spherical harmonic solutions, taking care to compare the results for secular gravity field change with independent solutions developed over 25 years of independent tracking to geodetic satellites by Satellite Laser Ranging (SLR) and DORIS.

The GRACE Mission in the Final Stage

NASA Astrophysics Data System (ADS)

Tapley, B. D.; Flechtner, F.; Watkins, M. M.; Boening, C.; Bettadpur, S. V.

2016-12-01

The twin satellites of the Gravity Recovery and Climate Experiment (GRACE) were launched on March 17, 2002 and have operated for over 13 years. The mission objectives are to sense the spatial and temporal variations of the Earth's mass through its effects on the gravity field at the GRACE satellite altitude. The major cause of the time varying mass is water motion and the GRACE mission has provided a continuous decade long measurement sequences which characterizes the seasonal cycle of mass transport between the oceans, land, cryosphere and atmosphere; its inter-annual variability; and the climate driven secular, or long period, mass transport signals. The mission is entering the final phase of operations. The current mission operations strategy emphasizes extending the mission lifetime to achieve mission overlap with the GRACE Follow On Mission, whose launch is scheduled for late 2017. The mission operations decisions necessary to extend the mission lifetime impact both the science data yield and the data quality. This presentation will review the mission status, the projections for mission lifetime, summarize plans for the RL 06 data re-analysis, describe the issues that influence the operations philosophy and discuss the impact on the science data products during the remaining mission lifetime.

Laser ranging interferometer for GRACE follow-on

NASA Astrophysics Data System (ADS)

Heinzel, Gerhard; Sheard, Benjmin; Brause, Nils; Danzmann, Karsten; Dehne, Marina; Gerberding, Oliver; Mahrdt, Christoph; Müller, Vitali; Schütze, Daniel; Stede, Gunnar; Klipstein, William; Folkner, William; Spero, Robert; Nicklaus, Kolja; Gath, Peter; Shaddock, Daniel

2017-11-01

The Gravity Recovery and Climate Experiment (GRACE) has produced a wealth of data on Earth gravity, hydrology, glaciology and climate research. To continue that data after the imminent end of the GRACE mission, a follow-on mission is planned to be launched in 2017, as a joint USGerman project with a smaller Australian contribution. The satellites will be essentially rebuilt as they were for GRACE using microwave ranging as the primary instrument for measuring changes of the intersatellite distance. In addition and in contrast to the original GRACE mission, a Laser Ranging Interferometer (LRI, previously also called `Laser Ranging Instrument') will be included as a technology demonstrator, which will operate together with the microwave ranging and supply a complimentary set of ranging data with lower noise, and new data on the relative alignment between the spacecraft. The LRI aims for a noise level of 80 nm/√Hz over a distance of up to 270km and will be the first intersatellite laser ranging interferometer. It shares many technologies with LISA-like gravitational wave observatories. This paper describes the optical architecture including the mechanisms to handle pointing jitter, the main noise sources and their mitigation, and initial laboratory breadboard experiments at AEI Hannover.

On the formulation of gravitational potential difference between the GRACE satellites based on energy integral in Earth fixed frame

NASA Astrophysics Data System (ADS)

Zeng, Y. Y.; Guo, J. Y.; Shang, K.; Shum, C. K.; Yu, J. H.

2015-09-01

Two methods for computing gravitational potential difference (GPD) between the GRACE satellites using orbit data have been formulated based on energy integral; one in geocentric inertial frame (GIF) and another in Earth fixed frame (EFF). Here we present a rigorous theoretical formulation in EFF with particular emphasis on necessary approximations, provide a computational approach to mitigate the approximations to negligible level, and verify our approach using simulations. We conclude that a term neglected or ignored in all former work without verification should be retained. In our simulations, 2 cycle per revolution (CPR) errors are present in the GPD computed using our formulation, and empirical removal of the 2 CPR and lower frequency errors can improve the precisions of Stokes coefficients (SCs) of degree 3 and above by 1-2 orders of magnitudes. This is despite of the fact that the result without removing these errors is already accurate enough. Furthermore, the relation between data errors and their influences on GPD is analysed, and a formal examination is made on the possible precision that real GRACE data may attain. The result of removing 2 CPR errors may imply that, if not taken care of properly, the values of SCs computed by means of the energy integral method using real GRACE data may be seriously corrupted by aliasing errors from possibly very large 2 CPR errors based on two facts: (1) errors of bar C_{2,0} manifest as 2 CPR errors in GPD and (2) errors of bar C_{2,0} in GRACE data-the differences between the CSR monthly values of bar C_{2,0} independently determined using GRACE and SLR are a reasonable measure of their magnitude-are very large. Our simulations show that, if 2 CPR errors in GPD vary from day to day as much as those corresponding to errors of bar C_{2,0} from month to month, the aliasing errors of degree 15 and above SCs computed using a month's GPD data may attain a level comparable to the magnitude of gravitational potential

Stumble into Grace

ERIC Educational Resources Information Center

Rogers, Jennifer

2015-01-01

Jennifer Rogers writes with apt and lyrical snippets from her perspective as a Montessori parent and from her long history as a primary guide. This short piece examines the word "grace" from multiple facets and serves as a meditation that uplifts and reminds us "that the life of a child is a gift."

GRACES, the Gemini remote access CFHT ESPaDOnS spectrograph: initial design and testing

NASA Astrophysics Data System (ADS)

Tollestrup, Eric V.; Pazder, John; Barrick, Gregory; Martioli, Eder; Schiavon, Ricardo; Anthony, André; Halman, Mark; Veillet, Christian

2012-09-01

The Gemini Remote Access CFHT ESPaDOnS Spectrograph (GRACES) is an innovative instrumentation experiment that will demonstrate if ESPaDOnS, a bench-mounted high-resolution optical spectrograph at CFHT, can be fed by a 270-m long fiber from the Gemini-North telescope with low enough losses to remain competitive with conventional spectrographs on other 8 to 10-m telescopes. Detailed simulations have shown that GRACES should be more sensitive than the HIRES spectrograph at Keck Observatory at wavelengths longer than about 600-700 nm. This result is possible by using FPB-type of optical fibers made by Polymicro Technologies and by keeping the critical focal ratio degradation (FRD) losses to less than 10%. Laboratory tests on these FPB optical fibers are underway and show that for 36-m lengths that the FRD losses are as low as 0.8% with a repeatability of 1%. Tests are currently underway on 280-m lengths.

Hydrology Applications of the GRACE missions

NASA Astrophysics Data System (ADS)

Srinivasan, M. M.; Ivins, E. R.; Jasinski, M. F.

2014-12-01

NASA and their German space agency partners have a rich history of global gravity observations beginning with the launch of the Gravity Recovery And Climate Experiment (GRACE) in 2002. The science goals of the mission include providing monthly maps of variations in the gravity field, where the major time-varying signal is due to water motion in the Earth system. GRACE has a unique ability to observe the mass flux of water movement at monthly time scales. The hydrology applications of the GRACE mission include measurements of seasonal storage of surface and subsurface water and evapotranspiration at the land-ocean-atmosphere boundary. These variables are invaluable for improved modeling and prediction of Earth system processes. Other mission-critical science objectives include measurements that are a key component of NASA's ongoing climate measuring capabilities. Successful strategies to enhance science and practical applications of the proposed GRACE-Follow On (GRACE-FO) mission, scheduled to launch in 2017, will require engaging with and facilitating between representatives in the science, societal applications, and mission planning communities. NASA's Applied Sciences Program is supporting collaboration on an applied approach to identifying communities of potential and of practice in order to identify and promote the societal benefits of these and future gravity missions. The objective is to engage applications-oriented users and organizations and enable them to envision possible applications and end-user needs as a way to increase the benefits of these missions to the nations. The focus of activities for this applications program include; engaging the science community in order to identify applications and current and potential data users, developing a written Applications Plan, conducting workshops and user tutorials, providing ready access to information via web pages, developing databases of key and interested users/scientists, creating printed materials

Pressure-induced structural and semiconductor-semiconductor transitions in C o0.5M g0.5C r2O4

NASA Astrophysics Data System (ADS)

Rahman, S.; Saqib, Hajra; Zhang, Jinbo; Errandonea, D.; Menéndez, C.; Cazorla, C.; Samanta, Sudeshna; Li, Xiaodong; Lu, Junling; Wang, Lin

2018-05-01

The effect of pressure on the structural, vibrational, and electronic properties of Mg-doped Cr bearing spinel C o0.5M g0.5C r2O4 was studied up to 55 GPa at room-temperature using x-ray diffraction, Raman spectroscopy, electrical transport measurements, and ab initio calculations. We found that the ambient-pressure phase is cubic (spinel-type, F d 3 ¯m ) and underwent a pressure-induced structural transition to a tetragonal phase (space group I 4 ¯m 2 ) above 28 GPa. The ab initio calculation confirmed this first-order phase transition. The resistivity of the sample decreased at low pressures with the existence of a low-pressure (LP) phase and started to increase with the emergence of a high-pressure (HP) phase. The temperature dependent resistivity experiments at different pressures illustrated the wide band gap semiconducting nature of both the LP and HP phases with different activation energies, suggesting a semiconductor-semiconductor transition at HP. No evidence of chemical decomposition or a semiconductor-metal transition was observed in our studies.

GRACE storage-runoff hystereses reveal the dynamics of ...

EPA Pesticide Factsheets

Watersheds function as integrated systems where climate and geology govern the movement of water. In situ instrumentation can provide local-scale insights into the non-linear relationship between streamflow and water stored in a watershed as snow, soil moisture, and groundwater. However, there is a poor understanding of these processes at the regional scale—primarily because of our inability to measure water stores and fluxes in the subsurface. Now NASA’s Gravity Recovery and Climate Experiment (GRACE) satellites quantify changes in the amount of water stored across and through the Earth, providing measurements of regional hydrologic behavior. Here we apply GRACE data to characterize for the first time how regional watersheds function as simple, dynamic systems through a series of hysteresis loops. While the physical processes underlying the loops are inherently complex, the vertical integration of terrestrial water in the GRACE signal provides process-based insights into the dynamic and non-linear function of regional-scale watersheds. We use this process-based understanding with GRACE data to effectively forecast seasonal runoff (mean R2 of 0.91) and monthly runoff (mean R2 of 0.77) in three regional-scale watersheds (>150,000 km2) of the Columbia River Basin, USA. Data from the Gravity Recovery and Climate Experiment (GRACE) satellites provide a novel dataset for understanding changes in the amount of water stored across and through the surface of the Ear

Characteristic mega-basin water storage behavior using GRACE.

PubMed

Reager, J T; Famiglietti, James S

2013-06-01

[1] A long-standing challenge for hydrologists has been a lack of observational data on global-scale basin hydrological behavior. With observations from NASA's Gravity Recovery and Climate Experiment (GRACE) mission, hydrologists are now able to study terrestrial water storage for large river basins (>200,000 km 2 ), with monthly time resolution. Here we provide results of a time series model of basin-averaged GRACE terrestrial water storage anomaly and Global Precipitation Climatology Project precipitation for the world's largest basins. We address the short (10 year) length of the GRACE record by adopting a parametric spectral method to calculate frequency-domain transfer functions of storage response to precipitation forcing and then generalize these transfer functions based on large-scale basin characteristics, such as percent forest cover and basin temperature. Among the parameters tested, results show that temperature, soil water-holding capacity, and percent forest cover are important controls on relative storage variability, while basin area and mean terrain slope are less important. The derived empirical relationships were accurate (0.54 ≤  E f  ≤ 0.84) in modeling global-scale water storage anomaly time series for the study basins using only precipitation, average basin temperature, and two land-surface variables, offering the potential for synthesis of basin storage time series beyond the GRACE observational period. Such an approach could be applied toward gap filling between current and future GRACE missions and for predicting basin storage given predictions of future precipitation.

Characteristic mega-basin water storage behavior using GRACE

PubMed Central

Reager, J T; Famiglietti, James S

2013-01-01

[1] A long-standing challenge for hydrologists has been a lack of observational data on global-scale basin hydrological behavior. With observations from NASA’s Gravity Recovery and Climate Experiment (GRACE) mission, hydrologists are now able to study terrestrial water storage for large river basins (>200,000 km2), with monthly time resolution. Here we provide results of a time series model of basin-averaged GRACE terrestrial water storage anomaly and Global Precipitation Climatology Project precipitation for the world’s largest basins. We address the short (10 year) length of the GRACE record by adopting a parametric spectral method to calculate frequency-domain transfer functions of storage response to precipitation forcing and then generalize these transfer functions based on large-scale basin characteristics, such as percent forest cover and basin temperature. Among the parameters tested, results show that temperature, soil water-holding capacity, and percent forest cover are important controls on relative storage variability, while basin area and mean terrain slope are less important. The derived empirical relationships were accurate (0.54 ≤ Ef ≤ 0.84) in modeling global-scale water storage anomaly time series for the study basins using only precipitation, average basin temperature, and two land-surface variables, offering the potential for synthesis of basin storage time series beyond the GRACE observational period. Such an approach could be applied toward gap filling between current and future GRACE missions and for predicting basin storage given predictions of future precipitation. PMID:24563556

Human-induced Terrestrial Water Storage Change: A Global Analysis using Hydrological Models and GRACE

NASA Astrophysics Data System (ADS)

Felfelani, F.; Pokhrel, Y. N.

2016-12-01

Hydrological models and data derived from the Gravity Recovery and Climate Experiment (GRACE) satellite mission are used to study terrestrial water storage (TWS) change; however, both have disadvantages that necessitate the integrated use of them. While GRACE doesn't disintegrate the vertical storage into its components, most models do not account for human activities. Here we use two Land Surface Models (LSMs), i.e., HiGW-MAT and PCRGLOBWB that fully couple natural and human drivers of changes in water cycle, explicitly simulating the changes in various TWS compartments. We first evaluate the models performance with GRACE observations. Then, we quantify the human footprint over global river basins located in different geographic and climate regions. To quantify human impacts, a new framework is proposed based on the GRACE observations (representing both climate variability and human activities) together with the natural simulation of LSMs using water budget equation (P-ET-R; P for precipitation, ET for evapotranspiration, and R for runoff). Finally, we examine the uncertainty in TWS simulations arising from the uncertainties in forcing data. Results indicate that, in snow-dominated regions, PCRGLOBWB generally fails to reproduce neither the interannual variability of observed TWS nor the seasonal cycle, while HiGW-MAT model shows significantly better results. In basins with human signatures, PCRGLOBWB generally shows better agreement with GRACE compared to HiGW-MAT. It is found that HiGW-MAT tends to overestimate groundwater depletion in basins with human impacts (e.g., Amudarya, Colorado, Euphrates and Indus), which results in larger negative interannual TWS trend compared to GRACE. Euphrates and Ganges river basins experience the highest human-induced TWS deficit rates (2.08 cm/yr and 1.94 cm/yr, respectively) during the simulation period of 2002-2010. Uncertainty analysis of results from the same model but with different forcing data suggests a high standard

Integrating Enhanced Grace Terrestrial Water Storage Data Into the U.S. and North American Drought Monitors

NASA Technical Reports Server (NTRS)

Housborg, Rasmus; Rodell, Matthew

2010-01-01

NASA's Gravity Recovery and Climate Experiment (GRACE) satellites measure time variations nf the Earth's gravity field enabling reliable detection of spatio-temporal variations in total terrestrial water storage (TWS), including ground water. The U.S. and North American Drought Monitors are two of the premier drought monitoring products available to decision-makers for assessing and minimizing drought impacts, but they rely heavily on precipitation indices and do not currently incorporate systematic observations of deep soil moisture and groundwater storage conditions. Thus GRACE has great potential to improve the Drought Monitors hy filling this observational gap. Horizontal, vertical and temporal disaggregation of the coarse-resolution GRACE TWS data has been accomplished by assimilating GRACE TWS anomalies into the Catchment Land Surface Model using ensemble Kalman smoother. The Drought Monitors combine several short-term and long-term drought indices and indicators expressed in percentiles as a reference to their historical frequency of occurrence for the location and time of year in question. To be consistent, we are in the process of generating a climatology of estimated soil moisture and ground water based on m 60-year Catchment model simulation which will subsequently be used to convert seven years of GRACE assimilated fields into soil moisture and groundwater percentiles. for systematic incorporation into the objective blends that constitute Drought Monitor baselines. At this stage we provide a preliminary evaluation of GRACE assimilated Catchment model output against independent datasets including soil moisture observations from Aqua AMSR-E and groundwater level observations from the U.S. Geological Survey's Groundwater Climate Response Network.

Kinetics of M1 muscarinic receptor and G protein signaling to phospholipase C in living cells

PubMed Central

Falkenburger, Björn H.; Jensen, Jill B.

2010-01-01

G protein–coupled receptors (GPCRs) mediate responses to external stimuli in various cell types. Early events, such as the binding of ligand and G proteins to the receptor, nucleotide exchange (NX), and GTPase activity at the Gα subunit, are common for many different GPCRs. For Gq-coupled M1 muscarinic (acetylcholine) receptors (M1Rs), we recently measured time courses of intermediate steps in the signaling cascade using Förster resonance energy transfer (FRET). The expression of FRET probes changes the density of signaling molecules. To provide a full quantitative description of M1R signaling that includes a simulation of kinetics in native (tsA201) cells, we now determine the density of FRET probes and construct a kinetic model of M1R signaling through Gq to activation of phospholipase C (PLC). Downstream effects on the trace membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2) and PIP2-dependent KCNQ2/3 current are considered in our companion paper in this issue (Falkenburger et al. 2010. J. Gen. Physiol. doi:10.1085/jgp.200910345). By calibrating their fluorescence intensity, we found that we selected transfected cells for our experiments with ∼3,000 fluorescently labeled receptors, G proteins, or PLC molecules per µm2 of plasma membrane. Endogenous levels are much lower, 1–40 per µm2. Our kinetic model reproduces the time courses and concentration–response relationships measured by FRET and explains observed delays. It predicts affinities and rate constants that align well with literature values. In native tsA201 cells, much of the delay between ligand binding and PLC activation reflects slow binding of G proteins to receptors. With M1R and Gβ FRET probes overexpressed, 10% of receptors have G proteins bound at rest, rising to 73% in the presence of agonist. In agreement with previous work, the model suggests that binding of PLC to Gαq greatly speeds up NX and GTPase activity, and that PLC is maintained in the active state by cycles of

Simulation Study of a Follow-on Gravity Mission to GRACE

NASA Technical Reports Server (NTRS)

Loomis, Bryant D.; Nerem, R. S.; Luthcke, Scott B.

2012-01-01

The gravity recovery and climate experiment (GRACE) has been providing monthly estimates of the Earth's time-variable gravity field since its launch in March 2002. The GRACE gravity estimates are used to study temporal mass variations on global and regional scales, which are largely caused by a redistribution of water mass in the Earth system. The accuracy of the GRACE gravity fields are primarily limited by the satellite-to-satellite range-rate measurement noise, accelerometer errors, attitude errors, orbit errors, and temporal aliasing caused by unmodeled high-frequency variations in the gravity signal. Recent work by Ball Aerospace and Technologies Corp., Boulder, CO has resulted in the successful development of an interferometric laser ranging system to specifically address the limitations of the K-band microwave ranging system that provides the satellite-to-satellite measurements for the GRACE mission. Full numerical simulations are performed for several possible configurations of a GRACE Follow-On (GFO) mission to determine if a future satellite gravity recovery mission equipped with a laser ranging system will provide better estimates of time-variable gravity, thus benefiting many areas of Earth systems research. The laser ranging system improves the range-rate measurement precision to approximately 0.6 nm/s as compared to approx. 0.2 micro-seconds for the GRACE K-band microwave ranging instrument. Four different mission scenarios are simulated to investigate the effect of the better instrument at two different altitudes. The first pair of simulated missions is flown at GRACE altitude (approx. 480 km) assuming on-board accelerometers with the same noise characteristics as those currently used for GRACE. The second pair of missions is flown at an altitude of approx. 250 km which requires a drag-free system to prevent satellite re-entry. In addition to allowing a lower satellite altitude, the drag-free system also reduces the errors associated with the

Flight phasemeter on the Laser Ranging Interferometer on the GRACE Follow-On mission

NASA Astrophysics Data System (ADS)

Bachman, B.; de Vine, G.; Dickson, J.; Dubovitsky, S.; Liu, J.; Klipstein, W.; McKenzie, K.; Spero, R.; Sutton, A.; Ware, B.; Woodruff, C.

2017-05-01

As the first inter-spacecraft laser interferometer, the Laser Ranging Interferometer (LRI) on the GRACE Follow-On Mission will demonstrate interferometry technology relevant to the LISA mission. This paper focuses on the completed LRI Laser Ranging Processor (LRP), which includes heterodyne signal phase tracking at μ {{cycle/}}\\sqrt{{{Hz}}} precision, differential wavefront sensing, offset frequency phase locking and Pound-Drever-Hall laser stabilization. The LRI design has characteristics that are similar to those for LISA: 1064 nm NPRO laser source, science bandwidth in the mHz range, MHz-range intermediate frequency and Doppler shift, detected optical power of tens of picoWatts. Laser frequency stabilization has been demonstrated at a level below 30{{Hz/}}\\sqrt{{{Hz}}}, better than the LISA requirement of 300{{Hz/}}\\sqrt{{{Hz}}}. The LRP has completed all performance testing and environmental qualification and has been delivered to the GRACE Follow-On spacecraft. The LRI is poised to test the LISA techniques of tone-assisted time delay interferometry and arm-locking. GRACE Follow-On launches in 2017.

Maple polyphenols, ginnalins A-C, induce S- and G2/M-cell cycle arrest in colon and breast cancer cells mediated by decreasing cyclins A and D1 levels.

PubMed

González-Sarrías, Antonio; Ma, Hang; Edmonds, Maxwell E; Seeram, Navindra P

2013-01-15

Polyphenols are bioactive compounds found in plant foods. Ginnalins A-C are polyphenols present in the sap and other parts of the sugar and red maple species which are used to produce maple syrup. Here we evaluated the antiproliferative effects of ginnalins A-C on colon (HCT-116) and breast (MCF-7) tumourigenic and non-tumourigenic colon (CCD-18Co) cells and investigated whether these effects were mediated through cell cycle arrest and/or apoptosis. Ginnalins A-C were twofold more effective against the tumourigenic than non-tumourigenic cells. Among the polyphenols, ginnalin A (84%, HCT-116; 49%, MCF-7) was more effective than ginnalins B and C (50%, HCT-116; 30%, MCF-7) at 50 μM concentrations. Ginnalin A did not induce apoptosis of the cancer cells but arrested cell cycle (in the S- and G(2)/M-phases) and decreased cyclins A and D1 protein levels. These results suggest that maple polyphenols may have potential cancer chemopreventive effects mediated through cell cycle arrest. Copyright © 2012 Elsevier Ltd. All rights reserved.

Restoration of C/EBPα in dedifferentiated liposarcoma induces G2/M cell cycle arrest and apoptosis

PubMed Central

Wu, Yuhsin V.; Okada, Tomoyo; DeCarolis, Penelope; Socci, Nicholas; O’Connor, Rachael; Geha, Rula C.; Somberg, C. Joy; Antonescu, Cristina; Singer, Samuel

2012-01-01

Well differentiated liposarcoma (WDLS) and dedifferentiated liposarcoma (DDLS) represent the most common biological group of liposarcoma, and there is a pressing need to develop targeted therapies for patients with advanced disease. To identify potential therapeutic targets, we sought to identify differences in the adipogenic pathways between DDLS, WDLS, and normal adipose tissue. In a microarray analysis of DDLS (n=84), WDLS (n=79), and normal fat (n=23), C/EBPα, a transcription factor involved in cell cycle regulation and differentiation, was underexpressed in DDLS compared to both WDLS and normal fat (15.2 fold and 27.8 fold, respectively). In normal adipose-derived stem cells, C/EBPα expression was strongly induced when cells were cultured in differentiation media, but in three DDLS cell lines, this induction was nearly absent. We restored C/EBPα expression in one of the cell lines (DDLS8817) by transfection of an inducible C/EBα expression vector. Inducing C/EBPα expression reduced proliferation and caused cells to accumulate in G2/M. Under differentiation conditions, the cell proliferation was reduced further, and 66% of the DDLS cells containing the inducible C/EBPα expression vector underwent apoptosis as demonstrated by annexin V staining. These cells in differentiation conditions expressed early adipocyte-specific mRNAs such as LPL and FABP4, but they failed to accumulate intracellular lipid droplets, a characteristic of mature adipocytes. These results demonstrate that loss of C/EBPα is an important factor in suppressing apoptosis and maintaining the dedifferentiated state in DDLS. Restoring C/EBPα may be a useful therapeutic approach for dedifferentiated liposarcomas. PMID:22170698

Saving Grace - A Climate Change Documentary Education Program

NASA Astrophysics Data System (ADS)

Byrne, J. M.; McDaniel, S.; Graham, J.; Little, L.; Hoggan, J. C.

2012-12-01

Saving Grace conveys climate change knowledge from the best international scientists and social scientists using a series of new media formats. An Education and Communication Plan (ECP) has been developed to disseminate climate change knowledge on impacts, mitigation and adaptation for individuals, and for all sectors of society. The research team is seeking contacts with science and social science colleagues around the world to provide the knowledge base for the ECP. Poverty enslaves…and climate change has, and will, spread and deepen poverty to hundreds of millions of people, primarily in the developing world. And make no mistake; we are enslaving hundreds of millions of people in a depressing and debilitating poverty that in numbers will far surpass the horrors of the slave trade of past centuries. Saving Grace is the story of that poverty - and minimizing that poverty. Saving Grace stars the best of the world's climate researchers. Saving Grace presents the science; who, where and why of greenhouse gases that drive climate change; current and projected impacts of a changing climate around the world; and most important, solutions to the climate change challenges we face.

Assessment of the hydrologic setting and mass transport within Saharan and Arabian Aquifers using GRACE, geochemical, geophysical and subsurface data

NASA Astrophysics Data System (ADS)

Sultan, M.; Sturchio, N. C.; Ahmed, M.; Saleh, S.; Mohamed, A.; Abuabdullah, M. M.; Emil, M. K.; Bettadpur, S. V.; Save, H.; Fathy, K.; Chouinard, K.

2016-12-01

A better understanding of the hydrologic setting, mass transport, origin, evolution, utilization, sustainability, and paleo-climatic recharge conditions of Saharan and Arabian aquifers was achieved by integrating observation from monthly (04/2002 to 03/2016) Gravity Recovery and Climate Experiment (GRACE)-derived Terrestrial Water Storage (TWS) from multiple GRACE solutions (mascons and spherical harmonic fields) with others from geochemical (solute chemistry), isotopic (O, H, Sr), geochronologic (Chlorine-36, Krypton-81), geophysical (aerogravity and aeromagnetic), and subsurface data. The investigated aquifers are: (1) Nubian Sandstone Aquifer System (NSAS; area: 2×106 km2) in northeast Africa and, (2) Mega Aquifer System (MAS; area: 1.1×106 km2) in Arabia. Our findings indicate the NSAS and MAS were largely recharged in previous wet climatic Pleistocene periods, as evidenced by the groundwater ages (up to 1 million years), yet they receive modest local recharge during interleaving dry periods in areas of relatively high (≥ 20 mm/yr) precipitation. In Sudan and Chad (southern NSAS), the average annual precipitation (AAP) is 95 mm/yr and the recharge is estimated at 3.2 x 109 m3/yr ( 7% of AAP); in the southwest parts of the MAS, the recharge at the foothills of the Red Sea mountains is 1.8 x 109 m3/yr (10% of AAP). Uplifts and/or shear zones orthogonal to groundwater flow impede the south to north flow in the NSAS as evidenced by the large differences in GRACE-derived TWS trends, groundwater ages, and isotopic compositions on either side of the east-west trending Uweinat-Aswan uplift. Similarly west to east groundwater flow in the MAS is impeded and impounded up-gradient from the N-S and/or NW-SE trending basement structures, reactivated during Red Sea opening. Shear zones subparallel to groundwater flow act as preferred flow pathways, as is the case with the NE-SW trending Pelusium shear zone which channels groundwater from the Kufra sub-basin (Libya

Synergies Between Grace and Regional Atmospheric Modeling Efforts

NASA Astrophysics Data System (ADS)

Kusche, J.; Springer, A.; Ohlwein, C.; Hartung, K.; Longuevergne, L.; Kollet, S. J.; Keune, J.; Dobslaw, H.; Forootan, E.; Eicker, A.

2014-12-01

In the meteorological community, efforts converge towards implementation of high-resolution (< 12km) data-assimilating regional climate modelling/monitoring systems based on numerical weather prediction (NWP) cores. This is driven by requirements of improving process understanding, better representation of land surface interactions, atmospheric convection, orographic effects, and better forecasting on shorter timescales. This is relevant for the GRACE community since (1) these models may provide improved atmospheric mass separation / de-aliasing and smaller topography-induced errors, compared to global (ECMWF-Op, ERA-Interim) data, (2) they inherit high temporal resolution from NWP models, (3) parallel efforts towards improving the land surface component and coupling groundwater models; this may provide realistic hydrological mass estimates with sub-diurnal resolution, (4) parallel efforts towards re-analyses, with the aim of providing consistent time series. (5) On the other hand, GRACE can help validating models and aids in the identification of processes needing improvement. A coupled atmosphere - land surface - groundwater modelling system is currently being implemented for the European CORDEX region at 12.5 km resolution, based on the TerrSysMP platform (COSMO-EU NWP, CLM land surface and ParFlow groundwater models). We report results from Springer et al. (J. Hydromet., accept.) on validating the water cycle in COSMO-EU using GRACE and precipitation, evapotranspiration and runoff data; confirming that the model does favorably at representing observations. We show that after GRACE-derived bias correction, basin-average hydrological conditions prior to 2002 can be reconstructed better than before. Next, comparing GRACE with CLM forced by EURO-CORDEX simulations allows identifying processes needing improvement in the model. Finally, we compare COSMO-EU atmospheric pressure, a proxy for mass corrections in satellite gravimetry, with ERA-Interim over Europe at

Predictive power of the grace score in population with diabetes.

PubMed

Baeza-Román, Anna; de Miguel-Balsa, Eva; Latour-Pérez, Jaime; Carrillo-López, Andrés

2017-12-01

Current clinical practice guidelines recommend risk stratification in patients with acute coronary syndrome (ACS) upon admission to hospital. Diabetes mellitus (DM) is widely recognized as an independent predictor of mortality in these patients, although it is not included in the GRACE risk score. The objective of this study is to validate the GRACE risk score in a contemporary population and particularly in the subgroup of patients with diabetes, and to test the effects of including the DM variable in the model. Retrospective cohort study in patients included in the ARIAM-SEMICYUC registry, with a diagnosis of ACS and with available in-hospital mortality data. We tested the predictive power of the GRACE score, calculating the area under the ROC curve. We assessed the calibration of the score and the predictive ability based on type of ACS and the presence of DM. Finally, we evaluated the effect of including the DM variable in the model by calculating the net reclassification improvement. The GRACE score shows good predictive power for hospital mortality in the study population, with a moderate degree of calibration and no significant differences based on ACS type or the presence of DM. Including DM as a variable did not add any predictive value to the GRACE model. The GRACE score has an appropriate predictive power, with good calibration and clinical applicability in the subgroup of diabetic patients. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

The cascade of C:N:P stoichiometry in an ombrotrophic peatland: from plants to peat

NASA Astrophysics Data System (ADS)

Wang, Meng; Moore, Tim R.; Talbot, Julie; Richard, Pierre J. H.

2014-01-01

Northern peatlands are important carbon (C) sinks and while the patterns of C accumulation have been frequently investigated, nitrogen (N) and phosphorus (P) accumulation are often neglected. Here we link the C:N:P stoichiometry from foliar plant tissues, through senescent litters to peat, and determine C, N and P accumulation rates at Mer Bleue Bog, eastern Canada. Average C:N:P ratios changed from 794:17:1 in the foliar tissues to 911:10:1 in litter and 1285:32:1 in acrotelm peat. The increase in C:N and C:P ratios from mature to senescent tissues is related to nutrient resorption. The increase in C:P and N:P ratios in peat, which was contrary to that observed in Canadian forest soils, may be related to plant/mycorrhizae uptake of P. The long-term apparent rates of C, N and P accumulation were 29.5 ± 2.1 (SE) g C, 0.87 ± 0.01 g N and 0.017 ± 0.002 g P m-2 yr-1, respectively. The significant correlation between the accumulation rates of N and P and that of C suggests more attention be placed on C:N:P stoichiometry in peatland biogeochemistry, in particular in understanding why C:P ratios are so large in the lower parts of the profile.

GRACE L1b inversion through a self-consistent modified radial basis function approach

NASA Astrophysics Data System (ADS)

Yang, Fan; Kusche, Juergen; Rietbroek, Roelof; Eicker, Annette

2016-04-01

Implementing a regional geopotential representation such as mascons or, more general, RBFs (radial basis functions) has been widely accepted as an efficient and flexible approach to recover the gravity field from GRACE (Gravity Recovery and Climate Experiment), especially at higher latitude region like Greenland. This is since RBFs allow for regionally specific regularizations over areas which have sufficient and dense GRACE observations. Although existing RBF solutions show a better resolution than classical spherical harmonic solutions, the applied regularizations cause spatial leakage which should be carefully dealt with. It has been shown that leakage is a main error source which leads to an evident underestimation of yearly trend of ice-melting over Greenland. Unlike some popular post-processing techniques to mitigate leakage signals, this study, for the first time, attempts to reduce the leakage directly in the GRACE L1b inversion by constructing an innovative modified (MRBF) basis in place of the standard RBFs to retrieve a more realistic temporal gravity signal along the coastline. Our point of departure is that the surface mass loading associated with standard RBF is smooth but disregards physical consistency between continental mass and passive ocean response. In this contribution, based on earlier work by Clarke et al.(2007), a physically self-consistent MRBF representation is constructed from standard RBFs, with the help of the sea level equation: for a given standard RBF basis, the corresponding MRBF basis is first obtained by keeping the surface load over the continent unchanged, but imposing global mass conservation and equilibrium response of the oceans. Then, the updated set of MRBFs as well as standard RBFs are individually employed as the basis function to determine the temporal gravity field from GRACE L1b data. In this way, in the MRBF GRACE solution, the passive (e.g. ice melting and land hydrology response) sea level is automatically

GRACE Follow-On Satellites Separating from Spacecraft (Artist's Concept)

NASA Image and Video Library

2018-04-30

Illustration of the twin spacecraft of the NASA/German Research Centre for Geosciences (GFZ) Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission. GRACE-FO will continue tracking the evolution of Earth's water cycle by monitoring changes in the distribution of mass on Earth. https://photojournal.jpl.nasa.gov/catalog/PIA22447

On the use of the GRACE normal equation of inter-satellite tracking data for estimation of soil moisture and groundwater in Australia

NASA Astrophysics Data System (ADS)

Tangdamrongsub, Natthachet; Han, Shin-Chan; Decker, Mark; Yeo, In-Young; Kim, Hyungjun

2018-03-01

An accurate estimation of soil moisture and groundwater is essential for monitoring the availability of water supply in domestic and agricultural sectors. In order to improve the water storage estimates, previous studies assimilated terrestrial water storage variation (ΔTWS) derived from the Gravity Recovery and Climate Experiment (GRACE) into land surface models (LSMs). However, the GRACE-derived ΔTWS was generally computed from the high-level products (e.g. time-variable gravity fields, i.e. level 2, and land grid from the level 3 product). The gridded data products are subjected to several drawbacks such as signal attenuation and/or distortion caused by a posteriori filters and a lack of error covariance information. The post-processing of GRACE data might lead to the undesired alteration of the signal and its statistical property. This study uses the GRACE least-squares normal equation data to exploit the GRACE information rigorously and negate these limitations. Our approach combines GRACE's least-squares normal equation (obtained from ITSG-Grace2016 product) with the results from the Community Atmosphere Biosphere Land Exchange (CABLE) model to improve soil moisture and groundwater estimates. This study demonstrates, for the first time, an importance of using the GRACE raw data. The GRACE-combined (GC) approach is developed for optimal least-squares combination and the approach is applied to estimate the soil moisture and groundwater over 10 Australian river basins. The results are validated against the satellite soil moisture observation and the in situ groundwater data. Comparing to CABLE, we demonstrate the GC approach delivers evident improvement of water storage estimates, consistently from all basins, yielding better agreement on seasonal and inter-annual timescales. Significant improvement is found in groundwater storage while marginal improvement is observed in surface soil moisture estimates.

Induction of stress proteins in the plant trypanosome Phytomonas characias.

PubMed

Sanchez-Moreno, M; Rodriguez-Cabezas, N; Fernandez-Becerra, C; Mesa-Valle, C; Osuna, A

1997-01-01

The present study of the synthesis of new proteins in plant trypanosomatids in the genus Phytomonas as a response to different types of stress demonstrates the production of a number of proteins that can be grouped into four families similar to those that appear in other organisms (heat-shock proteins). In the study of stress, Phytomonas cultures were subjected to changes in temperature from 22 degrees to 37 degrees C, deprived of glucose, grown in the presence of sodium arsenite, and treated with calcium ionophore. In addition, the culture medium was changed from Grace's medium (330 mosmol/1) to a plant-culture medium with an osmolarity of 286 mosmol/l, implying the exertion of stress during the parasite's normal biological cycle of passage from the insect vector to the plant host. The treatment with actinomycin D demonstrated that some of the mRNAs that codify these proteins are found in normal presynthesized conditions. To measure the effect of temperature on the macromolecule biosynthesis we compared the incorporation of labeled analogues ([3H]-thymidine, [3H]-uridine, and [3H]-leucine) by flagellates cultured at 22 degrees C with that by parasites cultivated at 37 degrees C.

PcG and trxG in plants - friends or foes.

PubMed

Pu, Li; Sung, Zinmay Renee

2015-05-01

The highly-conserved Polycomb group (PcG) and trithorax group (trxG) proteins play major roles in regulating gene expression and maintaining developmental states in many organisms. However, neither the recruitment of Polycomb repressive complexes (PRC) nor the mechanisms of PcG and trxG-mediated gene silencing and activation are well understood. Recent progress in Arabidopsis research challenges the dominant model of PRC2-dependent recruitment of PRC1 to target genes. Moreover, evidence indicates that diverse forms of PRC1, with shared components, are a common theme in plants and mammals. Although trxG is known to antagonize PcG, emerging data reveal that trxG can also repress gene expression, acting cooperatively with PcG. We discuss these recent findings and highlight the employment of diverse epigenetic mechanisms during development in plants and animals. Copyright © 2015 Elsevier Ltd. All rights reserved.

The wiring diagram for plant G signaling

DOE PAGES

Colaneri, Alejandro C.; Jones, Alan M.

2014-10-01

Like electronic circuits, the modular arrangement of cell-signaling networks decides how inputs produce outputs. Animal heterotrimeric guanine nucleotide binding proteins (G-proteins) operate as switches in the circuits that signal between extracellular agonists and intracellular effectors. There still is no biochemical evidence for a receptor or its agonist in the plant G-protein pathways. Plant G-proteins deviate in many important ways from the animal paradigm. This paper covers important discoveries from the last two years that enlighten these differences and ends describing alternative wiring diagrams for the plant signaling circuits regulated by G-proteins. Finally, we propose that plant G-proteins are integrated inmore » the signaling circuits as variable resistor rather than switches, controlling the flux of information in response to the cell's metabolic state.« less

Assimilation of GRACE Terrestrial Water Storage Data into a Land Surface Model

NASA Technical Reports Server (NTRS)

Reichle, Rolf H.; Zaitchik, Benjamin F.; Rodell, Matt

2008-01-01

The NASA Gravity Recovery and Climate Experiment (GRACE) system of satellites provides observations of large-scale, monthly terrestrial water storage (TWS) changes. In. this presentation we describe a land data assimilation system that ingests GRACE observations and show that the assimilation improves estimates of water storage and fluxes, as evaluated against independent measurements. The ensemble-based land data assimilation system uses a Kalman smoother approach along with the NASA Catchment Land Surface Model (CLSM). We assimilated GRACE-derived TWS anomalies for each of the four major sub-basins of the Mississippi into the Catchment Land Surface Model (CLSM). Compared with the open-loop (no assimilation) CLSM simulation, assimilation estimates of groundwater variability exhibited enhanced skill with respect to measured groundwater. Assimilation also significantly increased the correlation between simulated TWS and gauged river flow for all four sub-basins and for the Mississippi River basin itself. In addition, model performance was evaluated for watersheds smaller than the scale of GRACE observations, in the majority of cases, GRACE assimilation led to increased correlation between TWS estimates and gauged river flow, indicating that data assimilation has considerable potential to downscale GRACE data for hydrological applications. We will also describe how the output from the GRACE land data assimilation system is now being prepared for use in the North American Drought Monitor.

GIA models with composite rheology and 3D viscosity: effect on GRACE mass balance in Antarctica

NASA Astrophysics Data System (ADS)

van der Wal, Wouter; Whitehouse, Pippa; Schrama, Ernst

2014-05-01

Most Glacial Isostatic Adjustment (GIA) models that have been used to correct GRACE data for the influence of GIA assume a radial stratification of viscosity in the Earth's mantle (1D viscosity). Seismic data in Antarctica indicate that there are large viscosity variations in the horizontal direction (3D viscosity). The purpose of this research is to determine the effect of 3D viscosity on GIA model output, and hence mass balance estimates in Antarctica. We use a GIA model with 3D viscosity and composite rheology in combination with ice loading histories ICE-5G and W12a. From comparisons with uplift and sea-level data in Fennoscandia and North America three preferred viscosity models are selected. For two of the 3D viscosity models the maximum gravity rate due to ICE-5G forcing is located over the Ronne-Filchner ice shelf. This is in contrast with the results obtained using a 1D model, in which the maximum gravity rate due to ICE-5G forcing is always located over the Ross ice shelf. This demonstrates that not all 3D viscosity models can be approximated with a 1D viscosity model. Using CSR release 5 GRACE data from February 2003 to June 2013 mass balance estimates for the three preferred viscosity models are -131 to -171 Gt/year for the ICE-5G model, and -48 to -57 Gt/year for the W12a model. The range due to Earth model uncertainty is larger than the error bar for GRACE (10 Gt/year), but smaller than the range resulting from the difference in ice loading histories.

Reconciling GRACE and GPS estimates of long-term load deformation in southern Greenland

NASA Astrophysics Data System (ADS)

Wang, Song-Yun; Chen, J. L.; Wilson, Clark R.; Li, Jin; Hu, Xiaogong

2018-02-01

We examine vertical load deformation at four continuous Global Positioning System (GPS) sites in southern Greenland relative to Gravity Recovery and Climate Experiment (GRACE) predictions of vertical deformation over the period 2002-2016. With limited spatial resolution, GRACE predictions require adjustment before they can be compared with GPS height time series. Without adjustment, both GRACE spherical harmonic (SH) and mascon solutions predict significant vertical displacement rate differences relative to GPS. We use a scaling factor method to adjust GRACE results, based on a long-term mass rate model derived from GRACE measurements, glacial geography, and ice flow data. Adjusted GRACE estimates show significantly improved agreement with GPS, both in terms of long-term rates and interannual variations. A deceleration of mass loss is observed in southern Greenland since early 2013. The success at reconciling GPS and GRACE observations with a more detailed mass rate model demonstrates the high sensitivity to load distribution in regions surrounding GPS stations. Conversely, the value of GPS observations in constraining mass changes in surrounding regions is also demonstrated. In addition, our results are consistent with recent estimates of GIA uplift (˜4.4 mm yr-1) at the KULU site.

Restoration of C/EBPα in dedifferentiated liposarcoma induces G2/M cell cycle arrest and apoptosis.

PubMed

Wu, Yuhsin V; Okada, Tomoyo; DeCarolis, Penelope; Socci, Nicholas; O'Connor, Rachael; Geha, Rula C; Joy Somberg, C; Antonescu, Cristina; Singer, Samuel

2012-04-01

Well-differentiated liposarcoma (WDLS) and dedifferentiated liposarcoma (DDLS) represent the most common biological group of liposarcoma, and there is a pressing need to develop targeted therapies for patients with advanced disease. To identify potential therapeutic targets, we sought to identify differences in the adipogenic pathways between DDLS, WDLS, and normal adipose tissue. In a microarray analysis of DDLS (n = 84), WDLS (n = 79), and normal fat (n = 23), C/EBPα, a transcription factor involved in cell cycle regulation and differentiation, was underexpressed in DDLS when compared to both WDLS and normal fat (15.2- and 27.8-fold, respectively). In normal adipose-derived stem cells, C/EBPα expression was strongly induced when cells were cultured in differentiation media, but in three DDLS cell lines, this induction was nearly absent. We restored C/EBPα expression in one of the cell lines (DDLS8817) by transfection of an inducible C/EBPα expression vector. Inducing C/EBPα expression reduced proliferation and caused cells to accumulate in G2/M. Under differentiation conditions, the cell proliferation was reduced further, and 66% of the DDLS cells containing the inducible C/EBPα expression vector underwent apoptosis as demonstrated by annexin V staining. These cells in differentiation conditions expressed early adipocyte-specific mRNAs such as LPL and FABP4, but they failed to accumulate intracellular lipid droplets, a characteristic of mature adipocytes. These results demonstrate that loss of C/EBPα is an important factor in suppressing apoptosis and maintaining the dedifferentiated state in DDLS. Restoring C/EBPα may be a useful therapeutic approach for DDLS. Copyright © 2011 Wiley Periodicals, Inc.

Comparison of Seasonal Terrestrial Water Storage Variations from GRACE with Groundwater-level Measurements from the High Plains Aquifer (USA)

NASA Technical Reports Server (NTRS)

Strassberg, Gil; Scanlon, Bridget R.; Rodell, Matthew

2007-01-01

This study presents the first direct comparison of variations in seasonal GWS derived from GRACE TWS and simulated SM with GW-level measurements in a semiarid region. Results showed that variations in GWS and SM are the main sources controlling TWS changes over the High Plains, with negligible storage changes from surface water, snow, and biomass. Seasonal variations in GRACE TWS compare favorably with combined GWS from GW-level measurements (total 2,700 wells, average 1,050 GW-level measurements per season) and simulated SM from the Noah land surface model (R = 0.82, RMSD = 33 mm). Estimated uncertainty in seasonal GRACE-derived TWS is 8 mm, and estimated uncertainty in TWS changes is 11 mm. Estimated uncertainty in SM changes is 11 mm and combined uncertainty for TWS-SM changes is 15 mm. Seasonal TWS changes are detectable in 7 out of 9 monitored periods and maximum changes within a year (e.g. between winter and summer) are detectable in all 5 monitored periods. Grace-derived GWS calculated from TWS-SM generally agrees with estimates based on GW-level measurements (R = 0.58, RMSD = 33 mm). Seasonal TWS-SM changes are detectable in 5 out of the 9 monitored periods and maximum changes are detectable in all 5 monitored periods. Good correspondence between GRACE data and GW-level measurements from the intensively monitored High Plains aquifer validates the potential for using GRACE TWS and simulated SM to monitor GWS changes and aquifer depletion in semiarid regions subjected to intensive irrigation pumpage. This method can be used to monitor regions where large-scale aquifer depletion is ongoing, and in situ measurements are limited, such as the North China Plain or western India. This potential should be enhanced by future advances in GRACE processing, which will improve the spatial and temporal resolution of TWS changes, and will further increase applicability of GRACE data for monitoring GWS.

Benefits and Pitfalls of GRACE Terrestrial Water Storage Data Assimilation

NASA Technical Reports Server (NTRS)

Girotto, Manuela

2018-01-01

Satellite observations of terrestrial water storage (TWS) from the Gravity Recovery and Climate Experiment (GRACE) mission have a coarse resolution in time (monthly) and space (roughly 150,000 sq km at midlatitudes) and vertically integrate all water storage components over land, including soil moisture and groundwater. Nonetheless, data assimilation can be used to horizontally downscale and vertically partition GRACE-TWS observations. This presentation illustrates some of the benefits and drawbacks of assimilating TWS observations from GRACE into a land surface model over the continental United States and India. The assimilation scheme yields improved skill metrics for groundwater compared to the no-assimilation simulations. A smaller impact is seen for surface and root-zone soil moisture. Further, GRACE observes TWS depletion associated with anthropogenic groundwater extraction. Results from the assimilation emphasize the importance of representing anthropogenic processes in land surface modeling and data assimilation systems.

Basin Scale Estimates of Evapotranspiration Using GRACE and other Observations

NASA Technical Reports Server (NTRS)

Rodell, M.; Famiglietti, J. S.; Chen, J.; Seneviratne, S. I.; Viterbo, P.; Holl, S.; Wilson, C. R.

2004-01-01

Evapotranspiration is integral to studies of the Earth system, yet it is difficult to measure on regional scales. One estimation technique is a terrestrial water budget, i.e., total precipitation minus the sum of evapotranspiration and net runoff equals the change in water storage. Gravity Recovery and Climate Experiment (GRACE) satellite gravity observations are now enabling closure of this equation by providing the terrestrial water storage change. Equations are presented here for estimating evapotranspiration using observation based information, taking into account the unique nature of GRACE observations. GRACE water storage changes are first substantiated by comparing with results from a land surface model and a combined atmospheric-terrestrial water budget approach. Evapotranspiration is then estimated for 14 time periods over the Mississippi River basin and compared with output from three modeling systems. The GRACE estimates generally lay in the middle of the models and may provide skill in evaluating modeled evapotranspiration.

Reducing errors in the GRACE gravity solutions using regularization

NASA Astrophysics Data System (ADS)

Save, Himanshu; Bettadpur, Srinivas; Tapley, Byron D.

2012-09-01

The nature of the gravity field inverse problem amplifies the noise in the GRACE data, which creeps into the mid and high degree and order harmonic coefficients of the Earth's monthly gravity fields provided by GRACE. Due to the use of imperfect background models and data noise, these errors are manifested as north-south striping in the monthly global maps of equivalent water heights. In order to reduce these errors, this study investigates the use of the L-curve method with Tikhonov regularization. L-curve is a popular aid for determining a suitable value of the regularization parameter when solving linear discrete ill-posed problems using Tikhonov regularization. However, the computational effort required to determine the L-curve is prohibitively high for a large-scale problem like GRACE. This study implements a parameter-choice method, using Lanczos bidiagonalization which is a computationally inexpensive approximation to L-curve. Lanczos bidiagonalization is implemented with orthogonal transformation in a parallel computing environment and projects a large estimation problem on a problem of the size of about 2 orders of magnitude smaller for computing the regularization parameter. Errors in the GRACE solution time series have certain characteristics that vary depending on the ground track coverage of the solutions. These errors increase with increasing degree and order. In addition, certain resonant and near-resonant harmonic coefficients have higher errors as compared with the other coefficients. Using the knowledge of these characteristics, this study designs a regularization matrix that provides a constraint on the geopotential coefficients as a function of its degree and order. This regularization matrix is then used to compute the appropriate regularization parameter for each monthly solution. A 7-year time-series of the candidate regularized solutions (Mar 2003-Feb 2010) show markedly reduced error stripes compared with the unconstrained GRACE release 4

A mRNA-Responsive G-Quadruplex-Based Drug Release System

PubMed Central

Yaku, Hidenobu; Murashima, Takashi; Miyoshi, Daisuke; Sugimoto, Naoki

2015-01-01

G-quadruplex-based drug delivery carriers (GDDCs) were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II) phthalocyanine (CuAPC). As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR) mRNA. Structural analysis using circular dichroism (CD) spectroscopy showed that the GDDCs form a (3 + 1) type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM) at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM) at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA. PMID:25905703

Mycorrhizal Symbiotic Efficiency on C3 and C4 Plants under Salinity Stress - A Meta-Analysis.

PubMed

Chandrasekaran, Murugesan; Kim, Kiyoon; Krishnamoorthy, Ramasamy; Walitang, Denver; Sundaram, Subbiah; Joe, Manoharan M; Selvakumar, Gopal; Hu, Shuijin; Oh, Sang-Hyon; Sa, Tongmin

2016-01-01

A wide range of C3 and C4 plant species could acclimatize and grow under the impact of salinity stress. Symbiotic relationship between plant roots and arbuscular mycorrhizal fungi (AMF) are widespread and are well known to ameliorate the influence of salinity stress on agro-ecosystem. In the present study, we sought to understand the phenomenon of variability on AMF symbiotic relationship on saline stress amelioration in C3 and C4 plants. Thus, the objective was to compare varied mycorrhizal symbiotic relationship between C3 and C4 plants in saline conditions. To accomplish the above mentioned objective, we conducted a random effects models meta-analysis across 60 published studies. An effect size was calculated as the difference in mycorrhizal responses between the AMF inoculated plants and its corresponding control under saline conditions. Responses were compared between (i) identity of AMF species and AMF inoculation, (ii) identity of host plants (C3 vs. C4) and plant functional groups, (iii) soil texture and level of salinity and (iv) experimental condition (greenhouse vs. field). Results indicate that both C3 and C4 plants under saline condition responded positively to AMF inoculation, thereby overcoming the predicted effects of symbiotic efficiency. Although C3 and C4 plants showed positive effects under low (EC < 4 ds/m) and high (>8 ds/m) saline conditions, C3 plants showed significant effects for mycorrhizal inoculation over C4 plants. Among the plant types, C4 annual and perennial plants, C4 herbs and C4 dicot had a significant effect over other counterparts. Between single and mixed AMF inoculants, single inoculants Rhizophagus irregularis had a positive effect on C3 plants whereas Funneliformis mosseae had a positive effect on C4 plants than other species. In all of the observed studies, mycorrhizal inoculation showed positive effects on shoot, root and total biomass, and in nitrogen, phosphorous and potassium (K) uptake. However, it showed negative

GRACE-FO Satellites in a Clean Room at Vandenberg Air Force Base

NASA Image and Video Library

2018-03-12

One of the two Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) satellites and its turntable fixture at the Astrotech Space Operations processing facility at Vandenberg Air Force Base, California. GRACE-FO will extend GRACE's legacy of scientific achievements, which range from tracking mass changes of Earth's polar ice sheets and estimating global groundwater changes, to measuring the mass changes of large earthquakes and inferring changes in deep ocean currents, a driving force in climate. To date, GRACE observations have been used in more than 4,300 research publications. Its measurements provide a unique view of the Earth system and have far-reaching benefits to society, such as providing insights into where global groundwater resources may be shrinking or growing and where dry soils are contributing to drought. GRACE-FO is planned to fly at least five years. https://photojournal.jpl.nasa.gov/catalog/PIA22339

GRACE-FO Satellites in a Clean Room at Vandenberg Air Force Base

NASA Image and Video Library

2018-03-12

The Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) twin satellites, attached to turntable fixtures, at the Astrotech Space Operations processing facility at Vandenberg Air Force Base, California. GRACE-FO will extend GRACE's legacy of scientific achievements, which range from tracking mass changes of Earth's polar ice sheets and estimating global groundwater changes, to measuring the mass changes of large earthquakes and inferring changes in deep ocean currents, a driving force in climate. To date, GRACE observations have been used in more than 4,300 research publications. Its measurements provide a unique view of the Earth system and have far-reaching benefits to society, such as providing insights into where global groundwater resources may be shrinking or growing and where dry soils are contributing to drought. GRACE-FO is planned to fly at least five years. https://photojournal.jpl.nasa.gov/catalog/PIA22341

GRACE-FO Satellites in a Clean Room at Vandenberg Air Force Base

NASA Image and Video Library

2018-03-12

The Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) twin satellites, attached to turntable fixtures, at the Astrotech Space Operations processing facility at Vandenberg Air Force Base, California. GRACE-FO will extend GRACE's legacy of scientific achievements, which range from tracking mass changes of Earth's polar ice sheets and estimating global groundwater changes, to measuring the mass changes of large earthquakes and inferring changes in deep ocean currents, a driving force in climate. To date, GRACE observations have been used in more than 4,300 research publications. Its measurements provide a unique view of the Earth system and have far-reaching benefits to society, such as providing insights into where global groundwater resources may be shrinking or growing and where dry soils are contributing to drought. GRACE-FO is planned to fly at least five years. https://photojournal.jpl.nasa.gov/catalog/PIA22338

GRACE-FO Satellites in a Clean Room at Vandenberg Air Force Base

NASA Image and Video Library

2018-03-12

The Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) twin satellites, attached to turntable fixtures, at the Astrotech Space Operations processing facility at Vandenberg Air Force Base, California. GRACE-FO will extend GRACE's legacy of scientific achievements, which range from tracking mass changes of Earth's polar ice sheets and estimating global groundwater changes, to measuring the mass changes of large earthquakes and inferring changes in deep ocean currents, a driving force in climate. To date, GRACE observations have been used in more than 4,300 research publications. Its measurements provide a unique view of the Earth system and have far-reaching benefits to society, such as providing insights into where global groundwater resources may be shrinking or growing and where dry soils are contributing to drought. GRACE-FO is planned to fly at least five years. https://photojournal.jpl.nasa.gov/catalog/PIA22340

GRACE Follow-On and Potential Successors: Mission Options for the Upcoming Decadaes

NASA Astrophysics Data System (ADS)

Watkins, M. M.

2017-12-01

The GRACE Follow-On mission is currently scheduled to launch in the first quarter of 2018, providing a successor to GRACE for ongoing critical measurements of Earth's time varying mass distribution for the coming decade. As noted in the literature (and in several talks in this session), there are also several possible mission proposals and technologies to either augment or succeed GRACE FO for extended and improved measurements. Various scientific, programmatic, and technical issues drive each of these potential missions and these factors will be important in determining which will ultimately be selected for flight. These issues include accuracy requirements based on science goals, technical maturity, cost, and international partnership options. In this talk, we will provide a final detailed update before launch on the GRACE Follow-On status and expectations, and we will outline several of the key options for future missions after GRACE FO.

Characterizing Seasonal Drought, Water Supply Pattern and Their Impact on Vegetation Growth Using Satellite Soil Moisture Data, GRACE Water Storage and Precipitation Observations

NASA Astrophysics Data System (ADS)

A, G.; Velicogna, I.; Kimball, J. S.; Du, J.; Kim, Y.; Njoku, E. G.; Colliander, A.

2016-12-01

We combine soil moisture (SM) data from AMSR-E, AMSR-2 and SMAP, terrestrial water storage (TWS) changes from GRACE and precipitation measurements from GPCP to delineate and characterize drought and water supply pattern and its impact on vegetation growth. GRACE TWS provides spatially continuous observations of total terrestrial water storage changes and regional drought extent, persistence and severity, while satellite derived soil moisture estimates provide enhanced delineation of plant-available soil moisture. Together these data provide complementary metrics quantifying available plant water supply and have important implications for water resource management. We use these data to investigate the supply changes from different water components in relation to satellite based vegetation productivity metrics from MODIS, before, during and following the major drought events observed in the continental US during the past 13 years. We observe consistent trends and significant correlations between monthly time series of TWS, SM, and vegetation productivity. In Texas and surrounding semi-arid areas, we find that the spatial pattern of the vegetation-moisture relation follows the gradient in mean annual precipitation. In Texas, GRACE TWS and surface SM show strong coupling and similar characteristic time scale in relatively normal years, while during the 2011 onward hydrological drought, GRACE TWS manifests a longer time scale than that of surface SM, implying stronger drought persistence in deeper water storage. In the Missouri watershed, we find a spatially varying vegetation-moisture relationship where in the drier northwestern portion of the basin, the inter-annual variability in summer vegetation productivity is closely associated with changes in carry-on GRACE TWS from spring, whereas in the moist southeastern portion of the basin, summer precipitation is the dominant controlling factor on vegetation growth.

Discovery of Spatio-Temporal Relationships in GRACE, GPS Time Series, and Groundwater Data Using Voronoi Visualizations

NASA Astrophysics Data System (ADS)

Rude, C. M.; Li, J. D.; Rongier, G.; Gowanlock, M.; Herring, T.; Pankratius, V.

2017-12-01

We introduce a data exploration and visualization tool to facilitate the discovery of correlations across geospatial data sets in a computer-aided discovery system. Our approach is based on adaptive Voronoi tessellation maps that can handle spotty data availability, varying sensor density, and resolution at different scales in the same visualization product. Successful applications exploring spatio-temporal relationships are demonstrated on data sets from the Gravity Recovery and Climate Experiment (GRACE), GPS time series from the Plate Boundary Observatory, and groundwater well depth data from USGS, with the objective of understanding the Earth's surface response to changes in terrestrial water storage. Our results reveal that vertical positions in the majority of GPS stations are negatively correlated with terrestrial water storage from GRACE. This is expected if the changes are due to terrestrial water loading deforming the ground. Our application also identifies outliers that warrant further investigation, such as sites with low correlation or positive correlation due to poroelastic expansion. Other analyses reveal that GRACE correlates positively with water levels from wells, but the removal of GRACE non-groundwater components (canopy water, soil moisture, and snow accumulation) using model data from the Global Land Data Assimilation System unexpectedly lowers the correlations, effects which may be related to modeling accuracy and measurement errors. We acknowledge support from NASA AISTNNX15AG84G (PI Pankratius) and NSF ACI1442997 (PI Pankratius).

Grace by Body Clues.

ERIC Educational Resources Information Center

Adams, Marianne

2001-01-01

Describes the author's journey in the expressive arts, including dance, poetry, healing, and interdisciplinary expressive arts. Offers poems that illustrate how she grapples with professional identity, deeply personal life issues, and early formative memories. Shows how she is beginning to experience the arts as a place of acceptance and grace.…

Detecting Signatures of GRACE Sensor Errors in Range-Rate Residuals

NASA Astrophysics Data System (ADS)

Goswami, S.; Flury, J.

2016-12-01

In order to reach the accuracy of the GRACE baseline, predicted earlier from the design simulations, efforts are ongoing since a decade. GRACE error budget is highly dominated by noise from sensors, dealiasing models and modeling errors. GRACE range-rate residuals contain these errors. Thus, their analysis provides an insight to understand the individual contribution to the error budget. Hence, we analyze the range-rate residuals with focus on contribution of sensor errors due to mis-pointing and bad ranging performance in GRACE solutions. For the analysis of pointing errors, we consider two different reprocessed attitude datasets with differences in pointing performance. Then range-rate residuals are computed from these two datasetsrespectively and analysed. We further compare the system noise of four K-and Ka- band frequencies of the two spacecrafts, with range-rate residuals. Strong signatures of mis-pointing errors can be seen in the range-rate residuals. Also, correlation between range frequency noise and range-rate residuals are seen.

Sensitivity of GRACE-derived estimates of groundwater-level changes in southern Ontario, Canada

NASA Astrophysics Data System (ADS)

Hachborn, Ellen; Berg, Aaron; Levison, Jana; Ambadan, Jaison Thomas

2017-12-01

Amidst changing climates, understanding the world's water resources is of increasing importance. In Ontario, Canada, low water conditions are currently assessed using only precipitation and watershed-based stream gauges by the Conservation Authorities in Ontario and the Ministry of Natural Resources and Forestry. Regional groundwater-storage changes in Ontario are not currently measured using satellite data by research institutes. In this study, contributions from the Gravity Recovery and Climate Experiment (GRACE) data are compared to a hydrogeological database covering southern Ontario from 2003 to 2013, to determine the suitability of GRACE total water storage estimates for monitoring groundwater storage in this location. Terrestrial water storage data from GRACE were used to determine monthly groundwater storage (GWS) anomaly values. GWS values were also determined by multiplying groundwater-level elevations (from the Provincial Groundwater Monitoring Network wells) by specific yield. Comparisons of GRACE-derived GWS to well-based GWS data determined that GRACE is sufficiently sensitive to obtain a meaningful signal in southern Ontario. Results show that GWS values produced by GRACE are useful for identifying regional changes in groundwater storage in areas with limited available hydrogeological characterization data. Results also indicate that GRACE may have an ability to forecast changes in groundwater storage, which will become useful when monitoring climate shifts in the near future.

Water mass changes inferred by gravity field variations with GRACE

NASA Astrophysics Data System (ADS)

Fagiolini, Elisa; Gruber, Christian; Apel, Heiko; Viet Dung, Nguyen; Güntner, Andreas

2013-04-01

Since 2002 the Gravity Recovery And Climate Experiment (GRACE) mission has been measuring temporal variations of Earth's gravity field depicting with extreme accuracy how mass is distributed and varies around the globe. Advanced signal separation techniques enable to isolate different sources of mass such as atmospheric and oceanic circulation or land hydrology. Nowadays thanks to GRACE, floods, droughts, and water resources monitoring are possible on a global scale. At GFZ Potsdam scientists have been involved since 2000 in the initiation and launch of the GRACE precursor CHAMP satellite mission, since 2002 in the GRACE Science Data System and since 2009 in the frame of ESÁs GOCE High Processing Facility as well as projected GRACE FOLLOW-ON for the continuation of time variable gravity field determination. Recently GFZ has reprocessed the complete GRACE time-series of monthly gravity field spherical harmonic solutions with improved standards and background models. This new release (RL05) already shows significantly less noise and spurious artifacts. In order to monitor water mass re-distribution and fast moving water, we still need to reach a higher resolution in both time and space. Moreover, in view of disaster management applications we need to act with a shorter latency (current latency standard is 2 months). For this purpose, we developed a regional method based on radial base functions that is capable to compute models in regional and global representation. This new method localizes the gravity observation to the closest regions and omits spatial correlations with farther regions. Additionally, we succeeded to increase the temporal resolution to sub-monthly time scales. Innovative concepts such as Kalman filtering and regularization, along with sophisticated regional modeling have shifted temporal and spatial resolution towards new frontiers. We expect global hydrological models as WHGM to profit from such accurate outcomes. First results comparing the mass

Glacier mass variations from recent ITSG-Grace solutions: Experiences with the point-mass modeling technique in the framework of project SPICE.

NASA Astrophysics Data System (ADS)

Reimond, S.; Klinger, B.; Krauss, S.; Mayer-Gürr, T.; Eicker, A.; Zemp, M.

2017-12-01

In recent years, remotely sensed observations have become one of the most ubiquitous and valuable sources of information for glacier monitoring. In addition to altimetry and interferometry data (as observed, e.g., by the CryoSat-2 and TanDEM-X satellites), time-variable gravity field data from the GRACE satellite mission has been used by several authors to assess mass changes in glacier systems. The main challenges in this context are i) the limited spatial resolution of GRACE, ii) the gravity signal attenuation in space and iii) the problem of isolating the glaciological signal from the gravitational signatures as detected by GRACE.In order to tackle the challenges i) and ii), we thoroughly investigate the point-mass modeling technique to represent the local gravity field. Instead of simply evaluating global spherical harmonics, we operate on the normal equation level and make use of GRACE K-band ranging data (available since April 2002) processed at the Graz University of Technology. Assessing such small-scale mass changes from space-borne gravimetric data is an ill-posed problem, which we aim to stabilize by utilizing a Genetic Algorithm based Tikhonov regularization. Concerning issue iii), we evaluate three different hydrology models (i.e. GLDAS, LSDM and WGHM) for validation purposes and the derivation of error bounds. The non-glaciological signal is calculated for each region of interest and reduced from the GRACE results.We present mass variations of several alpine glacier systems (e.g. the European Alps, Svalbard or Iceland) and compare our results to glaciological observations provided by the World Glacier Monitoring Service (WGMS) and alternative inversion methods (surface density modeling).

Evaluating short-term hydro-meteorological fluxes using GRACE-derived water storage changes

NASA Astrophysics Data System (ADS)

Eicker, A.; Jensen, L.; Springer, A.; Kusche, J.

2017-12-01

Atmospheric and terrestrial water budgets, which represent important boundary conditions for both climate modeling and hydrological studies, are linked by evapotranspiration (E) and precipitation (P). These fields are provided by numerical weather prediction models and atmospheric reanalyses such as ERA-Interim and MERRA-Land; yet, in particular the quality of E is still not well evaluated. Via the terrestrial water budget equation, water storage changes derived from products of the Gravity Recovery and Climate Experiment (GRACE) mission, combined with runoff (R) data can be used to assess the realism of atmospheric models. In this contribution we will investigate the closure of the water balance for short-term fluxes, i.e. the agreement of GRACE water storage changes with P-E-R flux time series from different (global and regional) atmospheric reanalyses, land surface models, as well as observation-based data sets. Missing river runoff observations will be extrapolated using the calibrated rainfall-runoff model GR2M. We will perform a global analysis and will additionally focus on selected river basins in West Africa. The investigations will be carried out for various temporal scales, focusing on short-term fluxes down to daily variations to be detected in daily GRACE time series.

Monitoring climate and man-made induced variations in terrestrial water storage (TWS) across Africa using GRACE data

NASA Astrophysics Data System (ADS)

Ahmed, M. E.; Sultan, M.; Wahr, J. M.; Yan, E.; Bonin, J. A.; Chouinard, K.

2012-12-01

It is common practice for researchers engaged in research related to climate change to examine the temporal variations in relevant climatic parameters (e.g., temperature, precipitation) and to extract and examine drought indices reproduced from one or more such parameters. Drought indices (meteorological, agricultural and hydrological) define departures from normal conditions and are used as proxies for monitoring water availability. Many of these indices exclude significant controlling factor(s), do not work well in specific settings and regions, and often require long (≥50 yr) calibration time periods and substantial meteorological data, limiting their application in areas lacking adequate observational networks. Additional uncertainties are introduced by the models used in computing model-dependent indices. Aside from these uncertainties, none of these indices measure the variability in terrestrial water storage (TWS), a term that refers to the total vertically integrated water content in an area regardless of the reservoir in which it resides. Inter-annual trends in TWS were extracted from monthly Gravity Recovery and Climate Experiment (GRACE) data acquired (04/2002 to 08/2011) over Africa and correlated (in a GIS environment) with relevant temporal remote sensing, geologic, hydrologic, climatic, and topographic datasets. Findings include the following: (1) large sectors of Africa are undergoing statistically significant variations (+36 mm/yr to -16 mm/yr) due to natural and man-made causes; (2) warming of the tropical Atlantic ocean apparently intensified Atlantic monsoons and increased precipitation and TWS over western and central Africa's coastal plains, proximal mountainous source areas, and inland areas as far as central Chad; (3) warming in the central Indian Ocean decreased precipitation and TWS over eastern and southern Africa; (4) the high frequency of negative phases of the North Atlantic Oscillation (NAO) increased precipitation and TWS over

GRACE Follow-On Integration

NASA Image and Video Library

2018-04-30

At the Harris Spaceport Systems facility at Vandenberg Air Force Base in California, the twin GRACE-FO satellites are integrated with the multi-satellite dispenser structure that will be used to deploy the satellites during launch on the SpaceX Falcon 9 launch vehicle. https://photojournal.jpl.nasa.gov/catalog/PIA22442

Relation of the aortic stiffness with the GRACE risk score in patients with the non ST-segment elevation myocardial infarction.

PubMed

Omer, Gedikli; Gokhan, Aksan; Adem, Uzun; Sabri, Demircan; Korhan, Soylu

2014-01-01

Current guidelines recommend clinical risk scoring systems for the patients diagnosed and determinated treatment strategy with in Non-ST-elevation elevation myocardial infarction (NSTEMI). Previous studies demonstrated association between aortic elasticity properties, stiffness and severity CAD. However, the associations between Aortic stiffness, elasticity properties and clinical risk scores have not been investigated. In the present study we have evaluated the relation between the Global Registry of Acute Coronary Events (GRACE) risk score and aortic stiffness in patients with NSTEMI. We prospectively analyzed 87 consecutive patients with NSTEMI. Aortic elastic parameter and stiffness parameter were calculated from the echocardiographically derived thoracic aortic diameters (mm/m(2)), and the measurement of pulse pressure obtained by cuff sphygmomanometry. We have categorized the patients in to two groups as low ((n = 45) (GRACE risk score ≤ 140)) and high ((n = 42) (GRACE risk score > 140)) risk group according to GRACE risk score and compare the both groups. Table 1 shows baseline characteristics of patients. Our study showed that Aortic strain was significantly low (3.5 ± 1.4, 7.9 ± 2.3 respectively, p < 0.001) and aortic stiffness index was significantly high (3.9 ± 0.38; 3 ± 0.35, respectively, p < 0.001) in the high risk group values compared to those with low risk group. The aortic stiffness index was the only independent predictor of GRACE risk score (OR: 119.390; 95% CI: 2.925-4872.8; p = 0.011) in multivariate analysis. We found a significant correlation between aortic stiffness, impaired elasticity and GRACE risk score. Aortic stiffness index was the only independent variable of the high GRACE risk score. The inclusion of aortic stiffness into the GRACE risk score could allow improved risk classification of patients with ACS at admission and this may be important in the diagnosis, follow up and treatment of the patients.

Identifying high frequency signals in the daily swath mascon solutions from GRACE

NASA Astrophysics Data System (ADS)

Save, H.

2016-12-01

The Gravity Recovery and Climate Experiment (GRACE) mission has provided us with unique information about the total water column in the Earth system over the past 14 years. The GRACE project provides a monthly mean time-variable gravity solution. There has been significant progress in the community over the years to develop shorter time-window gravity solutions. The daily swath mascon solutions, which are under development at the Center for Space Research (CSR), are computed using daily GRACE observation data. This paper discusses the development and the progress of this product. This paper summarizes the analysis of these solutions with special emphasis on identifying the higher frequency natural processes observed by GRACE using these daily swath mascon solutions.

The ITSG-Grace2014 Gravity Field Model

NASA Astrophysics Data System (ADS)

Kvas, Andreas; Mayer-Gürr, Torsten; Zehenter, Norbert; Klinger, Beate

2015-04-01

The ITSG-Grace2014 GRACE-only gravity field model consists of a high resolution unconstrained static model (up to degree 200) with trend and annual signal, monthly unconstrained solutions with different spatial resolutions as well as daily snapshots derived by using a Kalman smoother. Apart from the estimated spherical harmonic coefficients, full variance-covariance matrices for the monthly solutions and the static gravity field component are provided. Compared to the previous release, multiple improvements in the processing chain are implemented: updated background models, better ionospheric modeling for GPS observations, an improved satellite attitude by combination of star camera and angular accelerations, estimation of K-band antenna center variations within the gravity field recovery process as well as error covariance function determination. Furthermore, daily gravity field variations have been modeled in the adjustment process to reduce errors caused by temporal leakage. This combined estimation of daily gravity variations field variations together with the static gravity field component represents a computational challenge due to the significantly increased parameter count. The modeling of daily variations up to a spherical harmonic degree of 40 for the whole GRACE observation period results in a system of linear equations with over 6 million unknown gravity field parameters. A least squares adjustment of this size is not solvable in a sensible time frame, therefore measures to reduce the problem size have to be taken. The ITSG-Grace2014 release is presented and selected parts of the processing chain and their effect on the estimated gravity field solutions are discussed.

Grace and compassion at "ground zero," New York City.

PubMed

Rogers, James R; Soyka, Karen M

2004-01-01

Responding to the request to write about our work at "ground zero" the site of the former World Trade Center in New York City following the September 11, 2001, terrorist attack has proved to be a challenging task. Challenging in that we have found it difficult to discuss and honor our experiences with mere words alone. Thus, this work has been "in progress" for a long period of time. Part of the challenge is reflected for us in the title of the article by the choice of the word "grace." That is, writing about grace at ground zero does not fit comfortably with our scientist-practitioner training. In searching for words to describe our experiences, however, we tried out a number of alternatives to "grace" including luck, chance, coincidence, and serendipity. None of these alternatives quite captured our experiences and our sense that certain events may best be conceptualized as unsolicited "gifts" that facilitated our work at the WTC site. So while the term "grace" may seem out of place in the scientific and professional literature, it fits well as a descriptor of some of our experiences as we continue our struggle to understand

Correlating GRACE with Standardized Precipitation Indices and Precipitation Gauges for the High Plains Aquifer

NASA Astrophysics Data System (ADS)

Miller, K. A.; Clancy, K.

2016-12-01

The NASA and German Aerospace Center Gravity Recovery and Climate Experiment (GRACE) detects monthly changes in the gravity of the earth assumed to be water storage using the distance between two satellites, GRACE A and GRACE B, as a phase change. We will use level 3 GRACE Tellus data from the NASA Jet Propulsion Laboratory Physical Oceanography Distributed Active Archive Center (PO.DAAC). The data have a resolution of 9 km2 and are available for 2002 to 2015. We examine GRACE data for the High Plains aquifer (Texas, Oklahoma, Wyoming, Nebraska, Kansas, New Mexico, Colorado and South Dakota) and compare changes to monthly averaged precipitation gauges, standardized precipitation indices for one, three, six, and twelve-months. We hypothesize that GRACE data will correlate best with 1) three-month standardized precipitation indices; 2) regions with natural land cover; 3) and in years where precipitation is at or above average.

Estimating Geocenter Motion and Changes in the Earth's Dynamic Oblateness from a Statistically Optimal Combination of GRACE Data and Geophysical Models

NASA Astrophysics Data System (ADS)

Sun, Y.; Ditmar, P.; Riva, R.

2016-12-01

Time-varying gravity field solutions of the GRACE satellite mission enable an observation of Earth's mass transport on a monthly basis since 2002. One of the remaining challenges is how to complement these solutions with sufficiently accurate estimates of very low-degree spherical harmonic coefficients, particularly degree-1 coefficients and C20. An absence or inaccurate estimation of these coefficients may result in strong biases in mass transports estimates. Variations in degree-1 coefficients reflect geocenter motion and variations in the C20coefficients describe changes in the Earth's dynamic oblateness (ΔJ2). In this study, we developed a novel methodology to estimate monthly variations in degree-1 and C20coefficients by combing GRACE data with oceanic mass anomalies (combination approach). Unlike the method by Swenson et al. (2008), the proposed approach exploits noise covariance information of both input datasets and thus produces stochastically optimal solutions. A numerical simulation study is carried out to verify the correctness and performance of the proposed approach. We demonstrate that solutions obtained with the proposed approach have a significantly higher quality, as compared to the method by Swenson et al. Finally, we apply the proposed approach to real monthly GRACE solutions. To evaluate the obtained results, we calculate mass transport time-series over selected regions where minimal mass anomalies are expected. A clear reduction in the RMS of the mass transport time-series (more than 50 %) is observed there when the degree-1 and C20 coefficients obtained with the proposed approach are used. In particular, the seasonal pattern in the mass transport time-series disappears almost entirely. The traditional approach (degree-1 coefficients based on Swenson et al. (2008) and C20 based on SLR data), in contrast, does not reduce that RMS or even makes it larger (e.g., over the Sahara desert). We further show that the degree-1 variations play a major

Anthocyanins from roselle extract arrest cell cycle G2/M phase transition via ATM/Chk pathway in p53-deficient leukemia HL-60 cells.

PubMed

Tsai, Tsung-Chang; Huang, Hui-Pei; Chang, Kai-Ting; Wang, Chau-Jong; Chang, Yun-Ching

2017-04-01

Cell cycle regulation is an important issue in cancer therapy. Delphinidin and cyanidin are two major anthocyanins of the roselle plant (Hibiscus sabdariffa). In the present study, we investigated the effect of Hibiscus anthocyanins (HAs) on cell cycle arrest in human leukemia cell line HL-60 and the analyzed the underlying molecular mechanisms. HAs extracted from roselle calyces (purity 90%) markedly induced G2/M arrest evaluated with flow cytometry analysis. Western blot analyses revealed that HAs (0.1-0.7 mg mL -1 ) induced G2/M arrest via increasing Tyr15 phosphorylation of Cdc2, and inducing Cdk inhibitors p27 and p21. HAs also induced phosphorylation of upstream signals related to G2/M arrest such as phosphorylation of Cdc25C tyrosine phosphatase at Ser216, increasing the binding of pCdc25C with 14-3-3 protein. HAs-induced phosphorylation of Cdc25C could be activated by ATM checkpoint kinases, Chk1, and Chk2. We first time confirmed that ATM-Chk1/2-Cdc25C pathway as a critical mechanism for G2/M arrest in HAs-induced leukemia cell cycle arrest, indicating that this compound could be a promising anticancer candidate or chemopreventive agents for further investigation. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1290-1304, 2017. © 2016 Wiley Periodicals, Inc.

Plant and soil carbon accumulation following fire in Mediterranean woodlands in Spain.

PubMed

Kaye, Jason Philip; Romanyà, Joan; Vallejo, V Ramón

2010-10-01

We measured plant and soil carbon (C) storage following canopy-replacing wildfires in woodlands of northeastern Spain that include an understory of shrubs dominated by Quercus coccifera and an overstory of Pinus halepensis trees. Established plant succession models predict rapid shrub recovery in these ecosystems, and we build on this model by contrasting shrub succession with long-term C storage in soils, trees, and the whole ecosystem. We used chronosequence and repeated sampling approaches to detect change over time. Aboveground plant C increased from <100 to ~3,000 g C m(-2) over 30 years following fire, which is substantially less than the 5,942 ± 487 g C m(-2) (mean ±1 standard error) in unburned sites. As expected, shrubs accumulated C rapidly, but the capacity for C storage in shrubs was <600 g C m(-2). Pines were the largest plant C pool in sites >20 years post fire, and accounted for all of the difference in plant C between older burned sites and unburned sites. In contrast, soil C was initially higher in burned sites (~4,500 g C m(-2)) than in unburned sites (3,264 ± 261 g C m(-2)) but burned site C declined to unburned levels within 10 years after fire. Combining these results with prior research suggests two states for C storage. When pine regeneration is successful, ~9,200 g C m(-2) accumulate in woodlands but when tree regeneration fails (due to microclimatic stress or short fire return intervals), ecosystem C storage of ~4,000 g C m(-2) will occur in the resulting shrublands.

Detecting seasonal and long-term vertical displacement in the North China Plain using GRACE and GPS

NASA Astrophysics Data System (ADS)

Wang, Linsong; Chen, Chao; Du, Jinsong; Wang, Tongqing

2017-06-01

In total, 29 continuous Global Positioning System (GPS) time series data together with data from Gravity Recovery and Climate Experiment (GRACE) are analysed to determine the seasonal displacements of surface loadings in the North China Plain (NCP). Results show significant seasonal variations and a strong correlation between GPS and GRACE results in the vertical displacement component; the average correlation and weighted root-mean-squares (WRMS) reduction between GPS and GRACE are 75.6 and 28.9 % respectively, when atmospheric and non-tidal ocean effects were removed, but the annual peak-to-peak amplitude of GPS (1.2-6.3 mm) is greater than the data (1.0-2.2 mm) derived from GRACE. We also calculate the trend rate as well as the seasonal signal caused by the mass load change from GRACE data; the rate of GRACE-derived terrestrial water storage (TWS) loss (after multiplying by the scaling factor) in the NCP was 3.39 cm yr-1 (equivalent to 12.42 km3 yr-1) from 2003 to 2009. For a 10-year time span (2003 to 2012), the rate loss of TWS was 2.57 cm yr-1 (equivalent to 9.41 km3 yr-1), which is consistent with the groundwater storage (GWS) depletion rate (the rate losses of GWS were 2.49 and 2.72 cm yr-1 during 2003-2009 and 2003-2012 respectively) estimated from GRACE-derived results after removing simulated soil moisture (SM) data from the Global Land Data Assimilation System (GLDAS)/Noah model. We also found that GRACE-derived GWS changes are in disagreement with the groundwater level changes from observations of shallow aquifers from 2003 to 2009, especially between 2010 and 2013. Although the shallow groundwater can be recharged from the annual climate-driven rainfall, the important facts indicate that GWS depletion is more serious in deep aquifers. The GRACE-derived result shows an overall uplift in the whole region at the 0.37-0.95 mm yr-1 level from 2004 to 2009, but the rate of change direction is inconsistent in different GPS stations at the -0.40-0.51 mm yr-1

Do Plants Contain G Protein-Coupled Receptors?1[C][W][OPEN

PubMed Central

Taddese, Bruck; Upton, Graham J.G.; Bailey, Gregory R.; Jordan, Siân R.D.; Abdulla, Nuradin Y.; Reeves, Philip J.; Reynolds, Christopher A.

2014-01-01

Whether G protein-coupled receptors (GPCRs) exist in plants is a fundamental biological question. Interest in deorphanizing new GPCRs arises because of their importance in signaling. Within plants, this is controversial, as genome analysis has identified 56 putative GPCRs, including G protein-coupled receptor1 (GCR1), which is reportedly a remote homolog to class A, B, and E GPCRs. Of these, GCR2 is not a GPCR; more recently, it has been proposed that none are, not even GCR1. We have addressed this disparity between genome analysis and biological evidence through a structural bioinformatics study, involving fold recognition methods, from which only GCR1 emerges as a strong candidate. To further probe GCR1, we have developed a novel helix-alignment method, which has been benchmarked against the class A-class B-class F GPCR alignments. In addition, we have presented a mutually consistent set of alignments of GCR1 homologs to class A, class B, and class F GPCRs and shown that GCR1 is closer to class A and/or class B GPCRs than class A, class B, or class F GPCRs are to each other. To further probe GCR1, we have aligned transmembrane helix 3 of GCR1 to each of the six GPCR classes. Variability comparisons provide additional evidence that GCR1 homologs have the GPCR fold. From the alignments and a GCR1 comparative model, we have identified motifs that are common to GCR1, class A, B, and E GPCRs. We discuss the possibilities that emerge from this controversial evidence that GCR1 has a GPCR fold. PMID:24246381

Comparative Analysis of the Base Compositions of the Pre-mRNA 3′ Cleaved-Off Region and the mRNA 3′ Untranslated Region Relative to the Genomic Base Composition in Animals and Plants

PubMed Central

Li, Xiu-Qing

2014-01-01

The precursor messenger RNA (pre-mRNA) three-prime cleaved-off region (3′COR) and the mRNA three-prime untranslated region (3′UTR) play critical roles in regulating gene expression. The differences in base composition between these regions and the corresponding genomes are still largely uncharacterized in animals and plants. In this study, the base compositions of non-redundant 3′CORs and 3′UTRs were compared with the corresponding whole genomes of eleven animals, four dicotyledonous plants, and three monocotyledonous (cereal) plants. Among the four bases (A, C, G, and U for adenine, cytosine, guanine, and uracil, respectively), U (which corresponds to T, for thymine, in DNA) was the most frequent, A the second most frequent, G the third most frequent, and C the least frequent in most of the species in both the 3′COR and 3′UTR regions. In comparison with the whole genomes, in both regions the U content was usually the most overrepresented (particularly in the monocotyledonous plants), and the C content was the most underrepresented. The order obtained for the species groups, when ranked from high to low according to the U contents in the 3′COR and 3′UTR was as follows: dicotyledonous plants, monocotyledonous plants, non-mammal animals, and mammals. In contrast, the genomic T content was highest in dicotyledonous plants, lowest in monocotyledonous plants, and intermediate in animals. These results suggest the following: 1) there is a mechanism operating in both animals and plants which is biased toward U and against C in the 3′COR and 3′UTR; 2) the 3′UTR and 3′COR, as functional units, minimized the difference between dicotyledonous and monocotyledonous plants, while the dicotyledonous and monocotyledonous genomes evolved into two extreme groups in terms of base composition. PMID:24941005

Mycorrhizal Symbiotic Efficiency on C3 and C4 Plants under Salinity Stress – A Meta-Analysis

PubMed Central

Chandrasekaran, Murugesan; Kim, Kiyoon; Krishnamoorthy, Ramasamy; Walitang, Denver; Sundaram, Subbiah; Joe, Manoharan M.; Selvakumar, Gopal; Hu, Shuijin; Oh, Sang-Hyon; Sa, Tongmin

2016-01-01

A wide range of C3 and C4 plant species could acclimatize and grow under the impact of salinity stress. Symbiotic relationship between plant roots and arbuscular mycorrhizal fungi (AMF) are widespread and are well known to ameliorate the influence of salinity stress on agro-ecosystem. In the present study, we sought to understand the phenomenon of variability on AMF symbiotic relationship on saline stress amelioration in C3 and C4 plants. Thus, the objective was to compare varied mycorrhizal symbiotic relationship between C3 and C4 plants in saline conditions. To accomplish the above mentioned objective, we conducted a random effects models meta-analysis across 60 published studies. An effect size was calculated as the difference in mycorrhizal responses between the AMF inoculated plants and its corresponding control under saline conditions. Responses were compared between (i) identity of AMF species and AMF inoculation, (ii) identity of host plants (C3 vs. C4) and plant functional groups, (iii) soil texture and level of salinity and (iv) experimental condition (greenhouse vs. field). Results indicate that both C3 and C4 plants under saline condition responded positively to AMF inoculation, thereby overcoming the predicted effects of symbiotic efficiency. Although C3 and C4 plants showed positive effects under low (EC < 4 ds/m) and high (>8 ds/m) saline conditions, C3 plants showed significant effects for mycorrhizal inoculation over C4 plants. Among the plant types, C4 annual and perennial plants, C4 herbs and C4 dicot had a significant effect over other counterparts. Between single and mixed AMF inoculants, single inoculants Rhizophagus irregularis had a positive effect on C3 plants whereas Funneliformis mosseae had a positive effect on C4 plants than other species. In all of the observed studies, mycorrhizal inoculation showed positive effects on shoot, root and total biomass, and in nitrogen, phosphorous and potassium (K) uptake. However, it showed negative

Towards Improved Snow Water Equivalent Estimation via GRACE Assimilation

NASA Technical Reports Server (NTRS)

Forman, Bart; Reichle, Rofl; Rodell, Matt

2011-01-01

Passive microwave (e.g. AMSR-E) and visible spectrum (e.g. MODIS) measurements of snow states have been used in conjunction with land surface models to better characterize snow pack states, most notably snow water equivalent (SWE). However, both types of measurements have limitations. AMSR-E, for example, suffers a loss of information in deep/wet snow packs. Similarly, MODIS suffers a loss of temporal correlation information beyond the initial accumulation and final ablation phases of the snow season. Gravimetric measurements, on the other hand, do not suffer from these limitations. In this study, gravimetric measurements from the Gravity Recovery and Climate Experiment (GRACE) mission are used in a land surface model data assimilation (DA) framework to better characterize SWE in the Mackenzie River basin located in northern Canada. Comparisons are made against independent, ground-based SWE observations, state-of-the-art modeled SWE estimates, and independent, ground-based river discharge observations. Preliminary results suggest improved SWE estimates, including improved timing of the subsequent ablation and runoff of the snow pack. Additionally, use of the DA procedure can add vertical and horizontal resolution to the coarse-scale GRACE measurements as well as effectively downscale the measurements in time. Such findings offer the potential for better understanding of the hydrologic cycle in snow-dominated basins located in remote regions of the globe where ground-based observation collection if difficult, if not impossible. This information could ultimately lead to improved freshwater resource management in communities dependent on snow melt as well as a reduction in the uncertainty of river discharge into the Arctic Ocean.

Water Storage Changes over the Tibetan Plateau Revealed by GRACE Mission

NASA Astrophysics Data System (ADS)

Guo, Jinyun; Mu, Dapeng; Liu, Xin; Yan, Haoming; Sun, Zhongchang; Guo, Bin

2016-04-01

We use GRACE gravity data released by the Center for Space Research (CSR) and the Groupe de Recherches en Geodesie Spatiale (GRGS) to detect the water storage changes over the Tibetan Plateau (TP). A combined filter strategy is put forward to process CSR RL05 data to remove the effect of striping errors. After the correction for GRACE by GLDAS and ICE-5G, we find that TP has been overall experiencing the water storage increase during 2003-2012. During the same time, the glacier over the Himalayas was sharply retreating. Interms of linear trends, CSR's results derived by the combined filter are close to GRGS RL03 with the Gaussian filter of 300-km window. The water storage increasing rates determined from CSR's RL05 products in the interior TP, Karakoram Mountain, Qaidam Basin, Hengduan Mountain, and middle Himalayas are 9.7, 6.2, 9.1,-18.6, and-20.2 mm/yr, respectively. These rates from GRGS's RL03 products are 8.6, 5.8, 10.5,-19.3 and-21.4 mm/yr, respectively.

Assimilation of Gridded GRACE Terrestrial Water Storage Estimates in the North American Land Data Assimilation System

NASA Technical Reports Server (NTRS)

Kumar, Sujay V.; Zaitchik, Benjamin F.; Peters-Lidard, Christa D.; Rodell, Matthew; Reichle, Rolf; Li, Bailing; Jasinski, Michael; Mocko, David; Getirana, Augusto; De Lannoy, Gabrielle;

The potential of GRACE gravimetry to detect the heavy rainfall-induced impoundment of a small reservoir in the upper Yellow River

NASA Astrophysics Data System (ADS)

Yi, Shuang; Song, Chunqiao; Wang, Qiuyu; Wang, Linsong; Heki, Kosuke; Sun, Wenke

2017-08-01

Artificial reservoirs are important indicators of anthropogenic impacts on environments, and their cumulative influences on the local water storage will change the gravity signal. However, because of their small signal size, such gravity changes are seldom studied using satellite gravimetry from the Gravity Recovery and Climate Experiment (GRACE). Here we investigate the ability of GRACE to detect water storage changes in the Longyangxia Reservoir (LR), which is situated in the upper main stem of the Yellow River. Three different GRACE solutions from the CSR, GFZ, and JPL with three different processing filters are compared here. We find that heavy precipitation in the summer of 2005 caused the LR water storage to increase by 37.9 m in height, which is equivalent to 13.0 Gt in mass, and that the CSR solutions with a DDK4 filter show the best performance in revealing the synthetic gravity signals. We also obtain 109 pairs of reservoir inundation area measurements from satellite imagery and water level changes from laser altimetry and in situ observations to derive the area-height ratios for the LR. The root mean square of GRACE series in the LR is reduced by 39% after removing synthetic signals caused by mass changes in the LR or by 62% if the GRACE series is further smoothed. We conclude that GRACE data show promising potential in detecting water storage changes in this ˜400 km2 reservoir and that a small signal size is not a restricting factor for detection using GRACE data.

Towards Designing Graceful Degradation into Trajectory Based Operations: A Human-systems Integration Approach

NASA Technical Reports Server (NTRS)

Edwards, Tamsyn; Lee, Paul

2017-01-01

One of the most fundamental changes to the air traffic management system in NextGen is the concept of trajectory based operations (TBO). With the introduction of such change, system safety and resilience is a critical concern, in particular, the ability of systems to gracefully degrade. In order to design graceful degradation into a TBO envrionment, knowledge of the potential causes of degradation, and appropriate solutions, is required. In addition, previous research has predominantly explored the technological contribution to graceful degradation, frequently neglecting to consider the role of the human operator, specifically, air traffic controllers (ATCOs). This is out of step with real-world operations, and potentially limits an ecologically valid understanding of achieving graceful degradation in an air traffic control (ATC) environment. The following literature review aims to identify and summarize the literature to date on the potential causes of degradation in ATC and the solutions that may be applied within a TBO context, with a specific focus on the contribution of the air traffic controller. A framework of graceful degradation, developed from the literature, is presented. It is argued that in order to achieve graceful degradation within TBO, a human-system integration approach must be applied.

A new monthly gravity field model based on GRACE observations computed by the modified dynamic approach

NASA Astrophysics Data System (ADS)

Zhou, H.; Luo, Z.; Li, Q.; Zhong, B.

2016-12-01

The monthly gravity field model can be used to compute the information about the mass variation within the system Earth, i.e., the relationship between mass variation in the oceans, land hydrology, and ice sheets. For more than ten years, GRACE has provided valuable information for recovering monthly gravity field model. In this study, a new time series of GRACE monthly solution, which is truncated to degree and order 60, is computed by the modified dynamic approach. Compared with the traditional dynamic approach, the major difference of our modified approach is the way to process the nuisance parameters. This type of parameters is mainly used to absorb low-frequency errors in KBRR data. One way is to remove the nuisance parameters before estimating the geo-potential coefficients, called Pure Predetermined Strategy (PPS). The other way is to determine the nuisance parameters and geo-potential coefficients simultaneously, called Pure Simultaneous Strategy (PSS). It is convenient to detect the gross error by PPS, while there is also obvious signal loss compared with the solutions derived from PSS. After comparing the difference of practical calculation formulas between PPS and PSS, we create the Filter Predetermine Strategy (FPS), which can combine the advantages of PPS and PSS efficiently. With FPS, a new monthly gravity field model entitled HUST-Grace2016s is developed. The comparisons of geoid degree powers and mass change signals in the Amazon basin, the Greenland and the Antarctic demonstrate that our model is comparable with the other published models, e.g., the CSR RL05, JPL RL05 and GFZ RL05 models. Acknowledgements: This work is supported by China Postdoctoral Science Foundation (Grant No.2016M592337), the National Natural Science Foundation of China (Grant Nos. 41131067, 41504014), the Open Research Fund Program of the State Key Laboratory of Geodesy and Earth's Dynamics (Grant No. SKLGED2015-1-3-E).

Antarctic Glacial Isostatic Adjustment and Ice Sheet Mass Balance using GRACE: A Report from the Ice-sheet Mass Balance Exercise (IMBIE)

NASA Astrophysics Data System (ADS)

Ivins, E. R.; Wahr, J. M.; Schrama, E. J.; Milne, G. A.; Barletta, V.; Horwath, M.; Whitehouse, P.

2012-12-01

In preparation for the Inter-govermental Panel on Climate Change: Assessment Report 5 (IPCC AR5), ESA and NASA have formed a committee of experts to perform a formal set of comparative experiments concerning space observations of ice sheet mass balance. This project began in August of 2011 and has now concluded with a report submitted for Science (Shepherd et al., 2012). The focus of the work conducted is to re-evaluate scientific reports on the mass balance of Greenland ice sheet (GIS) and Antarctic ice sheet (AIS). The most serious discrepancies have been reported for the AIS, amounting to as much as 0.9 mm/yr in discrepant sea level contribution. A direct method of determining the AIS is by space gravimetry. However, for this method to contribute to our understanding of sea level change, we require knowledge of present-day non-elastic vertical movements of bedrock in Antarctica. Quantifying the uncertainty and bias caused by lack of observational control on models of regional glacial isostatic adjustment (GIA), was a major focus for our experiments. This regional process is the most problematic error source for GRACE-determinations of ice mass balance in Antarctica. While GIA likely dominates some large vertical motions in Antarctica that are now observed with GPS (Thomas et al., 2011, GRL), interpretations still require models. The reported uncertainty for space gravimetric (GRACE) based sea level sourcing is roughly 0.20 to 0.35 mm/yr. The uncertainty is also part of the error budget for mass balances derived from altimetry measurements, though at a much lower level. Analysis of the GRACE time series using CSR RL04 (2003.0-2010.10) for AIS mass balance reveals a small trend of order +1 to -24 Gt/yr without a GIA correction. Three periods were selected over which to perform inter-comparisons (see Table). One class of GIA models, that relies primarily on far field sea level reconstructions (e.g. ICE-5G), provide a GIA correction that places AIS mass imbalance (δM

Analysis of a GRACE Global Mascon Solution for Gulf of Alaska Glaciers

NASA Technical Reports Server (NTRS)

Arendt, Anthony; Luthcke, Scott B.; Gardner, Alex; O'Neel, Shad; Hill, David; Moholdt, Geir; Abdalati, Waleed

2013-01-01

We present a high-resolution Gravity Recovery and Climate Experiment (GRACE) mascon solution for Gulf of Alaska (GOA) glaciers and compare this with in situ glaciological, climate and other remote-sensing observations. Our GRACE solution yields a GOA glacier mass balance of -6511 Gt a(exp.-1) for the period December 2003 to December 2010, with summer balances driving the interannual variability. Between October/November 2003 and October 2009 we obtain a mass balance of -6111 Gt a(exp. -1) from GRACE, which compares well with -6512 Gt a(exp. -1) from ICESat based on hypsometric extrapolation of glacier elevation changes. We find that mean summer (June-August) air temperatures derived from both ground and lower-troposphere temperature records were good predictors of GRACE-derived summer mass balances, capturing 59% and 72% of the summer balance variability respectively. Large mass losses during 2009 were likely due to low early melt season surface albedos, measured by the Moderate Resolution Imaging Spectroradiometer (MODIS) and likely associated with the 31 March 2009 eruption of Mount Redoubt, southwestern Alaska. GRACE data compared well with in situ measurements atWolverine Glacier (maritime Alaska), but poorly with those at Gulkana Glacier (interior Alaska). We conclude that, although GOA mass estimates from GRACE are robust over the entire domain, further constraints on subregional and seasonal estimates are necessary to improve fidelity to ground observations.

The Value of Information from a GRACE-Enhanced Drought Severity Index

NASA Astrophysics Data System (ADS)

Kuwayama, Y.; Bernknopf, R.; Macauley, M.; Brookshire, D.; Zaitchik, B. F.; Rodell, M.

2013-12-01

Water storage anomalies derived from the Gravity Recovery and Climate Experiment Data Assimilation System (GRACE-DAS) have been used to enhance the information contained in drought indicators. The potential value of this information is to inform local and regional decisions to improve economic welfare in the face of drought. Based on a characterization of current drought evaluations, a modeling framework has been structured to analyze the contributed value of the Earth observations in the assessment of the onset and duration of droughts and their regional impacts. The analysis focuses on (1) characterizing how GRACE-DAS provides Earth observation information for a drought warning, (2) assessing how a GRACE-DAS-enhanced U.S. Drought Monitor would improve economic outcomes in a region, and (3) applying this enhancement process in a decision framework to illustrate the potential role of GRACE data products in a recent drought and response scenario for a value-of-information (VOI) analysis. The VOI analysis quantifies the relative contribution of enhanced understanding and communication of the societal benefits associated with GRACE Earth observation science. Our emphasis is to illustrate the role of an enhanced National Integrated Drought Information System outlook on three key societal outcomes: effects on particular economic sectors, changes in land management decisions, and reductions in damages to ecosystem services.

The Status and Future Directions for the GRACE Mission

NASA Astrophysics Data System (ADS)

Tapley, B. D.; Flechtner, F.; Watkins, M. M.; Bettadpur, S. V.

2015-12-01

The twin satellites of the Gravity Recovery and Climate Experiment (GRACE) were launched on March 17, 2002 and have operated for over 13 years. The mission objectives are to sense the spatial and temporal variations of the Earth's mass through its effects on the gravity field at the GRACE satellite altitude. The major cause of the time varying mass is water motion and the GRACE mission has provided a continuous decade long measurement sequences which characterizes the seasonal cycle of mass transport between the oceans, land, cryosphere and atmosphere; its inter-annual variability; and the climate driven secular, or long period, mass transport signals. In 2012, a complete reanalysis of the mission data, referred to as the RL05 data release, was initiated. The monthly solutions from this effort were released in mid-2013 with the mean fields following in 2014 and 2015. The mission is entering the final phases of operations. The current mission operations strategy emphasizes extending the mission lifetime to achieve mission overlap with the GRACE Follow On Mission. This presentation will review the mission status and the projections for mission lifetime, summarize plans for the RL 06 data re-analysis, describe the issues that influence the operations philosophy and discuss the impact the operations may have on the scientific data products.

The AvrM Effector from Flax Rust Has a Structured C-Terminal Domain and Interacts Directly with the M Resistance Protein

PubMed Central

Catanzariti, Ann-Maree; Dodds, Peter N.; Ve, Thomas; Kobe, Bostjan; Ellis, Jeffrey G.; Staskawicz, Brian J.

2011-01-01

In plant immunity, recognition of pathogen effectors by plant resistance proteins leads to the activation of plant defenses and a localized cell death response. The AvrM effector from flax rust is a small secreted protein that is recognized by the M resistance protein in flax. Here, we investigate the mechanism of M–AvrM recognition and show that these two proteins directly interact in a yeast two-hybrid assay, and that this interaction correlates with the recognition specificity observed for each of the different AvrM variants. We further characterize this interaction by demonstrating that the C-terminal domain of AvrM is required for M-dependent cell death, and show that this domain also interacts with the M protein in yeast. We investigate the role of C-terminal differences among the different AvrM proteins for their involvement in this interaction and establish that M recognition is hindered by an additional 34 amino acids present at the C terminus of several AvrM variants. Structural characterization of recombinant AvrM-A protein revealed a globular C-terminal domain that dimerizes. PMID:19958138

OBLIQUE/EXTERIOR VIEW, LOOKING NORTHEAST, WITH SINTERING PLANT RUINS AND TRACES ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

OBLIQUE/EXTERIOR VIEW, LOOKING NORTHEAST, WITH SINTERING PLANT RUINS AND TRACES OF L. & N. RAILROAD EXTENDING THROUGH GRACE'S GAP TOWARD THE BIRMINGHAM CITY CENTER. - Republic Steel, Spaulding Red Ore Mine (Ruins), Spanning Grace's Pass at Louisville & Nashville Railroad, Birmingham, Jefferson County, AL

New GRACE-Derived Storage Change Estimates Using Empirical Mode Extraction

NASA Astrophysics Data System (ADS)

Aierken, A.; Lee, H.; Yu, H.; Ate, P.; Hossain, F.; Basnayake, S. B.; Jayasinghe, S.; Saah, D. S.; Shum, C. K.

2017-12-01

Estimated mass change from GRACE spherical harmonic solutions have north/south stripes and east/west banded errors due to random noise and modeling errors. Low pass filters like decorrelation and Gaussian smoothing are typically applied to reduce noise and errors. However, these filters introduce leakage errors that need to be addressed. GRACE mascon estimates (JPL and CSR mascon solutions) do not need decorrelation or Gaussian smoothing and offer larger signal magnitudes compared to the GRACE spherical harmonics (SH) filtered results. However, a recent study [Chen et al., JGR, 2017] demonstrated that both JPL and CSR mascon solutions also have leakage errors. We developed a new postprocessing method based on empirical mode decomposition to estimate mass change from GRACE SH solutions without decorrelation and Gaussian smoothing, the two main sources of leakage errors. We found that, without any post processing, the noise and errors in spherical harmonic solutions introduced very clear high frequency components in the spatial domain. By removing these high frequency components and reserve the overall pattern of the signal, we obtained better mass estimates with minimum leakage errors. The new global mass change estimates captured all the signals observed by GRACE without the stripe errors. Results were compared with traditional methods over the Tonle Sap Basin in Cambodia, Northwestern India, Central Valley in California, and the Caspian Sea. Our results provide larger signal magnitudes which are in good agreement with the leakage corrected (forward modeled) SH results.

Error Reduction Analysis and Optimization of Varying GRACE-Type Micro-Satellite Constellations

NASA Astrophysics Data System (ADS)

Widner, M. V., IV; Bettadpur, S. V.; Wang, F.; Yunck, T. P.

2017-12-01

The Gravity Recovery and Climate Experiment (GRACE) mission has been a principal contributor in the study and quantification of Earth's time-varying gravity field. Both GRACE and its successor, GRACE Follow-On, are limited by their paired satellite design which only provide a full map of Earth's gravity field approximately every thirty days and at large spatial resolutions of over 300 km. Micro-satellite technology has presented the feasibility of improving the architecture of future missions to address these issues with the implementation of a constellations of satellites having similar characteristics as GRACE. To optimize the constellation's architecture, several scenarios are evaluated to determine how implementing this configuration affects the resultant gravity field maps and characterize which instrument system errors improve, which do not, and how changes in constellation architecture affect these errors.

Hydrological Variations in Australia Recovered by GRACE High-Resolution Mascons Solutions

NASA Technical Reports Server (NTRS)

Carabajal, Claudia C.; Boy, Jean-Paul; Sabaka, Terence J.; Lemoine, Frank G.; Rowlands. David; Luthcke, Scott B.; Brown, M. Y.

2011-01-01

Australia represents a challenging region in which to study hydrological variations as recovered by the GRACE (Gravity Recovery And Climate Experiment) mission data. Much of Australia is characterized by relatively small hydrological signals, with large precipitation gradients between the North and the South. These signals are better recovered using innovative GRACE processing techniques such as high-resolution mascon solutions, which may help overcome the deficiencies in the standard GRACE data processing and filtering methods. We will show the power of using regional and global mas con solutions to recover hydrological variations from 2003 to 2011, as well as the oceanic mass variations in the surrounding regions. We will compare the GRACE signals with state of the art hydrology and ocean general circulation models, precipitation, soil moisture and groundwater data sets. We especially emphasize the gravity signatures observed during the decadal drought in the Murray-Darling river basin and the early 2011 floods in North-Western Australia.

Pyrolysis g.c.-m.s. of a series of degraded woods and coalified logs that increase in rank from peat to subbituminous coal

USGS Publications Warehouse

Hatcher, P.G.; Lerch, H. E.; Kotra, R.K.; Verheyen, T.V.

1988-01-01

Xylem tissue from degraded wood and coalified logs or stems was examined by pyrolysis g.c.-m.s. to improve understanding of the coalification process. The pyrolysis data, when combined with solid-state 13C n.m.r. data for the same samples, show several stages of evolution during coalification. The first stage, microbial degradation in peat, involves the selective degradation of cellulosic components and preservation of lignin-like components. As coalification increases, the lignin structural units undergo a series of defunctionalization reactions. The first of these involve loss of methoxyl groups, with replacement by phenolic hydroxyls such that catechol-like structures are produced. As the xylem tissue is converted to subbituminous coal, the persistence of phenols and methylated phenols in pyrolysis g.c.-m.s. data of subbituminous coal suggests that the catechol-like structures are being converted to phenol-like structures. The ability to discern detailed changes in the chemical structural composition of a genetically and histologically related series of samples provides an ideal method for developing models of coal structure, especially that of low-rank coal. ?? 1988.

Antitumor activities of extracts from selected desert plants against HepG2 human hepatocellular carcinoma cells.

PubMed

Thoppil, Roslin J; Harlev, Eli; Mandal, Animesh; Nevo, Eviatar; Bishayee, Anupam

2013-05-01

Phytochemicals are produced by desert plants to protect themselves against stressful environments. They have been shown to be useful in preventing and fighting adverse pathophysiological conditions and complex diseases, including cancer. Although many desert plants have been investigated for their antitumor properties, a large number of them still remain to be explored for possible therapeutic applications in oncologic diseases. To screen the antitumor effects of selected desert plants, namely Achillea fragrantissima (Forssk.) Sch. Bip. (Compositae), Ochradenus baccatus Delile (Resedaceae), Origanum dayi Post (Lamiaceae), Phlomis platystegia Post (Lamiaceae) and Varthemia iphionoides Boiss (Compositae), against an in vitro tumor model utilizing HepG2 human hepatocellular carcinoma cells. The aqueous extracts of aerial parts of the aforementioned plants were prepared and used for the in vitro experiments. The HepG2 cells were exposed to varying concentrations (0-4 mg/mL) of each plant extract for 24 or 48 h and the cytotoxicity was measured by the MTT assay. Following 24 h exposure, O. dayi extract exhibited a substantial antiproliferative effect in HepG2 cells (IC50 = 1.0 mg/mL) followed by O. baccatus (IC50 = 1.5 mg/mL). All plant extracts displayed cytotoxicity following 48 h exposure. Nevertheless, a substantial effect was observed with O. dayi (IC50 = 0.35 mg/mL) or O. baccatus (IC50 = 0.83 mg/mL). The aqueous extracts from aerial parts of O. dayi and O. baccatus possess antitumor effects against human liver cancer cells. These desert plants represent valuable resources for the development of potential anticancer agents.

The carriers of the A/G-G/G allelic combination of the c.2039 A>G and c.-29 G>A FSH receptor polymorphisms retrieve the highest number of oocytes in IVF/ICSI cycles.

PubMed

Allegra, Adolfo; Marino, Angelo; Raimondo, Stefania; Maiorana, Antonio; Gullo, Salvatore; Scaglione, Piero; Volpes, Aldo; Alessandro, Riccardo

2017-02-01

The objective of this study was the elucidation of the possible role of the single-nucleotide polymorphisms (SNP) at position -29 and 2039 of the FSH receptor gene (FSHR) as independent predictive markers of ovarian response. Indeed, the tailoring of reproductive treatments is crucial for both maximizing the success of IVF patients and obtaining a reduction in hypo- or hyper-response rates. This prospective, observational study analyzed the association of -29 and 2039 FSHR polymorphisms with the number of retrieved oocytes in 140 patients attending an IVF/ICSI cycle for severe male factors (≤5,000,000 spermatozoa/mL) or tubal factors at the ANDROS Day Surgery Clinic, Palermo, Italy. The results of this study demonstrate that the genetic combination of A/G for polymorphism c.2039 A>G with G/G for polymorphism c.-29 G>A is significantly associated with the highest number of collected oocytes (p = 0.03). This association was significant even after controlling for the effect of other clinical variables. The A/G-G/G allelic variant, identified as an independent variable, if confirmed in a larger number of patients, could be considered as a new genetic biomarker, which could increase the efficacy of prediction models for ovarian stimulation.

Natural and human-induced terrestrial water storage change: A global analysis using hydrological models and GRACE

NASA Astrophysics Data System (ADS)

Felfelani, Farshid; Wada, Yoshihide; Longuevergne, Laurent; Pokhrel, Yadu N.

2017-10-01

Hydrological models and the data derived from the Gravity Recovery and Climate Experiment (GRACE) satellite mission have been widely used to study the variations in terrestrial water storage (TWS) over large regions. However, both GRACE products and model results suffer from inherent uncertainties, calling for the need to make a combined use of GRACE and models to examine the variations in total TWS and their individual components, especially in relation to natural and human-induced changes in the terrestrial water cycle. In this study, we use the results from two state-of-the-art hydrological models and different GRACE spherical harmonic products to examine the variations in TWS and its individual components, and to attribute the changes to natural and human-induced factors over large global river basins. Analysis of the spatial patterns of the long-term trend in TWS from the two models and GRACE suggests that both models capture the GRACE-measured direction of change, but differ from GRACE as well as each other in terms of the magnitude over different regions. A detailed analysis of the seasonal cycle of TWS variations over 30 river basins shows notable differences not only between models and GRACE but also among different GRACE products and between the two models. Further, it is found that while one model performs well in highly-managed river basins, it fails to reproduce the GRACE-observed signal in snow-dominated regions, and vice versa. The isolation of natural and human-induced changes in TWS in some of the managed basins reveals a consistently declining TWS trend during 2002-2010, however; significant differences are again obvious both between GRACE and models and among different GRACE products and models. Results from the decomposition of the TWS signal into the general trend and seasonality indicate that both models do not adequately capture both the trend and seasonality in the managed or snow-dominated basins implying that the TWS variations from a

Analysis of a GRACE global mascon solution for Gulf of Alaska glaciers

USGS Publications Warehouse

Arendt, Anthony; Luthcke, Scott; Gardner, Alex; O'Neel, Shad; Hill, David; Moholdt, Geir; Abdalati, Waleed

2013-01-01

We present a high-resolution Gravity Recovery and Climate Experiment (GRACE) mascon solution for Gulf of Alaska (GOA) glaciers and compare this with in situ glaciological, climate and other remote-sensing observations. Our GRACE solution yields a GOA glacier mass balance of –65 ± 11 Gt a–1 for the period December 2003 to December 2010, with summer balances driving the interannual variability. Between October/November 2003 and October 2009 we obtain a mass balance of –61 ± 11 Gt a–1 from GRACE, which compares well with –65 ± 12 Gt a–1 from ICESat based on hypsometric extrapolation of glacier elevation changes. We find that mean summer (June–August) air temperatures derived from both ground and lower-troposphere temperature records were good predictors of GRACE-derived summer mass balances, capturing 59% and 72% of the summer balance variability respectively. Large mass losses during 2009 were likely due to low early melt season surface albedos, measured by the Moderate Resolution Imaging Spectroradiometer (MODIS) and likely associated with the 31 March 2009 eruption of Mount Redoubt, southwestern Alaska. GRACE data compared well with in situ measurements at Wolverine Glacier (maritime Alaska), but poorly with those at Gulkana Glacier (interior Alaska). We conclude that, although GOA mass estimates from GRACE are robust over the entire domain, further constraints on subregional and seasonal estimates are necessary to improve fidelity to ground observations.

Relation of the aortic stiffness with the GRACE risk score in patients with the non ST-segment elevation myocardial infarction

PubMed Central

Omer, Gedikli; Gokhan, Aksan; Adem, Uzun; Sabri, Demircan; Korhan, Soylu

2014-01-01

Background: Current guidelines recommend clinical risk scoring systems for the patients diagnosed and determinated treatment strategy with in Non-ST-elevation elevation myocardial infarction (NSTEMI). Previous studies demonstrated association between aortic elasticity properties, stiffness and severity CAD. However, the associations between Aortic stiffness, elasticity properties and clinical risk scores have not been investigated. In the present study we have evaluated the relation between the Global Registry of Acute Coronary Events (GRACE) risk score and aortic stiffness in patients with NSTEMI. Method: We prospectively analyzed 87 consecutive patients with NSTEMI. Aortic elastic parameter and stiffness parameter were calculated from the echocardiographically derived thoracic aortic diameters (mm/m2), and the measurement of pulse pressure obtained by cuff sphygmomanometry. We have categorized the patients in to two groups as low ((n = 45) (GRACE risk score ≤ 140)) and high ((n = 42) (GRACE risk score > 140)) risk group according to GRACE risk score and compare the both groups. Results: Table 1 shows baseline characteristics of patients. Our study showed that Aortic strain was significantly low (3.5 ± 1.4, 7.9 ± 2.3 respectively, p < 0.001) and aortic stiffness index was significantly high (3.9 ± 0.38; 3 ± 0.35, respectively, p < 0.001) in the high risk group values compared to those with low risk group. The aortic stiffness index was the only independent predictor of GRACE risk score (OR: 119.390; 95% CI: 2.925-4872.8; p = 0.011) in multivariate analysis. Conclusion: We found a significant correlation between aortic stiffness, impaired elasticity and GRACE risk score. Aortic stiffness index was the only independent variable of the high GRACE risk score. The inclusion of aortic stiffness into the GRACE risk score could allow improved risk classification of patients with ACS at admission and this may be important in the diagnosis, follow up and treatment of

Improved Uncertainty Quantification in Groundwater Flux Estimation Using GRACE

NASA Astrophysics Data System (ADS)

Reager, J. T., II; Rao, P.; Famiglietti, J. S.; Turmon, M.

2015-12-01

Groundwater change is difficult to monitor over large scales. One of the most successful approaches is in the remote sensing of time-variable gravity using NASA Gravity Recovery and Climate Experiment (GRACE) mission data, and successful case studies have created the opportunity to move towards a global groundwater monitoring framework for the world's largest aquifers. To achieve these estimates, several approximations are applied, including those in GRACE processing corrections, the formulation of the formal GRACE errors, destriping and signal recovery, and the numerical model estimation of snow water, surface water and soil moisture storage states used to isolate a groundwater component. A major weakness in these approaches is inconsistency: different studies have used different sources of primary and ancillary data, and may achieve different results based on alternative choices in these approximations. In this study, we present two cases of groundwater change estimation in California and the Colorado River basin, selected for their good data availability and varied climates. We achieve a robust numerical estimate of post-processing uncertainties resulting from land-surface model structural shortcomings and model resolution errors. Groundwater variations should demonstrate less variability than the overlying soil moisture state does, as groundwater has a longer memory of past events due to buffering by infiltration and drainage rate limits. We apply a model ensemble approach in a Bayesian framework constrained by the assumption of decreasing signal variability with depth in the soil column. We also discuss time variable errors vs. time constant errors, across-scale errors v. across-model errors, and error spectral content (across scales and across model). More robust uncertainty quantification for GRACE-based groundwater estimates would take all of these issues into account, allowing for more fair use in management applications and for better integration of GRACE

Neoglycolipid analogues of ganglioside G sub M1 as functional receptors of cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pacuszka, T.; Bradley, R.M.; Fishman, P.H.

1991-03-12

The authors synthesized several lipid analogues of ganglioside G{sub M1} by attaching its oligosaccharide moiety (G{sub M1}OS) to aminophospholipids, aliphatic amines, and cholesteryl hemisuccinate. They incubated G{sub M1}-deficient rat glioma C6 cells with each of the derivatives as well as native G{sub M1} and assayed the cells for their ability to bind and respond to cholera toxin. On the basis of the observed increase in binding of {sup 125}I-labeled cholera toxin, it was apparent that the cells took up and initially incorporated most of the derivatives into the plasma membrane. In the case of the aliphatic amine derivatives, the abilitymore » to generate new toxin binding sites was dependent on chain length; whereas the C{sub 10} derivative was ineffective, C{sub 12} and higher analogues were effective. Increased binding was dependent on both the concentration of the neoglycolipid in the medium and the time of exposure. Cells pretreated with the various derivatives accumulated cyclic AMP in response to cholera toxin, but there were differences in their effectiveness. The cholesterol and long-chain aliphatic amine derivatives were more effective than native G{sub M1}, whereas the phospholipid derivatives were less effective. The distance between G{sub M1}OS and the phospholipid also appeared to influence its functional activity. The results indicate that although G{sub M1}OS provides the recognition site for the binding of cholera toxin, the nature of the lipid moiety plays an important role in the action of the toxin.« less

[Construction and expression of the eukaryotic expression vector carrying HSV-1 gC glycoprotein gene].

PubMed

Dang, Yin-li; Yan, Yan; Zhang, Xiao-xiao; Li, Pu-yuan; Yu, Lan; Zhang, Lei; Zhang, Fang-lin; Xu, Zhi-kai; Wu, Xing-an

2011-05-01

To stably express herpes simplex virus type 1 (HSV-1) glycoprotein C (gC) in Chinese hamster ovary cells (CHO-K1). The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed and transfected into CHO-K1 cells by Lipofectamine 2000. The transfected cells were selected by G418 and methotrexate (MTX). The expression of HSV-1 gC was analyzed by Slot blot. HSV-1 gC proteins were purified with His-Ni Sepharose and then detected by Western blot. The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed successfully. CHO-K1 cells stably expressing HSV-1 gC proteins were established and confirmed by Western blot. The HSV-1 gC proteins have been expressed successfully and have good bioactivity. The results make it possible for further study and clinical use of HSV-1 gC.

Towards Designing Graceful Degradation into Trajectory Based Operations: A Human-Machine System Integration Approach

NASA Technical Reports Server (NTRS)

Edwards, Tamsyn; Lee, Paul

2017-01-01

One of the most fundamental changes to the air traffic management system in NextGen is the concept of trajectory based operations (TBO). With the introduction of such change, system safety and resilience is a critical concern, in particular, the ability of systems to gracefully degrade. In order to design graceful degradation into a TBO envrionment, knowledge of the potential causes of degradation, and appropriate solutions, is required. In addition, previous research has predominantly explored the technological contribution to graceful degradation, frequently neglecting to consider the role of the human operator, specifically, air traffic controllers (ATCOs). This is out of step with real-world operations, and potentially limits an ecologically valid understanding of achieving graceful degradation in an air traffic control (ATC) environment. The following literature review aims to identify and summarize the literature to date on the potential causes of degradation in ATC and the solutions that may be applied within a TBO context, with a specific focus on the contribution of the air traffic controller. A framework of graceful degradation, developed from the literature, is presented. It is argued that in order to achieve graceful degradation within TBO, a human-system integration approach must be applied.

Application of GRACE to the assessment of model-based estimates of monthly Greenland Ice Sheet mass balance (2003-2012)

NASA Astrophysics Data System (ADS)

Schlegel, Nicole-Jeanne; Wiese, David N.; Larour, Eric Y.; Watkins, Michael M.; Box, Jason E.; Fettweis, Xavier; van den Broeke, Michiel R.

2016-09-01

Quantifying the Greenland Ice Sheet's future contribution to sea level rise is a challenging task that requires accurate estimates of ice sheet sensitivity to climate change. Forward ice sheet models are promising tools for estimating future ice sheet behavior, yet confidence is low because evaluation of historical simulations is challenging due to the scarcity of continental-wide data for model evaluation. Recent advancements in processing of Gravity Recovery and Climate Experiment (GRACE) data using Bayesian-constrained mass concentration ("mascon") functions have led to improvements in spatial resolution and noise reduction of monthly global gravity fields. Specifically, the Jet Propulsion Laboratory's JPL RL05M GRACE mascon solution (GRACE_JPL) offers an opportunity for the assessment of model-based estimates of ice sheet mass balance (MB) at ˜ 300 km spatial scales. Here, we quantify the differences between Greenland monthly observed MB (GRACE_JPL) and that estimated by state-of-the-art, high-resolution models, with respect to GRACE_JPL and model uncertainties. To simulate the years 2003-2012, we force the Ice Sheet System Model (ISSM) with anomalies from three different surface mass balance (SMB) products derived from regional climate models. Resulting MB is compared against GRACE_JPL within individual mascons. Overall, we find agreement in the northeast and southwest where MB is assumed to be primarily controlled by SMB. In the interior, we find a discrepancy in trend, which we presume to be related to millennial-scale dynamic thickening not considered by our model. In the northwest, seasonal amplitudes agree, but modeled mass trends are muted relative to GRACE_JPL. Here, discrepancies are likely controlled by temporal variability in ice discharge and other related processes not represented by our model simulations, i.e., hydrological processes and ice-ocean interaction. In the southeast, GRACE_JPL exhibits larger seasonal amplitude than predicted by

G protein signaling in plants: minus times minus equals plus.

PubMed

Stateczny, Dave; Oppenheimer, Jara; Bommert, Peter

2016-12-01

Heterotrimeric G proteins are key regulators in the transduction of extracellular signals both in animals and plants. In plants, heterotrimeric G protein signaling plays essential roles in development and in response to biotic and abiotic stress. However, over the last decade it has become clear that plants have unique mechanisms of G protein signaling. Although plants share most of the core components of heterotrimeric G proteins, some of them exhibit unusual properties compared to their animal counterparts. In addition, plants do not share functional GPCRs. Therefore the well-established paradigm of the animal G protein signaling cycle is not applicable in plants. In this review, we summarize recent insights into these unique mechanisms of G protein signaling in plants with special focus on the evident potential of G protein signaling as a target to modify developmental and physiological parameters important for yield increase. Copyright © 2016 Elsevier Ltd. All rights reserved.

Improvements in GRACE Gravity Field Determination through Stochastic Observation Modeling

NASA Astrophysics Data System (ADS)

McCullough, C.; Bettadpur, S. V.

2016-12-01

Current unconstrained Release 05 GRACE gravity field solutions from the Center for Space Research (CSR RL05) assume random observation errors following an independent multivariate Gaussian distribution. This modeling of observations, a simplifying assumption, fails to account for long period, correlated errors arising from inadequacies in the background force models. Fully modeling the errors inherent in the observation equations, through the use of a full observation covariance (modeling colored noise), enables optimal combination of GPS and inter-satellite range-rate data and obviates the need for estimating kinematic empirical parameters during the solution process. Most importantly, fully modeling the observation errors drastically improves formal error estimates of the spherical harmonic coefficients, potentially enabling improved uncertainty quantification of scientific results derived from GRACE and optimizing combinations of GRACE with independent data sets and a priori constraints.

Emerging themes in heterotrimeric G-protein signaling in plants.

PubMed

Pandey, Sona; Vijayakumar, Anitha

2018-05-01

Heterotrimeric G-proteins are key signaling components involved during the regulation of a multitude of growth and developmental pathways in all eukaryotes. Although the core proteins (Gα, Gβ, Gγ subunits) and their basic biochemistries are conserved between plants and non-plant systems, seemingly different inherent properties of specific components, altered wirings of G-protein network architectures, and the presence of novel receptors and effector proteins make plant G-protein signaling mechanisms somewhat distinct from the well-established animal paradigm. G-protein research in plants is getting a lot of attention recently due to the emerging roles of these proteins in controlling many agronomically important traits. New findings on both canonical and novel G-protein components and their conserved and unique signaling mechanisms are expected to improve our understanding of this important module in affecting critical plant growth and development pathways and eventually their utilization to produce plants for the future needs. In this review, we briefly summarize what is currently known in plant G-protein research, describe new findings and how they are changing our perceptions of the field, and discuss important issues that still need to be addressed. Copyright © 2018 Elsevier B.V. All rights reserved.

The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

PubMed

Frøystein, N A; Sletten, E

1991-03-01

The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

The Generic Resolution Advisor and Conflict Evaluator (GRACE) for Detect-And-Avoid (DAA) Systems

NASA Technical Reports Server (NTRS)

Abramson, Michael; Refai, Mohamad; Santiago, Confesor

2017-01-01

The paper describes the Generic Resolution Advisor and Conflict Evaluator (GRACE), a novel alerting and guidance algorithm that combines flexibility, robustness, and computational efficiency. GRACE is "generic" in that it makes no assumptions regarding temporal or spatial scales, aircraft performance, or its sensor and communication systems. Accordingly, GRACE is well suited to research applications where alerting and guidance is a central feature and requirements are fluid involving a wide range of aviation technologies. GRACE has been used at NASA in a number of real-time and fast-time experiments supporting evolving requirements of DAA research, including parametric studies, NAS-wide simulations, human-in-the-loop experiments, and live flight tests.

Low-degree gravity change from GPS data of COSMIC and GRACE satellite missions

NASA Astrophysics Data System (ADS)

Lin, Tingjung; Hwang, Cheinway; Tseng, Tzu-Pang; Chao, B. F.

2012-01-01

This paper demonstrates estimation of time-varying gravity harmonic coefficients from GPS data of COSMIC and GRACE satellite missions. The kinematic orbits of COSMIC and GRACE are determined to the cm-level accuracy. The NASA Goddard's GEODYN II software is used to model the orbit dynamics of COSMIC and GRACE, including the effect of a static gravity field. The surface forces are estimated per one orbital period. Residual orbits generated from kinematic and reference orbits serve as observables to determine the harmonic coefficients in the weighted-constraint least-squares. The monthly COSMIC and GRACE GPS data from September 2006 to December 2007 (16 months) are processed to estimate harmonic coefficients to degree 5. The geoid variations from the GPS and CSR RL04 (GRACE) solutions show consistent patterns over space and time, especially in regions of active hydrological changes. The monthly GPS-derived second zonal coefficient closely resembles the SLR-derived and CSR RL04 values, and third and fourth zonal coefficients resemble the CSR RL04 values.

Evaluation of new GRACE time-variable gravity data over the ocean

NASA Astrophysics Data System (ADS)

Chambers, Don P.

2006-09-01

Monthly GRACE gravity field models from the three science processing centers (CSR, GFZ, and JPL) are analyzed for the period from February 2003 to April 2005 over the ocean. The data are used to estimate maps of the mass component of sea level at smoothing radii of 500 km and 750 km. In addition to using new gravity field models, a filter has been applied to estimate and remove systematic errors in the coefficients that cause erroneous patterns in the maps of equivalent water level. The filter is described and its effects are discussed. The GRACE maps have been evaluated using a residual analysis with maps of altimeter sea level from Jason-1 corrected for steric variations using the World Ocean Atlas 2001 monthly climatology. The mean uncertainty of GRACE maps determined from an average of data from all 3 processing centers is estimated to be less than 1.8 cm RMS at 750 km smoothing and 2.4 cm at 500 km smoothing, which is better than was found previously using the first generation GRACE gravity fields.

15 Years of GRACE Earth Observations

NASA Image and Video Library

2017-03-15

For 15 years, the GRACE mission has unlocked mysteries of how water moves around our planet. It gave us the first view of underground aquifers from space, and shows how fast polar ice sheets and mountain glaciers are melting.

Hydrogeology and water quality in the Graces Quarters area of Aberdeen Proving Ground, Maryland

USGS Publications Warehouse

Tenbus, Frederick J.; Blomquist, Joel D.

1995-01-01

Graces Quarters was used for open-air testing of chemical-warfare agents from the late 1940's until 1971. Testing and disposal activities have resulted in the contamination of ground water and surface water. The hydrogeology and water quality were examined at three test areas, four disposal sites, a bunker, and a service area on Graces Quarters. Methods of investigation included surface and borehole geophysics, water-quality sampling, water- level measurement, and hydrologic testing. The hydrogeologic framework is complex and consists of a discontinuous surficial aquifer, one or more upper confining units, and a confined aquifer system. Directions of ground-water flow vary spatially and temporally, and results of site investigations show that ground-water flow is controlled by the geology of the area. The ground water and surface water at Graces Quarters generally are unmineralized; the ground water is mildly acidic (median pH is 5.38) and poorly buffered. Inorganic constituents in excess of certain Federal drinking-water regulations and ambient water-quality criteria were detected at some sites, but they probably were present naturally. Volatile and semivolatile organic com- pounds were detected in the ground water and surface water at seven of the nine sites that were investi- gated. Concentrations of organic compounds at two of the nine sites exceeded Federal drinking-water regulations. Volatile compounds in concentrations as high as 6,000 m/L (micrograms per liter) were detected in the ground water at the site known as the primary test area. Concentrations of volatile compounds detected in the other areas ranged from 0.57 to 17 m/L.

Observing plants dealing with soil water stress: Daily soil moisture fluctuations derived from polymer tensiometers

NASA Astrophysics Data System (ADS)

van der Ploeg, Martine; de Rooij, Gerrit

2014-05-01

fluctuations in water content changes, with both root water uptake and root water excretion. The magnitude of the water content change was in the same order for all treatments, thus suggesting compensatory uptake. References Bakker G, Van der Ploeg MJ, de Rooij GH, Hoogendam CW, Gooren HPA, Huiskes C, Koopal LK and Kruidhof H. New polymer tensiometers: Measuring matric pressures down to the wilting point. Vadose Zone J. 6: 196-202, 2007. Blackman PG and Davies WJ. Root to shoot communication in maize plants of the effects of soil drying. J. Exp. Bot. 36: 39-48, 1985. Davies WJ and Zhang J. Root signals and the regulation of growth and development of plants in drying soil. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42: 55-76, 1991. Gollan T, Passioura JB and Munns R. Soil water status affects the stomatal conductance of fully turgid wheat and sunflower leafs. Aust. J. Plant Physiol. 13: 459-464, 1986. Gowing DJG, Davies WJ and Jones HG. A Positive Root-sourced Signal as an Indicator of Soil Drying in Apple, Malus x domestica Borkh. J. Exp. Bot. 41: 1535-1540, 1990. Grace J. Environmental controls of gas exchange in tropical rain forests. In: Press, M.C, J.D. Scholes and M.G. Barker (ed.). Physiological plant ecology: the 39th Symposium of the British Ecological Society. Blackwell Science, United Kingdom, 1999. Kool D, Agam N, Lazarovitch N, Heitman JL, Sauer TJ, Ben-Gal A. A review of approaches for evapotranspiration partitioning. Agricultural and Forest Meteorology 184: 56- 70, 2014. Mansfield TA and De Silva DLR. Sensory systems in the roots of plants and their role in controlling stomatal function in the leaves. Physiol. Chem. Phys. & Med. 26: 89-99, 1994. Sadras VO and Milroy SP. Soil-water thresholds for the responses of leaf expansion and gas exchange: a review. Field Crops Res. 47: 253-266, 1996. Schröder N, Lazarovitch N, Vanderborcht J, Vereecken H, Javaux M. Linking transpiration reduction to rhizosphere salinity using a 3D coupled soil-plant model. Plant Soil 2013

Investigating different filter and rescaling methods on simulated GRACE-like TWS variations for hydrological applications

NASA Astrophysics Data System (ADS)

Zhang, Liangjing; Dahle, Christoph; Neumayer, Karl-Hans; Dobslaw, Henryk; Flechtner, Frank; Thomas, Maik

2016-04-01

Terrestrial water storage (TWS) variations obtained from GRACE play an increasingly important role in various hydrological and hydro-meteorological applications. Since monthly-mean gravity fields are contaminated by errors caused by a number of sources with distinct spatial correlation structures, filtering is needed to remove in particular high frequency noise. Subsequently, bias and leakage caused by the filtering need to be corrected before the final results are interpreted as GRACE-based observations of TWS. Knowledge about the reliability and performance of different post-processing methods is highly important for the GRACE users. In this contribution, we re-assess a number of commonly used post-processing methods using a simulated GRACE-like gravity field time-series based on realistic orbits and instrument error assumptions as well as background error assumptions out of the updated ESA Earth System Model. Two non-isotropic filter methods from Kusche (2007) and Swenson and Wahr (2006) are tested. Rescaling factors estimated from five different hydrological models and the ensemble median are applied to the post-processed simulated GRACE-like TWS estimates to correct the bias and leakage. Since TWS anomalies out of the post-processed simulation results can be readily compared to the time-variable Earth System Model initially used as "truth" during the forward simulation step, we are able to thoroughly check the plausibility of our error estimation assessment and will subsequently recommend a processing strategy that shall also be applied to planned GRACE and GRACE-FO Level-3 products for hydrological applications provided by GFZ. Kusche, J. (2007): Approximate decorrelation and non-isotropic smoothing of time-variable GRACE-type gravity field models. J. Geodesy, 81 (11), 733-749, doi:10.1007/s00190-007-0143-3. Swenson, S. and Wahr, J. (2006): Post-processing removal of correlated errors in GRACE data. Geophysical Research Letters, 33(8):L08402.

Hydrological Excitations of Polar Motion Derived from Different Variables of Fgoals - g2 Climate Model

NASA Astrophysics Data System (ADS)

Winska, M.

2016-12-01

The hydrological contribution to decadal, inter-annual and multi-annual suppress polar motion derived from climate model as well as from GRACE (Gravity Recovery and Climate Experiment) data is discussed here for the period 2002.3-2016.0. The data set used here are Earth Orientation Parameters Combined 04 (EOP C04), Flexible Global Ocean-Atmosphere-Land System Model: Grid-point Version 2 (FGOAL-g2) and Global Land Data Assimilation System (GLDAS) climate models and GRACE CSR RL05 data for polar motion, hydrological and gravimetric excitation, respectively. Several Hydrological Angular Momentum (HAM) functions are calculated here from the selected variables: precipitation, evaporation, runoff, soil moisture, accumulated snow of the FGOALS and GLDAS climate models as well as from the global mass change fields from GRACE data provided by the International Earth Rotation and Reference System Service (IERS) Global Geophysical Fluids Center (GGFC). The contribution of different HAM excitation functions to achieve the full agreement between geodetic observations and geophysical excitation functions of polar motion is studied here.

JPL-20180522-GRACFOf-0001-NASAs GRACE FO Satellite Launches Aboard a SpaceX Falcon 9 Rocket

NASA Image and Video Library

2018-05-22

3-2-1 liftoff of Falcon 9 with GRACE-FO! NASA's Gravity Recovery and Climate Experiment Follow-on, or GRACE-FO, launched from Vandenberg Air Force Base on California's Central Coast on May 22, 2018. The twin orbiters shared a ride to space with five Iridium NEXT communications satellites. GRACE-FO will continue a study begun by the original GRACE mission, which proved that water movement can be tracked with high precision by its effect on Earth's gravitational field. GRACE-FO will continue the record of regional variations in gravity, telling us about changes in glaciers, ground water, sea levels and the health of our planet as a whole. For more, visit https://gracefo.jpl.nasa.gov .

Hydrologic implications of GRACE satellite data in the Colorado River Basin

USGS Publications Warehouse

Scanlon, Bridget R.; Zhang, Zizhan; Reedy, Robert C.; Pool, Donald R.; Save, Himanshu; Long, Di; Chen, Jianli; Wolock, David M.; Conway, Brian D.; Winester, Daniel

2015-01-01

Use of GRACE (Gravity Recovery and Climate Experiment) satellites for assessing global water resources is rapidly expanding. Here we advance application of GRACE satellites by reconstructing long-term total water storage (TWS) changes from ground-based monitoring and modeling data. We applied the approach to the Colorado River Basin which has experienced multiyear intense droughts at decadal intervals. Estimated TWS declined by 94 km3 during 1986–1990 and by 102 km3 during 1998–2004, similar to the TWS depletion recorded by GRACE (47 km3) during 2010–2013. Our analysis indicates that TWS depletion is dominated by reductions in surface reservoir and soil moisture storage in the upper Colorado basin with additional reductions in groundwater storage in the lower basin. Groundwater storage changes are controlled mostly by natural responses to wet and dry cycles and irrigation pumping outside of Colorado River delivery zones based on ground-based water level and gravity data. Water storage changes are controlled primarily by variable water inputs in response to wet and dry cycles rather than increasing water use. Surface reservoir storage buffers supply variability with current reservoir storage representing ∼2.5 years of available water use. This study can be used as a template showing how to extend short-term GRACE TWS records and using all available data on storage components of TWS to interpret GRACE data, especially within the context of droughts.

Dynamics of the Antarctic Circumpolar Current as seen by GRACE (Invited)

NASA Astrophysics Data System (ADS)

Thomas, M.; Dobslaw, H.; Bergmann, I.

2010-12-01

The Antarctic Circumpolar Current, being the strongest and longest ocean current on Earth, connects the three great ocean basins and contributes substantially to the global re-distribution of water masses, with a significant impact on global climate. Observational coverage from in-situ measurements is sparse due to the harsh environmental conditions, and satellite altimetry does not capture the full extent of the current due to seasonal sea-ice coverage. Ocean bottom pressure variations as sensed with the satellite gravity mission GRACE provide a promising way to broaden our observational basis. Besides monthly mean gravity fields that provide ocean bottom pressure variations averaged over 30 days, several alternative GRACE products with higher temporal resolution have been developed during the most recent years. These include 10-day solutions from GRGS Toulouse, weekly solutions from the GFZ Potsdam as well as constrained daily solutions from the University of Bonn which have been obtained by means of a Kalman filtering approach. In this presentation, ocean bottom pressure derived from these alternative GRACE releases will be contrasted against both in-situ observations and output from a numerical ocean model, highlighting the additional information contained in these GRACE solutions with respect to the standard monthly fields. By means of statistical analyses of ocean bottom pressure variations and barotropic transports it will be demonstrated how these new GRACE releases are contributing to our understanding of this highly dynamic great ocean conveyor.

The Current Status and Future Prospects for the GRACE Mission

NASA Astrophysics Data System (ADS)

Tapley, Byron; Flechtner, Frank; Watkins, Michael; Bettadpur, Srinivas; Boening, Carmen

2016-04-01

The twin satellites of the Gravity Recovery and Climate Experiment (GRACE) were launched on March 17, 2002 and have operated for over 13 years. The mission objectives are to sense the spatial and temporal variations of the Earth's mass through its effects on the gravity field at the GRACE satellite altitude. The major cause of the time varying mass is water motion and the GRACE mission has provided a continuous decade long measurement sequences which characterizes the seasonal cycle of mass transport between the oceans, land, cryosphere and atmosphere; its inter-annual variability; and the climate driven secular, or long period, mass transport signals. In 2012, the RLO5 solution, based on a complete reanalysis of the mission data, data release, was initiated. The monthly solutions from this effort were released in mid-2013 with the mean fields following in 2014 and 2015. The mission is entering the final phases of operations. The current mission operations strategy emphasizes extending the mission lifetime to achieve mission overlap with the GRACE Follow On Mission. This presentation will review the mission status and the projections for mission lifetime, summarize plans for the RL 06 data re-analysis, describe the issues that influence the operations philosophy and discuss the impact the operations may have on the scientific data products.

Root-Uptake of C-14 Acetic Acid by Various Plants and C-14 Dynamics Surrounding the Experimental Tessera

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ogiyama, S.; Takeda, H.; Uchida, S.

Carbon-14 (C-14, t{sub 1/2} = 5.73x10{sup 3} yrs) from radioactive waste is one of the most important radioactive nuclides for environmental assessment in the context of geological disposal, and understanding the transfer of radioactive elements to plants is essential for public health safety. In order to obtain fundamental knowledge, culture experiments using marigold (Tagetes patula L.), tall fescue (Festuca arundinacea S.), paddy rice (Oryza sativa L.), radish (Raphanus sativus L.), and carrot (Daucus carota L.) plants were conducted to examine root-uptake and dynamics of C-14 in the laboratory. The C-14 radioactivity in each plant part (e.g. shoot, root, edible part,more » etc.), medium (e.g. culture solution, sand, etc.), and air was determined. The distribution of C-14 in the plants was visualized using autoradiography. For a comparison, autoradiography was also done using Na-22. Results of the present study indicated that C-14 labeled CO{sub 2} gas was released from the culture solution to the atmosphere. Clear autoradiography images were observed in plants for the shoots and lower roots which were soaked in the culture solution. The upper roots which were not soaked in the culture solution were not clearly imaged. In the radiotracer experiment using Na-22, a clear image was observed for the whole carrot seedling, even including the upper root, on the autoradiography. However, the amounts of C-14 acetic acid absorbed by all the plants through their roots were considered to be very small. Inorganic carbon transformed from C-14 acetic acid would be taken up by plants through the roots, and some fraction of C-14 would be assimilated into the shoots by photosynthesis. (authors)« less

Temperature corrected-calibration of GRACE's accelerometer

NASA Astrophysics Data System (ADS)

Encarnacao, J.; Save, H.; Siemes, C.; Doornbos, E.; Tapley, B. D.

2017-12-01

Since April 2011, the thermal control of the accelerometers on board the GRACE satellites has been turned off. The time series of along-track bias clearly show a drastic change in the behaviour of this parameter, while the calibration model has remained unchanged throughout the entire mission lifetime. In an effort to improve the quality of the gravity field models produced at CSR in future mission-long re-processing of GRACE data, we quantify the added value of different calibration strategies. In one approach, the temperature effects that distort the raw accelerometer measurements collected without thermal control are corrected considering the housekeeping temperature readings. In this way, one single calibration strategy can be consistently applied during the whole mission lifetime, since it is valid to thermal the conditions before and after April 2011. Finally, we illustrate that the resulting calibrated accelerations are suitable for neutral thermospheric density studies.

Hypogammaglobulinemia associated with accelerated catabolism of IgG secondary to its interaction with an IgG-reactive monoclonal IgM

PubMed Central

Waldmann, Thomas A.; Johnson, John S.; Talal, Norman

1971-01-01

Hypogammaglobulinemia due to a new pathophysiological mechanism was studied in a patient with Sjögren's syndrome, a monoclonal IgM and a mixed (IgM-IgG) cryoglobulinemia. The IgM (IgMdk) component of the cryogel possessed light chains of λ-type with highly restricted electrophoretic mobility analagous to those of a Waldenström's macroglobulin. IgMdk reacted specifically with native IgG, with IgG subclasses 1, 2, and 4, and with the Fc piece of IgG to form a cryogel. Serum concentrations of IgG 1, 2, and 4 were 10% of normal, whereas the IgG3 level was slightly increased and the IgM level was markedly increased. Viscosity and analytical ultracentrifugation studies with the purified mixed cryogel (IgM-LgG) indicated soluble complex formation over a temperature range (36-38°C) attainable in vivo. Immunoglobulin turnover studies revealed a markedly elevated rate of IgM synthesis with a normal survival of IgM, IgA, and IgE. IgG3, which failed to form complexes with IgMdk at body temperature, had a normal synthetic rate and survival. In contrast, the other IgG subclasses showed reduced synthesis and shortened survival. These studies are the first indicating a short survival of some IgG subclasses with a normal survival of another. The hypogammaglobulinemia appears to be due in part to a new mechanism of accelerated protein catabolism: The rapid elimination of IgG due to its interaction with an IgG-reactive monoclonal IgM. PMID:4993860

Inter-comparison of GRACE data over India

NASA Astrophysics Data System (ADS)

Banerjee, Chandan; Kumar, D. Nagesh

2016-05-01

The advent of satellite remote sensing and its use in hydrology has facilitated a huge leap in the understanding of the various water resources, its interaction with ecological systems and anthropogenic creations. Recently, NASA and German Aerospace Research Agency-DLR launched the Gravity Recovery and Climate Experiment (GRACE) satellite mission consisting of two satellites. They measure the time varying gravity which gives changes in the distribution of mass on the surface of the earth which after removing atmospheric and oceanic effects is majorly caused by changes in Terrestrial Water Storage (TWS) changes. GRACE data is generally available as spherical harmonic coefficients, which is difficult for hydrologists to understand and interpret. JPL's TELLUS website is now providing gridded global data set in the form of mass anomaly derived from the Level-2 data sets of spherical harmonic coefficients of 3 sources, viz. CSR, GFZ and JPL. Before using these data sets for solving hydrological problems, it is important to understand the differences and similarities between these data sets as direct calibration of GRACE data is not possible. In this study we do an inter-comparison of the Level-3 Release 05 data sets over India. We compare the data sets using Pearson, Spearman and Kendall correlation. CSR and GFZ data sets appear to be closest to each other whereas JPL and GFZ data sets are most different from each other.

Using Tikhonov Regularization for Spatial Projections from CSR Regularized Spherical Harmonic GRACE Solutions

NASA Astrophysics Data System (ADS)

Save, H.; Bettadpur, S. V.

2013-12-01

It has been demonstrated before that using Tikhonov regularization produces spherical harmonic solutions from GRACE that have very little residual stripes while capturing all the signal observed by GRACE within the noise level. This paper demonstrates a two-step process and uses Tikhonov regularization to remove the residual stripes in the CSR regularized spherical harmonic coefficients when computing the spatial projections. We discuss methods to produce mass anomaly grids that have no stripe features while satisfying the necessary condition of capturing all observed signal within the GRACE noise level.

2G HTS wires made on 30 μm thick Hastelloy substrate

NASA Astrophysics Data System (ADS)

Sundaram, A.; Zhang, Y.; Knoll, A. R.; Abraimov, D.; Brownsey, P.; Kasahara, M.; Carota, G. M.; Nakasaki, R.; Cameron, J. B.; Schwab, G.; Hope, L. V.; Schmidt, R. M.; Kuraseko, H.; Fukushima, T.; Hazelton, D. W.

2016-10-01

REBCO (RE = rare earth) based high temperature superconducting (HTS) wires are now being utilized for the development of electric and electromagnetic devices for various industrial, scientific and medical applications. In the last several years, the increasing efforts in using the so-called second generation (2G) HTS wires for some of the applications require a further increase in their engineering current density (J e). The applications are those typically related to high magnetic fields where the higher J e of a REBCO wire, in addition to its higher irreversibility fields and higher mechanical strength, is already a major advantage over other superconducting wires. An effective way to increase the J e is to decrease the total thickness of a wire, for which using a thinner substrate becomes an obvious and attractive approach. By using our IBAD-MOCVD (ion beam assisted deposition-metal organic chemical vapor deposition) technology we have successfully made 2G HTS wires using a Hastelloy® C276 substrate that is only 30 μm in thickness. By using this thinner substrate instead of the typical 50 μm thick substrate and with a same critical current (I c), the J e of a wire can be increased by 30% to 45% depending on the copper stabilizer thickness. In this paper, we report the fabrication and characterization of the 2G HTS wires made on the 30 μm thick Hastelloy® C276 substrate. It was shown that with the optimization in the processing protocol, the surface of the thinner Hastelloy® C276 substrate can be readily electropolished to the quality needed for the deposition of the buffer stack. Same in the architecture as that on the standard 50 μm thick substrate, the buffer stack made on the 30 μm thick substrate showed an in-plane texture with a Δϕ of around 6.7° in the LaMnO3 cap layer. Low-temperature in-field transport measurement results suggest that the wires on the thinner substrate had achieved equivalent superconducting performance, most importantly the I

Regularized GRACE monthly solutions by constraining the difference between the longitudinal and latitudinal gravity variations

NASA Astrophysics Data System (ADS)

Chen, Qiujie; Chen, Wu; Shen, Yunzhong; Zhang, Xingfu; Hsu, Houze

2016-04-01

The existing unconstrained Gravity Recovery and Climate Experiment (GRACE) monthly solutions i.e. CSR RL05 from Center for Space Research (CSR), GFZ RL05a from GeoForschungsZentrum (GFZ), JPL RL05 from Jet Propulsion Laboratory (JPL), DMT-1 from Delft Institute of Earth Observation and Space Systems (DEOS), AIUB from Bern University, and Tongji-GRACE01 as well as Tongji-GRACE02 from Tongji University, are dominated by correlated noise (such as north-south stripe errors) in high degree coefficients. To suppress the correlated noise of the unconstrained GRACE solutions, one typical option is to use post-processing filters such as decorrelation filtering and Gaussian smoothing , which are quite effective to reduce the noise and convenient to be implemented. Unlike these post-processing methods, the CNES/GRGS monthly GRACE solutions from Centre National d'Etudes Spatiales (CNES) were developed by using regularization with Kaula rule, whose correlated noise are reduced to such a great extent that no decorrelation filtering is required. Actually, the previous studies demonstrated that the north-south stripes in the GRACE solutions are due to the poor sensitivity of gravity variation in east-west direction. In other words, the longitudinal sampling of GRACE mission is very sparse but the latitudinal sampling of GRACE mission is quite dense, indicating that the recoverability of the longitudinal gravity variation is poor or unstable, leading to the ill-conditioned monthly GRACE solutions. To stabilize the monthly solutions, we constructed the regularization matrices by minimizing the difference between the longitudinal and latitudinal gravity variations and applied them to derive a time series of regularized GRACE monthly solutions named RegTongji RL01 for the period Jan. 2003 to Aug. 2011 in this paper. The signal powers and noise level of RegTongji RL01 were analyzed in this paper, which shows that: (1) No smoothing or decorrelation filtering is required for RegTongji RL

Estimating the rates of mass change, ice volume change and snow volume change in Greenland from ICESat and GRACE data

NASA Astrophysics Data System (ADS)

Slobbe, D. C.; Ditmar, P.; Lindenbergh, R. C.

2009-01-01

The focus of this paper is on the quantification of ongoing mass and volume changes over the Greenland ice sheet. For that purpose, we used elevation changes derived from the Ice, Cloud, and land Elevation Satellite (ICESat) laser altimetry mission and monthly variations of the Earth's gravity field as observed by the Gravity Recovery and Climate Experiment (GRACE) mission. Based on a stand alone processing scheme of ICESat data, the most probable estimate of the mass change rate from 2003 February to 2007 April equals -139 +/- 68 Gtonyr-1. Here, we used a density of 600+/-300 kgm-3 to convert the estimated elevation change rate in the region above 2000m into a mass change rate. For the region below 2000m, we used a density of 900+/-300 kgm-3. Based on GRACE gravity models from half 2002 to half 2007 as processed by CNES, CSR, DEOS and GFZ, the estimated mass change rate for the whole of Greenland ranges between -128 and -218Gtonyr-1. Most GRACE solutions show much stronger mass losses as obtained with ICESat, which might be related to a local undersampling of the mass loss by ICESat and uncertainties in the used snow/ice densities. To solve the problem of uncertainties in the snow and ice densities, two independent joint inversion concepts are proposed to profit from both GRACE and ICESat observations simultaneously. The first concept, developed to reduce the uncertainty of the mass change rate, estimates this rate in combination with an effective snow/ice density. However, it turns out that the uncertainties are not reduced, which is probably caused by the unrealistic assumption that the effective density is constant in space and time. The second concept is designed to convert GRACE and ICESat data into two totally new products: variations of ice volume and variations of snow volume separately. Such an approach is expected to lead to new insights in ongoing mass change processes over the Greenland ice sheet. Our results show for different GRACE solutions a snow

Inferring Large-Scale Terrestrial Water Storage Through GRACE and GPS Data Fusion in Cloud Computing Environments

NASA Astrophysics Data System (ADS)

Rude, C. M.; Li, J. D.; Gowanlock, M.; Herring, T.; Pankratius, V.

2016-12-01

Surface subsidence due to depletion of groundwater can lead to permanent compaction of aquifers and damaged infrastructure. However, studies of such effects on a large scale are challenging and compute intensive because they involve fusing a variety of data sets beyond direct measurements from groundwater wells, such as gravity change measurements from the Gravity Recovery and Climate Experiment (GRACE) or surface displacements measured by GPS receivers. Our work therefore leverages Amazon cloud computing to enable these types of analyses spanning the entire continental US. Changes in groundwater storage are inferred from surface displacements measured by GPS receivers stationed throughout the country. Receivers located on bedrock are anti-correlated with changes in water levels from elastic deformation due to loading, while stations on aquifers correlate with groundwater changes due to poroelastic expansion and compaction. Correlating linearly detrended equivalent water thickness measurements from GRACE with linearly detrended and Kalman filtered vertical displacements of GPS stations located throughout the United States helps compensate for the spatial and temporal limitations of GRACE. Our results show that the majority of GPS stations are negatively correlated with GRACE in a statistically relevant way, as most GPS stations are located on bedrock in order to provide stable reference locations and measure geophysical processes such as tectonic deformations. Additionally, stations located on the Central Valley California aquifer show statistically significant positive correlations. Through the identification of positive and negative correlations, deformation phenomena can be classified as loading or poroelastic expansion due to changes in groundwater. This method facilitates further studies of terrestrial water storage on a global scale. This work is supported by NASA AIST-NNX15AG84G (PI: V. Pankratius) and Amazon.

A Benzothiazole Derivative (5g) Induces DNA Damage And Potent G2/M Arrest In Cancer Cells.

PubMed

Hegde, Mahesh; Vartak, Supriya V; Kavitha, Chandagirikoppal V; Ananda, Hanumappa; Prasanna, Doddakunche S; Gopalakrishnan, Vidya; Choudhary, Bibha; Rangappa, Kanchugarakoppal S; Raghavan, Sathees C

2017-05-31

Chemically synthesized small molecules play important role in anticancer therapy. Several chemical compounds have been reported to damage the DNA, either directly or indirectly slowing down the cancer cell progression by causing a cell cycle arrest. Direct or indirect reactive oxygen species formation causes DNA damage leading to cell cycle arrest and subsequent cell death. Therefore, identification of chemically synthesized compounds with anticancer potential is important. Here we investigate the effect of benzothiazole derivative (5g) for its ability to inhibit cell proliferation in different cancer models. Interestingly, 5g interfered with cell proliferation in both, cell lines and tumor cells leading to significant G2/M arrest. 5g treatment resulted in elevated levels of ROS and subsequently, DNA double-strand breaks (DSBs) explaining observed G2/M arrest. Consistently, we observed deregulation of many cell cycle associated proteins such as CDK1, BCL2 and their phosphorylated form, CyclinB1, CDC25c etc. Besides, 5g treatment led to decreased levels of mitochondrial membrane potential and activation of apoptosis. Interestingly, 5g administration inhibited tumor growth in mice without significant side effects. Thus, our study identifies 5g as a potent biochemical inhibitor to induce G2/M phase arrest of the cell cycle, and demonstrates its anticancer properties both ex vivo and in vivo.

Near real-time GRACE gravity field solutions for hydrological monitoring applications

NASA Astrophysics Data System (ADS)

Kvas, Andreas; Gouweleeuw, Ben; Mayer-Gürr, Torsten; Güntner, Andreas

2016-04-01

Within the EGSIEM (European Gravity Service for Improved Emergency Management) project, a demonstrator for a near real-time (NRT) gravity field service which provides daily GRACE gravity field solutions will be established. Compared to the official GRACE gravity products, these NRT solutions will increase the temporal resolution from one month to one day and reduce the latency from currently two months to five days. This fast availability allows the monitoring of total water storage variations and of hydrological extreme events as they occur, in contrast to a 'confirmation after occurrence' as is the situation today. The service will be jointly run by GFZ (German Research Centre for Geosciences) and Graz University of Technology, with each analysis center providing an independent solution. A Kalman filter framework, in which GRACE data is combined with prior information, serves as basis for the gravity field recovery in order to increase the redundancy of the gravity field estimates. The on-line nature of the NRT service necessitates a tailored smoothing algorithm as opposed to post-processing applications, where forward-backward smoothing can be applied. This contribution gives an overview on the near real-time processing chain and highlights differences between the computed NRT solutions and the standard GRACE products. We discuss the special characteristics of the Kalman filtered gravity field models as well as derived products and give an estimate of the expected error levels. Additionally, we show the added value of the NRT solutions through comparison of the first results of the pre-operational phase with in-situ data and monthly GRACE gravity field models.

CHAMP and GRACE Resonances and the Gravity Field of the Earth

NASA Astrophysics Data System (ADS)

Gooding, R. H.; Wagner, C. A.; Klokocnik, J.; Kostelecky, J.

With the far more precise orbits of CHAMP and GRACE today than was the standard 2-3 decades ago there was and is an unprecedented opportunity for determining precise and valuable values of certain lumped geopotential harmonic coefficients of selected orders independently of comprehensive gravity field models via the recently revived technique that capitalizes on the resonant variation of appropriate orbital elements the inclination in particular Here we first identify important resonances during the lifetime of CHAMP and GRACE in terms of the decaying semimajor axis these being 46 3 77 5 31 2 78 5 and 47 3 for CHAMP and 61 4 for GRACE Then we analyze state vectors for CHAMP and TLE for GRACE A from GFZ and determined the relevant lumped coefficients To increase its lifetime the CHAMP satellite orbit was raised twice in June and December 2002 so CHAMP passed through 31 2 resonance three times More accurate values for these coefficients are obtained than originally and the precision for the 62 4 overtone resonance implicit in 31 2 is striking comparable to that for 31 2 Most recently CHAMP passed throughout the 47 3 resonance yielding the opportunity to determine new lumped coefficients For GRACE we have no state vectors and have to work with the TLE only nevertheless we have lumped coefficients of 61st order from its strong 61 4 resonance In each case the resonant lumped values are compared with those derivable from various global gravity models We thereby confirm the continuing power of the resonance technique

Hydrologic implications of GRACE satellite data in the Colorado River Basin

NASA Astrophysics Data System (ADS)

Scanlon, Bridget R.; Zhang, Zizhan; Reedy, Robert C.; Pool, Donald R.; Save, Himanshu; Long, Di; Chen, Jianli; Wolock, David M.; Conway, Brian D.; Winester, Daniel

2015-12-01

Use of GRACE (Gravity Recovery and Climate Experiment) satellites for assessing global water resources is rapidly expanding. Here we advance application of GRACE satellites by reconstructing long-term total water storage (TWS) changes from ground-based monitoring and modeling data. We applied the approach to the Colorado River Basin which has experienced multiyear intense droughts at decadal intervals. Estimated TWS declined by 94 km3 during 1986-1990 and by 102 km3 during 1998-2004, similar to the TWS depletion recorded by GRACE (47 km3) during 2010-2013. Our analysis indicates that TWS depletion is dominated by reductions in surface reservoir and soil moisture storage in the upper Colorado basin with additional reductions in groundwater storage in the lower basin. Groundwater storage changes are controlled mostly by natural responses to wet and dry cycles and irrigation pumping outside of Colorado River delivery zones based on ground-based water level and gravity data. Water storage changes are controlled primarily by variable water inputs in response to wet and dry cycles rather than increasing water use. Surface reservoir storage buffers supply variability with current reservoir storage representing ˜2.5 years of available water use. This study can be used as a template showing how to extend short-term GRACE TWS records and using all available data on storage components of TWS to interpret GRACE data, especially within the context of droughts. This article was corrected on 12 JAN 2016. See the end of the full text for details.

Radial and tangential gravity rates from GRACE in areas of glacial isostatic adjustment

NASA Astrophysics Data System (ADS)

van der Wal, Wouter; Kurtenbach, Enrico; Kusche, Jürgen; Vermeersen, Bert

2011-11-01

In areas dominated by Glacial Isostatic Adjustment (GIA), the free-air gravity anomaly rate can be converted to uplift rate to good approximation by using a simple spectral relation. We provide quantitative comparisons between gravity rates derived from monthly gravity field solutions (GFZ Potsdam, CSR Texas, IGG Bonn) from the Gravity Recovery and Climate Experiment (GRACE) satellite mission with uplift rates measured by GPS in these areas. The band-limited gravity data from the GRACE satellite mission can be brought to very good agreement with the point data from GPS by using scaling factors derived from a GIA model (the root-mean-square of differences is 0.55 mm yr-1 for a maximum uplift rate signal of 10 mm yr-1). The root-mean-square of the differences between GRACE derived uplift rates and GPS derived uplift rates decreases with increasing GRACE time period to a level below the uncertainty that is expected from GRACE observations, GPS measurements and the conversion from gravity rate to uplift rate. With the current length of time-series (more than 8 yr) applying filters and a hydrology correction to the GRACE data does not reduce the root-mean-square of differences significantly. The smallest root-mean-square was obtained with the GFZ solution in Fennoscandia and with the CSR solution in North America. With radial gravity rates in excellent agreement with GPS uplift rates, more information on the GIA process can be extracted from GRACE gravity field solutions in the form of tangential gravity rates, which are equivalent to a rate of change in the deflection of the vertical scaled by the magnitude of gravity rate vector. Tangential gravity rates derived from GRACE point towards the centre of the previously glaciated area, and are largest in a location close to the centre of the former ice sheet. Forward modelling showed that present day tangential gravity rates have maximum sensitivity between the centre and edge of the former ice sheet, while radial gravity

Preliminary Results from Powell Research Group on Integrating GRACE Satellite and Ground-based Estimates of Groundwater Storage Changes

NASA Astrophysics Data System (ADS)

Scanlon, B. R.; Zhang, Z.; Reitz, M.; Rodell, M.; Sanford, W. E.; Save, H.; Wiese, D. N.; Croteau, M. J.; McGuire, V. L.; Pool, D. R.; Faunt, C. C.; Zell, W.

2017-12-01

Groundwater storage depletion is a critical issue for many of the major aquifers in the U.S., particularly during intense droughts. GRACE (Gravity Recovery and Climate Experiment) satellite-based estimates of groundwater storage changes have attracted considerable media attention in the U.S. and globally and interest in GRACE products continues to increase. For this reason, a Powell Research Group was formed to: (1) Assess variations in groundwater storage using a variety of GRACE products and other storage components (snow, surface water, and soil moisture) for major aquifers in the U.S., (2) Quantify long-term trends in groundwater storage from ground-based monitoring and regional and national modeling, and (3) Use ground-based monitoring and modeling to interpret GRACE water storage changes within the context of extreme droughts and over-exploitation of groundwater. The group now has preliminary estimates from long-term trends and seasonal fluctuations in water storage using different GRACE solutions, including CSR, JPL and GSFC. Approaches to quantifying uncertainties in GRACE data are included. This work also shows how GRACE sees groundwater depletion in unconfined versus confined aquifers, and plans for future work will link GRACE data to regional groundwater models. The wealth of ground-based observations for the U.S. provides a unique opportunity to assess the reliability of GRACE-based estimates of groundwater storage changes.

Low-power G m-C filter employing current-reuse differential difference amplifiers

DOE PAGES

Mincey, John S.; Briseno-Vidrios, Carlos; Silva-Martinez, Jose; ...

2016-08-10

This study deals with the design of low-power, high performance, continuous-time filters. The proposed OTA architecture employs current-reuse differential difference amplifiers in order to produce more power efficient Gm-C filter solutions. To demonstrate this, a 6th order low-pass Butterworth filter was designed in 0.18 m CMOS achieving a 65-MHz -3-dB frequency, an in-band input-referred third-order intercept point of 12.0 dBm, and an input referred noise density of 40 nV/Hz1=2, while only consuming 8.07 mW from a 1.8 V supply and occupying a total chip area of 0.21 mm2 with a power consumption of only 1.19 mW per pole.

Low-power G m-C filter employing current-reuse differential difference amplifiers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mincey, John S.; Briseno-Vidrios, Carlos; Silva-Martinez, Jose

This study deals with the design of low-power, high performance, continuous-time filters. The proposed OTA architecture employs current-reuse differential difference amplifiers in order to produce more power efficient Gm-C filter solutions. To demonstrate this, a 6th order low-pass Butterworth filter was designed in 0.18 m CMOS achieving a 65-MHz -3-dB frequency, an in-band input-referred third-order intercept point of 12.0 dBm, and an input referred noise density of 40 nV/Hz1=2, while only consuming 8.07 mW from a 1.8 V supply and occupying a total chip area of 0.21 mm2 with a power consumption of only 1.19 mW per pole.

Integrating Data from GRACE and Other Observing Systems for Hydrological Research and Applications

NASA Technical Reports Server (NTRS)

Rodell, M.; Famiglietti, J. S.; McWilliams, E.; Beaudoing, H. K.; Li, B.; Zaitchik, B.; Reichle, R.; Bolten, J.

2011-01-01

The Gravity Recovery and Climate Experiment (GRACE) mission provides a unique view of water cycle dynamics, enabling the only space based observations of water on and beneath the land surface that are not limited by depth. GRACE data are immediately useful for large scale applications such as ice sheet ablation monitoring, but they are even more valuable when combined with other types of observations, either directly or within a data assimilation system. Here we describe recent results of hydrological research and applications projects enabled by GRACE. These include the following: 1) global monitoring of interannual variability of terrestrial water storage and groundwater; 2) water balance estimates of evapotranspiration over several large river basins; 3) NASA's Energy and Water Cycle Study (NEWS) state of the global water budget project; 4) drought indicator products now being incorporated into the U.S. Drought Monitor; 5) GRACE data assimilation over several regions.

42 CFR 136a.33 - Grace period.

Code of Federal Regulations, 2010 CFR

2010-10-01

... explanation of their appeal rights as provided in § 36a.14 of the part. These patients shall be offered... ending September 16, 1988. During this grace period such individual's eligibility will continue to be...

42 CFR 136a.33 - Grace period.

Code of Federal Regulations, 2014 CFR

2014-10-01

... explanation of their appeal rights as provided in § 36a.14 of the part. These patients shall be offered... ending September 16, 1988. During this grace period such individual's eligibility will continue to be...

42 CFR 136a.33 - Grace period.

Code of Federal Regulations, 2013 CFR

2013-10-01

... explanation of their appeal rights as provided in § 36a.14 of the part. These patients shall be offered... ending September 16, 1988. During this grace period such individual's eligibility will continue to be...

42 CFR 136a.33 - Grace period.

Code of Federal Regulations, 2011 CFR

2011-10-01

... explanation of their appeal rights as provided in § 36a.14 of the part. These patients shall be offered... ending September 16, 1988. During this grace period such individual's eligibility will continue to be...

42 CFR 136a.33 - Grace period.

Code of Federal Regulations, 2012 CFR

2012-10-01

... explanation of their appeal rights as provided in § 36a.14 of the part. These patients shall be offered... ending September 16, 1988. During this grace period such individual's eligibility will continue to be...

Detection of human-induced evapotranspiration using GRACE satellite observations in the Haihe River Basin of China

NASA Astrophysics Data System (ADS)

Pan, Yun; Zhang, Chong; Gong, Huili; Yeh, Pat J.-F.; Shen, Yanjun; Guo, Ying; Huang, Zhiyong; Li, Xiaojuan

2017-04-01

Regional evapotranspiration (ET) can be enhanced by human activities such as irrigation or reservoir impoundment. Here the potential of using Gravity Recovery and Climate Experiment (GRACE) terrestrial water storage data in water budget calculations to detect human-induced ET change is investigated over the Haihe River basin of China. Comparison between GRACE-based monthly ET estimate (2005-2012) and Global Land Data Assimilation System (GLDAS)-modeled ET indicates that human-induced ET due to intensive groundwater irrigation from March to May can only be detected by GRACE. GRACE-based ET (521.7±21.1 mm/yr), considerably higher than GLDAS ET (461.7±29.8 mm/yr), agrees well with existing estimates found in the literature and indicates that human activities contribute to a 12% increase in ET. The double-peak seasonal pattern of ET (in May and August) as reported in published studies is well reproduced by GRACE-based ET estimate. This study highlights the unique capability of GRACE in detecting anthropogenic signals over regions with large groundwater consumption.

Detection of human-induced evapotranspiration using GRACE satellite observations in the Haihe River basin of China

NASA Astrophysics Data System (ADS)

Pan, Yun; Zhang, Chong; Gong, Huili; Yeh, Pat J.-F.; Shen, Yanjun; Guo, Ying; Huang, Zhiyong; Li, Xiaojuan

2017-01-01

Regional evapotranspiration (ET) can be enhanced by human activities such as irrigation or reservoir impoundment. Here the potential of using Gravity Recovery and Climate Experiment (GRACE) terrestrial water storage data in water budget calculations to detect human-induced ET change is investigated over the Haihe River basin of China. Comparison between GRACE-based monthly ET estimate (2005-2012) and Global Land Data Assimilation System (GLDAS)-modeled ET indicates that human-induced ET due to intensive groundwater irrigation from March to May can only be detected by GRACE. GRACE-based ET (521.7 ± 21.1 mm/yr), considerably higher than GLDAS ET (461.7 ± 29.8 mm/yr), agrees well with existing estimates found in the literature and indicates that human activities contribute to a 12% increase in ET. The double-peak seasonal pattern of ET (in May and August) as reported in published studies is well reproduced by GRACE-based ET estimate. This study highlights the unique capability of GRACE in detecting anthropogenic signals over regions with large groundwater consumption.

Greenland Ice Sheet seasonal and spatial mass variability from model simulations and GRACE (2003-2012)

NASA Astrophysics Data System (ADS)

Alexander, Patrick M.; Tedesco, Marco; Schlegel, Nicole-Jeanne; Luthcke, Scott B.; Fettweis, Xavier; Larour, Eric

2016-06-01

Improving the ability of regional climate models (RCMs) and ice sheet models (ISMs) to simulate spatiotemporal variations in the mass of the Greenland Ice Sheet (GrIS) is crucial for prediction of future sea level rise. While several studies have examined recent trends in GrIS mass loss, studies focusing on mass variations at sub-annual and sub-basin-wide scales are still lacking. At these scales, processes responsible for mass change are less well understood and modeled, and could potentially play an important role in future GrIS mass change. Here, we examine spatiotemporal variations in mass over the GrIS derived from the Gravity Recovery and Climate Experiment (GRACE) satellites for the January 2003-December 2012 period using a "mascon" approach, with a nominal spatial resolution of 100 km, and a temporal resolution of 10 days. We compare GRACE-estimated mass variations against those simulated by the Modèle Atmosphérique Régionale (MAR) RCM and the Ice Sheet System Model (ISSM). In order to properly compare spatial and temporal variations in GrIS mass from GRACE with model outputs, we find it necessary to spatially and temporally filter model results to reproduce leakage of mass inherent in the GRACE solution. Both modeled and satellite-derived results point to a decline (of -178.9 ± 4.4 and -239.4 ± 7.7 Gt yr-1 respectively) in GrIS mass over the period examined, but the models appear to underestimate the rate of mass loss, especially in areas below 2000 m in elevation, where the majority of recent GrIS mass loss is occurring. On an ice-sheet-wide scale, the timing of the modeled seasonal cycle of cumulative mass (driven by summer mass loss) agrees with the GRACE-derived seasonal cycle, within limits of uncertainty from the GRACE solution. However, on sub-ice-sheet-wide scales, some areas exhibit significant differences in the timing of peaks in the annual cycle of mass change. At these scales, model biases, or processes not accounted for by models related

Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors

PubMed Central

Giritch, Anatoli; Marillonnet, Sylvestre; Engler, Carola; van Eldik, Gerben; Botterman, Johan; Klimyuk, Victor; Gleba, Yuri

2006-01-01

Plant viral vectors allow expression of heterologous proteins at high yields, but so far, they have been unable to express heterooligomeric proteins efficiently. We describe here a rapid and indefinitely scalable process for high-level expression of functional full-size mAbs of the IgG class in plants. The process relies on synchronous coinfection and coreplication of two viral vectors, each expressing a separate antibody chain. The two vectors are derived from two different plant viruses that were found to be noncompeting. Unlike vectors derived from the same virus, noncompeting vectors effectively coexpress the heavy and light chains in the same cell throughout the plant body, resulting in yields of up to 0.5 g of assembled mAbs per kg of fresh-leaf biomass. This technology allows production of gram quantities of mAbs for research purposes in just several days, and the same protocol can be used on an industrial scale in situations requiring rapid response, such as pandemic or terrorism events. PMID:16973752

Protection Against Lipopolysaccharide-Induced Immunosuppression by IgG and IgM.

PubMed

Kyvelidou, Christiana; Sotiriou, Dimitris; Zerva, Ioanna; Athanassakis, Irene

2018-04-01

Lipopolysaccharide (LPS) is commonly used in murine sepsis models, which are largely associated with immunosuppression and collapse of the immune system. After adapting the LPS treatment to the needs of locally bred BALB/c mice, the present study explored the potential role of IgG and IgM in reversing LPS endotoxemia. The established protocol consisted of five daily intraperitoneal injections of 0.2 μg/g LPS, which was tolerable by half of the manipulated animals. Such a protocol allowed longer survival, necessary in the prospect of therapeutic treatment application. This treatment significantly decreased CD4+, CD8+, CD3z+, and CD19+ cells, while increasing myeloid-derived suppressor cells (MDSCs; CD11b+Gr1+), CD25+ and Foxp3+ cells. These results were accompanied by increased arginase-1 activity in spleen cell lysates and production of IL-6, TNF-α, IL-18, and C-reactive protein (CRP) in the serum. The applied LPS protocol did not alter serum procalcitonin levels. MDSCs isolated from the spleen of LPS-treated animals (LPS-MDSCs) decreased proliferation of naive T cells in coculture experiments. The application of IgG and IgM to the naive T cell/LPS-MDSCs cocultures significantly decreased CD25+, Foxp3+, and CD3z+ cells, indicating an anti-suppressive effect of immunoglobulins. The in vivo application of IgG and IgM significantly decreased the percent of CD11b+Gr1+, CD25+, Foxp3+ cells, and arginase-1 activity in the spleen of LPS-treated animals, while decreasing IL-6, TNF-α, and CRP levels in the serum, allowing survival to all animals tested. In conclusion, these results reveal a novel mode of action of IgG/IgM in LPS endotoxemia, strengthening thus the use of immunoglobulin treatment is septic patients.

The Generic Resolution Advisor and Conflict Evaluator (GRACE) for Detect-And-Avoid Systems

NASA Technical Reports Server (NTRS)

Abramson, Michael; Refai, Mohamad; Santiago, Confesor

2017-01-01

Java Architecture for Detect-And-Avoid (DAA) Extensibility and Modeling (JADEM) was developed at NASA Ames Research Center as a research and modeling tool for Unmanned Aircraft Systems (UAS) Integration in the National Airspace System (NAS). UAS will be required to have DAA systems in order to fulfill the regulatory requirement to remain well clear'' of other traffic. JADEM supports research on technological requirements and Minimum Operational Performance Standards (MOPS) for UAS DAA systems by providing a flexible and extensible software platform that includes models and algorithms for all major DAA functions. This paper describes one of these algorithms, the Generic Resolution Advisor and Conflict Evaluator (GRACE). GRACE supports two core DAA functions: threat evaluation and guidance. GRACE is generic in the sense that it is designed to work with any aircraft or sensor type (both cooperative and non-cooperative), and to be used in various applications and DAA guidance concepts, thus supporting evolving MOPS requirements and research. GRACE combines flexibility, robustness, and computational efficiency. It has modest memory requirements and can handle multiple cooperative and noncooperative intruders. GRACE has been used as a core JADEM component in several real-time and fast-time experiments, including human-in-the-loop simulations and live flight tests.

GRACE, time-varying gravity, Earth system dynamics and climate change

NASA Astrophysics Data System (ADS)

Wouters, B.; Bonin, J. A.; Chambers, D. P.; Riva, R. E. M.; Sasgen, I.; Wahr, J.

2014-11-01

Continuous observations of temporal variations in the Earth's gravity field have recently become available at an unprecedented resolution of a few hundreds of kilometers. The gravity field is a product of the Earth's mass distribution, and these data—provided by the satellites of the Gravity Recovery And Climate Experiment (GRACE)—can be used to study the exchange of mass both within the Earth and at its surface. Since the launch of the mission in 2002, GRACE data has evolved from being an experimental measurement needing validation from ground truth, to a respected tool for Earth scientists representing a fixed bound on the total change and is now an important tool to help unravel the complex dynamics of the Earth system and climate change. In this review, we present the mission concept and its theoretical background, discuss the data and give an overview of the major advances GRACE has provided in Earth science, with a focus on hydrology, solid Earth sciences, glaciology and oceanography.

GRACE, time-varying gravity, Earth system dynamics and climate change.

PubMed

Wouters, B; Bonin, J A; Chambers, D P; Riva, R E M; Sasgen, I; Wahr, J

2014-11-01

Continuous observations of temporal variations in the Earth's gravity field have recently become available at an unprecedented resolution of a few hundreds of kilometers. The gravity field is a product of the Earth's mass distribution, and these data-provided by the satellites of the Gravity Recovery And Climate Experiment (GRACE)-can be used to study the exchange of mass both within the Earth and at its surface. Since the launch of the mission in 2002, GRACE data has evolved from being an experimental measurement needing validation from ground truth, to a respected tool for Earth scientists representing a fixed bound on the total change and is now an important tool to help unravel the complex dynamics of the Earth system and climate change. In this review, we present the mission concept and its theoretical background, discuss the data and give an overview of the major advances GRACE has provided in Earth science, with a focus on hydrology, solid Earth sciences, glaciology and oceanography.

Plant growth and fertility requires functional interactions between specific PABP and eIF4G gene family members

PubMed Central

2018-01-01

The initiation of protein synthesis requires the involvement of the eukaryotic translation initiation factor (eIF) 4G to promote assembly of the factors needed to recruit a 40S ribosomal subunit to an mRNA. Although many eukaryotes express two eIF4G isoforms that are highly similar, those in plants, referred to as eIF4G and eIFiso4G, are highly divergent in size, sequence, and domain organization. Species of the Brassicaceae and the Cleomaceae also express a divergent eIFiso4G isoform, referred to as eIFiso4G2, not found elsewhere in the plant kingdom. Despite their divergence, eIF4G and eIFiso4G interact with eIF4A, eIF4B, and eIF4E isoforms needed for binding an mRNA. eIF4G and eIFiso4G also interact with the poly(A)-binding protein (PABP) which promotes ribosome recruitment to an mRNA. Increasing the complexity of such an interaction, however, Arabidopsis also expresses three PABP isoforms (PAB2, PAB4, and PAB8) in vegetative and reproductive tissues. In this study, the functional interactions among the eIF4G and the widely-expressed PABP isoforms were examined. Loss of PAB2 or PAB8 in combination with loss of eIF4G or eIFiso4G had little to no effect on growth or fertility whereas pab2 pab8 eif4g or pab2 pab8 eifiso4g1/2 mutants exhibited smaller stature and reduced fertility. Although the pab4 eifiso4g1 mutant grows normally and is fertile, pab4 eif4g or pab4 eifiso4g2 mutants could not be isolated. Even pab4/PAB4 eif4g/eIF4G heterozygous plants exhibited growth defects and low fertility. Mutant co-inheritance analysis in reciprocal crosses with wild-type plants revealed that most ovaries and pollen from pab4/PAB4 eif4g/eIF4G plants were PAB4 eif4g. Similarly, co-inheritance studies with pab4/PAB4 eifiso4g2/eIFiso4G2 plants suggested most ovaries were PAB4 eifiso4g2. These results suggest that a functional interaction between PAB4 and eIF4G and between PAB4 and eIFiso4G2 is required for growth and normal fertility. PMID:29381712

An improved GRACE monthly gravity field solution by modeling the non-conservative acceleration and attitude observation errors

NASA Astrophysics Data System (ADS)

Chen, Qiujie; Shen, Yunzhong; Chen, Wu; Zhang, Xingfu; Hsu, Houze

2016-06-01

The main contribution of this study is to improve the GRACE gravity field solution by taking errors of non-conservative acceleration and attitude observations into account. Unlike previous studies, the errors of the attitude and non-conservative acceleration data, and gravity field parameters, as well as accelerometer biases are estimated by means of weighted least squares adjustment. Then we compute a new time series of monthly gravity field models complete to degree and order 60 covering the period Jan. 2003 to Dec. 2012 from the twin GRACE satellites' data. The derived GRACE solution (called Tongji-GRACE02) is compared in terms of geoid degree variances and temporal mass changes with the other GRACE solutions, namely CSR RL05, GFZ RL05a, and JPL RL05. The results show that (1) the global mass signals of Tongji-GRACE02 are generally consistent with those of CSR RL05, GFZ RL05a, and JPL RL05; (2) compared to CSR RL05, the noise of Tongji-GRACE02 is reduced by about 21 % over ocean when only using 300 km Gaussian smoothing, and 60 % or more over deserts (Australia, Kalahari, Karakum and Thar) without using Gaussian smoothing and decorrelation filtering; and (3) for all examples, the noise reductions are more significant than signal reductions, no matter whether smoothing and filtering are applied or not. The comparison with GLDAS data supports that the signals of Tongji-GRACE02 over St. Lawrence River basin are close to those from CSR RL05, GFZ RL05a and JPL RL05, while the GLDAS result shows the best agreement with the Tongji-GRACE02 result.

Increased belowground C release during initial plant development of Populus deltoides x nigra grown under light and C reserve limited conditions

NASA Astrophysics Data System (ADS)

Studer, Mirjam S.; Siegwolf, Rolf T. W.; Schmidt, Michael W. I.; Abiven, Samuel

2014-05-01

Plants might be a key factor for the long-term stabilisation of carbon (C) in the soil, e.g. through enhanced physical protection of root-derived C against microbial decomposition in soil aggregates. On the other hand C released by the plants into the soil might promote the decomposition of native soil organic matter (SOM) through the stimulation of microbial activity. We measured the C budget of developing plant-soil systems (Populus deltoides x nigra, Cambisol soil) in the laboratory under controlled environmental conditions. In order to distinguish plant-derived from native C in the SOM and the soil CO2 efflux, we labelled the poplar shoots continuously with 13C-CO2 from first emergence of leaves (sprouting from stem cuttings). Throughout the experiment the CO2 fluxes (photosynthetic assimilation, dark respiratory loss, soil CO2 efflux) were measured frequently (every 30 min) and the 13C was traced in the soil CO2 efflux (1-2 times a week). After 10 weeks the plant-soil systems were destructively harvested and the distribution of the 13C distribution was analysed. The plants developed slowly (compared to previous experiments), most likely due to limitation in C reserves (long term cutting storage) and C supply (low light intensities). The amount of 13C recovered in the roots, microbial biomass and soil CO2 efflux was directly correlated with the leaf area of the different plant individuals. After 3-4 weeks of plant development we observed a high peak in the total soil CO2 efflux. During this time the relative belowground C release was increased massively over the basal rate of 17 % of net C assimilated, whereby the variability between the plant individuals was large. The smallest plants, i.e. the plants that were most resource limited, obtained the highest belowground C release accounting at the peak time for up to 57 % of net assimilated C. We hypothesize that the plants released specific compounds, which either directly (enzymatically) or indirectly (priming

ITSG-Grace2016 data preprocessing methodologies revisited: impact of using Level-1A data products

NASA Astrophysics Data System (ADS)

Klinger, Beate; Mayer-Gürr, Torsten

2017-04-01

For the ITSG-Grace2016 release, the gravity field recovery is based on the use of official GRACE (Gravity Recovery and Climate Experiment) Level-1B data products, generated by the Jet Propulsion Laboratory (JPL). Before gravity field recovery, the Level-1B instrument data are preprocessed. This data preprocessing step includes the combination of Level-1B star camera (SCA1B) and angular acceleration (ACC1B) data for an improved attitude determination (sensor fusion), instrument data screening and ACC1B data calibration. Based on a Level-1A test dataset, provided for individual month throughout the GRACE period by the Center of Space Research at the University of Texas at Austin (UTCSR), the impact of using Level-1A instead of Level-1B data products within the ITSG-Grace2016 processing chain is analyzed. We discuss (1) the attitude determination through an optimal combination of SCA1A and ACC1A data using our sensor fusion approach, (2) the impact of the new attitude product on temporal gravity field solutions, and (3) possible benefits of using Level-1A data for instrument data screening and calibration. As the GRACE mission is currently reaching its end-of-life, the presented work aims not only at a better understanding of GRACE science data to reduce the impact of possible error sources on the gravity field recovery, but it also aims at preparing Level-1A data handling capabilities for the GRACE Follow-On mission.

Evaluation of 14 global GIA forward models using a novel GPS dataset and GRACE

NASA Astrophysics Data System (ADS)

Bamber, J. L.; Schumacher, M.; Sha, Z.; Rougier, J.; King, M. A.; Khan, S. A.; Shum, C. K.; Luthcke, S. B.

2017-12-01

Observed mass movement from GRACE and vertical land motion from a global network of permanent GPS stations are used in a data driven approach to estimate GIA signals without introducing any assumptions about Earth structure nor ice loading history. Satellite data and in-situ observations are combined using a multivariate spatiotemporal model within a Bayesian Hierarchical Modelling (BHM) framework. In this study, the GPS data set of the Nevada Geodetic Laboratory (NGL) is used as the starting point for providing an observational estimate of global GIA uplift rates. A novel fully automatic post-processing strategy is developed to correct for non-GIA artifacts, including: (i) outlier detection (e.g. due to icing of Choke Ring Antennas or the antenna being buried in snow); (ii) automatic removal of reported and unreported jumps due to geophysical and hardware issues (a refinement of the jump database provided by NGL); and (iii) filtering for GPS stations that observe primarily the GIA signal rather than unwanted local effects (e.g., unmodelled loading effects from land hydrology, atmosphere, or tides). In order to accurately account for the elastic response of the Earth's crust over Antarctica and Greenland, uplift rates in these regions were corrected for the contemporary ice mass loading impact on elastic deformation using high-resolution ice mass balance time series. The novel global GPS data set shows a clean GIA signal at all post-processed stations and is therefore suitable to investigate the behavior of global GIA forward models. In addition, NASA's GSFC GRACE global mascon solutions are employed. The equal area 1x1 degree gridded mascons are spatially aggregated for larger regions to account for their spatial error correlations. Both the GPS and GRACE datasets are combined with prior information about spatial wavelengths of GIA signals obtained from the ICE-6G model within the BHM framework to solve for GIA. The results are compared with 14 global GIA forward

Partitioning GRACE ice loss for the Juneau Icefield using modeling, airborne and ground observations

NASA Astrophysics Data System (ADS)

Young, J. C.; Arendt, A. A.; Pettit, E. C.

2017-12-01

Glaciers of Alaska and Northwestern Canada are losing mass at one of the highest rates of any mountain glacier system globally. High-precision measurements from NASA's Gravity Recovery and Climate Experiment (GRACE) satellites have revealed changes in the local gravitational field along the Gulf of Alaska due to changes in these ice masses since 2003. In previous studies on Alaska glaciers, mass change estimates derived from GRACE compare well to time series' of Gulf of Alaska runoff from mass balance modeling. However, these studies did not adequately partition glacier and terrestrial snow pack mass change signals due to limited modeling capabilities and lack of sufficient ground observations. Our study focuses on the Juneau Icefield, one of the best-monitored areas in Alaska in terms of glacier mass balance, as a case study for partitioning GRACE glacier mass changes from terrestrial water storage changes both seasonally and in long-term trends. We leverage the modeling tool SnowModel to generate a time series of mass changes using assimilated field observations and airborne laser altimetry, and we compare to an iterated mass concentration GRACE solution from the NASA Goddard Space Flight Center Geodesy Laboratory ( 30-day intervals and 12,390 km2 resolution). The GRACE solution forward-models all mass signals other than those due to terrestrial water storage and the cryosphere, therefore requiring additional analysis to partition glacier mass balance and water storage signals. Our approach is one of the first to analyze GRACE at the sub-mountain range scale, and to examine terrestrial water storage trends at a smaller scale than the full Gulf of Alaska. Ultimately, this study points to refinements in the forward-modeling of terrestrial water storage in the GRACE processing chain, and provides best estimates for the timing and magnitude of subannual and long-term changes of the Juneau Icefield from 2003 to present.

C4GEM, a Genome-Scale Metabolic Model to Study C4 Plant Metabolism1[W][OA

PubMed Central

de Oliveira Dal’Molin, Cristiana Gomes; Quek, Lake-Ee; Palfreyman, Robin William; Brumbley, Stevens Michael; Nielsen, Lars Keld

2010-01-01

Leaves of C4 grasses (such as maize [Zea mays], sugarcane [Saccharum officinarum], and sorghum [Sorghum bicolor]) form a classical Kranz leaf anatomy. Unlike C3 plants, where photosynthetic CO2 fixation proceeds in the mesophyll (M), the fixation process in C4 plants is distributed between two cell types, the M cell and the bundle sheath (BS) cell. Here, we develop a C4 genome-scale model (C4GEM) for the investigation of flux distribution in M and BS cells during C4 photosynthesis. C4GEM, to our knowledge, is the first large-scale metabolic model that encapsulates metabolic interactions between two different cell types. C4GEM is based on the Arabidopsis (Arabidopsis thaliana) model (AraGEM) but has been extended by adding reactions and transporters responsible to represent three different C4 subtypes (NADP-ME [for malic enzyme], NAD-ME, and phosphoenolpyruvate carboxykinase). C4GEM has been validated for its ability to synthesize 47 biomass components and consists of 1,588 unique reactions, 1,755 metabolites, 83 interorganelle transporters, and 29 external transporters (including transport through plasmodesmata). Reactions in the common C4 model have been associated with well-annotated C4 species (NADP-ME subtypes): 3,557 genes in sorghum, 11,623 genes in maize, and 3,881 genes in sugarcane. The number of essential reactions not assigned to genes is 131, 135, and 156 in sorghum, maize, and sugarcane, respectively. Flux balance analysis was used to assess the metabolic activity in M and BS cells during C4 photosynthesis. Our simulations were consistent with chloroplast proteomic studies, and C4GEM predicted the classical C4 photosynthesis pathway and its major effect in organelle function in M and BS. The model also highlights differences in metabolic activities around photosystem I and photosystem II for three different C4 subtypes. Effects of CO2 leakage were also explored. C4GEM is a viable framework for in silico analysis of cell cooperation between M and BS

29 CFR 779.418 - Grace period for computing portion of compensation representing commissions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Grace period for computing portion of compensation... § 779.418 Grace period for computing portion of compensation representing commissions. Where it is not practicably possible for the employer to compute the commission earnings of the employee for all workweeks...

In search of laterally heterogeneous viscosity models of Glacial Isostatic Adjustment with the ICE-6G_C global ice history model

NASA Astrophysics Data System (ADS)

Li, Tanghua; Wu, Patrick; Steffen, Holger; Wang, Hansheng

2018-05-01

Most models of Glacial Isostatic Adjustment (GIA) assume that the Earth is laterally homogeneous. However, seismic and geological observations clearly show that the Earth's mantle is laterally heterogeneous. Previous studies of GIA with lateral heterogeneity mostly focused on its effect or sensitivity on GIA predictions, and it is not clear to what extent can lateral heterogeneity solve the misfits between GIA predictions and observations. Our aim is to search for the best 3D viscosity models that can simultaneously fit the global relative sea-level (RSL) data, the peak uplift rates (u-dot from GNSS) and peak gravity-rate-of-change (g-dot from the GRACE satellite mission) in Laurentia and Fennoscandia. However, the search is dependent on the ice and viscosity model inputs - the latter depends on the background viscosity and the seismic tomography models used. In this paper, the ICE-6G_C ice model, with Bunge & Grand's seismic tomography model and background viscosity models close to VM5 will be assumed. A Coupled Laplace-Finite Element Method is used to compute gravitationally self-consistent sea level change with time dependent coastlines and rotational feedback in addition to changes in deformation, gravity and the state of stress. Several laterally heterogeneous models are found to fit the global sea level data better than laterally homogeneous models. Two of these laterally heterogeneous models also fit the ICE-6G_C peak g-dot and u-dot rates observed in Laurentia simultaneously. However, even with the introduction of lateral heterogeneity, no model that is able to fit the present-day g-dot and uplift rate data in Fennoscandia has been found. Therefore, either the ice history of ICE-6G_C in Fennoscandia and Barent Sea needs some modifications, or the sub-lithospheric property/non-thermal effect underneath northern Europe must be different from that underneath Laurentia.

Assessment of terrestrial water contributions to polar motion from GRACE and hydrological models

NASA Astrophysics Data System (ADS)

Jin, S. G.; Hassan, A. A.; Feng, G. P.

2012-12-01

The hydrological contribution to polar motion is a major challenge in explaining the observed geodetic residual of non-atmospheric and non-oceanic excitations since hydrological models have limited input of comprehensive global direct observations. Although global terrestrial water storage (TWS) estimated from the Gravity Recovery and Climate Experiment (GRACE) provides a new opportunity to study the hydrological excitation of polar motion, the GRACE gridded data are subject to the post-processing de-striping algorithm, spatial gridded mapping and filter smoothing effects as well as aliasing errors. In this paper, the hydrological contributions to polar motion are investigated and evaluated at seasonal and intra-seasonal time scales using the recovered degree-2 harmonic coefficients from all GRACE spherical harmonic coefficients and hydrological models data with the same filter smoothing and recovering methods, including the Global Land Data Assimilation Systems (GLDAS) model, Climate Prediction Center (CPC) model, the National Centers for Environmental Prediction/National Center for Atmospheric Research (NCEP/NCAR) reanalysis products and European Center for Medium-Range Weather Forecasts (ECMWF) operational model (opECMWF). It is shown that GRACE is better in explaining the geodetic residual of non-atmospheric and non-oceanic polar motion excitations at the annual period, while the models give worse estimates with a larger phase shift or amplitude bias. At the semi-annual period, the GRACE estimates are also generally closer to the geodetic residual, but with some biases in phase or amplitude due mainly to some aliasing errors at near semi-annual period from geophysical models. For periods less than 1-year, the hydrological models and GRACE are generally worse in explaining the intraseasonal polar motion excitations.

The Generic Resolution Advisor and Conflict Evaluator (GRACE) for Unmanned Aircraft Detect-And-Avoid Systems

NASA Technical Reports Server (NTRS)

Abramson, Michael; Refai, Mohamad; Santiago, Confesor

2017-01-01

The paper describes the Generic Resolution Advisor and Conflict Evaluator (GRACE), a novel alerting and guidance algorithm that combines flexibility, robustness, and computational efficiency. GRACE is generic since it was designed without any assumptions regarding temporal or spatial scales, aircraft performance, or its sensor and communication systems. Therefore, GRACE was adopted as a core component of the Java Architecture for Detect-And-Avoid (DAA) Extensibility and Modeling, developed by NASA as a research and modeling tool for Unmanned Aerial Systems Integration in the National Airspace System (NAS). GRACE has been used in a number of real-time and fast-time experiments supporting evolving requirements of DAA research, including parametric studies, NAS-wide simulations, human-in-the-loop experiments, and live flight tests.

Identification of Outliers in Grace Data for Indo-Gangetic Plain Using Various Methods (Z-Score, Modified Z-score and Adjusted Boxplot) and Its Removal

NASA Astrophysics Data System (ADS)

Srivastava, S.

2015-12-01

Gravity Recovery and Climate Experiment (GRACE) data are widely used for the hydrological studies for large scale basins (≥100,000 sq km). GRACE data (Stokes Coefficients or Equivalent Water Height) used for hydrological studies are not direct observations but result from high level processing of raw data from the GRACE mission. Different partner agencies like CSR, GFZ and JPL implement their own methodology and their processing methods are independent from each other. The primary source of errors in GRACE data are due to measurement and modeling errors and the processing strategy of these agencies. Because of different processing methods, the final data from all the partner agencies are inconsistent with each other at some epoch. GRACE data provide spatio-temporal variations in Earth's gravity which is mainly attributed to the seasonal fluctuations in water level on Earth surfaces and subsurface. During the quantification of error/uncertainties, several high positive and negative peaks were observed which do not correspond to any hydrological processes but may emanate from a combination of primary error sources, or some other geophysical processes (e.g. Earthquakes, landslide, etc.) resulting in redistribution of earth's mass. Such peaks can be considered as outliers for hydrological studies. In this work, an algorithm has been designed to extract outliers from the GRACE data for Indo-Gangetic plain, which considers the seasonal variations and the trend in data. Different outlier detection methods have been used such as Z-score, modified Z-score and adjusted boxplot. For verification, assimilated hydrological (GLDAS) and hydro-meteorological data are used as the reference. The results have shown that the consistency amongst all data sets improved significantly after the removal of outliers.

Identifying water mass depletion in Northern Iraq observed by GRACE

NASA Astrophysics Data System (ADS)

Mulder, G.; Olsthoorn, T. N.; Al-Manmi, D. A. M. A.; Schrama, E. J. O.; Smidt, E. H.

2014-10-01

Observations acquired by Gravity Recovery And Climate Experiment (GRACE) mission indicate a mass loss of 31 ± 3 km3 or 130 ± 14 mm in Northern Iraq between 2007 and 2009. This data is used as an independent validation of a hydrologic model of the region including lake mass variations. We developed a rainfall-runoff model for five tributaries of the Tigris River, based on local geology and climate conditions. Model inputs are precipitation from Tropical Rainfall Measurement Mission (TRMM) observations, and potential evaporation from GLDAS model parameters. Our model includes a representation of the karstified aquifers that cause large natural groundwater variations in this region. Observed river discharges were used to calibrate our model. In order to get the total mass variations, we corrected for lake mass variations derived from Moderate Resolution Imaging Spectroradiometer (MODIS) in combination with satellite altimetry and some in-situ data. Our rainfall-runoff model confirms that Northern Iraq suffered a drought between 2007 and 2009 and is consistent with the mass loss observed by GRACE over that period. Also, GRACE observed the annual cycle predicted by the rainfall-runoff model. The total mass depletion seen by GRACE between 2007 and 2009 is mainly explained by a lake mass depletion of 74 ± 4 mm and a natural groundwater depletion of 37 ± 6 mm. Our findings indicate that man-made groundwater extraction has a minor influence in this region while depletion of lake mass and geology play a key role.

GRACE and the development of an education and training curriculum.

PubMed

Finch, R G; Blasi, F B; Verheij, T J M; Goossens, H; Coenen, S; Loens, K; Rohde, G; Saenz, H; Akova, M

2012-09-01

Antimicrobial resistance is a serious threat and compromises the management of infectious disease. This has particular significance in relation to infections of the respiratory tract, which are the lead cause of antibiotic prescribing. Education is fundamental to the correct use of antibiotics. A novel open access curriculum has been developed in the context of a European Union funded research project Genomics to combat Resistance against Antibiotics in Community-acquired lower respiratory tract infections in Europe (GRACE http://www.grace-lrti.org). The curriculum was developed in modular format and populated with clinical and scientific topics relevant to community-acquired lower respiratory tract infections. This curriculum informed the content of a series of postgraduate courses and workshops and permitted the creation of an open access e-Learning portal. A total of 153 presentations matching the topics within the curriculum together with slide material and handouts and 104 webcasts are available through the GRACE e-Learning portal, which is fully searchable using a 'mindmap' to navigate the contents. Metrics of access provided a means for assessing usage. The GRACE project has permitted the development of a unique on-line open access curriculum that comprehensively addresses the issues relevant to community-acquired lower respiratory tract infections and has provided a resource not only for personal learning, but also to support independent teaching activities such as lectures, workshops, seminars and course work. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

PubMed Central

Pilch, D S; Brousseau, R; Shafer, R H

1990-01-01

We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

Implications of GRACE Satellite Gravity Measurements for Diverse Hydrological Applications

NASA Astrophysics Data System (ADS)

Yirdaw-Zeleke, Sitotaw

Soil moisture plays a major role in the hydrologic water balance and is the basis for most hydrological models. It influences the partitioning of energy and moisture inputs at the land surface. Because of its importance, it has been used as a key variable for many hydrological studies such as flood forecasting, drought studies and the determination of groundwater recharge. Therefore, spatially distributed soil moisture with reasonable temporal resolution is considered a valuable source of information for hydrological model parameterization and validation. Unfortunately, soil moisture is difficult to measure and remains essentially unmeasured over spatial and temporal scales needed for a number of hydrological model applications. In 2002, the Gravity Recovery And Climate Experiment (GRACE) satellite platform was launched to measure, among other things, the gravitational field of the earth. Over its life span, these orbiting satellites have produced time series of mass changes of the earth-atmosphere system. The subsequent outcome of this, after integration over a number of years, is a time series of highly refined images of the earth's mass distribution. In addition to quantifying the static distribution of mass, the month-to-month variation in the earth's gravitational field are indicative of the integrated value of the subsurface total water storage for specific catchments. Utilization of these natural changes in the earth's gravitational field entails the transformation of the derived GRACE geopotential spherical harmonic coefficients into spatially varying time series estimates of total water storage. These remotely sensed basin total water storage estimates can be routinely validated against independent estimates of total water storage from an atmospheric-based water balance approach or from well calibrated macroscale hydrologic models. The hydrological relevance and implications of remotely estimated GRACE total water storage over poorly gauged, wetland

Phaleria macrocarpa (Boerl.) fruit induce G0/G1 and G2/M cell cycle arrest and apoptosis through mitochondria-mediated pathway in MDA-MB-231 human breast cancer cell.

PubMed

Kavitha, Nowroji; Ein Oon, Chern; Chen, Yeng; Kanwar, Jagat R; Sasidharan, Sreenivasan

2017-04-06

Phaleria macrocarpa (Scheff) Boerl, is a well-known folk medicinal plant in Indonesia. Traditionally, P. macrocarpa has been used to control cancer, impotency, hemorrhoids, diabetes mellitus, allergies, liver and hearth disease, kidney disorders, blood diseases, acne, stroke, migraine, and various skin diseases. The purpose of this study was to determine the in situ cytotoxicity effect P. macrocarpa fruit ethyl acetate fraction (PMEAF) and the underlying molecular mechanism of cell death. MDA-MB-231 cells were incubated with PMEAF for 24h. Cell cycle and viability were examined using flow cytometry analysis. Apoptosis was determined using the Annexin V assay and also by fluorescence microscopy. Apoptosis protein profiling was detected by RayBio® Human Apoptosis Array. The AO/PI staining and flow cytometric analysis of MDA-MB-231 cells treated with PMEAF were showed apoptotic cell death. The cell cycle analysis by flow cytometry analysis revealed that the accumulation of PMEAF treated MDA-MB-231 cells in G 0 /G 1 and G 2 /M-phase of the cell cycle. Moreover, the PMEAF exert cytotoxicity by increased the ROS production in MDA-MB-231 cells consistently stimulated the loss of mitochondrial membrane potential (∆ Ψm ) and induced apoptosis cell death by activation of numerous signalling proteins. The results from apoptosis protein profiling array evidenced that PMEAF stimulated the expression of 9 pro-apoptotic proteins (Bax, Bid, caspase 3, caspase 8, cytochrome c, p21, p27, p53 and SMAC) and suppressed the 4 anti-apoptotic proteins (Bcl-2, Bcl-w, XIAP and survivin) in MDA-MB-231 cells. The results indicated that PMEAF treatment induced apoptosis in MDA-MB-231 cells through intrinsic mitochondrial related pathway with the participation of pro and anti-apoptotic proteins, caspases, G 0 /G 1 and G 2 /M-phases cell cycle arrest by p53-mediated mechanism. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Comparison of RISK-PCI, GRACE, TIMI risk scores for prediction of major adverse cardiac events in patients with acute coronary syndrome.

PubMed

Jakimov, Tamara; Mrdović, Igor; Filipović, Branka; Zdravković, Marija; Djoković, Aleksandra; Hinić, Saša; Milić, Nataša; Filipović, Branislav

2017-12-31

To compare the prognostic performance of three major risk scoring systems including global registry for acute coronary events (GRACE), thrombolysis in myocardial infarction (TIMI), and prediction of 30-day major adverse cardiovascular events after primary percutaneous coronary intervention (RISK-PCI). This single-center retrospective study involved 200 patients with acute coronary syndrome (ACS) who underwent invasive diagnostic approach, ie, coronary angiography and myocardial revascularization if appropriate, in the period from January 2014 to July 2014. The GRACE, TIMI, and RISK-PCI risk scores were compared for their predictive ability. The primary endpoint was a composite 30-day major adverse cardiovascular event (MACE), which included death, urgent target-vessel revascularization (TVR), stroke, and non-fatal recurrent myocardial infarction (REMI). The c-statistics of the tested scores for 30-day MACE or area under the receiver operating characteristic curve (AUC) with confidence intervals (CI) were as follows: RISK-PCI (AUC=0.94; 95% CI 1.790-4.353), the GRACE score on admission (AUC=0.73; 95% CI 1.013-1.045), the GRACE score on discharge (AUC=0.65; 95% CI 0.999-1.033). The RISK-PCI score was the only score that could predict TVR (AUC=0.91; 95% CI 1.392-2.882). The RISK-PCI scoring system showed an excellent discriminative potential for 30-day death (AUC=0.96; 95% CI 1.339-3.548) in comparison with the GRACE scores on admission (AUC=0.88; 95% CI 1.018-1.072) and on discharge (AUC=0.78; 95% CI 1.000-1.058). In comparison with the GRACE and TIMI scores, RISK-PCI score showed a non-inferior ability to predict 30-day MACE and death in ACS patients. Moreover, RISK-PCI was the only scoring system that could predict recurrent ischemia requiring TVR.

Comparison of RISK-PCI, GRACE, TIMI risk scores for prediction of major adverse cardiac events in patients with acute coronary syndrome

PubMed Central

Jakimov, Tamara; Mrdović, Igor; Filipović, Branka; Zdravković, Marija; Djoković, Aleksandra; Hinić, Saša; Milić, Nataša; Filipović, Branislav

2017-01-01

Aim To compare the prognostic performance of three major risk scoring systems including global registry for acute coronary events (GRACE), thrombolysis in myocardial infarction (TIMI), and prediction of 30-day major adverse cardiovascular events after primary percutaneous coronary intervention (RISK-PCI). Methods This single-center retrospective study involved 200 patients with acute coronary syndrome (ACS) who underwent invasive diagnostic approach, ie, coronary angiography and myocardial revascularization if appropriate, in the period from January 2014 to July 2014. The GRACE, TIMI, and RISK-PCI risk scores were compared for their predictive ability. The primary endpoint was a composite 30-day major adverse cardiovascular event (MACE), which included death, urgent target-vessel revascularization (TVR), stroke, and non-fatal recurrent myocardial infarction (REMI). Results The c-statistics of the tested scores for 30-day MACE or area under the receiver operating characteristic curve (AUC) with confidence intervals (CI) were as follows: RISK-PCI (AUC = 0.94; 95% CI 1.790-4.353), the GRACE score on admission (AUC = 0.73; 95% CI 1.013-1.045), the GRACE score on discharge (AUC = 0.65; 95% CI 0.999-1.033). The RISK-PCI score was the only score that could predict TVR (AUC = 0.91; 95% CI 1.392-2.882). The RISK-PCI scoring system showed an excellent discriminative potential for 30-day death (AUC = 0.96; 95% CI 1.339-3.548) in comparison with the GRACE scores on admission (AUC = 0.88; 95% CI 1.018-1.072) and on discharge (AUC = 0.78; 95% CI 1.000-1.058). Conclusions In comparison with the GRACE and TIMI scores, RISK-PCI score showed a non-inferior ability to predict 30-day MACE and death in ACS patients. Moreover, RISK-PCI was the only scoring system that could predict recurrent ischemia requiring TVR. PMID:29308832

The plant G box promoter sequence activates transcription in Saccharomyces cerevisiae and is bound in vitro by a yeast activity similar to GBF, the plant G box binding factor.

PubMed Central

Donald, R G; Schindler, U; Batschauer, A; Cashmore, A R

1990-01-01

G box and I box sequences of the Arabidopsis thaliana ribulose-bisphosphate-1,5-carboxylase small subunit (RBCS) promoter are required for expression mediated by the Arabidopsis rbcS-1A promoter in transgenic tobacco plants and are bound in vitro by factors from plant nuclear extracts termed GBF and GA-1, respectively. We show here that a -390 to -60 rbcS-1A promoter fragment containing the G box and two I boxes activates transcription from a truncated iso-1-cytochrome c (CYC1) gene promoter in Saccharomyces cerevisiae. Mutagenesis of either the rbcS-1A G box or both I box sequences eliminated the expression mediated by this fragment. When polymerized, I box oligonucleotides were also capable of enhancing expression from the truncated CYC1 promoter. Single-copy G box sequences from the Arabidopsis rbcS-1A, Arabidopsis Adh and tomato rbcS-3A promoters were more potent activators and were used in mobility shift assays to identify a DNA binding activity in yeast functionally similar to GBF. In methylation interference experiments, the binding specificity of the yeast protein was indistinguishable from that obtained with plant nuclear extracts. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2161333

Comparison of precision orbit derived density estimates for CHAMP and GRACE satellites

NASA Astrophysics Data System (ADS)

Fattig, Eric Dale

Current atmospheric density models cannot adequately represent the density variations observed by satellites in Low Earth Orbit (LEO). Using an optimal orbit determination process, precision orbit ephemerides (POE) are used as measurement data to generate corrections to density values obtained from existing atmospheric models. Densities obtained using these corrections are then compared to density data derived from the onboard accelerometers of satellites, specifically the CHAMP and GRACE satellites. This comparison takes two forms, cross correlation analysis and root mean square analysis. The densities obtained from the POE method are nearly always superior to the empirical models, both in matching the trends observed by the accelerometer (cross correlation), and the magnitudes of the accelerometer derived density (root mean square). In addition, this method consistently produces better results than those achieved by the High Accuracy Satellite Drag Model (HASDM). For satellites orbiting Earth that pass through Earth's upper atmosphere, drag is the primary source of uncertainty in orbit determination and prediction. Variations in density, which are often not modeled or are inaccurately modeled, cause difficulty in properly calculating the drag acting on a satellite. These density variations are the result of many factors; however, the Sun is the main driver in upper atmospheric density changes. The Sun influences the densities in Earth's atmosphere through solar heating of the atmosphere, as well as through geomagnetic heating resulting from the solar wind. Data are examined for fourteen hour time spans between November 2004 and July 2009 for both the CHAMP and GRACE satellites. This data spans all available levels of solar and geomagnetic activity, which does not include data in the elevated and high solar activity bins due to the nature of the solar cycle. Density solutions are generated from corrections to five different baseline atmospheric models, as well as

Improving Soil Moisture Estimation through the Joint Assimilation of SMOS and GRACE Satellite Observations

NASA Technical Reports Server (NTRS)

Girotto, Manuela

2018-01-01

Observations from recent soil moisture dedicated missions (e.g. SMOS or SMAP) have been used in innovative data assimilation studies to provide global high spatial (i.e., approximately10-40 km) and temporal resolution (i.e., daily) soil moisture profile estimates from microwave brightness temperature observations. These missions are only sensitive to near-surface soil moisture 0-5 cm). In contrast, the Gravity Recovery and Climate Experiment (GRACE) mission provides accurate measurements of the entire vertically integrated terrestrial water storage (TWS) column but, it is characterized by low spatial (i.e., 150,000 km2) and temporal (i.e., monthly) resolutions. Data assimilation studies have shown that GRACE-TWS primarily affects (in absolute terms) deeper moisture storages (i.e., groundwater). In this presentation I will review benefits and drawbacks associated to the assimilation of both types of observations. In particular, I will illustrate the benefits and drawbacks of their joint assimilation for the purpose of improving the entire profile of soil moisture (i.e., surface and deeper water storages).

Translational control of phloem development by RNA G-quadruplex-JULGI determines plant sink strength.

PubMed

Cho, Hyunwoo; Cho, Hyun Seob; Nam, Hoyoung; Jo, Hunho; Yoon, Joonseon; Park, Chanyoung; Dang, Tuong Vi T; Kim, Eunah; Jeong, Jongmin; Park, Soyoung; Wallner, Eva-Sophie; Youn, Hyungjun; Park, Jongmin; Jeon, Jinseong; Ryu, Hojin; Greb, Thomas; Choi, Kyuha; Lee, Yoontae; Jang, Sung Key; Ban, Changill; Hwang, Ildoo

2018-06-01

The emergence of a plant vascular system was a prerequisite for the colonization of land; however, it is unclear how the photosynthate transporting system was established during plant evolution. Here, we identify a novel translational regulatory module for phloem development involving the zinc-finger protein JULGI (JUL) and its targets, the 5' untranslated regions (UTRs) of the SUPPRESSOR OF MAX2 1-LIKE4/5 (SMXL4/5) mRNAs, which is exclusively conserved in vascular plants. JUL directly binds and induces an RNA G-quadruplex in the 5' UTR of SMXL4/5, which are key promoters of phloem differentiation. We show that RNA G-quadruplex formation suppresses SMXL4/5 translation and restricts phloem differentiation. In turn, JUL deficiency promotes phloem formation and strikingly increases sink strength per seed. We propose that the translational regulation by the JUL/5' UTR G-quadruplex module is a major determinant of phloem establishment, thereby determining carbon allocation to sink tissues, and that this mechanism was a key invention during the emergence of vascular plants.

GRACE Mass Flux Measurements of Inland and Marginal Seas from Mascons: Analysis and Validation

NASA Astrophysics Data System (ADS)

Loomis, B.; Luthcke, S. B.; Sabaka, T. J.

2015-12-01

The latest GRACE time-variable gravity mascon solution from the NASA Goddard Space Flight Center (GSFC) applies an optimized set of models and constraints towards the direct measurement of 1-arc-degree global mass flux parameters each month. Separate mascon spatial constraint regions have been defined for the largest inland and marginal seas: Mediterranean Sea, Black Sea, Caspian Sea, Red Sea, and Hudson Bay. The mascon estimation approach, when applied with well-designed constraints, minimizes signal leakage across regional boundaries and eliminates the need for post-processing strategies. These post-processing techniques (e.g. smoothed averaging kernels) are necessary for computing regional mass change from the unconstrained spherical harmonics provided by the GRACE project to reduce the effect of noisy high degree and order terms, but introduce signal leakage into and out of the considered region. These mass signals are also difficult to obtain from altimetry measurements due to the comparatively sparse temperature and salinity data in these regions, which is needed to compute and remove the steric component of sea level variations. We provide new GSFC mascon measurements of these inland and marginal seas and compare to results obtained from kernel-averaged spherical harmonic solutions and steric-corrected altimetry measurements. The relative accuracy of the various solutions is determined by incorporating their output into the set of forward models applied in our processing of the GRACE Level-1B data and analyzing the effect on the inter-satellite range-rate residuals, where a reduction in residuals is a direct validation of improved solution quality.

Estimation and Validation of Oceanic Mass Circulation from the GRACE Mission

NASA Technical Reports Server (NTRS)

Boy, J.-P.; Rowlands, D. D.; Sabaka, T. J.; Luthcke, S. B.; Lemoine, F. G.

2011-01-01

Since the launch of the Gravity Recovery And Climate Experiment (GRACE) in March 2002, the Earth's surface mass variations have been monitored with unprecedented accuracy and resolution. Compared to the classical spherical harmonic solutions, global high-resolution mascon solutions allows the retrieval of mass variations with higher spatial and temporal sampling (2 degrees and 10 days). We present here the validation of the GRACE global mascon solutions by comparing mass estimates to a set of about 100 ocean bottom pressure (OSP) records, and show that the forward modelling of continental hydrology prior to the inversion of the K-band range rate data allows better estimates of ocean mass variations. We also validate our GRACE results to OSP variations modelled by different state-of-the-art ocean general circulation models, including ECCO (Estimating the Circulation and Climate of the Ocean) and operational and reanalysis from the MERCATOR project.

A modified acceleration-based monthly gravity field solution from GRACE data

NASA Astrophysics Data System (ADS)

Chen, Qiujie; Shen, Yunzhong; Chen, Wu; Zhang, Xingfu; Hsu, Houze; Ju, Xiaolei

2015-08-01

This paper describes an alternative acceleration approach for determining GRACE monthly gravity field models. The main differences compared to the traditional acceleration approach can be summarized as: (1) The position errors of GRACE orbits in the functional model are taken into account; (2) The range ambiguity is eliminated via the difference of the range measurements and (3) The mean acceleration equation is formed based on Cowell integration. Using this developed approach, a new time-series of GRACE monthly solution spanning the period January 2003 to December 2010, called Tongji_Acc RL01, has been derived. The annual signals from the Tongji_Acc RL01 time-series agree well with those from the GLDAS model. The performance of Tongji_Acc RL01 shows that this new model is comparable with the RL05 models released by CSR and JPL as well as with the RL05a model released by GFZ.

Research on the impact factors of GRACE precise orbit determination by dynamic method

NASA Astrophysics Data System (ADS)

Guo, Nan-nan; Zhou, Xu-hua; Li, Kai; Wu, Bin

2018-07-01

With the successful use of GPS-only-based POD (precise orbit determination), more and more satellites carry onboard GPS receivers to support their orbit accuracy requirements. It provides continuous GPS observations in high precision, and becomes an indispensable way to obtain the orbit of LEO satellites. Precise orbit determination of LEO satellites plays an important role for the application of LEO satellites. Numerous factors should be considered in the POD processing. In this paper, several factors that impact precise orbit determination are analyzed, namely the satellite altitude, the time-variable earth's gravity field, the GPS satellite clock error and accelerometer observation. The GRACE satellites provide ideal platform to study the performance of factors for precise orbit determination using zero-difference GPS data. These factors are quantitatively analyzed on affecting the accuracy of dynamic orbit using GRACE observations from 2005 to 2011 by SHORDE software. The study indicates that: (1) with the altitude of the GRACE satellite is lowered from 480 km to 460 km in seven years, the 3D (three-dimension) position accuracy of GRACE satellite orbit is about 3˜4 cm based on long spans data; (2) the accelerometer data improves the 3D position accuracy of GRACE in about 1 cm; (3) the accuracy of zero-difference dynamic orbit is about 6 cm with the GPS satellite clock error products in 5 min sampling interval and can be raised to 4 cm, if the GPS satellite clock error products with 30 s sampling interval can be adopted. (4) the time-variable part of earth gravity field model improves the 3D position accuracy of GRACE in about 0.5˜1.5 cm. Based on this study, we quantitatively analyze the factors that affect precise orbit determination of LEO satellites. This study plays an important role to improve the accuracy of LEO satellites orbit determination.

On the estimation of physical height changes using GRACE satellite mission data - A case study of Central Europe

NASA Astrophysics Data System (ADS)

Godah, Walyeldeen; Szelachowska, Małgorzata; Krynski, Jan

2017-12-01

The dedicated gravity satellite missions, in particular the GRACE (Gravity Recovery and Climate Experiment) mission launched in 2002, provide unique data for studying temporal variations of mass distribution in the Earth's system, and thereby, the geometry and the gravity fi eld changes of the Earth. The main objective of this contribution is to estimate physical height (e.g. the orthometric/normal height) changes over Central Europe using GRACE satellite mission data as well as to analyse them and model over the selected study area. Physical height changes were estimated from temporal variations of height anomalies and vertical displacements of the Earth surface being determined over the investigated area. The release 5 (RL05) GRACE-based global geopotential models as well as load Love numbers from the Preliminary Reference Earth Model (PREM) were used as input data. Analysis of the estimated physical height changes and their modelling were performed using two methods: the seasonal decomposition method and the PCA/ EOF (Principal Component Analysis/Empirical Orthogonal Function) method and the differences obtained were discussed. The main fi ndings reveal that physical height changes over the selected study area reach up to 22.8 mm. The obtained physical height changes can be modelled with an accuracy of 1.4 mm using the seasonal decomposition method.

Regionally Optimized GRACE Processing and Inter-comparison on the Antarctic Ice Sheet

NASA Astrophysics Data System (ADS)

Mohajerani, Y.; Velicogna, I.; Sutterley, T. C.; Rignot, E. J.

2017-12-01

The Antarctic ice sheet is losing mass at an accelerating rate, with a sea level contribution that changed from 0.08mm/yr from 1992 to 2001 to 0.4mm/yr from 2002 to 2011. While most of this contribution comes from West Antarctica, Totten Glacier has the largest discharge of ice in East Antarctica, with a sea level rise potential of 3.9 m. Furthermore, the drainage basin of Totten Glacier, along the neighboring Moscow University Glacier are below sea level, extending hundreds of kilometers inland. Therefore, obtaining regional estimates of both western and eastern Antarctic basins are of critical importance. The GRACE (Gravity Recovery and Climate Experiment) satellite has been providing mass balance time-series from geoid changes since 2002. Several mascon and harmonic GRACE solutions are available from different processing centers. Here, we evaluate the various solutions across the ice sheet and a new set of regionally optimized mascons to study the mass balance of Totten and Moscow University glaciers. We obtain a trend of -16.5±4.1Gt/yr with an acceleration of -2.0±1.8Gt/yr2 for the two glaciers for the period April 2002 to December 2016 using the Ivins et al (2013) GIA model (errors include leakage, GIA, and regression errors). We compare the results with the Mass Budget Method that combines ice discharge (D) and surface mass balance (SMB) from two models: 1) RACMO2.3, and 2) MAR3.6.4. MBM/RACMO2.3 shows the best agreement with the GRACE estimates. Within the common period from April 2002 to December 2015, the MBM/RACMO2.3 and MAR3.6.4 results are -15.6±1.8Gt/yr and -6.7±1.5Gt/yr respectively, while the GRACE time-series has a trend of -14.8±2.7 Gt/yr. We extend the study to the Getz Ice Shelf, the third largest ice shelf in West Antarctica after Ronne and Ross West ice shelves. We compare our gravity-derived mass estimates, the mass budget estimates, and the volume changes from altimetry data to compare the estimates and obtain a multi-sensor assessment

Separation of GRACE geoid time-variations using Independent Component Analysis

NASA Astrophysics Data System (ADS)

Frappart, F.; Ramillien, G.; Maisongrande, P.; Bonnet, M.

2009-12-01

Independent Component Analysis (ICA) is a blind separation method based on the simple assumptions of the independence of the sources and the non-Gaussianity of the observations. An approach based on this numerical method is used here to extract hydrological signals over land and oceans from the polluting striping noise due to orbit repetitiveness and present in the GRACE global mass anomalies. We took advantage of the availability of monthly Level-2 solutions from three official providers (i.e., CSR, JPL and GFZ) that can be considered as different observations of the same phenomenon. The efficiency of the methodology is first demonstrated on a synthetic case. Applied to one month of GRACE solutions, it allows to clearly separate the total water storage change from the meridional-oriented spurious gravity signals on the continents but not on the oceans. This technique gives results equivalent as the destriping method for continental water storage for the hydrological patterns with less smoothing. This methodology is then used to filter the complete series of the 2002-2009 GRACE solutions.

Application of GRACE for Monitoring Groundwater in Data Scarce Regions

NASA Technical Reports Server (NTRS)

Rodell, Matt; Li, Bailing; Famiglietti, Jay; Zaitchik, Ben

2012-01-01

In the United States, groundwater storage is somewhat well monitored (spatial and temporal data gaps notwithstanding) and abundant data are freely and easily accessible. Outside of the U.S., groundwater often is not monitored systematically and where it is the data are rarely centralized and made available. Since 2002 the Gravity Recovery and Climate Experiment (GRACE) satellite mission has delivered gravity field observations which have been used to infer variations in total terrestrial water storage, including groundwater, at regional to continental scales. Challenges to using GRACE for groundwater monitoring include its relatively coarse spatial and temporal resolutions, its inability to differentiate groundwater from other types of water on and under the land surface, and typical 2-3 month data latency. Data assimilation can be used to overcome these challenges, but uncertainty in the results remains and is difficult to quantify without independent observations. Nevertheless, the results are preferable to the alternative - no data at all- and GRACE has already revealed groundwater variability and trends in regions where only anecdotal evidence existed previously.

Physalis angulata induced G2/M phase arrest in human breast cancer cells.

PubMed

Hsieh, Wen-Tsong; Huang, Kuan-Yuh; Lin, Hui-Yi; Chung, Jing-Gung

2006-07-01

Physalis angulata (PA) is employed in herbal medicine around the world. It is used to treat diabetes, hepatitis, asthma and malaria in Taiwan. We have evaluated PA as a cancer chemopreventive agent in vitro by studying the role of PA in regulation of proliferation, cell cycle and apoptosis in human breast cancer cell lines. PA inhibited cell proliferation and induced G2/M arrest and apoptosis in human breast cancer MAD-MB 231 and MCF-7 cell lines. In this study, under treatment with various concentrations of PA in MDA-MB 231 cell line, we checked mRNA levels for cyclin A and cyclin B1 and the protein levels of cyclin A and cyclin B1, Cdc2 (cyclin-dependent kinases), p21(waf1/cip1) and P27(Kip1) (cyclin-dependent kinase inhibitors), Cdc25C, Chk2 and Wee1 kinase (cyclin-dependent kinase relative factors) in cell cycle G2/M phase. From those results, we determined that PA arrests MDA-MB 231 cells at the G2/M phase by (i) inhibiting synthesis or stability of mRNA and their downstream protein levels of cyclin A and cyclin B1, (ii) increasing p21(waf1/cip1) and P27(kip1) levels, (iii) increasing Chk2, thus causing an increase in Cdc25C phosphorylation/inactivation and inducing a decrease in Cdc2 levels and an increase in Wee1 level. According to the results obtained, PA appears to possess anticarcinogenic properties; these results suggest that the effect of PA on the levels of phosphorylated/inactivated Cdc25C are mediated by Chk2 activation, at least in part, via p21(waf1/cip1) and P27(kip1) cyclin-dependent kinase inhibitors pathway to arrest cells at G2/M phase in breast cancer carcinoma cells.

Differential in vitro inhibition of M3G and M6G formation from morphine by (R)- and (S)-methadone and structurally related opioids

PubMed Central

Morrish, Glynn A; Foster, David J R; Somogyi, Andrew A

2006-01-01

Aims To determine the in vitro kinetics of morphine-3-glucuronide (M3G) and morphine-6-glucuronide (M6G) formation and the inhibition potential by methadone enantiomers and structurally related opioids. Methods M3G and M6G formation kinetics from morphine were determined using microsomes from five human livers. Inhibition of glucuronide formation was investigated with eight inhibitors (100 µm) and the mechanism of inhibition determined for (R)- and (S)-methadone (70–500 µm) using three microsomal samples. Results Glucuronide formation displayed single enzyme kinetics. The M3G Vmax (mean ± SD) was 4.8-fold greater than M6G Vmax (555 ± 110 vs. 115 ± 19 nmol mg−1 protein h−1; P = 0.006, mean of difference 439; 95% confidence interval 313, 565 nmol mg−1 protein h−1). Km values for M3G and M6G formation were not significantly different (1.12 ± 0.37 vs. 1.11 ± 0.31 mm; P = 0.89, 0.02; −0.29, 0.32 mm). M3G and M6G formation was inhibited (P < 0.01) with a significant increase in the M3G/M6G ratio (P < 0.01) for all compounds tested. Detailed analysis with (R)- and (S)-methadone revealed noncompetitive inhibition with (R)-methadone Ki of 320 ± 42 µm and 192 ± 12 µm for M3G and M6G, respectively, and (S)-methadone Ki of 226 ± 30 µm and 152 ± 20 µm for M3G and M6G, respectively. Ki values for M3G inhibition were significantly greater than for M6G for (R)-methadone (P = 0.017, 128; 55, 202 µm) and (S)-methadone (P = 0.026, 75; 22, 128 µm). Conclusions Both methadone enantiomers noncompetitively inhibited the formation of morphine's primary metabolites, with greater inhibition of M6G formation compared with M3G. These findings indicate a mechanism for reduced morphine clearance in methadone-maintained patients and reduced relative formation of the opioid active M6G compared with M3G. PMID:16487227

Isorhapontigenin (ISO) inhibited cell transformation by inducing G0/G1 phase arrest via increasing MKP-1 mRNA Stability.

PubMed

Gao, Guangxun; Chen, Liang; Li, Jingxia; Zhang, Dongyun; Fang, Yong; Huang, Haishan; Chen, Xiequn; Huang, Chuanshu

2014-05-15

The cancer chemopreventive property of Chinese herb new isolate isorhapontigenin (ISO) and mechanisms underlying its activity have never been explored. Here we demonstrated that ISO treatment with various concentrations for 3 weeks could dramatically inhibit TPA/EGF-induced cell transformation of Cl41 cells in Soft Agar assay, whereas co-incubation of cells with ISO at the same concentrations could elicit G0/G1 cell-cycle arrest without redundant cytotoxic effects on non-transformed cells. Further studies showed that ISO treatment resulted in cyclin D1 downregulation in dose- and time-dependent manner. Our results indicated that ISO regulated cyclin D1 at transcription level via targeting JNK/C-Jun/AP-1 activation. Moreover, we found that ISO-inhibited JNK/C-Jun/AP-1 activation was mediated by both upregulation of MKP-1 expression through increasing its mRNA stability and deactivating MKK7. Most importantly, MKP-1 knockdown could attenuate ISO-mediated suppression of JNK/C-Jun activation and cyclin D1 expression, as well as G0/G1 cell cycle arrest and cell transformation inhibition, while ectopic expression of FLAG-cyclin D1 T286A mutant also reversed ISO-induced G0/G1 cell-cycle arrest and inhibition of cell transformation. Our results demonstrated that ISO is a promising chemopreventive agent via upregulating mkp-1 mRNA stability, which is distinct from its cancer therapeutic effect with downregulation of XIAP and cyclin D1 expression.

Ninety-day oral toxicity studies on two genetically modified maize MON810 varieties in Wistar Han RCC rats (EU 7th Framework Programme project GRACE).

PubMed

Zeljenková, Dagmar; Ambrušová, Katarína; Bartušová, Mária; Kebis, Anton; Kovrižnych, Jevgenij; Krivošíková, Zora; Kuricová, Miroslava; Líšková, Aurélia; Rollerová, Eva; Spustová, Viera; Szabová, Elena; Tulinská, Jana; Wimmerová, Soňa; Levkut, Mikuláš; Révajová, Viera; Ševčíková, Zuzana; Schmidt, Kerstin; Schmidtke, Jörg; La Paz, Jose Luis; Corujo, Maria; Pla, Maria; Kleter, Gijs A; Kok, Esther J; Sharbati, Jutta; Hanisch, Carlos; Einspanier, Ralf; Adel-Patient, Karine; Wal, Jean-Michel; Spök, Armin; Pöting, Annette; Kohl, Christian; Wilhelm, Ralf; Schiemann, Joachim; Steinberg, Pablo

2014-12-01

The GMO Risk Assessment and Communication of Evidence (GRACE; www.grace-fp7.eu ) project is funded by the European Commission within the 7th Framework Programme. A key objective of GRACE is to conduct 90-day animal feeding trials, animal studies with an extended time frame as well as analytical, in vitro and in silico studies on genetically modified (GM) maize in order to comparatively evaluate their use in GM plant risk assessment. In the present study, the results of two 90-day feeding trials with two different GM maize MON810 varieties, their near-isogenic non-GM varieties and four additional conventional maize varieties are presented. The feeding trials were performed by taking into account the guidance for such studies published by the EFSA Scientific Committee in 2011 and the OECD Test Guideline 408. The results obtained show that the MON810 maize at a level of up to 33 % in the diet did not induce adverse effects in male and female Wistar Han RCC rats after subchronic exposure, independently of the two different genetic backgrounds of the event.

Daily GRACE gravity field solutions track major flood events in the Ganges-Brahmaputra Delta

NASA Astrophysics Data System (ADS)

Gouweleeuw, Ben T.; Kvas, Andreas; Gruber, Christian; Gain, Animesh K.; Mayer-Gürr, Thorsten; Flechtner, Frank; Güntner, Andreas

2018-05-01

Two daily gravity field solutions based on observations from the Gravity Recovery and Climate Experiment (GRACE) satellite mission are evaluated against daily river runoff data for major flood events in the Ganges-Brahmaputra Delta (GBD) in 2004 and 2007. The trends over periods of a few days of the daily GRACE data reflect temporal variations in daily river runoff during major flood events. This is especially true for the larger flood in 2007, which featured two distinct periods of critical flood level exceedance in the Brahmaputra River. This first hydrological evaluation of daily GRACE gravity field solutions based on a Kalman filter approach confirms their potential for gravity-based large-scale flood monitoring. This particularly applies to short-lived, high-volume floods, as they occur in the GBD with a 4-5-year return period. The release of daily GRACE gravity field solutions in near-real time may enable flood monitoring for large events.

Identifying water mass depletion in Northern Iraq observed by GRACE

NASA Astrophysics Data System (ADS)

Mulder, Gert; Olsthoorn, Theo; Al-Manmi, Diary; Schrama, Ernst; Smidt, Ebel

2014-05-01

Observations acquired by Gravity Recovery And Climate Experiment (GRACE) mission indicates a mass loss of 31±3 km3 or 130±14 mm in Northern Iraq between 2006 and 2009. This data is used as an independent validation of a hydrologic model of the region including lake mass variations. We developed a rainfall-runoff model for five tributaries of the Tigris River, based on local geology and climate conditions. Model inputs are precipitation data from Tropical Rainfall Measurement Mission (TRMM) observations, and potential evaporation from GLDAS parameters. Our model includes an extensive network of karstified aquifers that causes large natural groundwater variations in this region. Observed river discharges have been used to calibrate our model. In order to get the total mass variations, we correct for lake mass variations derived from Moderate Resolution Imaging Spectroradiometer (MODIS) data in combination with satellite altimetry and some in-situ data. Our rainfall-runoff model confirms that Northern Iraq suffered a drought between 2006 and 2009 and is consistent with the mass loss observed by GRACE in that period. Also, GRACE picks up the annual cycle predicted by the rainfall-runoff model. The total mass depletion seen by GRACE between 2006 and 2009 is 130±14 mm, which is mainly explained by a lake mass depletion of 74±4 mm and a natural groundwater depletion of approximately 50 mm. Our findings indicate that man-made groundwater extraction has a minor influence in this region while depletion of lake mass and geology play a key role.

Validation of the EGSIEM combined monthly GRACE gravity fields

NASA Astrophysics Data System (ADS)

Li, Zhao; van Dam, Tonie; Chen, Qiang; Weigelt, Matthias; Güntner, Andreas; Jäggi, Adrian; Meyer, Ulrich; Jean, Yoomin; Altamimi, Zuheir; Rebischung, Paul

2016-04-01

Observations indicate that global warming is affecting the water cycle. Here in Europe predictions are for more frequent high precipitation events, wetter winters, and longer and dryer summers. The consequences of these changes include the decreasing availability of fresh water resources in some regions as well as flooding and erosion of coastal and low-lying areas in other regions. These weather related effects impose heavy costs on society and the economy. We cannot stop the immediate effects global warming on the water cycle. But there may be measures that we can take to mitigate the costs to society. The Horizon2020 supported project, European Gravity Service for Improved Emergency Management (EGSIEM), will add value to EO observations of variations in the Earth's gravity field. In particular, the EGSIEM project will interpret the observations of gravity field changes in terms of changes in continental water storage. The project team will develop tools to alert the public water storage conditions could indicate the onset of regional flooding or drought. As part of the EGSIEM project, a combined GRACE gravity product is generated, using various monthly GRACE solutions from associated processing centers (ACs). Since each AC follows a set of common processing standards but applies its own independent analysis method, the quality, robustness, and reliability of the monthly combined gravity fields should be significantly improved as compared to any individual solution. In this study, we present detailed and updated comparisons of the combined EGSIEM GRACE gravity product with GPS position time series, hydrological models, and existing GRACE gravity fields. The GPS residuals are latest REPRO2 station position residuals, obtained by rigorously stacking the IGS Repro 2 , daily solutions, estimating, and then restoring the annual and semi-annual signals.

Constraints of GRACE on the Ice Model and Mantle Rheology in Glacial Isostatic Adjustment Modeling in North-America

NASA Astrophysics Data System (ADS)

van der Wal, W.; Wu, P.; Sideris, M.; Wang, H.

2009-05-01

GRACE satellite data offer homogeneous coverage of the area covered by the former Laurentide ice sheet. The secular gravity rate estimated from the GRACE data can therefore be used to constrain the ice loading history in Laurentide and, to a lesser extent, the mantle rheology in a GIA model. The objective of this presentation is to find a best fitting global ice model and use it to study how the ice model can be modified to fit a composite rheology, in which creep rates from a linear and non-linear rheology are added. This is useful because all the ice models constructed from GIA assume that mantle rheology is linear, but creep experiments on rocks show that nonlinear rheology may be the dominant mechanism in some parts of the mantle. We use CSR release 4 solutions from August 2002 to October 2008 with continental water storage effects removed by the GLDAS model and filtering with a destriping and Gaussian filter. The GIA model is a radially symmetric incompressible Maxwell Earth, with varying upper and lower mantle viscosity. Gravity rate misfit values are computed for with a range of viscosity values with the ICE-3G, ICE-4G and ICE-5G models. The best fit is shown for models with ICE-3G and ICE-4G, and the ICE-4G model is selected for computations with a so-called composite rheology. For the composite rheology, the Coupled Laplace Finite-Element Method is used to compute the GIA response of a spherical self-gravitating incompressible Maxwell Earth. The pre-stress exponent (A) derived from a uni- axial stress experiment is varied between 3.3 x 10-34/10-35/10-36 Pa-3s-1, the Newtonian viscosity η is varied between 1 and 3 x 1021 Pa-s, and the stress exponent is taken to be 3. Composite rheology in general results in geoid rates that are too small compared to GRACE observations. Therefore, simple modifications of the ICE-4G history are investigated by scaling ice heights or delaying glaciation. It is found that a delay in glaciation is a better way to adjust ice

Mutations in MYB3R1 and MYB3R4 Cause Pleiotropic Developmental Defects and Preferential Down-Regulation of Multiple G2/M-Specific Genes in Arabidopsis1[C][W

PubMed Central

Haga, Nozomi; Kobayashi, Kosuke; Suzuki, Takamasa; Maeo, Kenichiro; Kubo, Minoru; Ohtani, Misato; Mitsuda, Nobutaka; Demura, Taku; Nakamura, Kenzo; Jürgens, Gerd; Ito, Masaki

2011-01-01

R1R2R3-Myb proteins represent an evolutionarily conserved class of Myb family proteins important for cell cycle regulation and differentiation in eukaryotic cells. In plants, this class of Myb proteins are believed to regulate the transcription of G2/M phase-specific genes by binding to common cis-elements, called mitosis-specific activator (MSA) elements. In Arabidopsis (Arabidopsis thaliana), MYB3R1 and MYB3R4 act as transcriptional activators and positively regulate cytokinesis by activating the transcription of KNOLLE, which encodes a cytokinesis-specific syntaxin. Here, we show that the double mutation myb3r1 myb3r4 causes pleiotropic developmental defects, some of which are due to deficiency of KNOLLE whereas other are not, suggesting that multiple target genes are involved. Consistently, microarray analysis of the double mutant revealed altered expression of many genes, among which G2/M-specific genes showed significant overrepresentation of the MSA motif and a strong tendency to be down-regulated by the double mutation. Our results demonstrate, on a genome-wide level, the importance of the MYB3R-MSA pathway for regulating G2/M-specific transcription. In addition, MYB3R1 and MYB3R4 may have diverse roles during plant development by regulating G2/M-specific genes with various functions as well as genes possibly unrelated to the cell cycle. PMID:21862669

Deriving Scaling Factors Using a Global Hydrological Model to Restore GRACE Total Water Storage Changes for China's Yangtze River Basin

NASA Technical Reports Server (NTRS)

Long, Di; Yang, Yuting; Yoshihide, Wada; Hong, Yang; Liang, Wei; Chen, Yaning; Yong, Bin; Hou, Aizhong; Wei, Jiangfeng; Chen, Lu

2015-01-01

This study used a global hydrological model (GHM), PCR-GLOBWB, which simulates surface water storage changes, natural and human induced groundwater storage changes, and the interactions between surface water and subsurface water, to generate scaling factors by mimicking low-pass filtering of GRACE signals. Signal losses in GRACE data were subsequently restored by the scaling factors from PCR-GLOBWB. Results indicate greater spatial heterogeneity in scaling factor from PCR-GLOBWB and CLM4.0 than that from GLDAS-1 Noah due to comprehensive simulation of surface and subsurface water storage changes for PCR-GLOBWB and CLM4.0. Filtered GRACE total water storage (TWS) changes applied with PCR-GLOBWB scaling factors show closer agreement with water budget estimates of TWS changes than those with scaling factors from other land surface models (LSMs) in China's Yangtze River basin. Results of this study develop a further understanding of the behavior of scaling factors from different LSMs or GHMs over hydrologically complex basins, and could be valuable in providing more accurate TWS changes for hydrological applications (e.g., monitoring drought and groundwater storage depletion) over regions where human-induced interactions between surface water and subsurface water are intensive.

A comparison of annual vertical crustal displacements from GPS and Gravity Recovery and Climate Experiment (GRACE) over Europe

NASA Astrophysics Data System (ADS)

van Dam, T.; Wahr, J.; LavalléE, David

2007-03-01

We compare approximately 3 years of GPS height residuals (with respect to the International Terrestrial Reference Frame) with predictions of vertical surface displacements derived from the Gravity Recovery and Climate Experiment (GRACE) gravity fields for stations in Europe. An annual signal fit to the residual monthly heights, corrected for atmospheric pressure and barotropic ocean loading effects, should primarily represent surface displacements due to long-wavelength variations in water storage. A comparison of the annual height signal from GPS and GRACE over Europe indicates that at most sites, the annual signals do not agree in amplitude or phase. We find that unlike the annual signal predicted from GRACE, the annual signal in the GPS heights is not coherent over the region, displaying significant variability from site to site. Confidence in the GRACE data and the unlikely possibility of large-amplitude small-scale features in the load field not captured by the GRACE data leads us to conclude that some of the discrepancy between the GPS and GRACE observations is due to technique errors in the GPS data processing. This is evidenced by the fact that the disagreement between GPS and GRACE is largest at coastal sites, where mismodeling of the semidiurnal ocean tidal loading signal can result in spurious annual signals.

GRace: a MATLAB-based application for fitting the discrimination-association model.

PubMed

Stefanutti, Luca; Vianello, Michelangelo; Anselmi, Pasquale; Robusto, Egidio

2014-10-28

The Implicit Association Test (IAT) is a computerized two-choice discrimination task in which stimuli have to be categorized as belonging to target categories or attribute categories by pressing, as quickly and accurately as possible, one of two response keys. The discrimination association model has been recently proposed for the analysis of reaction time and accuracy of an individual respondent to the IAT. The model disentangles the influences of three qualitatively different components on the responses to the IAT: stimuli discrimination, automatic association, and termination criterion. The article presents General Race (GRace), a MATLAB-based application for fitting the discrimination association model to IAT data. GRace has been developed for Windows as a standalone application. It is user-friendly and does not require any programming experience. The use of GRace is illustrated on the data of a Coca Cola-Pepsi Cola IAT, and the results of the analysis are interpreted and discussed.

Large scale mass redistribution and surface displacement from GRACE and SLR

NASA Astrophysics Data System (ADS)

Cheng, M.; Ries, J. C.; Tapley, B. D.

2012-12-01

Mass transport between the atmosphere, ocean and solid earth results in the temporal variations in the Earth gravity field and loading induced deformation of the Earth. Recent space-borne observations, such as GRACE mission, are providing extremely high precision temporal variations of gravity field. The results from 10-yr GRACE data has shown a significant annual variations of large scale vertical and horizontal displacements occurring over the Amazon, Himalayan region and South Asia, African, and Russian with a few mm amplitude. Improving understanding from monitoring and modeling of the large scale mass redistribution and the Earth's response are a critical for all studies in the geosciences, in particular for determination of Terrestrial Reference System (TRS), including geocenter motion. This paper will report results for the observed seasonal variations in the 3-dimentional surface displacements of SLR and GPS tracking stations and compare with the prediction from time series of GRACE monthly gravity solution.

A Comparison of Groundwater Storage Using GRACE Data, Groundwater Levels, and a Hydrological Model in Californias Central Valley

NASA Technical Reports Server (NTRS)

Kuss, Amber; Brandt, William; Randall, Joshua; Floyd, Bridget; Bourai, Abdelwahab; Newcomer, Michelle; Skiles, Joseph; Schmidt, Cindy

2011-01-01

The Gravity Recovery and Climate Experiment (GRACE) measures changes in total water storage (TWS) remotely, and may provide additional insight to the use of well-based data in California's agriculturally productive Central Valley region. Under current California law, well owners are not required to report groundwater extraction rates, making estimation of total groundwater extraction difficult. As a result, other groundwater change detection techniques may prove useful. From October 2002 to September 2009, GRACE was used to map changes in TWS for the three hydrological regions (the Sacramento River Basin, the San Joaquin River Basin, and the Tulare Lake Basin) encompassing the Central Valley aquifer. Net groundwater storage changes were calculated from the changes in TWS for each of the three hydrological regions and by incorporating estimates for additional components of the hydrological budget including precipitation, evapotranspiration, soil moisture, snow pack, and surface water storage. The calculated changes in groundwater storage were then compared to simulated values from the California Department of Water Resource's Central Valley Groundwater- Surface Water Simulation Model (C2VSIM) and their Water Data Library (WDL) Geographic Information System (GIS) change in storage tool. The results from the three methods were compared. Downscaling GRACE data into the 21 smaller Central Valley sub-regions included in C2VSIM was also evaluated. This work has the potential to improve California's groundwater resource management and use of existing hydrological models for the Central Valley.

Comparison of observed and modeled seasonal crustal vertical displacements derived from multi-institution GPS and GRACE solutions

NASA Astrophysics Data System (ADS)

Gu, Yanchao; Fan, Dongming; You, Wei

2017-07-01

Eleven GPS crustal vertical displacement (CVD) solutions for 110 IGS08/IGS14 core stations provided by the International Global Navigation Satellite Systems Service Analysis Centers are compared with seven Gravity Recovery and Climate Experiment (GRACE)-modeled CVD solutions. The results of the internal comparison of the GPS solutions from multiple institutions imply large uncertainty in the GPS postprocessing. There is also evidence that GRACE solutions from both different institutions and different processing approaches (mascon and traditional spherical harmonic coefficients) show similar results, suggesting that GRACE can provide CVD results of good internal consistency. When the uncertainty of the GPS data is accounted for, the GRACE data can explain as much as 50% of the actual signals and more than 80% of the GPS annual signals. Our study strongly indicates that GRACE data have great potential to correct the nontidal loading in GPS time series.

Joint Assimilation of SMOS Brightness Temperature and GRACE Terrestrial Water Storage Observations for Improved Soil Moisture Estimation

NASA Technical Reports Server (NTRS)

Girotto, Manuela; Reichle, Rolf H.; De Lannoy, Gabrielle J. M.; Rodell, Matthew

2017-01-01

Observations from recent soil moisture missions (e.g. SMOS) have been used in innovative data assimilation studies to provide global high spatial (i.e. 40 km) and temporal resolution (i.e. 3-days) soil moisture profile estimates from microwave brightness temperature observations. In contrast with microwave-based satellite missions that are only sensitive to near-surface soil moisture (0 - 5 cm), the Gravity Recovery and Climate Experiment (GRACE) mission provides accurate measurements of the entire vertically integrated terrestrial water storage column but, it is characterized by low spatial (i.e. 150,000 km2) and temporal (i.e. monthly) resolutions. Data assimilation studies have shown that GRACE-TWS primarily affects (in absolute terms) deeper moisture storages (i.e., groundwater). This work hypothesizes that unprecedented soil water profile accuracy can be obtained through the joint assimilation of GRACE terrestrial water storage and SMOS brightness temperature observations. A particular challenge of the joint assimilation is the use of the two different types of measurements that are relevant for hydrologic processes representing different temporal and spatial scales. The performance of the joint assimilation strongly depends on the chosen assimilation methods, measurement and model error spatial structures. The optimization of the assimilation technique constitutes a fundamental step toward a multi-variate multi-resolution integrative assimilation system aiming to improve our understanding of the global terrestrial water cycle.

Joint assimilation of SMOS brightness temperature and GRACE terrestrial water storage observations for improved soil moisture estimation

NASA Astrophysics Data System (ADS)

Girotto, M.; Reichle, R. H.; De Lannoy, G.; Rodell, M.

2017-12-01

Observations from recent soil moisture missions (e.g. SMOS) have been used in innovative data assimilation studies to provide global high spatial (i.e. 40 km) and temporal resolution (i.e. 3-days) soil moisture profile estimates from microwave brightness temperature observations. In contrast with microwave-based satellite missions that are only sensitive to near-surface soil moisture (0-5 cm), the Gravity Recovery and Climate Experiment (GRACE) mission provides accurate measurements of the entire vertically integrated terrestrial water storage column but, it is characterized by low spatial (i.e. 150,000 km2) and temporal (i.e. monthly) resolutions. Data assimilation studies have shown that GRACE-TWS primarily affects (in absolute terms) deeper moisture storages (i.e., groundwater). This work hypothesizes that unprecedented soil water profile accuracy can be obtained through the joint assimilation of GRACE terrestrial water storage and SMOS brightness temperature observations. A particular challenge of the joint assimilation is the use of the two different types of measurements that are relevant for hydrologic processes representing different temporal and spatial scales. The performance of the joint assimilation strongly depends on the chosen assimilation methods, measurement and model error spatial structures. The optimization of the assimilation technique constitutes a fundamental step toward a multi-variate multi-resolution integrative assimilation system aiming to improve our understanding of the global terrestrial water cycle.

In silico analysis of decomposed reflectances of C3 and C4 plants aiming at the effective assessment of crop needs

NASA Astrophysics Data System (ADS)

Baranoski, Gladimir V. G.; Van Leeuwen, Spencer; Chen, Tenn F.

2017-04-01

By separating the surface and subsurface components of foliar hyperspectral signatures using polarization optics, it is possible to enhance the remote discrimination of different plant species and optimize the assessment of different factors associated with their health status. These initiatives, in turn, can lead to higher crop yield and lower environmental impact. It is important to consider, however, that the main varieties of crops, represented by C3 (e.g., soy) and C4 (e.g., maize) plants, have markedly distinct morphological characteristics. Accordingly, the influence of these characteristics on their interactions with impinging light may affect the selection of optimal probe wavelengths for specific applications making use of combined hyperspectral and polarization measurements. In this paper, we compare the sensitivity of the total (including surface and subsurface components) and subsurface reflectance responses of C3 and C4 plants to different spectral and geometrical light incidence conditions. This investigation is supported by measured biophysical data and predictive light transport simulations. The results of our comparisons indicate that the total and subsurface reflectance responses of C3 and C4 plants depict well-defined patterns of sensitivity for varying illumination conditions. We believe that these patterns should be considered in the design of high-fidelity crop discrimination and monitoring procedures.

Life, performance and safety of Grace rechargeable lithium-titanium disulfide cells

NASA Astrophysics Data System (ADS)

Zuckerbrod, D.; Giovannoni, R. T.; Grossman, K. R.

The development of rechargeable Li-TiS2 cells is discussed. This proprietary process produces thin, flexible TiS2 cathodes with a life in excess of 500 cycles. TiS2 utilization of 93 percent is typically achieved at a C/5 discharge rate. A life of 200 cycles has been achieved for AA-size cells at a C/5 discharge rate and 60 cycles at the C rate. The practical energy density is 115 Wh/kg. Safety testing is underway. Vibration and high altitude did not cause venting. Crushing did not result in ignition or temperature rise. Forced overcharge and overdischarge did not result in skin temperatures above 40 C. The peak skin temperature during the short-circuit test was 120 C. Safety analyses point to the need for careful control of electrolyte volume and the benefits of a fusible separator. Grace is developing such a separator, which would shut down the electrochemical cell reaction at a temperature of 130 C.

Stable C &N isotopes in 2100 Year-B.P. human bone collagen indicate rare dietary dominance of C4 plants in NE-Italy.

PubMed

Laffranchi, Zita; Huertas, Antonio Delgado; Jiménez Brobeil, Sylvia A; Torres, Arsenio Granados; Riquelme Cantal, Jose A

2016-12-09

C 4 plants (e.g. maize, millet), part of our current diet, are only endemic of reduced areas in South-Europe due to their need of warm climates. Since the first vestiges of agriculture in Europe remains of C 4 plants were recorded but their overall proportion in the human diet remains unknown. Therefore, isotopic (δ 13 C and δ 15 N) composition of bone collagen from the skeletal remains (human and animals) of a Celtic population, Cenomani Gauls, from Verona (3 rd to 1 st century BC) in the NE Italy provide a new perspective on this matter. The δ 13 C collagen values of 90 human skeletal individuals range between -20.2‰ and -9.7‰ (V-PDB) with a mean value of -15.3‰. As present day C 4 plants have δ 13 C values around -11‰, which is equivalent to -9.5‰ for samples of preindustrial age, the less negative δ 13 C values in these individuals indicate a diet dominated by C 4 plants. This palaeodietary study indicates that some European populations predominantly consumed cultivated C 4 plants 2100 year B.P. This is supported by the paleobotanical records and ancient Roman sources (e.g. Pliny the Elder), which indicate that millet was a staple food in South-Europe.

Stable C & N isotopes in 2100 Year-B.P. human bone collagen indicate rare dietary dominance of C4 plants in NE-Italy

NASA Astrophysics Data System (ADS)

Laffranchi, Zita; Huertas, Antonio Delgado; Jiménez Brobeil, Sylvia A.; Torres, Arsenio Granados; Riquelme Cantal, Jose A.

2016-12-01

C4 plants (e.g. maize, millet), part of our current diet, are only endemic of reduced areas in South-Europe due to their need of warm climates. Since the first vestiges of agriculture in Europe remains of C4 plants were recorded but their overall proportion in the human diet remains unknown. Therefore, isotopic (δ13C and δ15N) composition of bone collagen from the skeletal remains (human and animals) of a Celtic population, Cenomani Gauls, from Verona (3rd to 1st century BC) in the NE Italy provide a new perspective on this matter. The δ13C collagen values of 90 human skeletal individuals range between -20.2‰ and -9.7‰ (V-PDB) with a mean value of -15.3‰. As present day C4 plants have δ13C values around -11‰, which is equivalent to -9.5‰ for samples of preindustrial age, the less negative δ13C values in these individuals indicate a diet dominated by C4 plants. This palaeodietary study indicates that some European populations predominantly consumed cultivated C4 plants 2100 year B.P. This is supported by the paleobotanical records and ancient Roman sources (e.g. Pliny the Elder), which indicate that millet was a staple food in South-Europe.

Stable C & N isotopes in 2100 Year-B.P. human bone collagen indicate rare dietary dominance of C4 plants in NE-Italy

PubMed Central

Laffranchi, Zita; Huertas, Antonio Delgado; Jiménez Brobeil, Sylvia A.; Torres, Arsenio Granados; Riquelme Cantal, Jose A.

2016-01-01

C4 plants (e.g. maize, millet), part of our current diet, are only endemic of reduced areas in South-Europe due to their need of warm climates. Since the first vestiges of agriculture in Europe remains of C4 plants were recorded but their overall proportion in the human diet remains unknown. Therefore, isotopic (δ13C and δ15N) composition of bone collagen from the skeletal remains (human and animals) of a Celtic population, Cenomani Gauls, from Verona (3rd to 1st century BC) in the NE Italy provide a new perspective on this matter. The δ13C collagen values of 90 human skeletal individuals range between −20.2‰ and −9.7‰ (V-PDB) with a mean value of −15.3‰. As present day C4 plants have δ13C values around −11‰, which is equivalent to −9.5‰ for samples of preindustrial age, the less negative δ13C values in these individuals indicate a diet dominated by C4 plants. This palaeodietary study indicates that some European populations predominantly consumed cultivated C4 plants 2100 year B.P. This is supported by the paleobotanical records and ancient Roman sources (e.g. Pliny the Elder), which indicate that millet was a staple food in South-Europe. PMID:27934943

Assimilation of Terrestrial Water Storage from GRACE in a Snow-Dominated Basin

NASA Technical Reports Server (NTRS)

Forman, Barton A.; Reichle, R. H.; Rodell, M.

2011-01-01

Terrestrial water storage (TWS) information derived from Gravity Recovery and Climate Experiment (GRACE) measurements is assimilated into a land surface model over the Mackenzie River basin located in northwest Canada. Assimilation is conducted using an ensemble Kalman smoother (EnKS). Model estimates with and without assimilation are compared against independent observational data sets of snow water equivalent (SWE) and runoff. For SWE, modest improvements in mean difference (MD) and root mean squared difference (RMSD) are achieved as a result of the assimilation. No significant differences in temporal correlations of SWE resulted. Runoff statistics of MD remain relatively unchanged while RMSD statistics, in general, are improved in most of the sub-basins. Temporal correlations are degraded within the most upstream sub-basin, but are, in general, improved at the downstream locations, which are more representative of an integrated basin response. GRACE assimilation using an EnKS offers improvements in hydrologic state/flux estimation, though comparisons with observed runoff would be enhanced by the use of river routing and lake storage routines within the prognostic land surface model. Further, GRACE hydrology products would benefit from the inclusion of better constrained models of post-glacial rebound, which significantly affects GRACE estimates of interannual hydrologic variability in the Mackenzie River basin.

The soil microbial community composition and soil microbial carbon uptake are more affected by soil type than by different vegetation types (C3 and C4 plants) and seasonal changes

NASA Astrophysics Data System (ADS)

Griselle Mellado Vazquez, Perla; Lange, Markus; Gleixner, Gerd

2016-04-01

This study investigates the influence of different vegetation types (C3 and C4 plants), soil type and seasonal changes on the soil microbial biomass, soil microbial community composition and soil microbial carbon (C) uptake. We collected soil samples in winter (non-growing season) and summer (growing season) in 2012 from an experimental site cropping C3 and C4 plants for 6 years on two different soil types (sandy and clayey). The amount of phospholipid fatty acids (PLFAs) and their compound-specific δ13C values were used to determined microbial biomass and the flow of C from plants to soil microorganisms, respectively. Higher microbial biomass was found in the growing season. The microbial community composition was mainly explained by soil type. Higher amounts of SOC were driving the predominance of G+ bacteria, actinobacteria and cyclic G- bacteria in sandy soils, whereas root biomass was significantly related to the increased proportions of G- bacteria in clayey soils. Plant-derived C in G- bacteria increased significantly in clayey soils in the growing season. This increase was positively and significantly driven by root biomass. Moreover, changes in plant-derived C among microbial groups pointed to specific capabilities of different microbial groups to decompose distinct sources of C. We concluded that soil texture and favorable growth conditions driven by rhizosphere interactions are the most important factors controlling the soil microbial community. Our results demonstrate that a change of C3 plants vs. C4 plants has only a minor effect on the soil microbial community. Thus, such experiments are well suited to investigate soil organic matter dynamics as they allow to trace the C flow from plants into the soil microbial community without changing the community abundance and composition.

Interfacial coupling induced direct Z scheme water splitting in metal-free photocatalyst: C3N/g-C3N4 heterojunctions.

PubMed

Wang, Jiajun; Li, Xiaoting; You, Ya; Xintong, Yang; Wang, Ying; Li, Qunxiang

2018-06-21

Mimicking the natural photosynthesis in green plants, artificial Z-scheme photocatalysis enables more efficient utilization of solar energy for photocatalytic water splitting. Most currently designed g-C3N4-based Z-scheme heterojunctions are usually based on metal-containing semiconductor photocatalysts, thus exploiting metal-free photocatalysts for Z-scheme water splitting is of huge interest. Herein, we propose two metal-free C3N/g-C3N4 heterojunctions with the C3N monolayer covering g-C3N4 sheet (monolayer or bilayer) and systematically explore their electronic structures, charge distributions and photocatalytic properties by performing extensive hybrid density functional calculations. We clearly reveal that the relative strong built-in electric fields around their respective interface regions, caused by the charge transfer from C3N monolayer to g-C3N4 monolayer or bilayer, result in the bands bending, renders the transfer of photogenerated carriers in these two heterojunctions following the Z-scheme instead of the type-II pathway. Moreover, the photogenerated electrons and holes in these two C3N/g-C3N4 heterojunctions not only can be efficiently separated, but also have strong redox abilities for water oxidation and reduction. Compared with the isolated g-C3N4 sheets, the light absorption in visible to near-infrared region are significantly enhanced in these proposed heterojunctions. These theoretical findings suggest that these proposed metal-free C3N/g-C3N4 heterojunctions are promising direct Z-scheme photocatalysts for solar water splitting. © 2018 IOP Publishing Ltd.

Secular gravity variation at Svalbard (Norway) from ground observations and GRACE satellite data

NASA Astrophysics Data System (ADS)

Mémin, A.; Rogister, Y.; Hinderer, J.; Omang, O. C.; Luck, B.

2011-03-01

The Svalbard archipelago, Norway, is affected by both the present-day ice melting (PDIM) and Glacial Isostatic Adjustment (GIA) subsequent to the Last Pleistocene deglaciation. The induced deformation of the Earth is observed by using different techniques. At the Geodetic Observatory in Ny-Ålesund, precise positioning measurements have been collected since 1991, a superconducting gravimeter (SG) has been installed in 1999, and six campaigns of absolute gravity (AG) measurements were performed between 1998 and 2007. Moreover, the Gravity Recovery and Climate Experiment (GRACE) satellite mission provides the time variation of the Earth gravity field since 2002. The goal of this paper is to estimate the present rate of ice melting by combining geodetic observations of the gravity variation and uplift rate with geophysical modelling of both the GIA and Earth's response to the PDIM. We estimate the secular gravity variation by superimposing the SG series with the six AG measurements. We collect published estimates of the vertical velocity based on GPS and VLBI data. We analyse the GRACE solutions provided by three groups (CSR, GFZ, GRGS). The crux of the problem lies in the separation of the contributions from the GIA and PDIM to the Earth's deformation. To account for the GIA, we compute the response of viscoelastic Earth models having different radial structures of mantle viscosity to the deglaciation histories included in the models ICE-3G or ICE-5G. To account for the effect of PDIM, we compute the deformation of an elastic Earth model for six models of ice-melting extension and rates. Errors in the gravity variation and vertical velocity are estimated by taking into account the measurement uncertainties and the variability of the GRACE solutions and GIA and PDIM models. The ground observations agree with models that involve a current ice loss of 25 km3 water equivalent yr-1 over Svalbard, whereas the space observations give a value in the interval [5, 18] km3

Enhanced photocatalytic performances of ultrafine g-C3N4 nanosheets obtained by gaseous stripping with wet nitrogen

NASA Astrophysics Data System (ADS)

Fan, Chengkong; Feng, Qiang; Xu, Guangqing; Lv, Jun; Zhang, Yong; Liu, Jiaqin; Qin, Yongqiang; Wu, Yucheng

2018-01-01

Graphitic carbon nitride (g-C3N4) is a promising heterogeneous photocatalyst for organics pollutants degradation and water splitting. Herein, we highlight an available pathway to prepare the ultrafine g-C3N4 nanosheets by gaseous stripping of bulk g-C3N4 in wet nitrogen. As comparison, g-C3N4 treated in air and nitrogen atmospheres are also prepared. The obtained products are characterized with X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy and Fourier transform infrared spectra, respectively. Well dispersed g-C3N4 nanosheets can be obtained by this gaseous stripping process in wet nitrogen, which possess much higher specific surface area (211.2 m2 g-1) than that of bulk g-C3N4 (15.3 m2 g-1). Both RhB degradation and water splitting are applied to characterize the photocatalytic performances of the ultrafine g-C3N4 nanosheets. The g-C3N4 (w-N2) nanosheets can degrade 20 mg/L RhB completely within 12 min under visible light illumination, which is 5.32 times faster than that of bulk g-C3N4. Also, the g-C3N4 (w-N2) nanosheets possess the highest photocatalytic hydrogen evolution rate of 1113.48 μmol h-1 g-1 under visible light illumination, which is 6 times that of bulk g-C3N4. The mechanisms of enhancing the photocatalytic performance are discussed to be the higher oxidation ability of VB and higher specific surface area (211.2 m2/g) of the ultrafine g-C3N4 nanosheets.

Characterization of the recombinant copper chaperone (CCS) from the plant Glycine (G.) max.

PubMed

Sagasti, Sara; Yruela, Inmaculada; Bernal, Maria; Lujan, Maria A; Frago, Susana; Medina, Milagros; Picorel, Rafael

2011-02-01

The goal of the present work was to characterize the recombinant copper chaperone (CCS) from soybean. Very little is known about plant copper chaperones, which makes this study of current interest, and allows for a comparison with the better known homologues from yeast and humans. To obtain sizeable amounts of pure protein suitable for spectroscopic characterization, we cloned and overexpressed the G. max CCS chaperone in E. coli in the presence of 0.5 mM CuSO(4) and 0.5 mM ZnSO(4) in the broth. A pure protein preparation was obtained by using two IMAC steps and pH gradient chromatography. Most of the proteins were obtained as apo-form, devoid of copper atoms. The chaperone showed a high content (i.e., over 40%) of loops, turns and random coil as determined both by circular dichroism and homology modelling. The homology 3-D structural model suggests the protein might fold in three structural protein domains. The 3-D model along with the primary structure and spectroscopic data may suggest that copper atoms occupy the two metal binding sites, MKCEGC and CTC, within the N-terminal domain I and C-terminal domain III, respectively. But only one Zn-binding site was obtained spectroscopically.

Multiplex Immunoassay for Lyme Disease Using VlsE1-IgG and pepC10-IgM Antibodies: Improving Test Performance through Bioinformatics ▿

PubMed Central

Porwancher, Richard B.; Hagerty, C. Greg; Fan, Jianqing; Landsberg, Lisa; Johnson, Barbara J. B.; Kopnitsky, Mark; Steere, Allen C.; Kulas, Karen; Wong, Susan J.

2011-01-01

The Centers for Disease Control and Prevention currently recommends a 2-tier serologic approach to Lyme disease laboratory diagnosis, comprised of an initial serum enzyme immunoassay (EIA) for antibody to Borrelia burgdorferi followed by supplementary IgG and IgM Western blotting of EIA-positive or -equivocal samples. Western blot accuracy is limited by subjective interpretation of weakly positive bands, false-positive IgM immunoblots, and low sensitivity for detection of early disease. We developed an objective alternative second-tier immunoassay using a multiplex microsphere system that measures VlsE1-IgG and pepC10-IgM antibodies simultaneously in the same sample. Our study population comprised 79 patients with early acute Lyme disease, 82 patients with early-convalescent-phase disease, 47 patients with stage II and III disease, 34 patients post-antibiotic treatment, and 794 controls. A bioinformatic technique called partial receiver-operator characteristic (ROC) regression was used to combine individual antibody levels into a single diagnostic score with a single cutoff; this technique enhances test performance when a high specificity is required (e.g., ≥95%). Compared to Western blotting, the multiplex assay was equally specific (95.6%) but 20.7% more sensitive for early-convalescent-phase disease (89.0% versus 68.3%, respectively; 95% confidence interval [95% CI] for difference, 12.1% to 30.9%) and 12.5% more sensitive overall (75.0% versus 62.5%, respectively; 95% CI for difference, 8.1% to 17.1%). As a second-tier test, a multiplex assay for VlsE1-IgG and pepC10-IgM antibodies performed as well as or better than Western blotting for Lyme disease diagnosis. Prospective validation studies appear to be warranted. PMID:21367982

A one- and two-dimensional NMR study of the B to Z transition of (m5dC-dG)3 in methanolic solution.

PubMed Central

Feigon, J; Wang, A H; van der Marel, G A; Van Boom, J H; Rich, A

1984-01-01

The deoxyribose hexanucleoside pentaphosphate (m5dC-dG)3 has been studied by 500 MHz 1H NMR in D2O (0.1 M NaCl) and in D2O/deuterated methanol mixtures. Two conformations, in slow equilibrium on the NMR time scale, were detected in methanolic solution. Two-dimensional nuclear Overhauser effect (NOE) experiments were used to assign the base and many of the sugar resonances as well as to determine structural features for both conformations. The results were consistent with the an equilibrium in solution between B-DNA and Z-DNA. The majority of the molecules have a B-DNA structure in low-salt D2O and a Z-DNA structure at high methanol concentrations. A cross-strand NOE between methyl groups on adjacent cytosines is observed for Z-DNA but not B-DNA. The B-DNA conformation predominates at low methanol concentrations and is stabilized by increasing temperature, while the Z-DNA conformation predominates at high methanol concentrations and low temperatures. 31P NMR spectra gave results consistent with those obtained by 1H NMR. Comparison of the 31P spectra with those obtained on poly(dG-m5dC) allow assignment of the lower field resonances to GpC in the Z conformation. PMID:6694910

Assessing Global Water Storage Variability from GRACE: Trends, Seasonal Cycle, Subseasonal Anomalies and Extremes.

PubMed

Humphrey, Vincent; Gudmundsson, Lukas; Seneviratne, Sonia I

Throughout the past decade, the Gravity Recovery and Climate Experiment (GRACE) has given an unprecedented view on global variations in terrestrial water storage. While an increasing number of case studies have provided a rich overview on regional analyses, a global assessment on the dominant features of GRACE variability is still lacking. To address this, we survey key features of temporal variability in the GRACE record by decomposing gridded time series of monthly equivalent water height into linear trends, inter-annual, seasonal, and subseasonal (intra-annual) components. We provide an overview of the relative importance and spatial distribution of these components globally. A correlation analysis with precipitation and temperature reveals that both the inter-annual and subseasonal anomalies are tightly related to fluctuations in the atmospheric forcing. As a novelty, we show that for large regions of the world high-frequency anomalies in the monthly GRACE signal, which have been partly interpreted as noise, can be statistically reconstructed from daily precipitation once an adequate averaging filter is applied. This filter integrates the temporally decaying contribution of precipitation to the storage changes in any given month, including earlier precipitation. Finally, we also survey extreme dry anomalies in the GRACE record and relate them to documented drought events. This global assessment sets regional studies in a broader context and reveals phenomena that had not been documented so far.

Global models underestimate large decadal declining and rising water storage trends relative to GRACE satellite data

PubMed Central

Scanlon, Bridget R.; Zhang, Zizhan; Save, Himanshu; Sun, Alexander Y.; van Beek, Ludovicus P. H.; Wiese, David N.; Reedy, Robert C.; Longuevergne, Laurent; Döll, Petra; Bierkens, Marc F. P.

2018-01-01

Assessing reliability of global models is critical because of increasing reliance on these models to address past and projected future climate and human stresses on global water resources. Here, we evaluate model reliability based on a comprehensive comparison of decadal trends (2002–2014) in land water storage from seven global models (WGHM, PCR-GLOBWB, GLDAS NOAH, MOSAIC, VIC, CLM, and CLSM) to trends from three Gravity Recovery and Climate Experiment (GRACE) satellite solutions in 186 river basins (∼60% of global land area). Medians of modeled basin water storage trends greatly underestimate GRACE-derived large decreasing (≤−0.5 km3/y) and increasing (≥0.5 km3/y) trends. Decreasing trends from GRACE are mostly related to human use (irrigation) and climate variations, whereas increasing trends reflect climate variations. For example, in the Amazon, GRACE estimates a large increasing trend of ∼43 km3/y, whereas most models estimate decreasing trends (−71 to 11 km3/y). Land water storage trends, summed over all basins, are positive for GRACE (∼71–82 km3/y) but negative for models (−450 to −12 km3/y), contributing opposing trends to global mean sea level change. Impacts of climate forcing on decadal land water storage trends exceed those of modeled human intervention by about a factor of 2. The model-GRACE comparison highlights potential areas of future model development, particularly simulated water storage. The inability of models to capture large decadal water storage trends based on GRACE indicates that model projections of climate and human-induced water storage changes may be underestimated. PMID:29358394

Global models underestimate large decadal declining and rising water storage trends relative to GRACE satellite data.

PubMed

Scanlon, Bridget R; Zhang, Zizhan; Save, Himanshu; Sun, Alexander Y; Müller Schmied, Hannes; van Beek, Ludovicus P H; Wiese, David N; Wada, Yoshihide; Long, Di; Reedy, Robert C; Longuevergne, Laurent; Döll, Petra; Bierkens, Marc F P

2018-02-06

Assessing reliability of global models is critical because of increasing reliance on these models to address past and projected future climate and human stresses on global water resources. Here, we evaluate model reliability based on a comprehensive comparison of decadal trends (2002-2014) in land water storage from seven global models (WGHM, PCR-GLOBWB, GLDAS NOAH, MOSAIC, VIC, CLM, and CLSM) to trends from three Gravity Recovery and Climate Experiment (GRACE) satellite solutions in 186 river basins (∼60% of global land area). Medians of modeled basin water storage trends greatly underestimate GRACE-derived large decreasing (≤-0.5 km 3 /y) and increasing (≥0.5 km 3 /y) trends. Decreasing trends from GRACE are mostly related to human use (irrigation) and climate variations, whereas increasing trends reflect climate variations. For example, in the Amazon, GRACE estimates a large increasing trend of ∼43 km 3 /y, whereas most models estimate decreasing trends (-71 to 11 km 3 /y). Land water storage trends, summed over all basins, are positive for GRACE (∼71-82 km 3 /y) but negative for models (-450 to -12 km 3 /y), contributing opposing trends to global mean sea level change. Impacts of climate forcing on decadal land water storage trends exceed those of modeled human intervention by about a factor of 2. The model-GRACE comparison highlights potential areas of future model development, particularly simulated water storage. The inability of models to capture large decadal water storage trends based on GRACE indicates that model projections of climate and human-induced water storage changes may be underestimated. Copyright © 2018 the Author(s). Published by PNAS.

Deep Ocean Warming Assessed from Altimeters, GRACE, 3 In-situ Measurements, and a Non-Boussinesq OGCM

NASA Technical Reports Server (NTRS)

Song, Y. Tony; Colberg, Frank

2011-01-01

Observational surveys have shown significant oceanic bottom water warming, but they are too spatially and temporally sporadic to quantify the deep ocean contribution to the present-day sea level rise (SLR). In this study, altimetry sea surface height (SSH), Gravity Recovery and Climate Experiment (GRACE) ocean mass, and in situ upper ocean (0-700 m) steric height have been assessed for their seasonal variability and trend maps. It is shown that neither the global mean nor the regional trends of altimetry SLR can be explained by the upper ocean steric height plus the GRACE ocean mass. A non-Boussinesq ocean general circulation model (OGCM), allowing the sea level to rise as a direct response to the heat added into the ocean, is then used to diagnose the deep ocean steric height. Constrained by sea surface temperature data and the top of atmosphere (TOA) radiation measurements, the model reproduces the observed upper ocean heat content well. Combining the modeled deep ocean steric height with observational upper ocean data gives the full depth steric height. Adding a GRACE-estimated mass trend, the data-model combination explains not only the altimetry global mean SLR but also its regional trends fairly well. The deep ocean warming is mostly prevalent in the Atlantic and Indian oceans, and along the Antarctic Circumpolar Current, suggesting a strong relation to the oceanic circulation and dynamics. Its comparison with available bottom water measurements shows reasonably good agreement, indicating that deep ocean warming below 700 m might have contributed 1.1 mm/yr to the global mean SLR or one-third of the altimeter-observed rate of 3.11 +/- 0.6 mm/yr over 1993-2008.

Homocysteine enhances the predictive value of the GRACE risk score in patients with ST-elevation myocardial infarction.

PubMed

Fan, Yan; Wang, Jianjun; Zhang, Sumei; Wan, Zhaofei; Zhou, Dong; Ding, Yanhong; He, Qinli; Xie, Ping

2017-09-01

The present study aims to investigate whether the addition of homocysteine level to the Global Registry of Acute Coronary Events (GRACE) risk score enhances its predictive value for clinical outcomes in ST-elevation myocardial infarction (STEMI). A total of 1143 consecutive patients with STEMI were included in this prospective cohort study. Homocysteine was detected, and the GRACE score was calculated. The predictive power of the GRACE score alone or combined with homocysteine was assessed by the receiver operating characteristic (ROC) analysis, methods of net reclassification improvement (NRI) and integrated discrimination improvement (IDI). During a median follow-up period of 36.7 months, 271 (23.7%) patients reached the clinical endpoints. It showed that the GRACE score and homocysteine could independently predict all-cause death [GRACE: HR=1.031 (1.024-1.039), p<0.001; homocysteine: HR=1.023 (1.018-1.028), p<0.001] and MACE [GRACE: HR=1.008 (1.005-1.011), p<0.001; homocysteine: HR=1.022 (1.018-1.025), p<0.001]. When they were used in combination to assess the clinical outcomes, the area under the ROC curve significantly increased from 0.786 to 0.884 (95% CI=0.067-0.128, Z=6.307, p<0.001) for all-cause death and from 0.678 to 0.759 (95% CI=0.055-0.108, Z=5.943, p<0.001) for MACE. The addition of homocysteine to the GRACE model improved NRI (all-cause death: 0.575, p<0.001; MACE: 0.621, p=0.008) and IDI (all-cause death: 0.083, p<0.001; MACE: 0.130, p=0.016), indicating effective discrimination and reclassification. Both the GRACE score and homocysteine are significant and independent predictors for clinical outcomes in patients with STEMI. A combination of them can develop a more predominant prediction for clinical outcomes in these patients.

An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

PubMed

Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

2018-06-01

: Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

Plant G-proteins come of age: Breaking the bond with animal models

NASA Astrophysics Data System (ADS)

Botella, Jimmy; Trusov, Yuri

2016-05-01

G-proteins are universal signal transducers mediating many cellular responses. Plant G-protein signaling has been modeled on the well-established animal paradigm but accumulated experimental evidence indicates that G-protein-dependent signaling in plants has taken a very different evolutionary path. Here we review the differences between plant and animal G-proteins reported over past two decades. Most importantly, while in animal systems the G-protein signaling cycle is activated by seven transmembrane-spanning G-protein coupled receptors, the existence of these type of receptors in plants is highly controversial. Instead plant G-proteins have been proven to be functionally associated with atypical receptors such as the Arabidopsis RGS1 and a number of receptor-like kinases. We propose that, instead of the GTP/GDP cycle used in animals, plant G-proteins are activated/de-activated by phosphorylation/de-phosphorylation. We discuss the need of a fresh new look at these signaling molecules and provide a hypothetical model that departs fromthe accepted animal paradigm.

Plant G-Proteins Come of Age: Breaking the Bond with Animal Models.

PubMed

Trusov, Yuri; Botella, José R

2016-01-01

G-proteins are universal signal transducers mediating many cellular responses. Plant G-protein signaling has been modeled on the well-established animal paradigm but accumulated experimental evidence indicates that G-protein-dependent signaling in plants has taken a very different evolutionary path. Here we review the differences between plant and animal G-proteins reported over past two decades. Most importantly, while in animal systems the G-protein signaling cycle is activated by seven transmembrane-spanning G-protein coupled receptors, the existence of these type of receptors in plants is highly controversial. Instead plant G-proteins have been proven to be functionally associated with atypical receptors such as the Arabidopsis RGS1 and a number of receptor-like kinases. We propose that, instead of the GTP/GDP cycle used in animals, plant G-proteins are activated/de-activated by phosphorylation/de-phosphorylation. We discuss the need of a fresh new look at these signaling molecules and provide a hypothetical model that departs from the accepted animal paradigm.

Measuring the Value of Earth Observation Information with the Gravity Research and Climate Experiment (GRACE) Satellite

NASA Astrophysics Data System (ADS)

Bernknopf, R.; Kuwayama, Y.; Brookshire, D.; Macauley, M.; Zaitchik, B.; Pesko, S.; Vail, P.

2014-12-01

Determining how much to invest in earth observation technology depends in part on the value of information (VOI) that can be derived from the observations. We design a framework and then evaluate the value-in-use of the NASA Gravity Research and Climate Experiment (GRACE) for regional water use and reliability in the presence of drought. As a technology that allows measurement of water storage, the GRACE Data Assimilation System (DAS) provides information that is qualitatively different from that generated by other water data sources. It provides a global, reproducible grid of changes in surface and subsurface water resources on a frequent and regular basis. Major damages from recent events such as the 2012 Midwest drought and the ongoing drought in California motivate the need to understand the VOI from remotely sensed data such as that derived from GRACE DAS. Our conceptual framework models a dynamic risk management problem in agriculture. We base the framework on information from stakeholders and subject experts. The economic case for GRACE DAS involves providing better water availability information. In the model, individuals have a "willingness to pay" (wtp) for GRACE DAS - essentially, wtp is an expression of savings in reduced agricultural input costs and for costs that are influenced by regional policy decisions. Our hypothesis is that improvements in decision making can be achieved with GRACE DAS measurements of water storage relative to data collected from groundwater monitoring wells and soil moisture monitors that would be relied on in the absence of GRACE DAS. The VOI is estimated as a comparison of outcomes. The California wine grape industry has features that allow it to be a good case study and a basis for extrapolation to other economic sectors. We model water use in this sector as a sequential decision highlighting the attributes of GRACE DAS input as information for within-season production decisions as well as for longer-term water reliability.

Contributions of GRACE to Understanding of Spatial Distribution of Spring Flooding in Snow-dominated Afghan Watersheds

NASA Astrophysics Data System (ADS)

Roningen, J. M.; Daly, S. F.; Vuyovich, C.

2012-12-01

In Afghanistan, where both historical and current in situ hydrologic records are extremely limited, the development and stability operations communities require guidance as to how to best utilize capabilities in remote sensing of the water cycle to understand and predict seasonal flooding. In this study, three versions of Level 3 GRACE datasets (CSR, CSR 4.1 and GRGS) are compared to TRMM 3B42 products, SSM/I-derived snow water equivalent products (SWE), and MODIS-derived flooding extents to assess their potential for contributing to an understanding of the spatial and temporal patterns of spring flooding in Afghanistan from the period 2002-2012. GRACE, which allows for assessment of correlations between small-scale temporal changes in the gravitational field of the earth with changes in the total water storage in the hydrosphere, opens the possibility for incorporation of subsurface components of the hydrologic cycle into remote monitoring and modeling of water resources. GRACE data exhibit clear seasonal fluctuations in many areas of Afghanistan, but an assessment is required of the extent to which this data can be disaggregated spatially and related to geographic patterns of precipitation, snowmelt and flooding. In this study, TRMM 3B42 and SSM/I-derived SWE datasets were used as proxies for measured precipitation. These datasets were convolved with a Gaussian filter with a 300 km half-radius at each reported GRACE data point in order to compensate for spatial correlation ('leakage' effects) in the GRACE data. In mountainous and snowmelt-dominated basins such as the majority of those in this study, GRACE analyses that make use of land surface model (LSM) derived estimates may not provide adequate characterization of snow water equivalent and soil moisture in this region. Therefore, soil and subsurface moisture were evaluated as a single storage component using the GRACE data, and flooding occurrence was evaluated as a qualitative surface expression of this

Detection of Human Toxoplasma-Specific Immunoglobulins A, M, and G with a Recombinant Toxoplasma gondii Rop2 Protein

PubMed Central

Martin, Valentina; Arcavi, Miriam; Santillan, Graciela; Amendoeira, Maria Regina R.; De Souza Neves, Elizabeth; Griemberg, Gloria; Guarnera, Eduardo; Garberi, Juan C.; Angel, Sergio O.

1998-01-01

The Toxoplasma gondii rhoptry protein Rop2 was expressed in Escherichia coli as a fusion protein containing 44 kDa of the 55-kDa mature Rop2, supplied with six histidyl residues at the N-terminal end (Rop2196–561). Humoral response during Toxoplasma infection of humans was analyzed by immunoglobulin G (IgG), IgA, and IgM enzyme-linked immunosorbent assay with Rop2196–561 as the antigen substrate. The analyzed sera were divided according to T. gondii-specific serological tests (IgG, IgA, or IgM indirect immunofluorescence and IgA or IgM immunosorbent agglutination assay) as group A (IgG+ IgA− IgM−; n = 35), group B (IgG+ IgA+ IgM+; n = 21), group C (IgG+ IgA+ IgM−; n = 5), and group D (IgG+ IgA− IgM+; n = 16). Twenty-six T. gondii-seronegative sera from individuals with other infections were also included (group E). Anti-Rop2 IgG antibodies were detected in 82.8% of group A sera and in 97.6% of the sera with acute-phase marker immunoglobulins (groups B, C, and D). The percentage of IgA antibody reactivity against Rop2196–561 was 17.1% in group A, 50% in group D, and 80.8% in groups B and C. The percentage of IgM antibody reactivity was 0% in groups A and C and 62% in groups B and D. Sera from group E failed to show IgA, IgM, or IgG antibody reactivity. Since T. gondii Rop2 elicits a strong humoral response from an early stage of infection, it is suggested that recombinant Rop2196–561 would be suitable for use in diagnostic systems, in combination with other T. gondii antigens, to detect specific IgG, IgA, and IgM antibodies. PMID:9729528

Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging

PubMed Central

Bhargava, Yogesh; Hampden-Smith, Kathryn; Chachlaki, Konstantina; Wood, Katherine C.; Vernon, Jeffrey; Allerston, Charles K.; Batchelor, Andrew M.; Garthwaite, John

2013-01-01

Genetically-encoded biosensors are powerful tools for understanding cellular signal transduction mechanisms. In aiming to investigate cGMP signaling in neurones using the EGFP-based fluorescent biosensor, FlincG (fluorescent indicator for cGMP), we encountered weak or non-existent fluorescence after attempted transfection with plasmid DNA, even in HEK293T cells. Adenoviral infection of HEK293T cells with FlincG, however, had previously proved successful. Both constructs were found to harbor a mutation in the EGFP domain and had a tail of 17 amino acids at the C-terminus that differed from the published sequence. These discrepancies were systematically examined, together with mutations found beneficial for the related GCaMP family of Ca2+ biosensors, in a HEK293T cell line stably expressing both nitric oxide (NO)-activated guanylyl cyclase and phosphodiesterase-5. Restoring the mutated amino acid improved basal fluorescence whereas additional restoration of the correct C-terminal tail resulted in poor cGMP sensing as assessed by superfusion of either 8-bromo-cGMP or NO. Ultimately, two improved FlincGs were identified: one (FlincG2) had the divergent tail and gave moderate basal fluorescence and cGMP response amplitude and the other (FlincG3) had the correct tail, a GCaMP-like mutation in the EGFP region and an N-terminal tag, and was superior in both respects. All variants tested were strongly influenced by pH over the physiological range, in common with other EGFP-based biosensors. Purified FlincG3 protein exhibited a lower cGMP affinity (0.89 μM) than reported for the original FlincG (0.17 μM) but retained rapid kinetics and a 230-fold selectivity over cAMP. Successful expression of FlincG2 or FlincG3 in differentiated N1E-115 neuroblastoma cells and in primary cultures of hippocampal and dorsal root ganglion cells commends them for real-time imaging of cGMP dynamics in neural (and other) cells, and in their subcellular specializations. PMID:24068983

Leaf and plant water use efficiency of C{sub 4} species grown at glacial to elevated CO{sub 2} concentrations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Polley, H.W.; Johnson, H.B.; Mayeux, H.S.

1996-03-01

Leaf gas exchange was measured on C{sub 4} plants grown from near glacial to current CO{sub 2} concentrations (200-350 {mu}mol mol{sup -1}) and from the current concentration to possible future levels (near 700 and 1000 {mu}mol mol{sup -1}) to test the prediction that intrinsic water use efficiency (CO{sub 2} assimilation [A]/stomatal conductance to water [g]) would rise by a similar relative amount as CO{sub 2} concentration. Studied were species differing in growth form or life history, the perennial grass Schizachyrium scoparium (little bluestem), perennial shrub Atriplex canescens (four-wing saltbush), and annual grass Schizachyrium scoparium (little bluestem), leaf A/g of themore » C{sub 4} species examined was stimulated proportionally more by a given relative increase in CO{sub 2} over subambient than by elevated concentrations. The ratio of the relative increase in A/g to that in CO{sub 2} exceeded unity in S, scoparium and A. canescens as CO{sub 2} rose from 700 to 1000 {mu}mol mol{sup -1}. At higher CO{sub 2} concentrations, A/g of the C{sub 4} perennials was similar to that expected for C{sub 3} plants. Since much of the potential response of C{sub 4} plants to CO{sub 4} perennials was similar to that expected for C{sub 3} plants. Since much of the potential response of C{sub 4} plants to CO{sub 2} often derives from higher water use efficiency (WUE), these results indicated that potential productivity of some C{sub 4} plants increased relatively more since glaciation than it will in the future. There also were large (>100%) differences in A/g and plant WUE (production/transpiration) at a given CO{sub 2} level among the plants examined that could influence the relative productivities of C{sub 4} species or growth forms and their interactions with C{sub 3} plants. 34 refs., 3 figs., 3 tabs.« less

Analysis of Terrestrial Water Storage Changes from GRACE and GLDAS

NASA Technical Reports Server (NTRS)

Syed, Tajdarul H.; Famiglietti, James S.; Rodell, Matthew; Chen, Jianli; Wilson, Clark R.

2008-01-01

Since March 2002, the Gravity Recovery and Climate Experiment (GRACE) has provided first estimates of land water storage variations by monitoring the time-variable component of Earth's gravity field. Here we characterize spatial-temporal variations in terrestrial water storage changes (TWSC) from GRACE and compare them to those simulated with the Global Land Data Assimilation System (GLDAS). Additionally, we use GLDAS simulations to infer how TWSC is partitioned into snow, canopy water and soil water components, and to understand how variations in the hydrologic fluxes act to enhance or dissipate the stores. Results quantify the range of GRACE-derived storage changes during the studied period and place them in the context of seasonal variations in global climate and hydrologic extremes including drought and flood, by impacting land memory processes. The role of the largest continental river basins as major locations for freshwater redistribution is highlighted. GRACE-based storage changes are in good agreement with those obtained from GLDAS simulations. Analysis of GLDAS-simulated TWSC illustrates several key characteristics of spatial and temporal land water storage variations. Global averages of TWSC were partitioned nearly equally between soil moisture and snow water equivalent, while zonal averages of TWSC revealed the importance of soil moisture storage at low latitudes and snow storage at high latitudes. Evapotranspiration plays a key role in dissipating globally averaged terrestrial water storage. Latitudinal averages showed how precipitation dominates TWSC variations in the tropics, evapotranspiration is most effective in the midlatitudes, and snowmelt runoff is a key dissipating flux at high latitudes. Results have implications for monitoring water storage response to climate variability and change, and for constraining land model hydrology simulations.

Glacier stagnant in central Karakorum during 2003 to 2008 derived from DEOS Mass Transport Model GRACE data and one monthly degree-day model

NASA Astrophysics Data System (ADS)

Zhang, Xiaowen; Zhang, Shiqiang; Xu, Junli

2016-10-01

Glacier change in central Karakorum is known as `anomony' in the late 1990s, where many glaciers expanded and numbers of glacier surged while most of glaciers in the Greater Himalaya rapidly retreated. However, the understanding of glacier change in this region is still poor. Glacier changes for the Hunza river basin (HRB) in central Karakorum during 2003 to 2008 were investigated from different data sources. The mass variation in HRB were estimated from the DEOS Mass Transport Model (DMT-1) GRACE data and the Variable Infiltration Capacity (VIC) model, and compared with the simulated glacier mass balance by one monthly degree-day model. The surface elevation difference of glaciers between ASTER DEM and SRTM were calculated. The mass variations from GRACE data suggest that the glacier mass balance in HRB during 2003-2007 has no clear trend. The cumulative mass balance is positive during 2003-2008. The average glacier surface elevation difference between SRTM DEM and ASTER DEM is 11.8+/-3.2 m. The average differences of glacier surface elevation of Batura glaciers in accumulation zones is increased with 0.88m.a-1, These results indicate that there is no significant glacier retreat during 1999 to 2008. The seasonal amplitude of simulated mass variation of the monthly degree-day model agreed well with that estimated from DMT-1 GRACE data, but the simulated glacier accumulation is less than that calculated from GRACE data. The main reason probably lies in that the precipitation of glaciers and ungalciated areas were underestimated, especially in alpine areas.

Results and Error Estimates from GRACE Forward Modeling over Antarctica

NASA Astrophysics Data System (ADS)

Bonin, Jennifer; Chambers, Don

2013-04-01

Forward modeling using a weighted least squares technique allows GRACE information to be projected onto a pre-determined collection of local basins. This decreases the impact of spatial leakage, allowing estimates of mass change to be better localized. The technique is especially valuable where models of current-day mass change are poor, such as over Antarctica. However when tested previously, the least squares technique has required constraints in the form of added process noise in order to be reliable. Poor choice of local basin layout has also adversely affected results, as has the choice of spatial smoothing used with GRACE. To develop design parameters which will result in correct high-resolution mass detection and to estimate the systematic errors of the method over Antarctica, we use a "truth" simulation of the Antarctic signal. We apply the optimal parameters found from the simulation to RL05 GRACE data across Antarctica and the surrounding ocean. We particularly focus on separating the Antarctic peninsula's mass signal from that of the rest of western Antarctica. Additionally, we characterize how well the technique works for removing land leakage signal from the nearby ocean, particularly that near the Drake Passage.

Arm-Locking with the GRACE Follow-On Laser Ranging Instrument

NASA Technical Reports Server (NTRS)

Thorpe, James Ira; Mckenzie, Kirk

2016-01-01

Arm-locking is a technique for stabilizing the frequency of a laser in an inter-spacecraft interferometer by using the spacecraft separation as the frequency reference. A candidate technique for future space-based gravitational wave detectors such as the Laser Interferometer Space Antenna (LISA), arm-locking has been extensive studied in this context through analytic models, time-domain simulations, and hardware-in-the-loop laboratory demonstrations. In this paper we show the Laser Ranging Instrument flying aboard the upcoming Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) mission provides an appropriate platform for an on-orbit demonstration of the arm-locking technique. We describe an arm-locking controller design for the GRACE-FO system and a series of time-domain simulations that demonstrate its feasibility. We conclude that it is possible to achieve laser frequency noise suppression of roughly two orders of magnitude around a Fourier frequency of 1Hz with conservative margins on the system's stability. We further demonstrate that `pulling' of the master laser frequency due to fluctuating Doppler shifts and lock acquisition transients is less than 100MHz over several GRACE-FO orbits. These findings motivate further study of the implementation of such a demonstration.

Arm locking with the GRACE follow-on laser ranging interferometer

NASA Astrophysics Data System (ADS)

Thorpe, James Ira; McKenzie, Kirk

2016-02-01

Arm locking is a technique for stabilizing the frequency of a laser in an interspacecraft interferometer by using the spacecraft separation as the frequency reference. A candidate technique for future space-based gravitational wave detectors such as the Laser Interferometer Space Antenna, arm locking has been extensive studied in this context through analytic models, time-domain simulations, and hardware-in-the-loop laboratory demonstrations. In this paper we show the laser ranging interferometer instrument flying aboard the upcoming Gravity Recovery and Climate Experiment follow-on (GRACE-FO) mission provides an appropriate platform for an on-orbit demonstration of the arm-locking technique. We describe an arm-locking controller design for the GRACE-FO system and a series of time-domain simulations that demonstrate its feasibility. We conclude that it is possible to achieve laser frequency noise suppression of roughly 2 orders of magnitude around a Fourier frequency of 1 Hz with conservative margins on the system's stability. We further demonstrate that "pulling" of the master laser frequency due to fluctuating Doppler shifts and lock acquisition transients is less than 100 MHz over several GRACE-FO orbits. These findings motivate further study of the implementation of such a demonstration.

Sensitivity of the Gravity Recovery and Climate Experiment (GRACE) to the complexity of aquifer systems for monitoring of groundwater

NASA Astrophysics Data System (ADS)

Katpatal, Yashwant B.; Rishma, C.; Singh, Chandan K.

2018-05-01

The Gravity Recovery and Climate Experiment (GRACE) satellite mission is aimed at assessment of groundwater storage under different terrestrial conditions. The main objective of the presented study is to highlight the significance of aquifer complexity to improve the performance of GRACE in monitoring groundwater. Vidarbha region of Maharashtra, central India, was selected as the study area for analysis, since the region comprises a simple aquifer system in the western region and a complex aquifer system in the eastern region. Groundwater-level-trend analyses of the different aquifer systems and spatial and temporal variation of the terrestrial water storage anomaly were studied to understand the groundwater scenario. GRACE and its field application involve selecting four pixels from the GRACE output with different aquifer systems, where each GRACE pixel encompasses 50-90 monitoring wells. Groundwater storage anomalies (GWSA) are derived for each pixel for the period 2002 to 2015 using the Release 05 (RL05) monthly GRACE gravity models and the Global Land Data Assimilation System (GLDAS) land-surface models (GWSAGRACE) as well as the actual field data (GWSAActual). Correlation analysis between GWSAGRACE and GWSAActual was performed using linear regression. The Pearson and Spearman methods show that the performance of GRACE is good in the region with simple aquifers; however, performance is poorer in the region with multiple aquifer systems. The study highlights the importance of incorporating the sensitivity of GRACE in estimation of groundwater storage in complex aquifer systems in future studies.

In vitro anti-plasmodial activity of some traditionally used medicinal plants against Plasmodium falciparum.

PubMed

Venkatesalu, V; Gopalan, N; Pillai, C R; Singh, Vineeta; Chandrasekaran, M; Senthilkumar, A; Chandramouli, N

2012-07-01

The anti-plasmodial activity of different solvent extracts of Adhatoda vasica (root), Caesalpinia pulcherrima (leaf), Carica papaya (pulp), Erythroxylum monogynum (leaf), Lantana camara (whole plant), Ocimum sanctum (root) and Phyllanthus niruri (whole plant) were studied against Plasmodium falciparum. Of the 35 extracts tested, seven extracts showed good anti-plasmodial activity. Methanol extract of C. pulcherrima showed the lowest IC50 value (10.96 μg/mL) followed by methanol extract of A. vasica (IC(50)=11.1 μg/mL), chloroform extract of O. sanctum (IC(50)=11.47 μg/mL), methanol extract of E. monogynum (IC(50)=12.23 μg/mL), acetone extract of C. pulcherrima (IC(50)=12.49 μg/mL), methanol extract of O. sanctum and acetone extract of A. vasica (IC(50)=14.04 μg/mL). The results of the present study justify the use of these medicinal plants in traditional practice, and also, a further study on the isolation of anti-plasmodial molecules from their active crude extracts is in progress.

Screening of in vitro antimicrobial activity of plants used in traditional Indonesian medicine.

PubMed

Romulo, Andreas; Zuhud, Ervizal A M; Rondevaldova, Johana; Kokoska, Ladislav

2018-12-01

In many regions of Indonesia, there are numerous traditional herbal preparations for treatment of infectious diseases. However, their antimicrobial potential has been poorly studied by modern laboratory methods. This study investigates in vitro antimicrobial activity of 49 ethanol extracts from 37 plant species used in Indonesian traditional medicine for treatment against Candida albicans, Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus. The plants were collected from the Biopharmaca collection garden, Bogor, Indonesia. The plant material was dried, finely grounded, extracted using ethanol, concentrated, and the dried residue was dissolved in 100% DMSO. Antimicrobial activity was determined in terms of a minimum inhibitory concentration (MIC) using a broth microdilution method in 96-well microplates. The extract of Orthosiphon aristatus (Blume) Miq. (Lamiaceae) leaf produced the strongest antimicrobial effect, inhibiting the growth of C. albicans (MIC 128 μg/mL), S. aureus (MIC 256 μg/mL), E. faecalis (MIC 256 μg/mL) and P. aeruginosa (MIC 256 μg/mL). The leaf extract of Woodfordia floribunda Salisb. (Lythraceae) also exhibited significant effect against C. albicans (MIC 128 μg/mL), S. aureus (MIC 256 μg/mL) and E. faecalis (MIC 256 μg/mL). Rotheca serrata (L.) Steane & Mabb. (Lamiaceae) leaf extract inhibited the growth of S. aureus (MIC 256 µg/mL) and C. albicans (MIC 256 µg/mL). The leaf extract of O. aristatus and W. floribunda exhibited a significant anti-candidal effect. Therefore, both of these plants can serve as prospective source materials for the development of new anti-candidal agents.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Menadione induces G2/M arrest in gastric cancer cells by down-regulation of CDC25C and proteasome mediated degradation of CDK1 and cyclin B1

PubMed Central

Lee, Min Ho; Cho, Yoonjung; Kim, Do Hyun; Woo, Hyun Jun; Yang, Ji Yeong; Kwon, Hye Jin; Yeon, Min Ji; Park, Min; Kim, Sa-Hyun; Moon, Cheol; Tharmalingam, Nagendran; Kim, Tae Ue; Kim, Jong-Bae

2016-01-01

Menadione (vitamin K3) has been reported to induce apoptotic cell death and growth inhibition in various types of cancer cells. However, involvement of menadione in cell cycle control has not been considered in gastric cancer cells yet. In the current study, we have investigated whether menadione is involved in the cell cycle regulation and suppression of growth in gastric cancer cells. In the cell cycle analysis, we found that menadione induced G2/M cell cycle arrest in AGS cells. To elucidate the underlying mechanism, we investigated the cell cycle regulatory molecules involved in the G2/M cell cycle transition. After 24 h of menadione treatment, the protein level of CDK1, CDC25C and cyclin B1 in AGS cells was decreased in a menadione dose-dependent manner. In the time course experiment, the protein level of CDC25C decreased in 6 h, and CDK1and cyclin B1 protein levels began to decrease after 18 h of menadione treatment. We found that mRNA level of CDC25C decreased by menadione treatment in 6 h. Menadione did not have an influence on mRNA level of CDK1 and cyclin B1 though the protein levels were decreased. However, the decreased protein levels of CDK1 and cyclin B1 were recovered by inhibition of proteasome. Collectively, these results suggest that menadione inhibits growth of gastric cancer cells by reducing expression of CDC25C and promoting proteasome mediated degradation of CDK1 and cyclin B1 thereby blocking transition of the cell cycle from G2 phase to M phase. PMID:28077999

Estimation of Greenland's Ice Sheet Mass Balance Using ICESat and GRACE Data

NASA Astrophysics Data System (ADS)

Slobbe, D.; Ditmar, P.; Lindenbergh, R.

2007-12-01

Data of the GRACE gravity mission and the ICESat laser altimetry mission are used to create two independent estimates of Greenland's ice sheet mass balance over the full measurement period. For ICESat data, a processing strategy is developed using the elevation differences of geometrically overlapping footprints of both crossing and repeated tracks. The dataset is cleaned using quality flags defined by the GLAS science team. The cleaned dataset reveals some strong, spatially correlated signals that are shown to be related to physical phenomena. Different processing strategies are used to convert the observed temporal height differences to mass changes for 6 different drainage systems, further divided into a region above and below 2000 meter elevation. The results are compared with other altimetry based mass balance estimates. In general, the obtained results confirm trends discovered by others, but we also show that the choice of processing strategy strongly influences our results, especially for the areas below 2000 meter. Furthermore, GRACE based monthly variations of the Earth's gravity field as processed by CNES, CSR, GFZ and DEOS are used to estimate the mass balance change for North and South Greenland. It is shown that our results are comparable with recently published GRACE estimates (mascon solutions). On the other hand, the estimates based on GRACE data are only partly confirmed by the ICESat estimates. Possible explanations for the obvious differences will be discussed.

Methods for Combination of GRACE Gravimetry and ICESat Altimetry over Antarctica on Monthly Timescales

NASA Astrophysics Data System (ADS)

Hardy, R. A.; Nerem, R. S.; Wiese, D. N.

2017-12-01

Gravity and surface elevation change data altimetry provide different perspectives on mass variability in Antarctica. In anticipation of the concurrent operation of the successors of GRACE and ICESat, GRACE Follow-On and ICESat-2, we approach the problem of combining these data for enhanced spatial resolution and disaggregation of Antarctica's major mass transport processes. Using elevation changes gathered from over 500 million overlapping ICESat laser shot pairs between 2003 and 2009, we construct gridded models of Antarctic elevation change for each ICESat operational period. Comparing these elevation grids with temporally registered JPL RL05M mascon solutions, we exploit the relationship between surface mass flux and elevation change to inform estimates of effective surface density. These density estimates enable solutions for glacial isostatic adjustment and monthly estimates of surface mass change. These are used alongside spatial statistics from both the data and models of surface mass balance to produce enhanced estimates of Antarctic mass balance. We validate our solutions by modeling the effects of elastic loading and GIA from these solutions on the vertical motion of Antarctica's GNSS sites.

Functional studies of p.R132C, p.R149C, p.M283V, p.E431K, and a novel c.652-2A>G mutations of the CYP21A2 gene.

PubMed

Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D; Buzzalino, Noemí; Stivel, Mirta; Ceballos, Nora R; Dain, Liliana

2014-01-01

Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90-95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream.

Functional Studies of p.R132C, p.R149C, p.M283V, p.E431K, and a Novel c.652-2A>G Mutations of the CYP21A2 Gene

PubMed Central

Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D.; Buzzalino, Noemí; Stivel, Mirta

2014-01-01

Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90–95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream. PMID:24667412

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

Colonization of a Deglaciated Moraine: Contrasting Patterns of Carbon Uptake and Release from C3 and CAM Plants.

PubMed

Varolo, Elisa; Zanotelli, Damiano; Montagnani, Leonardo; Tagliavini, Massimo; Zerbe, Stefan

2016-01-01

Current glacier retreat makes vast mountain ranges available for vegetation establishment and growth. As a result, carbon (C) is accumulated in the soil, in a negative feedback to climate change. Little is known about the effective C budget of these new ecosystems and how the presence of different vegetation communities influences CO2 fluxes. On the Matsch glacier forefield (Alps, Italy) we measured over two growing seasons the Net Ecosystem Exchange (NEE) of a typical grassland, dominated by the C3 Festuca halleri All., and a community dominated by the CAM rosettes Sempervivum montanum L. Using transparent and opaque chambers, with air temperature as the driver, we partitioned NEE to calculate Ecosystem Respiration (Reco) and Gross Ecosystem Exchange (GEE). In addition, soil and vegetation samples were collected from the same sites to estimate the Net Ecosystem Carbon Balance (NECB). The two communities showed contrasting GEE but similar Reco patterns, and as a result they were significantly different in NEE during the period measured. The grassland acted as a C sink, with a total cumulated value of -46.4±35.5 g C m-2 NEE, while the plots dominated by the CAM rosettes acted as a source, with 31.9±22.4 g C m-2. In spite of the different NEE, soil analysis did not reveal significant differences in carbon accumulation of the two plant communities (1770±130 for F. halleri and 2080±230 g C m-2 for S. montanum), suggesting that processes often neglected, like lateral flows and winter respiration, can have a similar relevance as NEE in the determination of the Net Ecosystem Carbon Balance.

Colonization of a Deglaciated Moraine: Contrasting Patterns of Carbon Uptake and Release from C3 and CAM Plants

PubMed Central

Tagliavini, Massimo; Zerbe, Stefan

2016-01-01

Introduction Current glacier retreat makes vast mountain ranges available for vegetation establishment and growth. As a result, carbon (C) is accumulated in the soil, in a negative feedback to climate change. Little is known about the effective C budget of these new ecosystems and how the presence of different vegetation communities influences CO2 fluxes. Methods On the Matsch glacier forefield (Alps, Italy) we measured over two growing seasons the Net Ecosystem Exchange (NEE) of a typical grassland, dominated by the C3 Festuca halleri All., and a community dominated by the CAM rosettes Sempervivum montanum L. Using transparent and opaque chambers, with air temperature as the driver, we partitioned NEE to calculate Ecosystem Respiration (Reco) and Gross Ecosystem Exchange (GEE). In addition, soil and vegetation samples were collected from the same sites to estimate the Net Ecosystem Carbon Balance (NECB). Results The two communities showed contrasting GEE but similar Reco patterns, and as a result they were significantly different in NEE during the period measured. The grassland acted as a C sink, with a total cumulated value of -46.4±35.5 g C m-2 NEE, while the plots dominated by the CAM rosettes acted as a source, with 31.9±22.4 g C m-2. In spite of the different NEE, soil analysis did not reveal significant differences in carbon accumulation of the two plant communities (1770±130 for F. halleri and 2080±230 g C m-2 for S. montanum), suggesting that processes often neglected, like lateral flows and winter respiration, can have a similar relevance as NEE in the determination of the Net Ecosystem Carbon Balance. PMID:28033605

Anti-fungal and Anti-Mycobacterial activity of plants of Nuevo Leon, Mexico.

PubMed

Garza, Blanca Alicia Alanis; Arroyo, Joel López; González, Gloria González; González, Elvira Garza; González, Elvira Garza; de Torres, Noemí Waksman; Aranda, Ricardo Salazar

2017-01-01

Severe fungal infections, particularly those caused by Candida spp, have increased in recent decades and are associated with an extremely high rate of morbidity and mortality. Since plants are an important source of potentially bioactive compounds, in this work the antifungal activity of the methanol extracts of 10 plants (Acacia rigidula, Buddleja cordata, Cephalanthus occidentalis, Juglans nigra, Parkinsonia aculeata, Parthenium hysterophorus, Quercus canbyi, Ricinus communis, Salvia coccinea and Teucrium bicolor) were evaluated. The activity was evaluated according to the micro dilution assay described in CLSI M27-A protocol using some clinical isolates of different species of Candida (C. albicans, C. parapsilosis, C. tropicalis, C. krusei and C. glabrata). All extracts showed MIC values < 31.25μg/mL against at least one of the strains used, which is very interesting because it was crude extracts. Acacia rigidula (0.93-3.75μg/mL) and Quercus canbyi (0.93-7.5μg/mL) had antifungal activity against 7 strains with MIC values <8μg/mL in all cases. Furthermore excerpts activity against Mycobacterium tuberculosis (strain H37rv) was evaluated. Only Salvia coccinea and Teucrium bicolor showed MIC values125μg/mL by the method of MABA.

Can we observe the fronts of the Antarctic Circumpolar Current using GRACE OBP?

NASA Astrophysics Data System (ADS)

Makowski, J.; Chambers, D. P.; Bonin, J. A.

2014-12-01

The Antarctic Circumpolar Current (ACC) and the Southern Ocean remains one of the most undersampled regions of the world's oceans. The ACC is comprised of four major fronts: the Sub-Tropical Front (STF), the Polar Front (PF), the Sub-Antarctic Front (SAF), and the Southern ACC Front (SACCF). These were initially observed individually from repeat hydrographic sections and their approximate locations globally have been quantified using all available temperature data from the World Ocean and Climate Experiment (WOCE). More recent studies based on satellite altimetry have found that the front positions are more dynamic and have shifted south by up to 1° on average since 1993. Using ocean bottom pressure (OBP) data from the current Gravity Recovery and Climate Experiment (GRACE) we have measured integrated transport variability of the ACC south of Australia. However, differentiation of variability of specific fronts has been impossible due to the necessary smoothing required to reduce noise and correlated errors in the measurements. The future GRACE Follow-on (GFO) mission and the post 2020 GRACE-II mission are expected to produce higher resolution gravity fields with a monthly temporal resolution. Here, we study the resolution and error characteristics of GRACE gravity data that would be required to resolve variations in the front locations and transport. To do this, we utilize output from a high-resolution model of the Southern Ocean, hydrology models, and ice sheet surface mass balance models; add various amounts of random and correlated errors that may be expected from GFO and GRACE-II; and quantify requirements needed for future satellite gravity missions to resolve variations along the ACC fronts.

Ultrathin g-C3N4 films supported on Attapulgite nanofibers with enhanced photocatalytic performance

NASA Astrophysics Data System (ADS)

Xu, Yongshuai; Zhang, Lili; Yin, Minghui; Xie, Dengyu; Chen, Jiaqi; Yin, Jingzhou; Fu, Yongsheng; Zhao, Pusu; Zhong, Hui; Zhao, Yijiang; Wang, Xin

2018-05-01

A novel visible-light-responsive photocatalyst is fabricated by introducing g-C3N4 ultrathin films onto the surface of attapulgite (ATP) via a simple in-situ depositing technique, in which ATP was pre-grafted using (3-Glycidyloxypropyl) trimethoxysilane (KH560) as the surfactant. A combination of XRD, FT-IR, BET, XPS, UV-vis, TEM and SEM techniques are utilized to characterize the composition, morphology and optical properties of the products. The results show that with the help of KH560, g-C3N4 presented as ultrathin layer is uniformly loaded onto the surface of ATP by forming a new chemical bond (Sisbnd Osbnd C). Comparing with g-C3N4 and ATP, ATP/g-C3N4 exhibits remarkably enhanced visible-light photocatalytic activity in degradation of methyl orange (MO) because of its high surface area, appropriate band gap and the synergistic effect between g-C3N4 and ATP. To achieve the best photocatalyst, the ratio of g-C3N4 was adjusted by controlling the mass portion between ATP-KH560 and melamine (r = m (ATP-KH560)/m (melamine)). The highest decomposition rate of methyl orange (MO) was 96.06% when r = 0.5 and this degradation efficiency remained unchanged after 4 cycles, which is 10 times as that of pure g-C3N4 particles. Possible photocatalytic mechanism is presented.

Rhesus Monkey Rhadinovirus ORF57 Induces gH and gL Glycoprotein Expression through Posttranscriptional Accumulation of Target mRNAs ▿

PubMed Central

Shin, Young C.; Desrosiers, Ronald C.

2011-01-01

Open reading frame 57 (ORF57) of gamma-2 herpesviruses is a key regulator of viral gene expression. It has been reported to enhance the expression of viral genes by transcriptional, posttranscriptional, or translational activation mechanisms. Previously we have shown that the expression of gH and gL of rhesus monkey rhadinovirus (RRV), a close relative of the human Kaposi's sarcoma-associated herpesvirus (KSHV), could be dramatically rescued by codon optimization as well as by ORF57 coexpression (J. P. Bilello, J. S. Morgan, and R. C. Desrosiers, J. Virol. 82:7231–7237, 2008). We show here that ORF57 coexpression and codon optimization had similar effects, except that the rescue of expression by codon optimization was temporally delayed relative to that of ORF57 coexpression. The transfection of gL mRNA directly into cells with or without ORF57 coexpression and with or without codon optimization recapitulated the effects of these modes of induction on transfected DNA. These findings suggested an important role for the enhancement of mRNA stability and/or the translation of mRNA for these very different modes of induced expression. This conclusion was confirmed by several different measures of gH and gL mRNA stability and accumulation with or without ORF57 coexpression and with or without codon optimization. Our results indicate that RRV gH and gL expression is severely limited by the stability of the mRNA and that ORF57 coexpression and codon optimization independently induce gH and gL expression principally by allowing accumulation and translation of these mRNAs. PMID:21613403

Detection of co-seismic earthquake gravity field signals using GRACE-like mission simulations

NASA Astrophysics Data System (ADS)

Sharifi, Mohammad Ali; Shahamat, Abolfazl

2017-05-01

After launching the GRACE satellite mission in 2002, the earth's gravity field and its temporal variations are measured with a closer inspection. Although these variations are mainly because of the mass transfer of land water storage, they can also happen due to mass movements related to some natural phenomena including earthquakes, volcanic eruptions, melting of polar ice caps and glacial isostatic adjustment. Therefore this paper shows which parameters of an earthquake are more sensitive to GRACE-Like satellite missions. For this purpose, the parameters of the Maule earthquake that occurred in recent years and Alaska earthquake that occurred in 1964 have been chosen. Then we changed their several parameters to serve our purpose. The GRACE-Like sensitivity is observed by using the simulation of the earthquakes along with gravity changes they caused, as well as using dislocation theory under a half space earth. This observation affects the various faulting parameters which include fault length, width, depth and average slip. These changes were therefore evaluated and the result shows that the GRACE satellite missions tend to be more sensitive to Width among the Length and Width, the other parameter is Dip variations than other parameters. This article can be useful to the upcoming scenario designers and seismologists in their quest to study fault parameters.

Analysis of Seasonal Variability in Gulf of Alaska Glacier Mass Balance using GRACE

NASA Astrophysics Data System (ADS)

Arendt, A. A.; Luthcke, S. B.; Oneel, S.; Gardner, A. S.; Hill, D. F.

2011-12-01

Mass variations of glaciers in Alaska/northwestern Canada must be quantified in order to assess impacts on ecosystems, human infrastructure, and global sea level. Here we combine Gravity Recovery and Climate Experiment (GRACE) observations with a wide range of satellite and field data to investigate drivers of these recent changes, with a focus on seasonal variations. Our central focus will be the exceptionally high mass losses of 2009, which do not correlate with weather station temperature and precipitation data, but may be linked to ash fall from the March 31, 2009 eruption of Mt. Redoubt. The eruption resulted in a significant decrease in MODIS-derived surface albedo over many Alaska glacier regions, and likely contributed to some of the 2009 anomalous mass loss observed by GRACE. We also focus on the Juneau and Stikine Icefield regions that are far from the volcanic eruption but experienced the largest mass losses of any region in 2009. Although rapid drawdown of tidewater glaciers was occurring in southeast Alaska during 2009, we show these changes were probably not sufficiently widespread to explain all of the GRACE signal in those regions. We examine additional field and satellite datasets to quantify potential errors in the climate and GRACE fields that could result in the observed discrepancy.

Assessment of 3D hydrologic deformation using GRACE and GPS

NASA Astrophysics Data System (ADS)

Watson, C. S.; Tregoning, P.; Fleming, K.; Burgette, R. J.; Featherstone, W. E.; Awange, J.; Kuhn, M.; Ramillien, G.

2009-12-01

Hydrological processes cause variations in gravitational potential and surface deformations, both of which are detectable with ever increasing precision using space geodetic techniques. By comparing the elastic deformation computed from continental water load estimates derived from the Gravity Recovery and Climate Experiment (GRACE), with three-dimensional surface deformation derived from GPS observations, there is clear potential to better understand global to regional hydrological processes, in addition to acquiring further insight into the systematic error contributions affecting each space geodetic technique. In this study, we compare elastic deformation derived from water load estimates taken from the CNES, CSR, GFZ and JPL time variable GRACE fields. We compare these surface displacements with those derived at a global network of GPS sites that have been homogeneously reprocessed in the GAMIT/GLOBK suite. We extend our comparison to include a series of different GPS solutions, with each solution only subtly different based on the methodology used to down weight the height component in realizing site coordinates on the terrestrial reference frame. Each of the GPS solutions incorporate modeling of atmospheric loading and utilization of the VMF1 and a priori zenith hydrostatic delays derived via ray tracing through ECMWF meteorological fields. The agreement between GRACE and GPS derived deformations is not limited to the vertical component, with excellent agreement in the horizontal component across areas where large hydrologic signals occur over broad spatial scales (with correlation in horizontal components as high as 0.9). Agreement is also observed at smaller scales, including across Europe. These comparisons assist in understanding the magnitude of current error contributions within both space geodetic techniques. With the emergence of homogeneously reprocessed GPS time series spanning the GRACE mission, this technique offers one possible means of

Neonatal Hyperbilirubinemia in infants with G6PD c.563C > TVariant

PubMed Central

2012-01-01

Background There is a strong correlation between glucose-6-phosphate dehydrogenase (G6PD) deficiency and neonatal hyperbilirubinemia with a rare but potential threat of devastating acute bilirubin encephalopathy. G6PD deficiency was observed in 4–14% of hospitalized icteric neonates in Pakistan. G6PD c.563C > T is the most frequently reported variant in this population. The present study was aimed at evaluating the time to onset of hyperbilirubinemia and the postnatal bilirubin trajectory in infants having G6PD c.563C > T. Methods This was a case–control study conducted at The Aga Khan University, Pakistan during the year 2008. We studied 216 icteric male neonates who were re-admitted for phototherapy during the study period. No selection was exercised. Medical records showed that 32 were G6PD deficient while 184 were G6PD normal. Each infant was studied for birth weight, gestational age, age at the time of presentation, presence of cephalhematoma, sepsis and neurological signs, peak bilirubin level, age at peak bilirubin level, days of hospitalization, whether phototherapy or exchange blood transfusion was initiated, and the outcome. During hospital stay, each baby was tested for complete blood count, reticulocyte count, ABO and Rh blood type, direct antiglobulin test and quantitative G6PD estimation [by kinetic determination of G6PDH]. G6PDgenotype was analyzed in 32 deficient infants through PCR-RFLP analysis and gene sequencing. Results G6PD variants c.563C > T and c.131 C > G were observed in 21 (65%) and three (9%) of the 32 G6PD deficient infants, respectively. DNA of eight (25%) newborns remained uncharacterized. In contrast to G6PD normal neonates, infants with c.563C > T variant had significantly lower enzyme activity (mean ± 1SD; 0.3 ± 0.2 U/gHb vs. 14.0 ± 4.5 U/gHb, p < 0.001) experienced higher peak levels of total serum bilirubin (mean ± 1SD; 16.8 ± 5.4 mg/dl vs. 13.8 ± 4.6 mg/dl, p = 0.008) which peaked earlier after

Rapid isolation of novel FK506 binding proteins from multiple organisms using gDNA and cDNA T7 phage display.

PubMed

Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter

2009-10-01

Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.

Assimilation of GRACE Terrestrial Water Storage Data into a Land Surface Model: Results for the Mississippi River Basin

NASA Technical Reports Server (NTRS)

Zaitchik, Benjamin F.; Rodell, Matthew; Reichle, Rolf H.

2007-01-01

NASA's GRACE mission has the potential to be extremely valuable for water resources applications and global water cycle research. What makes GRACE unique among Earth Science satellite systems is that it is able to monitor variations in water stored in all forms, from snow and surface water to soil moisture to groundwater in the deepest aquifers. However, the space and time resolutions of GRACE observations are coarse. GRACE typically resolves water storage changes over regions the size of Nebraska on a monthly basis, while city-scale, daily observations would be more useful for water management, agriculture, and weather prediction. High resolution numerical (computer) hydrology models have been developed, which predict the fates of water and energy after they strike the land surface as precipitation and sunlight. These are similar to weather and climate forecast models, which simulate atmospheric processes. We integrated the GRACE observations into a hydrology model using an advanced technique called data assimilation. The results were new estimates of groundwater, soil moisture, and snow variations, which combined the veracity of GRACE with the high resolution of the model. We tested the technique over the Mississippi River basin, but it will be even more valuable in parts of the world which lack reliable data on water availability.

GRACE Follow-On Moves Closer to Launch

NASA Image and Video Library

2018-05-11

Technicians inspect the twin GRACE Follow-On satellites and their multi-satellite dispenser at the SpaceX facility at Vandenberg Air Force Base in California. The satellites were subsequently stacked atop another satellite dispenser containing the five Iridium NEXT communications satellites they will share a ride to orbit with. https://photojournal.jpl.nasa.gov/catalog/PIA22452

Seasonal Water Storage Variations as Impacted by Water Abstractions: Comparing the Output of a Global Hydrological Model with GRACE and GPS Observations

NASA Astrophysics Data System (ADS)

Döll, Petra; Fritsche, Mathias; Eicker, Annette; Müller Schmied, Hannes

2014-11-01

Better quantification of continental water storage variations is expected to improve our understanding of water flows, including evapotranspiration, runoff and river discharge as well as human water abstractions. For the first time, total water storage (TWS) on the land area of the globe as computed by the global water model WaterGAP (Water Global Assessment and Prognosis) was compared to both gravity recovery and climate experiment (GRACE) and global positioning system (GPS) observations. The GRACE satellites sense the effect of TWS on the dynamic gravity field of the Earth. GPS reference points are displaced due to crustal deformation caused by time-varying TWS. Unfortunately, the worldwide coverage of the GPS tracking network is irregular, while GRACE provides global coverage albeit with low spatial resolution. Detrended TWS time series were analyzed by determining scaling factors for mean annual amplitude ( f GRACE) and time series of monthly TWS ( f GPS). Both GRACE and GPS indicate that WaterGAP underestimates seasonal variations of TWS on most of the land area of the globe. In addition, seasonal maximum TWS occurs 1 month earlier according to WaterGAP than according to GRACE on most land areas. While WaterGAP TWS is sensitive to the applied climate input data, none of the two data sets result in a clearly better fit to the observations. Due to the low number of GPS sites, GPS observations are less useful for validating global hydrological models than GRACE observations, but they serve to support the validity of GRACE TWS as observational target for hydrological modeling. For unknown reasons, WaterGAP appears to fit better to GPS than to GRACE. Both GPS and GRACE data, however, are rather uncertain due to a number of reasons, in particular in dry regions. It is not possible to benefit from either GPS or GRACE observations to monitor and quantify human water abstractions if only detrended (seasonal) TWS variations are considered. Regarding GRACE, this is

Assessing Aridity, Hydrological Drought, and Recovery Using GRACE and GLDAS: a Case Study in Iraq

NASA Astrophysics Data System (ADS)

Moradkhani, H.; Almamalachy, Y. S.; Yan, H.; Ahmadalipour, A.; Irannezhad, M.

2016-12-01

Iraq has suffered from several drought events during the period of 2003-2012, which imposed substantial impacts on natural environment and socioeconomic sectors, e.g. lower discharge of Tigris and Euphrates, groundwater depletion and increase in its salinity, population migration, and agricultural degradation. To investigate the aridity and climatology of Iraq, Global Land Data Assimilation System (GLDAS) monthly datasets of precipitation, temperature, and evapotranspiration at 0.25 degree spatial resolution are used. The Gravity Recovery and Climate Experiment (GRACE) satellite-derived monthly Terrestrial Water Storage (TWS) deficit is used as the hydrological drought indicator. The data is available globally at 1 degree spatial resolution. This study aims to monitor hydrological drought and assess drought recovery time for the period of August 2002 until December 2015. Two approaches are implemented to derive the GRACE-based TWS deficit. The first approach estimates the TWS deficit based on the difference from its own climatology, while the second approach directly calculates the deficit from TWS anomaly. Severity of drought events are calculated by integrating monthly water deficit over the drought period. The results indicate that both methods are capable of capturing the severe drought events in Iraq, while the second approach quantifies higher deficit and severity. In addition, two methods are employed to assess drought recovery time based on the estimated deficit. Both methods indicate similar drought recovery times, varying from less than a month to 9 months. The results demonstrate that the GRACE TWS is a reliable indicator for drought assessment over Iraq, and provides useful information to decision makers for developing drought adaptation and mitigation strategies over data-sparse regions.

The impact of Polycomb group (PcG) and Trithorax group (TrxG) epigenetic factors in plant plasticity.

PubMed

de la Paz Sanchez, Maria; Aceves-García, Pamela; Petrone, Emilio; Steckenborn, Stefan; Vega-León, Rosario; Álvarez-Buylla, Elena R; Garay-Arroyo, Adriana; García-Ponce, Berenice

2015-11-01

Current advances indicate that epigenetic mechanisms play important roles in the regulatory networks involved in plant developmental responses to environmental conditions. Hence, understanding the role of such components becomes crucial to understanding the mechanisms underlying the plasticity and variability of plant traits, and thus the ecology and evolution of plant development. We now know that important components of phenotypic variation may result from heritable and reversible epigenetic mechanisms without genetic alterations. The epigenetic factors Polycomb group (PcG) and Trithorax group (TrxG) are involved in developmental processes that respond to environmental signals, playing important roles in plant plasticity. In this review, we discuss current knowledge of TrxG and PcG functions in different developmental processes in response to internal and environmental cues and we also integrate the emerging evidence concerning their function in plant plasticity. Many such plastic responses rely on meristematic cell behavior, including stem cell niche maintenance, cellular reprogramming, flowering and dormancy as well as stress memory. This information will help to determine how to integrate the role of epigenetic regulation into models of gene regulatory networks, which have mostly included transcriptional interactions underlying various aspects of plant development and its plastic response to environmental conditions. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Global analysis of approaches for deriving total water storage changes from GRACE satellites and implications for groundwater storage change estimation

NASA Astrophysics Data System (ADS)

Long, D.; Scanlon, B. R.; Longuevergne, L.; Chen, X.

2015-12-01

Increasing interest in use of GRACE satellites and a variety of new products to monitor changes in total water storage (TWS) underscores the need to assess the reliability of output from different products. The objective of this study was to assess skills and uncertainties of different approaches for processing GRACE data to restore signal losses caused by spatial filtering based on analysis of 1°×1° grid scale data and basin scale data in 60 river basins globally. Results indicate that scaling factors from six land surface models (LSMs), including four models from GLDAS-1 (Noah 2.7, Mosaic, VIC, and CLM 2.0), CLM 4.0, and WGHM, are similar over most humid, sub-humid, and high-latitude regions but can differ by up to 100% over arid and semi-arid basins and areas with intensive irrigation. Large differences in TWS anomalies from three processing approaches (scaling factor, additive, and multiplicative corrections) were found in arid and semi-arid regions, areas with intensive irrigation, and relatively small basins (e.g., ≤ 200,000 km2). Furthermore, TWS anomaly products from gridded data with CLM4.0 scaling factors and the additive correction approach more closely agree with WGHM output than the multiplicative correction approach. Estimation of groundwater storage changes using GRACE satellites requires caution in selecting an appropriate approach for restoring TWS changes. A priori ground-based data used in forward modeling can provide a powerful tool for explaining the distribution of signal gains or losses caused by low-pass filtering in specific regions of interest and should be very useful for more reliable estimation of groundwater storage changes using GRACE satellites.

Study of seasonal and long-term vertical deformation in Nepal based on GPS and GRACE observations

NASA Astrophysics Data System (ADS)

Zhang, Tengxu; Shen, WenBin; Pan, Yuanjin; Luan, Wei

2018-02-01

Lithospheric deformation signal can be detected by combining data from continuous global positioning system (CGPS) and satellite observations from the Gravity Recovery and Climate Experiment (GRACE). In this paper, we use 2.5- to 19-year-long time series from 35 CGPS stations to estimate vertical deformation rates in Nepal, which is located in the southern side of the Himalaya. GPS results were compared with GRACE observations. Principal component analysis was conducted to decompose the time series into three-dimensional principal components (PCs) and spatial eigenvectors. The top three high-order PCs were calculated to correct common mode errors. Both GPS and GRACE observations showed significant seasonal variations. The observed seasonal GPS vertical variations are in good agreement with those from the GRACE-derived results, particularly for changes in surface pressure, non-tidal oceanic mass loading, and hydrologic loading. The GPS-observed rates of vertical deformation obtained for the region suggest both tectonic impact and mass decrease. The rates of vertical crustal deformation were estimated by removing the GRACE-derived hydrological vertical rates from the GPS measurements. Most of the sites located in the southern part of the Main Himalayan Thrust subsided, whereas the northern part mostly showed an uplift. These results may contribute to the understanding of secular vertical crustal deformation in Nepal.

Comparison of GPS and GRACE hydrological loading signatures in Myanmar, India, Bangladesh, and Bhutan

NASA Astrophysics Data System (ADS)

Materna, K.; Feng, L.; Lindsey, E. O.; Hill, E.; Burgmann, R.

2017-12-01

The elastic response of the lithosphere to surface mass redistributions produces significant deformation that can be observed in geodetic time series. This deformation is especially pronounced in Southeast Asia, where the annual monsoon produces large-amplitude hydrological loads. The MIBB network of 20 continuous GPS stations in Myanmar, India, Bangladesh, and Bhutan, operational since 2012, provides an opportunity to study the earth's response to these loads. In this study, we use GRACE gravity products as an estimate of surface water distribution, and input these estimates into an elastic loading calculation. We compare the predicted deformation with that observed with GPS. We find that elastic loading from the GRACE gravity field is able to explain the phase and the peak-to-peak amplitude (typically 2-3 cm) of the vertical GPS oscillations in northeast India and central Myanmar. GRACE-based corrections reduce the RMS scatter of the GPS data by 30%-45% in these regions. However, this approach does not capture all of the variation in central Bangladesh and southern Myanmar. Local hydrological effects, non-tidal ocean loads, poroelastic deformation, or differences in elastic properties may explain discrepancies between the GPS and GRACE signals in these places. The results of our calculations have practical implications for campaign GPS measurements in Myanmar, which make up the majority of geodetic measurements at this point. We may be able to reduce errors in campaign measurements and increase the accuracy of velocity estimates by correcting for hydrologic signals with GRACE data. The results also have potential implications for crustal rheology in Southeast Asia.

Application of EOF/PCA-based methods in the post-processing of GRACE derived water variations

NASA Astrophysics Data System (ADS)

Forootan, Ehsan; Kusche, Jürgen

2010-05-01

Two problems that users of monthly GRACE gravity field solutions face are 1) the presence of correlated noise in the Stokes coefficients that increases with harmonic degree and causes ‘striping', and 2) the fact that different physical signals are overlaid and difficult to separate from each other in the data. These problems are termed the signal-noise separation problem and the signal-signal separation problem. Methods that are based on principal component analysis and empirical orthogonal functions (PCA/EOF) have been frequently proposed to deal with these problems for GRACE. However, different strategies have been applied to different (spatial: global/regional, spectral: global/order-wise, geoid/equivalent water height) representations of the GRACE level 2 data products, leading to differing results and a general feeling that PCA/EOF-based methods are to be applied ‘with care'. In addition, it is known that conventional EOF/PCA methods force separated modes to be orthogonal, and that, on the other hand, to either EOFs or PCs an arbitrary orthogonal rotation can be applied. The aim of this paper is to provide a common theoretical framework and to study the application of PCA/EOF-based methods as a signal separation tool due to post-process GRACE data products. In order to investigate and illustrate the applicability of PCA/EOF-based methods, we have employed them on GRACE level 2 monthly solutions based on the Center for Space Research, University of Texas (CSR/UT) RL04 products and on the ITG-GRACE03 solutions from the University of Bonn, and on various representations of them. Our results show that EOF modes do reveal the dominating annual, semiannual and also long-periodic signals in the global water storage variations, but they also show how choosing different strategies changes the outcome and may lead to unexpected results.

Frequency Evaluation of T6235C (m1) and A4889G (m2) Polymorphisms of CYP1A1 Gene in a Healthy Population from the west of Mazandaran Province, Iran.

PubMed

Ahangar, N; Alizadeh, B; Tousi, A

2016-06-30

CYP1A1 is an important phase I xenobiotic metabolizing enzyme involved in the metabolism of numbers of toxins, endogenous hormones and drugs. Polymorphisms in this phase I gene can alter enzyme activity and induction, also are known to be associated with cancer susceptibility related to environmental toxins and hormone exposure. The present study was aimed to determine the frequencies of commonly known functional polymorphismsof CYP1A1 gene including CYP1A1 m1 (MspI), and CYP1A1 m2 (Ile-Val) in a healthy population from the west of Mazandaran province, Iran. A total of 200 unrelated healthy subjects from Mazandaran province, residing in Tonekabon city, coming for blood donating at Tonekabon Blood Transfusion Center were enrolled. Genomic DNA was extracted from peripheral blood lymphocytes of each subject. All subjects were genotyped for CYP1A1 m1 (T>C) and m2 (A>G) by polymerase chain reaction-restriction fragment length polymorphism method. The frequencies of the TT(wt/wt), TC(wt/mt) and CC(mt/mt) genotypes were as 65.5%, 32.0% and 2.5% respectively for m1 and frequencies of the AA(wt/wt), AG(wt/mt) and GG(mt/mt) genotypes were as 84.5%, 15% and 0.5% respectively for the m2. The frequencies of T and C alleles in the population were 81.5% and 18.5% respectively and the frequencies of A and G alleles were 92% and 8% respectively. Results of the present study might be important in understanding the distribution of CYP1A1 (m1) and CYP1A1 (m2) polymorphisms in Mazandaran province of Iran. Moreover, these results may determine the susceptibilities of individuals towards environmental procarcinogens that result in several cancers.

Using ocean bottom pressure from the gravity recovery and climate experiment (GRACE) to estimate transport variability in the southern Indian Ocean

NASA Astrophysics Data System (ADS)