Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K
2011-11-01
Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.
Replication and Transcription of Eukaryotic DNA in Esherichia coli
Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.
1974-01-01
Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264
Transformation of Streptococcus lactis Protoplasts by Plasmid DNA †
Kondo, Jeffery K.; McKay, Larry L.
1982-01-01
Polyethylene glycol-treated protoplasts prepared from Streptococcus lactis LM3302, a lactose-negative (Lac−) derivative of S. lactis ML3, were transformed to lactose-fermenting ability by a transductionally shortened plasmid (pLM2103) coding for lactose utilization. Images PMID:16346019
Gemini surfactants mediate efficient mitochondrial gene delivery and expression.
Cardoso, Ana M; Morais, Catarina M; Cruz, A Rita; Cardoso, Ana L; Silva, Sandra G; do Vale, M Luísa; Marques, Eduardo F; Pedroso de Lima, Maria C; Jurado, Amália S
2015-03-02
Gene delivery targeting mitochondria has the potential to transform the therapeutic landscape of mitochondrial genetic diseases. Taking advantage of the nonuniversal genetic code used by mitochondria, a plasmid DNA construct able to be specifically expressed in these organelles was designed by including a codon, which codes for an amino acid only if read by the mitochondrial ribosomes. In the present work, gemini surfactants were shown to successfully deliver plasmid DNA to mitochondria. Gemini surfactant-based DNA complexes were taken up by cells through a variety of routes, including endocytic pathways, and showed propensity for inducing membrane destabilization under acidic conditions, thus facilitating cytoplasmic release of DNA. Furthermore, the complexes interacted extensively with lipid membrane models mimicking the composition of the mitochondrial membrane, which predicts a favored interaction of the complexes with mitochondria in the intracellular environment. This work unravels new possibilities for gene therapy toward mitochondrial diseases.
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.
Hu, B; Li, J; Yu, W; Fang, J
1993-01-01
Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.
Hong, S B; Hwang, I; Dessaux, Y; Guyon, P; Kim, K S; Farrand, S K
1997-01-01
The mechanisms that ensure that Ti plasmid T-DNA genes encoding proteins involved in the biosynthesis of opines in crown gall tumors are always matched by Ti plasmid genes conferring the ability to catabolize that set of opines on the inducing Agrobacterium strains are unknown. The pathway for the biosynthesis of the opine agropine is thought to require an enzyme, mannopine cyclase, coded for by the ags gene located in the T(R) region of octopine-type Ti plasmids. Extracts prepared from agropine-type tumors contained an activity that cyclized mannopine to agropine. Tumor cells containing a T region in which ags was mutated lacked this activity and did not contain agropine. Expression of ags from the lac promoter conferred mannopine-lactonizing activity on Escherichia coli. Agrobacterium tumefaciens strains harboring an octopine-type Ti plasmid exhibit a similar activity which is not coded for by ags. Analysis of the DNA sequence of the gene encoding this activity, called agcA, showed it to be about 60% identical to T-DNA ags genes. Relatedness decreased abruptly in the 5' and 3' untranslated regions of the genes. ags is preceded by a promoter that functions only in the plant. Expression analysis showed that agcA also is preceded by its own promoter, which is active in the bacterium. Translation of agcA yielded a protein of about 45 kDa, consistent with the size predicted from the DNA sequence. Antibodies raised against the agcA product cross-reacted with the anabolic enzyme. These results indicate that the agropine system arose by a duplication of a progenitor gene, one copy of which became associated with the T-DNA and the other copy of which remained associated with the bacterium. PMID:9244272
Development of a Gene Cloning System in Methanogens.
1987-03-27
Genetic transfer via DNA-dependent natural transformation was achieved for two markers, 5-fluorouracil-resistance, and 6- mercaptopurine resistance...resistance genes, and genes coding for enzymes that produce colored products will be tested as markers for plasmid transformation. A functional plasmid...clones, which include resistances to mercaptopurine , azahypoxanthine, diazauracil, kanamycin, mitomycin C, and fluorouracil- mercaptopurine and
Mela, Francesca; Fritsche, Kathrin; Boersma, Hidde; van Elsas, Jan D; Bartels, Daniela; Meyer, Folker; de Boer, Wietse; van Veen, Johannes A; Leveau, Johan H J
2008-10-01
Plasmid pTer331 from the bacterium Collimonas fungivorans Ter331 is a new member of the pIPO2/pSB102 family of environmental plasmids. The 40 457-bp sequence of pTer331 codes for 44 putative ORFs, most of which represent genes involved in replication, partitioning and transfer of the plasmid. We confirmed that pTer331 is stably maintained in its native host. Deletion analysis identified a mini-replicon capable of replicating autonomously in Escherichia coli and Pseudomonas putida. Furthermore, plasmid pTer331 was able to mobilize and retromobilize IncQ plasmid pSM1890 at typical rates of 10(-4) and 10(-8), respectively. Analysis of the 91% DNA sequence identity between pTer331 and pIPO2 revealed functional conservation of coding sequences, the deletion of DNA fragments flanked by short direct repeats (DR), and sequence preservation of long DRs. In addition, we experimentally established that pTer331 has no obvious contribution in several of the phenotypes that are characteristic of its host C. fungivorans Ter331, including the ability to efficiently colonize plant roots. Based on our findings, we hypothesize that cryptic plasmids such as pTer331 and pIPO2 might not confer an individual advantage to bacteria, but, due to their broad-host-range and ability to retromobilize, benefit bacterial populations by accelerating the intracommunal dissemination of the mobile gene pool.
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sankar, P.; Lee, J.H.; Shanmugam, K.T.
1985-04-01
Escherichia coli has two unlinked genes that code for hydrogenase synthesis and activity. The DNA fragments containing the two genes (hydA and hydB) were cloned into a plasmid vector, pBR322. The plasmids containing the hyd genes (pSE-290 and pSE-111 carrying the hydA and hydB genes, respectively) were used to genetically map a total of 51 mutant strains with defects in hydrogenase activity. A total of 37 mutants carried a mutation in the hydB gene, whereas the remaining 14 hyd were hydA. This complementation analysis also established the presence of two new genes, so far unidentified, one coding for formate dehydrogenase-2more » (fdv) and another producing an electron transport protein (fhl) coupling formate dehydrogenase-2 to hydrogenase. Three of the four genes, hydB, fhl, and fdv, may constitute a single operon, and all three genes are carried by a 5.6-kilobase-pair chromosomal DNA insert in plasmid pSE-128. Plasmids carrying a part of this 5.6-kilobase-pair DNA (pSE-130) or fragments derived from this DNA in different orientations (pSE-126 and pSE-129) inhibited the production of active formate hydrogenlyase. This inhibition occurred even in a prototrophic E. coli, strain K-10, but only during an early induction period. These results, based on complementation analysis with cloned DNA fragments, show that both hydA and hydB genes are essential for the production of active hydrogenase. For the expression of active formate hydrogenlyase, two other gene products, fhl and fdv are also needed. All four genes map between 58 and 59 min in the E. coli chromosome.« less
Tett, Adrian; Spiers, Andrew J; Crossman, Lisa C; Ager, Duane; Ciric, Lena; Dow, J Maxwell; Fry, John C; Harris, David; Lilley, Andrew; Oliver, Anna; Parkhill, Julian; Quail, Michael A; Rainey, Paul B; Saunders, Nigel J; Seeger, Kathy; Snyder, Lori AS; Squares, Rob; Thomas, Christopher M; Turner, Sarah L; Zhang, Xue-Xian; Field, Dawn; Bailey, Mark J
2009-01-01
The plasmid pQBR103 was found within Pseudomonas populations colonizing the leaf and root surfaces of sugar beet plants growing at Wytham, Oxfordshire, UK. At 425 kb it is the largest self-transmissible plasmid yet sequenced from the phytosphere. It is known to enhance the competitive fitness of its host, and parts of the plasmid are known to be actively transcribed in the plant environment. Analysis of the complete sequence of this plasmid predicts a coding sequence (CDS)-rich genome containing 478 CDSs and an exceptional degree of genetic novelty; 80% of predicted coding sequences cannot be ascribed a function and 60% are orphans. Of those to which function could be assigned, 40% bore greatest similarity to sequences from Pseudomonas spp, and the majority of the remainder showed similarity to other c-proteobacterial genera and plasmids. pQBR103 has identifiable regions presumed responsible for replication and partitioning, but despite being tra+ lacks the full complement of any previously described conjugal transfer functions. The DNA sequence provided few insights into the functional significance of plant-induced transcriptional regions, but suggests that 14% of CDSs may be expressed (11 CDSs with functional annotation and 54 without), further highlighting the ecological importance of these novel CDSs. Comparative analysis indicates that pQBR103 shares significant regions of sequence with other plasmids isolated from sugar beet plants grown at the same geographic location. These plasmid sequences indicate there is more novelty in the mobile DNA pool accessible to phytosphere pseudomonas than is currently appreciated or understood. PMID:18043644
Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu
2010-06-01
Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.
Barucca, A; Capitani, M; Cesca, M; Tomassoni, D; Kazmi, U; Concetti, F; Vincenzetti, L; Concetti, A; Venanzi, F M
2014-11-01
Anti-idiotypic MK2-23 monoclonal antibody (anti-Id MK2-23 mAb), which mimics the high molecular weight melanoma-associated antigen (HMW-MAA), has been used to implement active immunotherapy against melanoma. However, due to safety and standardization issues, this approach never entered extensive clinical trials. In the present study, we investigated the usage of DNA vaccines as an alternative to MK2-23 mAb immunization. MK2-23 DNA plasmids coding for single chain (scFv) MK2-23 antibody were constructed via the insertion of variable heavy (V H) and light (V L) chains of MK2-23 into the pVAC-1mcs plasmids. Two alternative MK2-23 plasmids format V H/V L, and V L/V H were assembled. We demonstrate that both polypeptides expressed by scFv plasmids in vitro retained the ability to mimic HMW-MAA antigen, and to elicit specific anti-HMW-MAA humoral and cellular immunoresponses in immunized mice. Notably, MK2-23 scFv DNA vaccines impaired the onset and growth of transplantable B16 melanoma cells not engineered to express HMW-MAA. This pilot study suggests that optimized MK2-23 scFv DNA vaccines could potentially provide a safer and cost-effective alternative to anti-Id antibody immunization, for melanoma immunotherapy.
Is a Genome a Codeword of an Error-Correcting Code?
Kleinschmidt, João H.; Silva-Filho, Márcio C.; Bim, Edson; Herai, Roberto H.; Yamagishi, Michel E. B.; Palazzo, Reginaldo
2012-01-01
Since a genome is a discrete sequence, the elements of which belong to a set of four letters, the question as to whether or not there is an error-correcting code underlying DNA sequences is unavoidable. The most common approach to answering this question is to propose a methodology to verify the existence of such a code. However, none of the methodologies proposed so far, although quite clever, has achieved that goal. In a recent work, we showed that DNA sequences can be identified as codewords in a class of cyclic error-correcting codes known as Hamming codes. In this paper, we show that a complete intron-exon gene, and even a plasmid genome, can be identified as a Hamming code codeword as well. Although this does not constitute a definitive proof that there is an error-correcting code underlying DNA sequences, it is the first evidence in this direction. PMID:22649495
Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli
NASA Astrophysics Data System (ADS)
Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz
1981-02-01
Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.
Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni
2014-01-01
Summary The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications. PMID:25541598
Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni
2014-10-01
The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications.
Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C
2018-06-01
High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non-coding DNA. The putative ratio of non-synonymous and synonymous changes within the open reading frames (ORFs) in the plasmid sequence indicates that natural selection does not impact upon the prevalence of these mutations. Here we have demonstrated the abundance of mutations that fall outside of the reported range of detection of next generation sequencing (NGS) and second generation sequencing (SGS) platforms, providing a methodology capable of being utilized in cell line development platforms to identify the fidelity of recombinant genes throughout the production process. © 2018 Wiley Periodicals, Inc.
The mitochondrial genome of Moniliophthora roreri, the frosty pod rot pathogen of cacao.
Costa, Gustavo G L; Cabrera, Odalys G; Tiburcio, Ricardo A; Medrano, Francisco J; Carazzolle, Marcelo F; Thomazella, Daniela P T; Schuster, Stephen C; Carlson, John E; Guiltinan, Mark J; Bailey, Bryan A; Mieczkowski, Piotr; Pereira, Gonçalo A G; Meinhardt, Lyndel W
2012-05-01
In this study, we report the sequence of the mitochondrial (mt) genome of the Basidiomycete fungus Moniliophthora roreri, which is the etiologic agent of frosty pod rot of cacao (Theobroma cacao L.). We also compare it to the mtDNA from the closely-related species Moniliophthora perniciosa, which causes witches' broom disease of cacao. The 94 Kb mtDNA genome of M. roreri has a circular topology and codes for the typical 14 mt genes involved in oxidative phosphorylation. It also codes for both rRNA genes, a ribosomal protein subunit, 13 intronic open reading frames (ORFs), and a full complement of 27 tRNA genes. The conserved genes of M. roreri mtDNA are completely syntenic with homologous genes of the 109 Kb mtDNA of M. perniciosa. As in M. perniciosa, M. roreri mtDNA contains a high number of hypothetical ORFs (28), a remarkable feature that make Moniliophthoras the largest reservoir of hypothetical ORFs among sequenced fungal mtDNA. Additionally, the mt genome of M. roreri has three free invertron-like linear mt plasmids, one of which is very similar to that previously described as integrated into the main M. perniciosa mtDNA molecule. Moniliophthora roreri mtDNA also has a region of suspected plasmid origin containing 15 hypothetical ORFs distributed in both strands. One of these ORFs is similar to an ORF in the mtDNA gene encoding DNA polymerase in Pleurotus ostreatus. The comparison to M. perniciosa showed that the 15 Kb difference in mtDNA sizes is mainly attributed to a lower abundance of repetitive regions in M. roreri (5.8 Kb vs 20.7 Kb). The most notable differences between M. roreri and M. perniciosa mtDNA are attributed to repeats and regions of plasmid origin. These elements might have contributed to the rapid evolution of mtDNA. Since M. roreri is the second species of the genus Moniliophthora whose mtDNA genome has been sequenced, the data presented here contribute valuable information for understanding the evolution of fungal mt genomes among closely-related species. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.
Hofmeister series salts enhance purification of plasmid DNA by non-ionic detergents
Lezin, George; Kuehn, Michael R.; Brunelli, Luca
2011-01-01
Ion-exchange chromatography is the standard technique used for plasmid DNA purification, an essential molecular biology procedure. Non-ionic detergents (NIDs) have been used for plasmid DNA purification, but it is unclear whether Hofmeister series salts (HSS) change the solubility and phase separation properties of specific NIDs, enhancing plasmid DNA purification. After scaling-up NID-mediated plasmid DNA isolation, we established that NIDs in HSS solutions minimize plasmid DNA contamination with protein. In addition, large-scale NID/HSS solutions eliminated LPS contamination of plasmid DNA more effectively than Qiagen ion-exchange columns. Large-scale NID isolation/NID purification generated increased yields of high quality DNA compared to alkali isolation/column purification. This work characterizes how HSS enhance NID-mediated plasmid DNA purification, and demonstrates that NID phase transition is not necessary for LPS removal from plasmid DNA. Specific NIDs such as IGEPAL CA-520 can be utilized for rapid, inexpensive and efficient laboratory-based large-scale plasmid DNA purification, outperforming Qiagen-based column procedures. PMID:21351074
Michel, Christian J
2017-04-18
In 1996, a set X of 20 trinucleotides was identified in genes of both prokaryotes and eukaryotes which has on average the highest occurrence in reading frame compared to its two shifted frames. Furthermore, this set X has an interesting mathematical property as X is a maximal C 3 self-complementary trinucleotide circular code. In 2015, by quantifying the inspection approach used in 1996, the circular code X was confirmed in the genes of bacteria and eukaryotes and was also identified in the genes of plasmids and viruses. The method was based on the preferential occurrence of trinucleotides among the three frames at the gene population level. We extend here this definition at the gene level. This new statistical approach considers all the genes, i.e., of large and small lengths, with the same weight for searching the circular code X . As a consequence, the concept of circular code, in particular the reading frame retrieval, is directly associated to each gene. At the gene level, the circular code X is strengthened in the genes of bacteria, eukaryotes, plasmids, and viruses, and is now also identified in the genes of archaea. The genes of mitochondria and chloroplasts contain a subset of the circular code X . Finally, by studying viral genes, the circular code X was found in DNA genomes, RNA genomes, double-stranded genomes, and single-stranded genomes.
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926
Plasmid-linked ampicillin resistance in haempohilus influenza type b.
Elwell, L P; De Graaff, J; Seibert, D; Falkow, S
1975-08-01
Four ampicillin-resistant, beta-lactamase-producing strains of Haempohilus influenzae type b were examined for the presence of plasmid deoxyribonucleic acid (DNA). Three resistant strains contained a 30 x 10-6-dalton (30Mdal) plasmid and one resitant strain contained a 3-Mdal plasmid. The ampicillin-sensitive Haemophilus strains examined did not contain plasmid DNA. Transformation of a sensitive H. influenzae strain to ampicillin resistance with isolated plasmid DNA preparations revealed that the structural gene for beta-lactamase resided on both plasmid species. DNA-DNA hybridization studies showed that the 30-Mdal Haemophilus plasmid contained the ampicillin translocation DNA segment (TnA) found on some R-factors of enteric origin of the H. influenzae plasmids.
Davis, R; Vapnek, D
1976-01-01
The amounts of plasmid deoxyribonucleic acid (DNA) and the levels of the in vivo transcription of the Escherichia coli plasmids R538-1 (repressed for conjugal transfer) and R538-1drd (derepressed for transfer) were determined by DNA-DNA hybridization and DNA-ribonucleic acid hybridization, respectively. The results demonstrate that the level of plasmid transcription is increased by two-fold in the strain carrying the derepressed plasmid, compared to an isogenic strain carrying the repressed plasmid, whereas the amount of plasmid DNA is approximately the same, suggesting that the transfer genes are under transcriptional control. Levels of plasmid DNA, plasmid DNA transcription, and chloramphenicol acetyltransferase activity were also compared in a mutant strain that carried the R538-1drd plasmid and was resistant to high levels of antibiotics. This strain produces about 13 copies of plasmid DNA per chromosome compared to five copies for the parent strain. The level of transcription of plasmid DNA was found to be twofold higher in the high-level resistant strain, whereas the level of chloramphenition, acetyltransferase activity was increased by 10-fold. In addition the levels of plasmid DNA transcription and chloramphenicol acetyltransferase activity in the high-level resistant strain were found to be further increased by the presence of high levels of chloramphenicol in the growth medium. The amount of plasmid DNA remained constant under these conditions, indicating that high levels of chloramphenicol can stimulate the expression of plasmid genes at the level of transcription in this strain. PMID:767321
Suzuki, Ryosuke; Ishikawa, Tomohiro; Konishi, Eiji; Matsuda, Mami; Watashi, Koichi; Aizaki, Hideki; Takasaki, Tomohiko; Wakita, Takaji
2014-01-01
A method for rapid production of single-round infectious particles (SRIPs) of flavivirus would be useful for viral mutagenesis studies. Here, we established a DNA-based production system for SRIPs of flavivirus. We constructed a Japanese encephalitis virus (JEV) subgenomic replicon plasmid, which lacked the C-prM-E (capsid-pre-membrane-envelope) coding region, under the control of the cytomegalovirus promoter. When the JEV replicon plasmid was transiently co-transfected with a JEV C-prM-E expression plasmid into 293T cells, SRIPs were produced, indicating successful trans-complementation with JEV structural proteins. Equivalent production levels were observed when C and prM-E proteins were provided separately. Furthermore, dengue types 1-4, West Nile, yellow fever or tick-borne encephalitis virus prM-E proteins could be utilized for production of chimaeric flavivirus SRIPs, although the production was less efficient for dengue and yellow fever viruses. These results indicated that our plasmid-based system is suitable for investigating the life cycles of flaviviruses, diagnostic applications and development of safer vaccine candidates.
Ultrasound enhances in vivo tumor expression of plasmid DNA by PEG-introduced cationized dextran.
Hosseinkhani, Hossein; Tabata, Yasuhiko
2005-11-28
This study is an investigation to experimentally confirm whether or not ultrasound (US) irradiation is effective in enhancing the in vivo gene expression of plasmid DNA in tumor. Dextran was cationized by introducing spermine to the hydroxyl groups to allow to polyionically complex with a plasmid DNA. The cationized dextran prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have an active ester and methoxy groups at each terminal, to obtain cationized dextran with different percentages of PEG introduced. Various cationized dextrans with or without PEG introduction were mixed with a plasmid DNA of LacZ to form cationized dextran-plasmid DNA complexes. Electrophoretical examination revealed that the plasmid DNA was complexed both with the cationized dextran and PEG-introduced cationized dextran, irrespective of the PEG introduction percentage, although the higher N/P ratio was needed for plasmid DNA complexation with the latter. By complexation with the cationized dextran, the zeta potential of plasmid DNA was changed to be positive. The charge of PEG-introduced cationized dextran-plasmid DNA complexes became close to 0 mV as their percentage of PEG introduced increased, although the molecular size was about 250 nm, irrespective of the PEG introduction. When cationized dextran-plasmid DNA complexes with or without PEG introduction were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass and the subsequent US irradiation to the tumor mass percutaneously, the PEG-introduced cationized dextran-plasmid DNA complex plus US irradiation enhanced the tumor level of gene expression to a significantly high extent compared with the cationized dextran-plasmid DNA complex and free plasmid DNA with or without US irradiation. The enhanced level depended on the time period and timing of US irradiation. Fluorescent microscopic studies revealed that the localization of plasmid DNA and the gene expression were observed in the tumor tissue injected with the PEG-introduced cationized dextran-plasmid DNA complex plus the subsequent US irradiation. We conclude that complexation with the PEG-introduced cationized dextran combined with US irradiation is a promising way to target the plasmid DNA to the tumor for gene expression.
Michel, Christian J.
2017-01-01
In 1996, a set X of 20 trinucleotides was identified in genes of both prokaryotes and eukaryotes which has on average the highest occurrence in reading frame compared to its two shifted frames. Furthermore, this set X has an interesting mathematical property as X is a maximal C3 self-complementary trinucleotide circular code. In 2015, by quantifying the inspection approach used in 1996, the circular code X was confirmed in the genes of bacteria and eukaryotes and was also identified in the genes of plasmids and viruses. The method was based on the preferential occurrence of trinucleotides among the three frames at the gene population level. We extend here this definition at the gene level. This new statistical approach considers all the genes, i.e., of large and small lengths, with the same weight for searching the circular code X. As a consequence, the concept of circular code, in particular the reading frame retrieval, is directly associated to each gene. At the gene level, the circular code X is strengthened in the genes of bacteria, eukaryotes, plasmids, and viruses, and is now also identified in the genes of archaea. The genes of mitochondria and chloroplasts contain a subset of the circular code X. Finally, by studying viral genes, the circular code X was found in DNA genomes, RNA genomes, double-stranded genomes, and single-stranded genomes. PMID:28420220
Tumor targeting of gene expression through metal-coordinated conjugation with dextran.
Hosseinkhani, Hossein; Aoyama, Teruyoshi; Ogawa, Osamu; Tabata, Yasuhiko
2003-03-07
Tumor targeting of plasmid DNA was achieved through the conjugation of dextran derivatives with chelate residues based on metal coordination. Diethylenetriamine pentaacetic acid (DTPA), spermidine (Sd), and spermine (Sm) were chemically introduced to the hydroxyl groups of dextran to obtain dextran-DTPA, dextran-Sd and dextran-Sm derivatives. Conjugation of the dextran derivative by Zn(2+) coordination decreased the apparent size of the plasmid DNA, depending on the derivative type. The negative zeta potential of plasmid DNA became almost 0 mV after Zn(2+)-coordinated conjugation with dextran-Sm. When the dextran derivative-plasmid DNA conjugates with Zn(2+) coordination were intravenously injected subcutaneously into mice bearing Meth-AR-1 fibrosarcoma, the dextran-Sm-plasmid DNA conjugate significantly enhanced the level of gene expression in the tumor, in contrast to the conjugate of other dextran derivatives and free plasmid DNA. The enhanced gene expression produced by the Zn(2+)-coordinated dextran-Sm-plasmid DNA conjugate was specific to the tumor, whereas a simple mixture of dextran-Sm and plasmid DNA was not effective. The level of gene expression depended on the percentage of chelate residues introduced, the mixing weight ratio of the plasmid DNA/Sm residue used for conjugate preparation, and the plasmid DNA dose. A fluorescent microscopic study revealed that localization of plasmid DNA in the tumor tissue was observed only after injection of the dextran-Sm-plasmid DNA conjugate with Zn(2+) coordination. In addition, the gene expression induced by the conjugate lasted for more than 10 days after the injection. We conclude that Zn(2+)-coordinated dextran-Sm conjugation is a promising way to enable plasmid DNA to target the tumor in gene expression as well as to prolong the duration of gene expression.
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Cloning of the active thymidine kinase gene of herpes simplex virus type 1 in Escherichia coli K-12.
Colbere-Garapin, F; Chousterman, S; Horodniceanu, F; Kourilsky, P; Garapin, A C
1979-08-01
A herpes simplex virus DNA fragment that is produced by digestion with BamHI endonuclease and carries the thymidine kinase (TK; ATP:thymidine 5'-phosphotransferase, EC 2.7.1.21) gene has been cloned in Escherichia coli. A recombinat plasmid, pFG5, has been analyzed extensively and a detailed restriction map is presented. pFG5 DNA efficiently transforms TK- mouse L cells. The TK coding sequence in the cloned fragment has been localized and a smaller recombinant plasmid, pAG0, also carrying an active TK gene, has been constructed to serve as a more convenient vector for transfer, into TK- cells, of genes previously cloned in E. coli.
Design and construction of functional AAV vectors.
Gray, John T; Zolotukhin, Serge
2011-01-01
Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (P<0.05) bursal lesion scores and significantly lower (P<0.05) bursa weight/body weight ratios than those that only received P/VP243/E two or three times. Chickens inoculated with two plasmids separately in the thigh muscles of different legs or P/VP243/E two times had 33-50% protection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (P<0.05) than those in groups receiving two doses of P/VP243/E or P/VP243/E and P/cIFN-gamma. Chickens protected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A.; Li, Xinran; Zhu, Saijie; Cui, Zhengrong
2012-01-01
Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged anoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. PMID:22921518
Quantification Bias Caused by Plasmid DNA Conformation in Quantitative Real-Time PCR Assay
Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming
2011-01-01
Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification. PMID:22194997
2010-01-01
Research in plant molecular biology involves DNA purification on a daily basis. Although different commercial kits enable convenient extraction of high-quality DNA from E. coli cells, PCR and agarose gel samples as well as plant tissues, each kit is designed for a particular type of DNA extraction work, and the cost of purchasing these kits over a long run can be considerable. Furthermore, a simple method for the isolation of binary plasmid from Agrobacterium tumefaciens cells with satisfactory yield is lacking. Here we describe an easy protocol using homemade silicon dioxide matrix and seven simple solutions for DNA extraction from E. coli and A. tumefaciens cells, PCR and restriction digests, agarose gel slices, and plant tissues. Compared with the commercial kits, this protocol allows rapid DNA purification from diverse sources with comparable yield and purity at negligible cost. Following this protocol, we have demonstrated: (1) DNA fragments as small as a MYC-epitope tag coding sequence can be successfully recovered from an agarose gel slice; (2) Miniprep DNA from E. coli can be eluted with as little as 5 μl water, leading to high DNA concentrations (>1 μg/μl) for efficient biolistic bombardment of Arabidopsis seedlings, polyethylene glycol (PEG)-mediated Arabidopsis protoplast transfection and maize protoplast electroporation; (3) Binary plasmid DNA prepared from A. tumefaciens is suitable for verification by restriction analysis without the need for large scale propagation; (4) High-quality genomic DNA is readily isolated from several plant species including Arabidopsis, tobacco and maize. Thus, the silicon dioxide matrix-based DNA purification protocol offers an easy, efficient and economical way to extract DNA for various purposes in plant research. PMID:20180960
Large-scale preparation of plasmid DNA.
Heilig, J S; Elbing, K L; Brent, R
2001-05-01
Although the need for large quantities of plasmid DNA has diminished as techniques for manipulating small quantities of DNA have improved, occasionally large amounts of high-quality plasmid DNA are desired. This unit describes the preparation of milligram quantities of highly purified plasmid DNA. The first part of the unit describes three methods for preparing crude lysates enriched in plasmid DNA from bacterial cells grown in liquid culture: alkaline lysis, boiling, and Triton lysis. The second part describes four methods for purifying plasmid DNA in such lysates away from contaminating RNA and protein: CsCl/ethidium bromide density gradient centrifugation, polyethylene glycol (PEG) precipitation, anion-exchange chromatography, and size-exclusion chromatography.
Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A; Li, Xinran; Zhu, Saijie; Cui, Zhengrong
2012-10-28
Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed
2013-01-01
Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers. PMID:23637766
Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed
2013-01-01
Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers.
Vapnek, Daniel; Spingler, Elizabeth
1974-01-01
Deoxyribonucleic acid-ribonucleic acid (DNA-RNA) hybridization studies have been performed with R-plasmid DNA (R538-1drd) and in vivo-synthesized RNA. R-plasmid DNA was isolated from Escherichia coli K-12, and the complementary strands were separated in cesium chloride-polyuridylic acid-polyguanylic acid gradients. DNA-RNA hybridization was performed with the separated DNA strands and RNA purified from R-plasmid-carrying cells. The results demonstrated that an asymmetric transcription of the R-plasmid DNA occurs in vivo. Hybridization was only detected with the H strand (denser strand in cesium chloride-polyuridylic acid-polyguanylic acid). By determining the density of the RNA-DNA hybrid in CsCl gradients, it was estimated that greater than 60% of the nucleotide sequences in the R-plasmid DNA are transcribed in logarithmically growing E. coli cells. No R-plasmid-specific RNA was detected in E. coli cells that did not carry the plasmid. PMID:4612013
Yang, V W; Marks, J A; Davis, B P; Jeffries, T W
1994-01-01
This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063
Santos, Diego M; Carneiro, Marcia W; de Moura, Tatiana R; Fukutani, Kiyoshi; Clarencio, Jorge; Soto, Manuel; Espuelas, Socorro; Brodskyn, Claudia; Barral, Aldina; Barral-Netto, Manoel; de Oliveira, Camila I
2012-01-01
Vaccine development has been a priority in the fight against leishmaniases, which are vector-borne diseases caused by Leishmania protozoa. Among the different immunization strategies employed to date is inoculation of plasmid DNA coding for parasite antigens, which has a demonstrated ability to induce humoral and cellular immune responses. In this sense, inoculation of plasmid DNA encoding Leishmania kinetoplasmid membrane protein-11 (KMP-11) was able to confer protection against visceral leishmaniasis. However, recently the use of antigen delivery systems such as poly(lactic-co-glycolic acid) (PLGA) nanoparticles has also proven effective for eliciting protective immune responses. In the present work, we tested two immunization strategies with the goal of obtaining protection, in terms of lesion development and parasite load, against cutaneous leishmaniasis caused by L. braziliensis. One strategy involved immunization with plasmid DNA encoding L. infantum chagasi KMP-11. Alternatively, mice were primed with PLGA nanoparticles loaded with the recombinant plasmid DNA and boosted using PLGA nanoparticles loaded with recombinant KMP-11. Both immunization strategies elicited detectable cellular immune responses with the presence of both proinflammatory and anti-inflammatory cytokines; mice receiving the recombinant PLGA nanoparticle formulations also demonstrated anti-KMP-11 IgG1 and IgG2a. Mice were then challenged with L. braziliensis, in the presence of sand fly saliva. Lesion development was not inhibited following either immunization strategy. However, immunization with PLGA nanoparticles resulted in a more prominent reduction in parasite load at the infection site when compared with immunization using plasmid DNA alone. This effect was associated with a local increase in interferon-gamma and in tumor necrosis factor-alpha. Both immunization strategies also resulted in a lower parasite load in the draining lymph nodes, albeit not significantly. Our results encourage the pursuit of immunization strategies employing nanobased delivery systems for vaccine development against cutaneous leishmaniasis caused by L. braziliensis infection.
The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector
NASA Technical Reports Server (NTRS)
Ludwig, D. L.; Bruschi, C. V.
1991-01-01
The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.
A gene delivery system for insect cells mediated by arginine-rich cell-penetrating peptides.
Chen, Yung-Jen; Liu, Betty Revon; Dai, Yun-Hao; Lee, Cheng-Yi; Chan, Ming-Huan; Chen, Hwei-Hsien; Chiang, Huey-Jenn; Lee, Han-Jung
2012-02-10
Most bioactive macromolecules, such as protein, DNA and RNA, basically cannot permeate into cells freely from outside the plasma membrane. Cell-penetrating peptides (CPPs) are a group of short peptides that possess the ability to traverse the cell membrane and have been considered as candidates for mediating gene and drug delivery into living cells. In this study, we demonstrate that three arginine-rich CPPs (SR9, HR9 and PR9) are able to form stable complexes with plasmid DNA and deliver DNA into insect Sf9 cells in a noncovalent manner. The transferred plasmid DNA containing enhanced green fluorescent protein (EGFP) and red fluorescent protein (RFP) coding regions could be expressed in cells functionally assayed at both the protein and RNA levels. Furthermore, treatment of cells with CPPs and CPP/DNA complexes resulted in a viability of 84-93% indicating these CPPs are not cytotoxic. These results suggest that arginine-rich CPPs appear to be a promising tool for insect transgenesis. Copyright © 2011 Elsevier B.V. All rights reserved.
Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.
2017-01-01
We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072
Hosseinkhani, Hossein; Tabata, Yasuhiko
2004-05-31
The objective of this study is to investigate feasibility of a non-viral gene carrier with repeated RGD sequences (Pronectin F+) in tumor targeting for gene expression. The Pronectin F+ was cationized by introducing spermine (Sm) to the hydroxyl groups to allow to polyionically complex with plasmid DNA. The cationized Pronectin F+ prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have active ester and methoxy groups at the terminal, to form various PEG-introduced cationized Pronectin F+. The cationized Pronectin F+ with or without PEGylation at different extents was mixed with a plasmid DNA of LacZ to form respective cationized Pronectin F+-plasmid DNA complexes. The plasmid DNA was electrophoretically complexed with cationized Pronectin F+ and PEG-introduced cationized Pronectin F+, irrespective of the PEGylation extent, although the higher N/P ratio of complexes was needed for complexation with the latter Pronectin F+. The molecular size and zeta potential measurements revealed that the plasmid DNA was reduced in size to about 250 nm and the charge was changed to be positive by the complexation with cationized Pronectin F+. For the complexation with PEG-introduced cationized Pronectin F+, the charge of complex became neutral being almost 0 mV with the increasing PEGylation extents, while the molecular size was similar to that of cationized Pronectin F+. When cationized Pronectin F+-plasmid DNA complexes with or without PEGylation were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass, the PEG-introduced cationized Pronectin F+-plasmid DNA complex specifically enhanced the level of gene expression in the tumor, to a significantly high extent compared with the cationized Pronectin F+-plasmid DNA complexes and free plasmid DNA. The enhanced level of gene expression depended on the percentage of PEG introduced, the N/P ratio, and the plasmid DNA dose. A fluorescent microscopic study revealed that the localization of plasmid DNA in the tumor tissue was observed only for the PEG-introduced cationized Pronectin F+-plasmid DNA complex injected. We conclude that the PEGylation of cationized Pronectin F+ is a promising way to enable the plasmid DNA to target to the tumor for gene expression. Coyright 2004 Elsevier B.V.
Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.
Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg
2015-11-25
DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.
Barth, Peter T.; Grinter, Nigel J.
1974-01-01
Bacterial strains showing linked resistance to streptomycin (Sm) and sulfonamides (Su) were chosen representing a wide taxonomic and geographical range. Their SmSu resistances were transferred to Escherichia coli K-12 and then plasmid deoxyribonucleic acid (DNA) was isolated by ethidium bromide CsCl centrifugation. The plasmid DNA was examined by electron microscopy and analyzed by sedimentation through 5 to 20% neutral sucrose gradients. Plasmid DNA from strains having transmissible SmSu resistance consisted of two or three molecular species, one of which had a molecular mass of about 5.7 Mdal (106 daltons), the others varying between 20 to 60 Mdal. By using transformation or F′ mobilization, we isolated the SmSu-resistance determinant from any fellow resident plasmids in each strain and again isolated the plasmid DNA. Cosedimentation of each of these with a differently labeled reference plasmid DNA (R300B) showed 9 out of 12 of the plasmids to have a molecular mass not significantly different from the reference (5.7 Mdal); two others were 6.3 and 9.2 Mdal, but PB165 consisted of three plasmids of 7.4, 14.7, and 21.4 Mdal. Three separate isolations of the SmSu determinant from PB165 gave the same three plasmids, which we conclude may be monomer, dimer, and trimer, respectively. DNA-DNA hybridizations at 75 C demonstrated 80 to 93% homology between reference R300B DNA and each isolated SmSu plasmid DNA, except for the 9.2-Mdal plasmid which had 45% homology and PB165 which had 35%. All the SmSu plasmids were present as multiple copies (about 10) per chromosome. The conjugative plasmid of R300 (present as 1.3 copies per chromosome) has been shown to have negligible effect on the number of copies of its accompanying SmSu plasmid R300B. We conclude that the SmSu plasmids are closely related and probably have a common evolutionary origin. Images PMID:4616941
Stohl, L L; Collins, R A; Cole, M D; Lambowitz, A M
1982-01-01
Mitochondria from two Neurospora intermedia strains (P4O5-Labelle and Fiji N6-6) were found to contain plasmid DNAs in addition to the standard mitochondrial DNA species. The plasmid DNAs consist of monomeric circles (4.1-4.3 kbp and 5.2-5.3 kbp for Labelle and Fiji, respectively) and oligomers in which monomers are organized as head-to-tail repeats. DNA-DNA hybridization experiments showed that the plasmids have no substantial sequence homology to mtDNA, to each other, or to a previously characterized mitochondrial plasmid from N. crassa strain Mauriceville-lc (Collins et al. Cell 24, 443-452, 1981). The intramitochondrial location of the plasmids was established by cell fractionation and nuclease protection experiments. In sexual crosses, the plasmids showed strict maternal inheritance, the same as Neurospora mitochondrial DNA. The plasmids may represent a novel class of mitochondrial genetic elements. Images PMID:6280144
In real-time quantitative PCR studies using absolute plasmid DNA standards, a calibration curve is developed to estimate an unknown DNA concentration. However, potential differences in the amplification performance of plasmid DNA compared to genomic DNA standards are often ignore...
Nunes, Catherine; Sousa, Angela; Nunes, José C; Morão, António M; Sousa, Fani; Queiroz, João A
2014-06-01
The present study describes the integration of membrane technology with monolithic chromatography to obtain plasmid DNA with high quality. Isolation and clarification of plasmid DNA lysate were first conducted by a microfiltration step, by using a hydrophilic nylon microfiltration membrane, avoiding the need of centrifugation. For the total elimination of the remaining impurities, a suitable purification step is required. Monolithic stationary phases have been successfully applied as an alternative to conventional supports. Thus, the sample recovered from the membrane process was applied into a nongrafted CarbonylDiImidazole disk. Throughout the global procedure, a reduced level of impurities such as proteins and RNA was obtained, and no genomic DNA was detectable in the plasmid DNA sample. The chromatographic process demonstrated an efficient performance on supercoiled plasmid DNA purity and recovery (100 and 84.44%, respectively). Thereby, combining the membrane technology to eliminate some impurities from lysate sample with an efficient chromatographic strategy to purify the supercoiled plasmid DNA arises as a powerful approach for industrial-scale systems aiming at plasmid DNA purification. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Construction of Biologically Functional Bacterial Plasmids In Vitro
Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.
1973-01-01
The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039
Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B
1999-05-01
The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.
The control of lambda DNA terminase synthesis.
Murialdo, H; Davidson, A; Chow, S; Gold, M
1987-01-01
Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667
Explanatory chapter: how plasmid preparation kits work.
Koontz, Laura
2013-01-01
To isolate plasmid DNA from bacteria using a commercial plasmid miniprep kit (if interested, compare this protocol with Isolation of plasmid DNA from bacteria). Copyright © 2013 Elsevier Inc. All rights reserved.
Enhancing Malaria Vaccine Development by the Naval Medical Research Center
2003-03-01
optimized in Milestone 1 of this Phase II project. Reduction in particle size of the biopolymeric carrier was sufficient for intramuscular administration of...glycolide) (PLGA) with incorporated DNA plasmid were developed for systemic administration of DNA plasmids for use as a malaria vaccine. Objectives in...with incorporated DNA plasmid were developed for systemic administration of DNA plasmids for use as a malaria vaccine. Objectives in Milestone 1
Plasmid fermentation process for DNA immunization applications.
Carnes, Aaron E; Williams, James A
2014-01-01
Plasmid DNA for immunization applications must be of the highest purity and quality. The ability of downstream purification to efficiently produce a pure final product is directly influenced by the performance of the upstream fermentation process. While several clinical manufacturing facilities already have validated fermentation processes in place to manufacture plasmid DNA for use in humans, a simple and inexpensive laboratory-scale fermentation process can be valuable for in-house production of plasmid DNA for use in animal efficacy studies. This chapter describes a simple fed-batch fermentation process for producing bacterial cell paste enriched with high-quality plasmid DNA. A constant feeding strategy results in a medium cell density culture with continuously increasing plasmid amplification towards the end of the process. Cell banking and seed culture preparation protocols, which can dramatically influence final product yield and quality, are also described. These protocols are suitable for production of research-grade plasmid DNA at the 100 mg-to-1.5 g scale from a typical 10 L laboratory benchtop fermentor.
Dealtry, Simone; Holmsgaard, Peter N.; Dunon, Vincent; Jechalke, Sven; Ding, Guo-Chun; Krögerrecklenfort, Ellen; Heuer, Holger; Hansen, Lars H.; Springael, Dirk; Zühlke, Sebastian; Sørensen, Søren J.
2014-01-01
Biopurification systems (BPS) are used on farms to control pollution by treating pesticide-contaminated water. It is assumed that mobile genetic elements (MGEs) carrying genes coding for enzymes involved in degradation might contribute to the degradation of pesticides. Therefore, the composition and shifts of MGEs, in particular, of IncP-1 plasmids carried by BPS bacterial communities exposed to various pesticides, were monitored over the course of an agricultural season. PCR amplification of total community DNA using primers targeting genes specific to different plasmid groups combined with Southern blot hybridization indicated a high abundance of plasmids belonging to IncP-1, IncP-7, IncP-9, IncQ, and IncW, while IncU and IncN plasmids were less abundant or not detected. Furthermore, the integrase genes of class 1 and 2 integrons (intI1, intI2) and genes encoding resistance to sulfonamides (sul1, sul2) and streptomycin (aadA) were detected and seasonality was revealed. Amplicon pyrosequencing of the IncP-1 trfA gene coding for the replication initiation protein revealed high IncP-1 plasmid diversity and an increase in the abundance of IncP-1β and a decrease in the abundance of IncP-1ε over time. The data of the chemical analysis showed increasing concentrations of various pesticides over the course of the agricultural season. As an increase in the relative abundances of bacteria carrying IncP-1β plasmids also occurred, this might point to a role of these plasmids in the degradation of many different pesticides. PMID:24771027
Improvement and Optimization of Two Engineered Phage Resistance Mechanisms in Lactococcus lactis
McGrath, Stephen; Fitzgerald, Gerald F.; van Sinderen, Douwe
2001-01-01
Homologous replication module genes were identified for four P335 type phages. DNA sequence analysis revealed that all four phages exhibited more than 90% DNA homology for at least two genes, designated rep2009 and orf17. One of these genes, rep2009, codes for a putative replisome organizer protein and contains an assumed origin of phage DNA replication (ori2009), which was identical for all four phages. DNA fragments representing the ori2009 sequence confer a phage-encoded resistance (Per) phenotype on lactococcal hosts when they are supplied on a high-copy-number vector. Furthermore, cloning multiple copies of the ori2009 sequence was found to increase the effectiveness of the Per phenotype conferred. A number of antisense plasmids targeting specific genes of the replication module were constructed. Two separate plasmids targeting rep2009 and orf17 were found to efficiently inhibit proliferation of all four phages by interfering with intracellular phage DNA replication. These results represent two highly effective strategies for inhibiting bacteriophage proliferation, and they also identify a novel gene, orf17, which appears to be important for phage DNA replication. Furthermore, these results indicate that although the actual mechanisms of DNA replication are very similar, if not identical, for all four phages, expression of the replication genes is significantly different in each case. PMID:11157223
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Sletvold, H; Johnsen, P J; Hamre, I; Simonsen, G S; Sundsfjord, A; Nielsen, K M
2008-07-01
Glycopeptide resistant Enterococcus faecium (GREF) persists on Norwegian poultry farms despite the ban on the growth promoter avoparcin. The biological basis for long-term persistence of avoparcin resistance is not fully understood. This study presents the complete DNA sequence of the E. faecium R-plasmid pVEF3 and functional studies of some plasmid-encoded traits (a toxin-antitoxin (TA) system and an ABC transporter) that may be of importance for plasmid persistence. The pVEF3 (63.1 kbp), isolated from an E. faecium strain of poultry origin sampled in Norway in 1999, has 71 coding sequences including the vanA avoparcin/vancomycin resistance encoding gene cluster. pVEF3 encodes the TA system omega-epsilon-zeta, and plasmid stability tests and transcription analysis show that omega-epsilon-zeta is functional in Enterococcus faecalis OGIX, although with decreasing effect over time. The predicted ABC transporter was not found to confer reduced susceptibility to any of the 28 substances tested. The TA system identified in the pVEF-type plasmids may contribute to vanA plasmid persistence on Norwegian poultry farms. However, size and compositional heterogeneity among E. faecium vanA plasmids suggest that additional plasmid maintenance systems in combination with host specific factors and frequent horizontal gene transfer and rearrangement causes the observed plasmid composition and distribution patterns.
Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance
Coffee, Erin M.; Tolan, Dean R.
2010-01-01
SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353
Longkumer, Toshisangba; Kamireddy, Swetha; Muthyala, Venkateswar Reddy; Akbarpasha, Shaikh; Pitchika, Gopi Krishna; Kodetham, Gopinath; Ayaluru, Murali; Siddavattam, Dayananda
2013-01-01
While analyzing plasmids of Acinetobacter sp. DS002 we have detected a circular DNA molecule pTS236, which upon further investigation is identified as the genome of a phage. The phage genome has shown sequence similarity to the recently discovered Sphinx 2.36 DNA sequence co-purified with the Transmissible Spongiform Encephalopathy (TSE) particles isolated from infected brain samples collected from diverse geographical regions. As in Sphinx 2.36, the phage genome also codes for three proteins. One of them codes for RepA and is shown to be involved in replication of pTS236 through rolling circle (RC) mode. The other two translationally coupled ORFs, orf106 and orf96, code for coat proteins of the phage. Although an orf96 homologue was not previously reported in Sphinx 2.36, a closer examination of DNA sequence of Sphinx 2.36 revealed its presence downstream of orf106 homologue. TEM images and infection assays revealed existence of phage AbDs1 in Acinetobacter sp. DS002.
Longkumer, Toshisangba; Kamireddy, Swetha; Muthyala, Venkateswar Reddy; Akbarpasha, Shaikh; Pitchika, Gopi Krishna; Kodetham, Gopinath; Ayaluru, Murali; Siddavattam, Dayananda
2013-01-01
While analyzing plasmids of Acinetobacter sp. DS002 we have detected a circular DNA molecule pTS236, which upon further investigation is identified as the genome of a phage. The phage genome has shown sequence similarity to the recently discovered Sphinx 2.36 DNA sequence co-purified with the Transmissible Spongiform Encephalopathy (TSE) particles isolated from infected brain samples collected from diverse geographical regions. As in Sphinx 2.36, the phage genome also codes for three proteins. One of them codes for RepA and is shown to be involved in replication of pTS236 through rolling circle (RC) mode. The other two translationally coupled ORFs, orf106 and orf96, code for coat proteins of the phage. Although an orf96 homologue was not previously reported in Sphinx 2.36, a closer examination of DNA sequence of Sphinx 2.36 revealed its presence downstream of orf106 homologue. TEM images and infection assays revealed existence of phage AbDs1 in Acinetobacter sp. DS002. PMID:23867905
Ribeiro, S C; Monteiro, G A; Prazeres, D M F
2009-04-01
Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.
Streptococcus mutans serotype c tagatose 6-phosphate pathway gene cluster.
Jagusztyn-Krynicka, E K; Hansen, J B; Crow, V L; Thomas, T D; Honeyman, A L; Curtiss, R
1992-01-01
DNA cloned into Escherichia coli K-12 from a serotype c strain of Streptococcus mutans encodes three enzyme activities for galactose utilization via the tagatose 6-phosphate pathway: galactose 6-phosphate isomerase, tagatose 6-phosphate kinase, and tagatose-1,6-bisphosphate aldolase. The genes coding for the tagatose 6-phosphate pathway were located on a 3.28-kb HindIII DNA fragment. Analysis of the tagatose proteins expressed by recombinant plasmids in minicells was used to determine the sizes of the various gene products. Mutagenesis of these plasmids with transposon Tn5 was used to determine the order of the tagatose genes. Tagatose 6-phosphate isomerase appears to be composed of 14- and 19-kDa subunits. The sizes of the kinase and aldolase were found to be 34 and 36 kDa, respectively. These values correspond to those reported previously for the tagatose pathway enzymes in Staphylococcus aureus and Lactococcus lactis. Images PMID:1328153
Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick
2001-01-01
The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501
Craig, R K; Hall, L; Parker, D; Campbell, P N
1981-01-01
A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038
Dolgova, Evgeniya V; Potter, Ekaterina A; Proskurina, Anastasiya S; Minkevich, Alexandra M; Chernych, Elena R; Ostanin, Alexandr A; Efremov, Yaroslav R; Bayborodin, Sergey I; Nikolin, Valeriy P; Popova, Nelly A; Kolchanov, Nikolay A; Bogachev, Sergey S
2016-05-25
Previously, we demonstrated that poorly differentiated cells of various origins, including tumor-initiating stem cells present in the ascites form of mouse cancer cell line Krebs-2, are capable of naturally internalizing both linear double-stranded DNA and circular plasmid DNA. The method of co-incubating Krebs-2 cells with extracellular plasmid DNA (pUC19) or TAMRA-5'-dUTP-labeled polymerase chain reaction (PCR) product was used. It was found that internalized plasmid DNA isolated from Krebs-2 can be transformed into competent Escherichia coli cells. Thus, the internalization processes taking place in the Krebs-2 cell subpopulation have been analyzed and compared, as assayed by E. coli colony formation assay (plasmid DNA) and cytofluorescence (TAMRA-DNA). We showed that extracellular DNA both in the form of plasmid DNA and a PCR product is internalized by the same subpopulation of Krebs-2 cells. We found that the saturation threshold for Krebs-2 ascites cells is 0.5 μg DNA/10(6) cells. Supercoiled plasmid DNA, human high-molecular weight DNA, and 500 bp PCR fragments are internalized into the Krebs-2 tumor-initiating stem cells via distinct, non-competing internalization pathways. Under our experimental conditions, each cell may harbor 340-2600 copies of intact plasmid material, or up to 3.097 ± 0.044×10(6) plasmid copies (intact or not), as detected by quantitative PCR. The internalization dynamics of extracellular DNA, copy number of the plasmids taken up by the cells, and competition between different types of double-stranded DNA upon internalization into tumor-initiating stem cells of mouse ascites Krebs-2 have been comprehensively analyzed. Investigation of the extracellular DNA internalization into tumor-initiating stem cells is an important part of understanding their properties and possible destruction mechanisms. For example, a TAMRA-labeled DNA probe may serve as an instrument to develop a target for the therapy of cancer, aiming at elimination of tumor stem cells, as well as developing a straightforward test system for the quantification of poorly differentiated cells, including tumor-initiating stem cells, in the bulk tumor sample (biopsy or surgery specimen).
Tikhomirova, L P; Ikonomova, R N; Kuznetsova, E N
1986-01-01
For the transformation of the yeast Hansenula polymorpha we have constructed a set of hybrid plasmids carrying the LEU2 gene of Saccharomyces cerevisiae as a selective marker and fragments of mitochondrial DNA of Candida utilis and H. polymorpha or chromosomal DNA fragments of H. polymorpha as replicator sequences. The replication properties of chimeric plasmids in the yeast H. polymorpha were investigated. We showed that for plasmids propagated autonomously in this yeast the plasmid monomers could be detected in the transformants only during the immediate time after the transformation event. Further growth under selective conditions led to the selection of polymeric forms of plasmid DNA as it was clearly shown for transformants carrying cosmid pL2 with mtDNA fragment of C. utilis. Such transformants carrying polymerized plasmids showed a remarkably increased stability of the transformed phenotype. Cosmid pL2 was able to shuttle between Escherichia coli, S. cerevisiae and H. polymorpha, whereas plasmids with DNA fragments from H. polymorpha did not transform S. cerevisiae effectively.
Liu, Betty R.; Huang, Yue-Wern; Aronstam, Robert S.; Lee, Han-Jung
2016-01-01
Cell-penetrating peptides (CPPs) have been shown to deliver cargos, including protein, DNA, RNA, and nanomaterials, in fully active forms into live cells. Most of the CPP sequences in use today are based on non-native proteins that may be immunogenic. Here we demonstrate that the L5a CPP (RRWQW) from bovine lactoferricin (LFcin), stably and noncovalently complexed with plasmid DNA and prepared at an optimal nitrogen/phosphate ratio of 12, is able to efficiently enter into human lung cancer A549 cells. The L5a CPP delivered a plasmid containing the enhanced green fluorescent protein (EGFP) coding sequence that was subsequently expressed in cells, as revealed by real-time PCR and fluorescent microscopy at the mRNA and protein levels, respectively. Treatment with calcium chloride increased the level of gene expression, without affecting CPP-mediated transfection efficiency. Zeta-potential analysis revealed that positively electrostatic interactions of CPP/DNA complexes correlated with CPP-mediated transport. The L5a and L5a/DNA complexes were not cytotoxic. This biomimetic LFcin L5a represents one of the shortest effective CPPs and could be a promising lead peptide with less immunogenic for DNA delivery in gene therapy. PMID:26942714
Liu, Betty R; Huang, Yue-Wern; Aronstam, Robert S; Lee, Han-Jung
2016-01-01
Cell-penetrating peptides (CPPs) have been shown to deliver cargos, including protein, DNA, RNA, and nanomaterials, in fully active forms into live cells. Most of the CPP sequences in use today are based on non-native proteins that may be immunogenic. Here we demonstrate that the L5a CPP (RRWQW) from bovine lactoferricin (LFcin), stably and noncovalently complexed with plasmid DNA and prepared at an optimal nitrogen/phosphate ratio of 12, is able to efficiently enter into human lung cancer A549 cells. The L5a CPP delivered a plasmid containing the enhanced green fluorescent protein (EGFP) coding sequence that was subsequently expressed in cells, as revealed by real-time PCR and fluorescent microscopy at the mRNA and protein levels, respectively. Treatment with calcium chloride increased the level of gene expression, without affecting CPP-mediated transfection efficiency. Zeta-potential analysis revealed that positively electrostatic interactions of CPP/DNA complexes correlated with CPP-mediated transport. The L5a and L5a/DNA complexes were not cytotoxic. This biomimetic LFcin L5a represents one of the shortest effective CPPs and could be a promising lead peptide with less immunogenic for DNA delivery in gene therapy.
Rapid screening for plasmid DNA.
Hughes, C; Meynell, G G
1977-03-07
A procedure is described for demonstrating plasmid DNA and its molecular weight, based on rate zonal centrifugation of unlabelled DNA in neutral sucrose gradients containing a low concentration of ethidium bromide. Each DNA species is then visualized as a discrete fluorescent band when the centrifuge tube is illuminated with ultra-violet light. Plasmids exist as closed circular and as relaxed circular molecules, which sediment separately, but during preparation of lysates, closed circular molecules are nicked so that each plasmid forms only a single band of relaxed circles within the gradient.
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
O'Brien, Travis J; Jiang, Guohui; Chun, Gina; Mandel, H George; Westphal, Craig S; Kahen, Kaveh; Montaser, Akbar; States, J Christopher; Patierno, Steven R
2006-11-07
Some hexavalent chromium [Cr(VI)]-containing compounds are lung carcinogens. Once within cells, Cr(VI) is reduced to trivalent chromium [Cr(III)] which displays an affinity for both DNA bases and the phosphate backbone. A diverse array of genetic lesions is produced by Cr including Cr-DNA monoadducts, DNA interstrand crosslinks (ICLs), DNA-Cr-protein crosslinks (DPCs), abasic sites, DNA strand breaks and oxidized bases. Despite the large amount of information available on the genotoxicity of Cr, little is known regarding the molecular mechanisms involved in the removal of these lesions from damaged DNA. Recent work indicates that nucleotide excision repair (NER) is involved in the processing of Cr-DNA adducts in human and rodent cells. In order to better understand this process at the molecular level and begin to identify the Cr-DNA adducts processed by NER, the incision of CrCl(3) [Cr(III)]-damaged plasmid DNA was studied using a thermal-resistant UvrABC NER endonuclease from Bacillus caldotenax (Bca). Treatment of plasmid DNA with Cr(III) (as CrCl(3)) increased DNA binding as a function of dose. For example, at a Cr(III) concentration of 1 microM we observed approximately 2 Cr(III)-DNA adducts per plasmid. At this same concentration of Cr(III) we found that approximately 17% of the plasmid DNA contained ICLs ( approximately 0.2 ICLs/plasmid). When plasmid DNA treated with Cr(III) (1 microM) was incubated with Bca UvrABC we observed approximately 0.8 incisions/plasmid. The formation of endonuclease IV-sensitive abasic lesions or Fpg-sensitive oxidized DNA bases was not detected suggesting that the incision of Cr(III)-damaged plasmid DNA by UvrABC was not related to the generation of oxidized DNA damage. Taken together, our data suggest that a sub-fraction of Cr(III)-DNA adducts is recognized and processed by the prokaryotic NER machinery and that ICLs are not necessarily the sole lesions generated by Cr(III) that are substrates for NER.
He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan
2016-08-01
The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.
Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei
2014-01-01
DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks. PMID:24736466
Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei
2014-01-01
DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.
Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.
Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M
1985-10-30
A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.
Reconstructing the complex evolutionary history of mobile plasmids in red algal genomes
Lee, JunMo; Kim, Kyeong Mi; Yang, Eun Chan; Miller, Kathy Ann; Boo, Sung Min; Bhattacharya, Debashish; Yoon, Hwan Su
2016-01-01
The integration of foreign DNA into algal and plant plastid genomes is a rare event, with only a few known examples of horizontal gene transfer (HGT). Plasmids, which are well-studied drivers of HGT in prokaryotes, have been reported previously in red algae (Rhodophyta). However, the distribution of these mobile DNA elements and their sites of integration into the plastid (ptDNA), mitochondrial (mtDNA), and nuclear genomes of Rhodophyta remain unknown. Here we reconstructed the complex evolutionary history of plasmid-derived DNAs in red algae. Comparative analysis of 21 rhodophyte ptDNAs, including new genome data for 5 species, turned up 22 plasmid-derived open reading frames (ORFs) that showed syntenic and copy number variation among species, but were conserved within different individuals in three lineages. Several plasmid-derived homologs were found not only in ptDNA but also in mtDNA and in the nuclear genome of green plants, stramenopiles, and rhizarians. Phylogenetic and plasmid-derived ORF analyses showed that the majority of plasmid DNAs originated within red algae, whereas others were derived from cyanobacteria, other bacteria, and viruses. Our results elucidate the evolution of plasmid DNAs in red algae and suggest that they spread as parasitic genetic elements. This hypothesis is consistent with their sporadic distribution within Rhodophyta. PMID:27030297
An 'instant gene bank' method for gene cloning by mutant complementation.
Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J
1994-02-01
We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.
Kobayashi, Shintaro; Yoshii, Kentaro; Hirano, Minato; Muto, Memi; Kariwa, Hiroaki
2017-02-01
Reverse genetics systems facilitate investigation of many aspects of the life cycle and pathogenesis of viruses. However, genetic instability in Escherichia coli has hampered development of a reverse genetics system for West Nile virus (WNV). In this study, we developed a novel reverse genetics system for WNV based on homologous recombination in mammalian cells. Introduction of the DNA fragment coding for the WNV structural protein together with a DNA-based replicon resulted in the release of infectious WNV. The growth rate and plaque size of the recombinant virus were almost identical to those of the parent WNV. Furthermore, chimeric WNV was produced by introducing the DNA fragment coding for the structural protein and replicon plasmid derived from various strains. Here, we report development of a novel system that will facilitate research into WNV infection. Copyright © 2016 Elsevier B.V. All rights reserved.
The abundant extrachromosomal DNA content of the Spiroplasma citri GII3-3X genome
Saillard, Colette; Carle, Patricia; Duret-Nurbel, Sybille; Henri, Raphaël; Killiny, Nabil; Carrère, Sébastien; Gouzy, Jérome; Bové, Joseph-Marie; Renaudin, Joël; Foissac, Xavier
2008-01-01
Background Spiroplama citri, the causal agent of citrus stubborn disease, is a bacterium of the class Mollicutes and is transmitted by phloem-feeding leafhopper vectors. In order to characterize candidate genes potentially involved in spiroplasma transmission and pathogenicity, the genome of S. citri strain GII3-3X is currently being deciphered. Results Assembling 20,000 sequencing reads generated seven circular contigs, none of which fit the 1.8 Mb chromosome map or carried chromosomal markers. These contigs correspond to seven plasmids: pSci1 to pSci6, with sizes ranging from 12.9 to 35.3 kbp and pSciA of 7.8 kbp. Plasmids pSci were detected as multiple copies in strain GII3-3X. Plasmid copy numbers of pSci1-6, as deduced from sequencing coverage, were estimated at 10 to 14 copies per spiroplasma cell, representing 1.6 Mb of extrachromosomal DNA. Genes encoding proteins of the TrsE-TraE, Mob, TraD-TraG, and Soj-ParA protein families were predicted in most of the pSci sequences, in addition to members of 14 protein families of unknown function. Plasmid pSci6 encodes protein P32, a marker of insect transmissibility. Plasmids pSci1-5 code for eight different S. citri adhesion-related proteins (ScARPs) that are homologous to the previously described protein P89 and the S. kunkelii SkARP1. Conserved signal peptides and C-terminal transmembrane alpha helices were predicted in all ScARPs. The predicted surface-exposed N-terminal region possesses the following elements: (i) 6 to 8 repeats of 39 to 42 amino acids each (sarpin repeats), (ii) a central conserved region of 330 amino acids followed by (iii) a more variable domain of about 110 amino acids. The C-terminus, predicted to be cytoplasmic, consists of a 27 amino acid stretch enriched in arginine and lysine (KR) and an optional 23 amino acid stretch enriched in lysine, aspartate and glutamate (KDE). Plasmids pSci mainly present a linear increase of cumulative GC skew except in regions presenting conserved hairpin structures. Conclusion The genome of S. citri GII3-3X is characterized by abundant extrachromosomal elements. The pSci plasmids could not only be vertically inherited but also horizontally transmitted, as they encode proteins usually involved in DNA element partitioning and cell to cell DNA transfer. Because plasmids pSci1-5 encode surface proteins of the ScARP family and pSci6 was recently shown to confer insect transmissibility, diversity and abundance of S. citri plasmids may essentially aid the rapid adaptation of S. citri to more efficient transmission by different insect vectors and to various plant hosts. PMID:18442384
Upadhya, Archana; Sangave, Preeti C
2016-10-01
Cell penetrating peptides are useful tools for intracellular delivery of nucleic acids. Delivery of plasmid DNA, a large nucleic acid, poses a challenge for peptide mediated transport. The paper investigates and compares efficacy of five novel peptide designs for complexation of plasmid DNA and subsequent delivery into cells. The peptides were designed to contain reported DNA condensing agents and basic cell penetrating sequences, octa-arginine (R 8 ) and CHK 6 HC coupled to cell penetration accelerating peptides such as Bax inhibitory mutant peptide (KLPVM) and a peptide derived from the Kaposi fibroblast growth factor (kFGF) membrane translocating sequence. A tryptophan rich peptide, an analogue of Pep-3, flanked with CH 3 on either ends was also a part of the study. The peptides were analysed for plasmid DNA complexation, protection of peptide-plasmid DNA complexes against DNase I, serum components and competitive ligands by simple agarose gel electrophoresis techniques. Hemolysis of rat red blood corpuscles (RBCs) in the presence of the peptides was used as a measure of peptide cytotoxicity. Plasmid DNA delivery through the designed peptides was evaluated in two cell lines, human cervical cancer cell line (HeLa) and (NIH/3 T3) mouse embryonic fibroblasts via expression of the secreted alkaline phosphatase (SEAP) reporter gene. The importance of hydrophobic sequences in addition to cationic sequences in peptides for non-covalent plasmid DNA complexation and delivery has been illustrated. An alternative to the employment of fatty acid moieties for enhanced gene transfer has been proposed. Comparison of peptides for plasmid DNA complexation and delivery of peptide-plasmid DNA complexes to cells estimated by expression of a reporter gene, SEAP. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.
Esipov, Roman S; Stepanenko, Vasily N; Gurevich, Alexandr I; Chupova, Larisa A; Miroshnikov, Anatoly I
2006-01-01
Chemico-enzymatic synthesis and cloning in Esherichia coli of an artificial gene coding human glucagon was performed. Recombinant plasmid containing hybrid glucagons gene and intein Ssp dnaB from Synechocestis sp. was designed. Expression of the obtained hybrid gene in E. coli, properties of the formed hybrid protein, and conditions of its autocatalytic cleavage leading to glucagon formation were studied.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki
A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less
Formighieri, Eduardo F; Tiburcio, Ricardo A; Armas, Eduardo D; Medrano, Francisco J; Shimo, Hugo; Carels, Nicolas; Góes-Neto, Aristóteles; Cotomacci, Carolina; Carazzolle, Marcelo F; Sardinha-Pinto, Naiara; Thomazella, Daniela P T; Rincones, Johana; Digiampietri, Luciano; Carraro, Dirce M; Azeredo-Espin, Ana M; Reis, Sérgio F; Deckmann, Ana C; Gramacho, Karina; Gonçalves, Marilda S; Moura Neto, José P; Barbosa, Luciana V; Meinhardt, Lyndel W; Cascardo, Júlio C M; Pereira, Gonçalo A G
2008-10-01
We present here the sequence of the mitochondrial genome of the basidiomycete phytopathogenic hemibiotrophic fungus Moniliophthora perniciosa, causal agent of the Witches' Broom Disease in Theobroma cacao. The DNA is a circular molecule of 109,103 base pairs, with 31.9% GC, and is the largest sequenced so far. This size is due essentially to the presence of numerous non-conserved hypothetical ORFs. It contains the 14 genes coding for proteins involved in the oxidative phosphorylation, the two rRNA genes, one ORF coding for a ribosomal protein (rps3), and a set of 26 tRNA genes that recognize codons for all amino acids. Seven homing endonucleases are located inside introns. Except atp8, all conserved known genes are in the same orientation. Phylogenetic analysis based on the cox genes agrees with the commonly accepted fungal taxonomy. An uncommon feature of this mitochondrial genome is the presence of a region that contains a set of four, relatively small, nested, inverted repeats enclosing two genes coding for polymerases with an invertron-type structure and three conserved hypothetical genes interpreted as the stable integration of a mitochondrial linear plasmid. The integration of this plasmid seems to be a recent evolutionary event that could have implications in fungal biology. This sequence is available under GenBank accession number AY376688.
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.
Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix
2014-01-01
The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.
Xiao, W; Rank, G H
1989-03-15
The yeast SMR1 gene was used as a dominant resistance-selectable marker for industrial yeast transformation and for targeting integration of an economically important gene at the homologous ILV2 locus. A MEL1 gene, which codes for alpha-galactosidase, was inserted into a dispensable upstream region of SMR1 in vitro; different treatments of the plasmid (pWX813) prior to transformation resulted in 3' end, 5' end and replacement integrations that exhibited distinct integrant structures. One-step replacement within a nonessential region of the host genome generated a stable integration of MEL1 devoid of bacterial plasmid DNA. Using this method, we have constructed several alpha-galactosidase positive industrial Saccharomyces strains. Our study provides a general method for stable gene transfer in most industrial Saccharomyces yeasts, including those used in the baking, brewing (ale and lager), distilling, wine and sake industries, with solely nucleotide sequences of interest. The absence of bacterial DNA in the integrant structure facilitates the commercial application of recombinant DNA technology in the food and beverage industry.
Coelho-Castelo, AAM; Trombone, AP; Rosada, RS; Santos, RR; Bonato, VLD; Sartori, A; Silva, CL
2006-01-01
In order to assess a new strategy of DNA vaccine for a more complete understanding of its action in immune response, it is important to determine the in vivo biodistribution fate and antigen expression. In previous studies, our group focused on the prophylactic and therapeutic use of a plasmid DNA encoding the Mycobacterium leprae 65-kDa heat shock protein (Hsp65) and achieved an efficient immune response induction as well as protection against virulent M. tuberculosis challenge. In the present study, we examined in vivo tissue distribution of naked DNA-Hsp65 vaccine, the Hsp65 message, genome integration and methylation status of plasmid DNA. The DNA-Hsp65 was detectable in several tissue types, indicating that DNA-Hsp65 disseminates widely throughout the body. The biodistribution was dose-dependent. In contrast, RT-PCR detected the Hsp65 message for at least 15 days in muscle or liver tissue from immunized mice. We also analyzed the methylation status and integration of the injected plasmid DNA into the host cellular genome. The bacterial methylation pattern persisted for at least 6 months, indicating that the plasmid DNA-Hsp65 does not replicate in mammalian tissue, and Southern blot analysis showed that plasmid DNA was not integrated. These results have important implications for the use of DNA-Hsp65 vaccine in a clinical setting and open new perspectives for DNA vaccines and new considerations about the inoculation site and delivery system. PMID:16445866
Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA
Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.
1974-01-01
DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576
Stoyan, T; Gloeckner, G; Diekmann, S; Carbon, J
2001-08-01
The CBF1 (centromere binding factor 1) gene of Candida glabrata was cloned by functional complementation of the methionine biosynthesis defect of a Saccharomyces cerevisiae cbf1 deletion mutant. The C. glabrata-coded protein, CgCbf1, contains a basic-helix-loop-helix leucine zipper domain and has features similar to those of other budding yeast Cbf1 proteins. CgCbf1p binds in vitro to the centromere DNA element I (CDEI) sequence GTCACATG with high affinity (0.9 x 10(9) M(-1)). Bandshift experiments revealed a pattern of protein-DNA complexes on CgCEN DNA different from that known for S. cerevisiae. We examined the effect of altering the CDEI binding site on CEN plasmid segregation, using a newly developed colony-sectoring assay. Internal deletion of the CDEI binding site led only to a fivefold increase in rates of plasmid loss, indicating that direct binding of Cbf1p to the centromere DNA is not required for full function. Additional deletion of sequences to the left of CDEI, however, led to a 70-fold increase in plasmid loss rates. Deletion of the CBF1 gene proved to be lethal in C. glabrata. C. glabrata cells containing the CBF1 gene under the influence of a shutdown promoter (tetO-ScHOP) arrested their growth after 5 h of cultivation in the presence of the reactive drug doxycycline. DAPI (4',6'-diamidino-2-phenylindole) staining of the arrested cells revealed a significant increase in the number of large-budded cells with single nuclei, 2C DNA content, and short spindles, indicating a defect in the G(2)/M transition of the cell cycle. Thus, we conclude that Cbf1p is required for chromosome segregation in C. glabrata.
Multiple Pathways of Plasmid DNA Transfer in Helicobacter pylori
Rohrer, Stefanie; Holsten, Lea; Weiss, Evelyn; Benghezal, Mohammed; Fischer, Wolfgang; Haas, Rainer
2012-01-01
Many Helicobacter pylori (Hp) strains carry cryptic plasmids of different size and gene content, the function of which is not well understood. A subgroup of these plasmids (e.g. pHel4, pHel12), contain a mobilisation region, but no cognate type IV secretion system (T4SS) for conjugative transfer. Instead, certain H. pylori strains (e.g. strain P12 carrying plasmid pHel12) can harbour up to four T4SSs in their genome (cag-T4SS, comB, tfs3, tfs4). Here, we show that such indigenous plasmids can be efficiently transferred between H. pylori strains, even in the presence of extracellular DNaseI eliminating natural transformation. Knockout of a plasmid-encoded mobA relaxase gene significantly reduced plasmid DNA transfer in the presence of DNaseI, suggesting a DNA conjugation or mobilisation process. To identify the T4SS involved in this conjugative DNA transfer, each individual T4SS was consecutively deleted from the bacterial chromosome. Using a marker-free counterselectable gene deletion procedure (rpsL counterselection method), a P12 mutant strain was finally obtained with no single T4SS (P12ΔT4SS). Mating experiments using these mutants identified the comB T4SS in the recipient strain as the major mediator of plasmid DNA transfer between H. pylori strains, both in a DNaseI-sensitive (natural transformation) as well as a DNaseI-resistant manner (conjugative transfer). However, transfer of a pHel12::cat plasmid from a P12ΔT4SS donor strain into a P12ΔT4SS recipient strain provided evidence for the existence of a third, T4SS-independent mechanism of DNA transfer. This novel type of plasmid DNA transfer, designated as alternate DNaseI-Resistant (ADR) mechanism, is observed at a rather low frequency under in vitro conditions. Taken together, our study describes for the first time the existence of three distinct pathways of plasmid DNA transfer between H. pylori underscoring the importance of horizontal gene transfer for this species. PMID:23029142
Multiple pathways of plasmid DNA transfer in Helicobacter pylori.
Rohrer, Stefanie; Holsten, Lea; Weiss, Evelyn; Benghezal, Mohammed; Fischer, Wolfgang; Haas, Rainer
2012-01-01
Many Helicobacter pylori (Hp) strains carry cryptic plasmids of different size and gene content, the function of which is not well understood. A subgroup of these plasmids (e.g. pHel4, pHel12), contain a mobilisation region, but no cognate type IV secretion system (T4SS) for conjugative transfer. Instead, certain H. pylori strains (e.g. strain P12 carrying plasmid pHel12) can harbour up to four T4SSs in their genome (cag-T4SS, comB, tfs3, tfs4). Here, we show that such indigenous plasmids can be efficiently transferred between H. pylori strains, even in the presence of extracellular DNaseI eliminating natural transformation. Knockout of a plasmid-encoded mobA relaxase gene significantly reduced plasmid DNA transfer in the presence of DNaseI, suggesting a DNA conjugation or mobilisation process. To identify the T4SS involved in this conjugative DNA transfer, each individual T4SS was consecutively deleted from the bacterial chromosome. Using a marker-free counterselectable gene deletion procedure (rpsL counterselection method), a P12 mutant strain was finally obtained with no single T4SS (P12ΔT4SS). Mating experiments using these mutants identified the comB T4SS in the recipient strain as the major mediator of plasmid DNA transfer between H. pylori strains, both in a DNaseI-sensitive (natural transformation) as well as a DNaseI-resistant manner (conjugative transfer). However, transfer of a pHel12::cat plasmid from a P12ΔT4SS donor strain into a P12ΔT4SS recipient strain provided evidence for the existence of a third, T4SS-independent mechanism of DNA transfer. This novel type of plasmid DNA transfer, designated as alternate DNaseI-Resistant (ADR) mechanism, is observed at a rather low frequency under in vitro conditions. Taken together, our study describes for the first time the existence of three distinct pathways of plasmid DNA transfer between H. pylori underscoring the importance of horizontal gene transfer for this species.
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908
Meira, L B; Henriques, J A; Magaña-Schwencke, N
1995-01-01
The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218
Muraki, Yasushi; Washioka, Hiroshi; Sugawara, Kanetsu; Matsuzaki, Yoko; Takashita, Emi; Hongo, Seiji
2004-07-01
Influenza C virus-like particles (VLPs) have been generated from cloned cDNAs. A cDNA of the green fluorescent protein (GFP) gene in antisense orientation was flanked by the 5' and 3' non-coding regions of RNA segment 5 of the influenza C virus. The cDNA cassette was inserted between an RNA polymerase I promoter and terminator of the Pol I vector. This plasmid DNA was transfected into 293T cells together with plasmids encoding virus proteins of C/Ann Arbor/1/50 or C/Yamagata/1/88. Transfer of the supernatants of the transfected 293T cells to HMV-II cells resulted in GFP expression in the HMV-II cells. The quantification of the GFP-positive HMV-II cells indicated the presence of approximately 10(6) VLPs (ml supernatant)(-1). Cords 50-300 microm in length were observed on transfected 293T cells, although the cords were not observed when the plasmid for M1 protein of C/Ann Arbor/1/50 was replaced with that of C/Taylor/1233/47. A series of transfection experiments with plasmids encoding M1 mutants of C/Ann Arbor/1/50 or C/Taylor/1233/47 showed that an amino acid at residue 24 of the M1 protein is responsible for cord formation. This finding provides direct evidence for a previous hypothesis that M1 protein is involved in the formation of cord-like structures protruding from the C/Yamagata/1/88-infected cells. Evidence was obtained by electron microscopy that transfected cells bearing cords produced filamentous VLPs, suggesting the potential role of the M1 protein in determining the filamentous/spherical morphology of influenza C virus.
Ultra-low background DNA cloning system.
Goto, Kenta; Nagano, Yukio
2013-01-01
Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.
A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.
Hassan, Sally; Keshavarz-Moore, Eli; Ward, John
2016-09-01
With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.
Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.
Mishima, Y; Mitsuma, T; Ogata, K
1985-01-01
An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977
Continuous Production of Discrete Plasmid DNA-Polycation Nanoparticles Using Flash Nanocomplexation.
Santos, Jose Luis; Ren, Yong; Vandermark, John; Archang, Maani M; Williford, John-Michael; Liu, Heng-Wen; Lee, Jason; Wang, Tza-Huei; Mao, Hai-Quan
2016-12-01
Despite successful demonstration of linear polyethyleneimine (lPEI) as an effective carrier for a wide range of gene medicine, including DNA plasmids, small interfering RNAs, mRNAs, etc., and continuous improvement of the physical properties and biological performance of the polyelectrolyte complex nanoparticles prepared from lPEI and nucleic acids, there still exist major challenges to produce these nanocomplexes in a scalable manner, particularly for lPEI/DNA nanoparticles. This has significantly hindered the progress toward clinical translation of these nanoparticle-based gene medicine. Here the authors report a flash nanocomplexation (FNC) method that achieves continuous production of lPEI/plasmid DNA nanoparticles with narrow size distribution using a confined impinging jet device. The method involves the complex coacervation of negatively charged DNA plasmid and positive charged lPEI under rapid, highly dynamic, and homogeneous mixing conditions, producing polyelectrolyte complex nanoparticles with narrow distribution of particle size and shape. The average number of plasmid DNA packaged per nanoparticles and its distribution are similar between the FNC method and the small-scale batch mixing method. In addition, the nanoparticles prepared by these two methods exhibit similar cell transfection efficiency. These results confirm that FNC is an effective and scalable method that can produce well-controlled lPEI/plasmid DNA nanoparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Continuous Production of Discrete Plasmid DNA-Polycation Nanoparticles Using Flash Nanocomplexation
Santos, Jose Luis; Ren, Yong; Vandermark, John; Archang, Maani M.; Williford, John-Michael; Liu, Heng-wen; Lee, Jason; Wang, Tza-Huei; Mao, Hai-Quan
2016-01-01
Despite successful demonstration of linear polyethyleneimine (lPEI) as an effective carrier for a wide range of gene medicine, including DNA plasmids, small interfering RNAs, mRNAs, etc., and continuous improvement of the physical properties and biological performance of the polyelectrolyte complex nanoparticles prepared from lPEI and nucleic acids, there still exist major challenges to produce these nanocomplexes in a scalable manner, particularly for lPEI/DNA nanoparticles. This has significantly hindered the progress towards clinical translation of these nanoparticle-based gene medicine. Here we report a flash nanocomplexation (FNC) method that achieves continuous production of lPEI/plasmid DNA nanoparticles with narrow size distribution using a confined impinging jet device. The method involves the complex coacervation of negatively charged DNA plasmid and positive charged lPEI under rapid, highly dynamic, and homogeneous mixing conditions, producing polyelectrolyte complex nanoparticles with narrow distribution of particle size and shape. The average number of plasmid DNA packaged per nanoparticles and its distribution are similar between the FNC method and the small-scale batch mixing method. In addition, the nanoparticles prepared by these two methods exhibit similar cell transfection efficiency. These results confirm that FNC is an effective and scalable method that can produce well-controlled lPEI/plasmid DNA nanoparticles. PMID:27717227
Sequential cloning of chromosomes
Lacks, Sanford A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.
Horizontal gene transfer of chromosomal Type II toxin-antitoxin systems of Escherichia coli.
Ramisetty, Bhaskar Chandra Mohan; Santhosh, Ramachandran Sarojini
2016-02-01
Type II toxin-antitoxin systems (TAs) are small autoregulated bicistronic operons that encode a toxin protein with the potential to inhibit metabolic processes and an antitoxin protein to neutralize the toxin. Most of the bacterial genomes encode multiple TAs. However, the diversity and accumulation of TAs on bacterial genomes and its physiological implications are highly debated. Here we provide evidence that Escherichia coli chromosomal TAs (encoding RNase toxins) are 'acquired' DNA likely originated from heterologous DNA and are the smallest known autoregulated operons with the potential for horizontal propagation. Sequence analyses revealed that integration of TAs into the bacterial genome is unique and contributes to variations in the coding and/or regulatory regions of flanking host genome sequences. Plasmids and genomes encoding identical TAs of natural isolates are mutually exclusive. Chromosomal TAs might play significant roles in the evolution and ecology of bacteria by contributing to host genome variation and by moderation of plasmid maintenance. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Hosseinkhani, Hossein; Aoyama, Ternyoshi; Yamamoto, Shingo; Ogawa, Osamu; Tabata, Yasuhiko
2002-10-01
The purpose of this study is to examine the ultrasound (US)-enhanced gene expression by the complexes of a plasmid DNA with gelatin derivatives of aminization. Gelatin derivatives with different introduced extents of ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) were prepared with a water-soluble carbodiimide. The molecular size and zeta potential of the gelatin derivatives before and after complexation with the plasmid DNA were examined. After incubation with the complexes with or without US exposure, the DNA expression of rat gastric mucosal cells was measured to evaluate the effect of the type of gelatin derivatives on their gene expression. The cell uptake of the complexes, the cell viability, and the buffering effect of gelatin derivatives were examined. The apparent molecular size and zeta potential of gelatin derivatives became larger as their aminization extent increased although the Sm gelatin derivative of higher aminization showed a larger value than other corresponding derivatives. Irrespective of the type of gelatin derivatives, the apparent molecular size of plasmid DNA was reduced by increasing the gelatin-DNA mixing ratio to attain a saturated value of about 150 nm. The condensed gelatin-DNA complexes showed the zeta potential of 10-15 mV. The cells incubated with the complex exhibited significantly stronger luciferase activities than free plasmid DNA, and the activity was further enhanced by US irradiation. The enhancement was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. The amount of plasmid DNA internalized into the cells was significantly increased by the complexation with every gelatin derivative, whereas US irradiation did not significantly increase the DNA internalization. US irradiation had no effect on the viability of cells incubated with every gelatin derivative-plasmid DNA complex, although the viability was decreased by the complex incubation. The buffering capacity of Sm derivative was higher than that of Ed and Sd derivatives and comparable with that of polyethylene amine. Among amine derivatives of gelatin, the Sm derivative enabled the plasmid DNA to induce the US-enhanced gene expression of cells in vitro most effectively because of the superior buffering effect.
The pPSU Plasmids for Generating DNA Molecular Weight Markers.
Henrici, Ryan C; Pecen, Turner J; Johnston, James L; Tan, Song
2017-05-26
Visualizing nucleic acids by gel electrophoresis is one of the most common techniques in molecular biology, and reference molecular weight markers or ladders are commonly used for size estimation. We have created the pPSU1 & pPSU2 pair of molecular weight marker plasmids which produce both 100 bp and 1 kb DNA ladders when digested with two common restriction enzymes. The 100 bp ladder fragments have been optimized to migrate appropriately on both agarose and native polyacrylamide, unlike many currently available DNA ladders. Sufficient plasmid DNA can be isolated from 100 ml E. coli cultures for the two plasmids to produce 100 bp or 1 kb ladders for 1000 gels. As such, the pPSU1 and pPSU2 plasmids provide reference fragments from 50 to 10000 bp at a fraction of the cost of commercial DNA ladders. The pPSU1 and pPSU2 plasmids are available without licensing restrictions to nonprofit academic users, affording freely available high-quality, low-cost molecular weight standards for molecular biology applications.
[Construction of plant expression plasmid of chimera SBR-CT delta A1].
Mai, Sui; Ling, Junqi
2003-08-01
The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.
Tripathi, Prashant; Moinuddin; Dixit, Kiran; Mir, Abdul Rouf; Habib, Safia; Alam, Khursheed; Ali, Asif
2014-07-01
Peroxynitrite (ONOO(-)), formed by the reaction between nitric oxide (NO) and superoxide (O2(-)), has been implicated in the etiology of numerous disease processes. Peroxynitrite interacts with DNA via direct oxidative reactions or via indirect radical-mediated mechanism. It can inflict both oxidative and nitrosative damages on DNA bases, generating abasic sites, resulting in the single strand breaks. Plasmid pUC 18 isolated from Escherichiacoli was modified with peroxynitrite, generated by quenched flow process. Modifications incurred in plasmid DNA were characterized by ultraviolet and fluorescence spectroscopy, circular dichroism, HPLC and melting temperature studies. Binding characteristics and specificity of antibodies from diabetes patients were analyzed by direct binding and inhibition ELISA. Peroxynitrite modification of pUC 18 plasmid resulted in the formation of strand breaks and base modification. The major compound formed when peroxynitrite reacted with DNA was 8-nitroguanine, a specific marker for peroxynitrite induced DNA damage in inflamed tissues. The concentration of 8-nitroguanine was found to be 3.8 μM. Sera from diabetes type 1 patients from different age groups were studied for their binding to native and peroxynitrite modified plasmid. Direct binding and competitive-inhibition ELISA results showed higher recognition of peroxynitrite modified plasmid, as compared to the native form, by auto-antibodies present in diabetes patients. The preferential recognition of modified plasmid by diabetes autoantibodies was further reiterated by gel shift assay. Experimentally induced anti-peroxynitrite-modified plasmid IgG was used as a probe to detect nitrosative lesions in the DNA isolated from diabetes patients. Copyright © 2014 Elsevier Inc. All rights reserved.
Development of new plasmid DNA vaccine vectors with R1-based replicons
2012-01-01
Background There has been renewed interest in biopharmaceuticals based on plasmid DNA (pDNA) in recent years due to the approval of several veterinary DNA vaccines, on-going clinical trials of human pDNA-based therapies, and significant advances in adjuvants and delivery vehicles that have helped overcome earlier efficacy deficits. With this interest comes the need for high-yield, cost-effective manufacturing processes. To this end, vector engineering is one promising strategy to improve plasmid production. Results In this work, we have constructed a new DNA vaccine vector, pDMB02-GFP, containing the runaway R1 origin of replication. The runaway replication phenotype should result in plasmid copy number amplification after a temperature shift from 30°C to 42°C. However, using Escherichia coli DH5α as a host, we observed that the highest yields of pDMB02-GFP were achieved during constant-temperature culture at 30°C, with a maximum yield of approximately 19 mg pDNA/g DCW being observed. By measuring mRNA and protein levels of the R1 replication initiator protein, RepA, we determined that RepA may be limiting pDMB02-GFP yield at 42°C. A mutant plasmid, pDMB-ATG, was constructed by changing the repA start codon from the sub-optimal GTG to ATG. In cultures of DH5α[pDMB-ATG], temperature-induced plasmid amplification was more dramatic than that observed with pDMB02-GFP, and RepA protein was detectable for several hours longer than in cultures of pDMB02-GFP at 42°C. Conclusions Overall, we have demonstrated that R1-based plasmids can produce high yields of high-quality pDNA without the need for a temperature shift, and have laid the groundwork for further investigation of this class of vectors in the context of plasmid DNA production. PMID:22889338
Fricova, Dominika; Valach, Matus; Farkas, Zoltan; Pfeiffer, Ilona; Kucsera, Judit; Tomaska, Lubomir; Nosek, Jozef
2010-01-01
As a part of our initiative aimed at a large-scale comparative analysis of fungal mitochondrial genomes, we determined the complete DNA sequence of the mitochondrial genome of the yeast Candida subhashii and found that it exhibits a number of peculiar features. First, the mitochondrial genome is represented by linear dsDNA molecules of uniform length (29 795 bp), with an unusually high content of guanine and cytosine residues (52.7 %). Second, the coding sequences lack introns; thus, the genome has a relatively compact organization. Third, the termini of the linear molecules consist of long inverted repeats and seem to contain a protein covalently bound to terminal nucleotides at the 5′ ends. This architecture resembles the telomeres in a number of linear viral and plasmid DNA genomes classified as invertrons, in which the terminal proteins serve as specific primers for the initiation of DNA synthesis. Finally, although the mitochondrial genome of C. subhashii contains essentially the same set of genes as other closely related pathogenic Candida species, we identified additional ORFs encoding two homologues of the family B protein-priming DNA polymerases and an unknown protein. The terminal structures and the genes for DNA polymerases are reminiscent of linear mitochondrial plasmids, indicating that this genome architecture might have emerged from fortuitous recombination between an ancestral, presumably circular, mitochondrial genome and an invertron-like element. PMID:20395267
The Escherichia coli supX locus is topA, the structural gene for DNA topoisomerase I.
Margolin, P; Zumstein, L; Sternglanz, R; Wang, J C
1985-01-01
Mutations in the supX locus, which result in the absence of DNA topoisomerase I enzyme activity in both Salmonella typhimurium and Escherichia coli, are all selected as suppressors of the leu-500 promoter mutation in S. typhimurium. To determine whether the supX locus is the structural gene topA for the DNA topoisomerase I enzyme or is a positive-acting regulator/activator gene for a nearby topA structural gene, nonsense mutations were selected in the E. coli supX gene carried on an F' episome in S. typhimurium cells. The cysB-topA region of the episomes with nonsense-mutant supX alleles were then cloned onto plasmid pBR322 and transformed into E. coli cells lacking a chromosomal supX gene. Three such E. coli strains, each carrying cloned DNA from episomes with different nonsense-mutant supX alleles, all lacked DNA topoisomerase I activity but expressed antigenic determinants specific to the enzyme; control cells lacked both enzyme activity and antigenic determinants. Maxicell studies of plasmid-coded proteins demonstrated the absence of the DNA topoisomerase I protein (100 kDa) in the three strains but the appearance of a new smaller peptide in each (36, 47, and 64 kDa). These new peptides must represent fragments of the enzyme resulting from translation termination at the supX nonsense codons and confirm the interpretation that the supX gene is topA, the structural gene for DNA topoisomerase I. Images PMID:2991925
Conrad, Cheyenne C; Gilroyed, Brandon H; McAllister, Tim A; Reuter, Tim
2012-10-01
Non-O157 Shiga toxin producing Escherichia coli (STEC) are gaining recognition as human pathogens, but no standardized method exists to identify them. Sequence analysis revealed that STEC can be classified on the base of variable O antigen regions into different O serotypes. Polymerase chain reaction is a powerful technique for thorough screening and complex diagnosis for these pathogens, but requires a positive control to verify qualitative and/or quantitative DNA-fragment amplification. Due to the pathogenic nature of STEC, controls are not readily available and cell culturing of STEC reference strains requires biosafety conditions of level 2 or higher. In order to bypass this limitation, controls of stacked O-type specific DNA-fragments coding for primer recognition sites were designed to screen for nine STEC serotypes frequently associated with human infection. The synthetic controls were amplified by PCR, cloned into a plasmid vector and transferred into bacteria host cells. Plasmids amplified by bacterial expression were purified, serially diluted and tested as standards for real-time PCR using SYBR Green and TaqMan assays. Utility of synthetic DNA controls was demonstrated in conventional and real-time PCR assays and validated with DNA from natural STEC strains. Copyright © 2012 Elsevier B.V. All rights reserved.
Physiological effects of pH gradients on Escherichia coli during plasmid DNA production.
Cortés, José T; Flores, Noemí; Bolívar, Francisco; Lara, Alvaro R; Ramírez, Octavio T
2016-03-01
A two-compartment scale-down system was used to mimic pH heterogeneities that can occur in large-scale bioreactors. The system consisted of two interconnected stirred tank reactors (STRs) where one of them represented the conditions of the bulk of the fluid and the second one the zone of alkali addition for pH control. The working volumes ratio of the STRs was set to 20:1 in order to simulate the relative sizes of the bulk and alkali addition zones, respectively, in large-scale bioreactors. Residence times (tR ) in the alkali addition STR of 60, 120, 180, and 240 s were simulated during batch cultures of an engineered Escherichia coli strain that produced plasmid DNA (pDNA). pH gradients of up to 0.9 units, between the two compartments, were attained. The kinetic, stoichiometric, and pDNA topological changes due to the pH gradients were studied and compared to cultures at constant pH of 7.2 and 8.0. As the tR increased, the pDNA and biomass yields, as well as pDNA final titer decreased, whereas the accumulation of organic acids increased. Furthermore, the transcriptional response of 10 selected genes to alkaline stress (pH 8.0) and pH gradients was monitored at different stages of the cultures. The selected genes coded for ion transporters, amino acids catabolism enzymes, and transcriptional regulators. The transcriptional response of genes coding for amino acids catabolism, in terms of relative transcription level and stage of maximal expression, was different when the alkaline stress was constant or transient. This suggests the activation of different mechanisms by E. coli to cope with pH fluctuations compared to constant alkaline pH. Moreover, the transcriptional response of genes related to negative control of DNA synthesis did not correlate with the lower pDNA yields. This is the first study that reports the effects of pH gradients on pDNA production by E. coli cultures. The information presented can be useful for the design of better bioreactor scale-up strategies. © 2015 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gottlieb, J.; Muzyczka, N.
1988-06-01
When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less
USDA-ARS?s Scientific Manuscript database
A trans-complemented CSF- JE chimeric viral replicon was constructed using an infectious cDNA clone of the CSF virus (CSFV) Alfort/187 strain. The E2 gene of CSFV Alfort/187 strain was deleted and the resultant plasmid pA187delE2 was inserted by a fragment containing the region coding for a truncate...
Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y
2016-01-01
Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.
Carnes, Aaron E; Hodgson, Clague P; Luke, Jeremy M; Vincent, Justin M; Williams, James A
2009-10-15
DNA vaccines and gene medicines, derived from bacterial plasmids, are emerging as an important new class of pharmaceuticals. However, the challenges of performing cell lysis processes for plasmid DNA purification at an industrial scale are well known. To address downstream purification challenges, we have developed autolytic Escherichia coli host strains that express endolysin (phage lambdaR) in the cytoplasm. Expression of the endolysin is induced during fermentation by a heat inducible promoter. The endolysin remains in the cytoplasm, where it is separated from its peptidoglycan substrate in the cell wall; hence the cells remain alive and intact and can be harvested by the usual methods. The plasmid DNA is then recovered by autolytic extraction under slightly acidic, low salt buffer conditions and treatment with a low concentration of non-ionic detergent. Under these conditions the E. coli genomic DNA remains associated with the insoluble cell debris and is removed by a solid-liquid separation. Here, we report fermentation, lysis methods, and plasmid purification using autolytic hosts.
Sequential cloning of chromosomes
Lacks, S.A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.
Dong, Lianhua; Meng, Ying; Wang, Jing; Liu, Yingying
2014-02-01
DNA reference materials of certified value have a critical function in many analytical processes of DNA measurement. Quantification of amoA genes in ammonia oxidizing bacteria (AOB) and archaea (AOA), and of nirS and nosZ genes in the denitrifiers is very important for determining their distribution and abundance in the natural environment. A plasmid reference material containing nirS, nosZ, amoA-AOB, and amoA-AOA is developed to provide a DNA standard with copy number concentration for ensuring comparability and reliability of quantification of these genes. Droplet digital PCR (ddPCR) was evaluated for characterization of the plasmid reference material. The result revealed that restriction endonuclease digestion of plasmids can improve amplification efficiency and minimize the measurement bias of ddPCR. Compared with the conformation of the plasmid, the size of the DNA fragment containing the target sequence and the location of the restriction site relative to the target sequence are not significant factors affecting plasmid quantification by ddPCR. Liquid chromatography-isotope dilution mass spectrometry (LC-IDMS) was used to provide independent data for quantifying the plasmid reference material. The copy number concentration of the digested plasmid determined by ddPCR agreed well with that determined by LC-IDMS, improving both the accuracy and reliability of the plasmid reference material. The reference value, with its expanded uncertainty (k = 2), of the plasmid reference material was determined to be (5.19 ± 0.41) × 10(9) copies μL(-1) by averaging the results of two independent measurements. Consideration of the factors revealed in this study can improve the reliability and accuracy of ddPCR; thus, this method has the potential to accurately quantify DNA reference materials.
Lin, Kevin N; Grandhi, Taraka Sai Pavan; Goklany, Sheba; Rege, Kaushal
2018-04-10
Plasmid DNA (pDNA) is an attractive therapeutic biomolecule in several diseases including cancer, AIDS, cystic fibrosis, Parkinson's disease, and Alzheimer's disease. Increasing demand for plasmid DNA as a therapeutic biomolecule for transgene expression or vaccine applications necessitate novel approaches to bioprocessing. The synthesis, characterization and evaluation of aminoglycoside-derived hydrogel microbeads (Amikabeads) for pDNA binding is described previously. Here, the generation and evaluation of novel chemotherapeutic drug-conjugated microbeads for application in pDNA binding and recovery is described. Chemotherapeutic drug-conjugated Amikabeads demonstrate higher binding of methylated pDNA compared to unmethylated pDNA in presence of high salt concentrations. Desorption of plasmids from drug-conjugated microbeads is facilitated by the use of organic modifiers. The observed differences in binding methylated versus unmethylated DNA can make drug-conjugated microbeads useful in diagnostic as well as therapeutic applications. These results demonstrate that anti-cancer drugs represent a diverse set of ligands that may be exploited for molecular engineering of novel DNA binding materials for applications in delivery, diagnostics, and biomanufacturing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Depto, A.S.; Stenberg, R.M.
1989-03-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection ofmore » the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.« less
DNA packaging by the Bacillus subtilis defective bacteriophage PBSX.
Anderson, L M; Bott, K F
1985-01-01
Defective bacteriophage PBSX, a resident of all Bacillus subtilis 168 chromosomes, packages fragments of DNA from all portions of the host chromosome when induced by mitomycin C. In this study, the physical process for DNA packaging of both chromosomal and plasmid DNAs was examined. Discrete 13-kilobase (kb) lengths of DNA were packaged by wild-type phage, and the process was DNase I resistant and probably occurred by a head-filling mechanism. Genetically engineered isogenic host strains having a chloramphenicol resistance determinant integrated as a genetic flag at two different regions of the chromosome were used to monitor the packaging of specific chromosomal regions. No dramatic selectivity for these regions could be documented. If the wild-type strain 168 contains autonomously replicating plasmids, especially pC194, the mitomycin C induces an increase in size of resident plasmid DNA, which is then packaged as 13-kb pieces into phage heads. In strain RB1144, which lacks substantial portions of the PBSX resident phage region, mitomycin C treatment did not affect the structure of resident plasmids. Induction of PBSX started rolling circle replication on plasmids, which then became packaged as 13-kb fragments. This alteration or cannibalization of plasmid replication resulting from mitomycin C treatment requires for its function some DNA within the prophage deletion of strain RB1144. Images PMID:3923209
Insights into the bovine rumen plasmidome
Kav, Aya Brown; Sasson, Goor; Jami, Elie; Doron-Faigenboim, Adi; Benhar, Itai; Mizrahi, Itzhak
2012-01-01
Plasmids are self-replicating genetic elements capable of mobilization between different hosts. Plasmids often serve as mediators of lateral gene transfer, a process considered to be a strong and sculpting evolutionary force in microbial environments. Our aim was to characterize the overall plasmid population in the environment of the bovine rumen, which houses a complex and dense microbiota that holds enormous significance for humans. We developed a procedure for the isolation of total rumen plasmid DNA, termed rumen plasmidome, and subjected it to deep sequencing using the Illumina paired-end protocol and analysis using public and custom-made bioinformatics tools. A large number of plasmidome contigs aligned with plasmids of rumen bacteria isolated from different locations and at various time points, suggesting that not only the bacterial taxa, but also their plasmids, are defined by the ecological niche. The bacterial phylum distribution of the plasmidome was different from that of the rumen bacterial taxa. Nevertheless, both shared a dominance of the phyla Firmicutes, Bacteroidetes, and Proteobacteria. Evidently, the rumen plasmidome is of a highly mosaic nature that can cross phyla. Interestingly, when we compared the functional profile of the rumen plasmidome to two plasmid databases and two recently published rumen metagenomes, it became apparent that the rumen plasmidome codes for functions, which are enriched in the rumen ecological niche and could confer advantages to their hosts, suggesting that the functional profiles of mobile genetic elements are associated with their environment, as has been previously implied for viruses. PMID:22431592
Yudin, M A; Bykov, V N; Nikiforov, A S; Al-Shekhadat, R I; Ivanov, I M; Ustinova, T M
2018-04-01
We compared the efficiency of delivery of plasmid DNA (active ingredient concentration 1 mg/kg) that provides production of nerve growth factor (NGF) after intravenous administration to rats and after administration by hydroporation. The method of hydroporation ensured plasmid penetration into the liver tissue and lengthened the time of its detection in the organ. DNA concentration in 1 h after its introduction by hydroporation or intravenous route was 0.7 and 0.05 ng/mg tissue, respectively. The use of this transfection method ensured preservation of NGF DNA in the liver tissue at a level of 0.24 ng/mg of tissue 1 day after administration of the plasmid construct, while after intravenous administration, expression of the analyzed DNA was not detected in blood and liver samples. After hydroporation, the maximum of relative normalized expression of cDNA (270 rel. units) was observed after 4 h, and after 1 day, this parameter decreased to 35 rel. units. Introduction of plasmid DNA of NGF by hydroporation prevented the development of disorders of neuromuscular conduction in a rats model of toxic neuropathy induced by subacute administration of malathion in a dose of 0.5 LD 50 .
DETECTION OF DNA DAMAGE USING MELTING ANALYSIS TECHNIQUES
A rapid and simple fluorescence screening assay for UV radiation-, chemical-, and enzyme-induced DNA damage is reported. This assay is based on a melting/annealing analysis technique and has been used with both calf thymus DNA and plasmid DNA (puc 19 plasmid from E. coli). DN...
Hosseinkhani, Hossein; Tabata, Yasuhiko
2003-01-09
The objective of this study is to investigate the efficiency of a non-viral gene carrier with RGD sequences, Pronectin F(+) for gene transfection. The Pronectin F(+) was cationized by introducing ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) to the hydroxyl groups while the corresponding gelatin derivative was prepared similarly because gelatin also has one RGD sequence per molecule. The zeta potential and molecular size of Pronectin F(+) and gelatin derivatives were examined before and after polyion complexation with a plasmid DNA of luciferase. When complexed with the plasmid DNA at the Pronectin F(+)/plasmid DNA mixing ratio of 50, the complex exhibited a zeta potential of about 10 mV, which is similar to that of the gelatin derivative-plasmid DNA complex. Irrespective of the type of Pronectin F(+) and gelatin derivatives, their complexation enabled the apparent molecular size of plasmid DNA to reduce to about 200 nm, the size decreasing with the increased derivative/plasmid DNA weight mixing ratio. The rat gastric mucosal (RGM)-1 cells treated with both complexes exhibited significantly stronger luciferase activities than free plasmid DNA although the enhanced extent was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. Cell attachment was enhanced by the Pronectin F(+) derivative to a significant high extent compared with the gelatin derivative. The amount of plasmid DNA internalized into the cells was enhanced by the complexation with every Pronectin F(+) derivative compared with the gelatin derivative. For both of Pronectin F(+) and gelatin carriers, the buffering capacity of Sm derivatives was higher than that of Ed and Sd derivatives and comparable to that of polyethyleneimine. It is likely that the high efficiency of gene transfection for the Sm derivative is due to the superior buffering effect. We conclude that the Sm derivative of Pronectin F(+) is promising as a non-viral vector of gene transfection.
Reporter gene expression in dendritic cells after gene gun administration of plasmid DNA.
Watkins, Craig; Hopkins, John; Harkiss, Gordon
2005-07-21
Dendritic cells (DC) play an integral role in plasmid DNA vaccination. However, the interaction between plasmid DNA and DC in vivo is incompletely understood. In this report, we utilise the sheep pseudoafferent cannulation model to examine the interaction between plasmid DNA encoding enhanced green fluorescent protein (pEGFP) and afferent lymph DC (ALDC) following gene gun administration. The results show that peaks of fluorescent ALDC tended to appear around days 1-4 and 9-13, then erratically thereafter for up to 2 months. Phenotypic analysis showed that EGFP+ ALDC expressed MHC class II, WC6, CD1b, and SIRPalpha markers. Plasmid, detected by PCR, was found in lymph cells and cell-free plasma on a daily basis, and was present variably for up to 2 months. Plasmid was also detected in purified CD1b+ ALDC, but the presence of plasmid did not correlate with EGFP expression by ALDC. Free EGFP in afferent lymph plasma was detectable by luminometry only after three administrations of the plasmid. The results show that gene gun administered pEGFP persisted for extended periods after a single administration, leeching out of skin on a daily basis. The plasmid was associated with both the cellular and fluid components of afferent lymph. EGFP protein appeared in afferent lymph in a pulsatile manner, but associated only with ALDC.
Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.
Kuwahara, S
1978-09-01
Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid.
Plasmid pVAX1-NH36 purification by membrane and bead perfusion chromatography.
Franco-Medrano, Diana Ivonne; Guerrero-Germán, Patricia; Montesinos-Cisneros, Rosa María; Ortega-López, Jaime; Tejeda-Mansir, Armando
2017-03-01
The demand for plasmid DNA (pDNA) has increased in response to the rapid advances in vaccines applications to prevent and treat infectious diseases caused by virus, bacteria or parasites, such as Leishmania species. The immunization protocols require large amounts of supercoiled plasmid DNA (sc-pDNA) challenging the development of efficient and profitable processes for capturing and purified pDNA molecules from large volumes of lysates. A typical bioprocess involves four steps: fermentation, primary recovery, intermediate recovery and final purification. Ion-exchange chromatography is one of the key operations in the purification schemes of pDNA owing the chemical structure of these macromolecules. The goal of this research was to compare the performance of the final purification step of pDNA using ion-exchange chromatography on columns packed with Mustang Q membranes or perfusive beads POROS 50 HQ. The experimental results showed that both matrixes could separate the plasmid pVAX1-NH36 (3936 bp) from impurities in clarified Escherichia coli lysates with an adequate resolution. In addition, a 24- and 21-fold global purification factor was obtained. An 88 and 63% plasmid recuperation was achieved with ion-exchange membranes and perfusion beads, respectively. A better understanding of perfusion-based matrices for the purification of pDNA was developed in this research.
Cloning and characterization of the human 5,10-methenyltetrahydrofolate synthetase-encoding cDNA.
Dayan, A; Bertrand, R; Beauchemin, M; Chahla, D; Mamo, A; Filion, M; Skup, D; Massie, B; Jolivet, J
1995-11-20
Methenyltetrahydrofolate synthetase (MTHFS) catalyses the obligatory initial metabolic step in the intracellular conversion of 5-formyltetrahydrofolate to other reduced folates. We have isolated and sequenced a human MTHFS cDNA which is 872-bp long and codes for a 203-amino-acid protein of 23,229 Da. Escherichia coli BL21(DE3), transfected with pET11c plasmids containing an open reading frame encoding MTHFS, showed a 100-fold increase in MTHFS activity in bacterial extracts after IPTG induction. Northern blot studies of human tissues determined that the MTHFS mRNA was expressed preferentially in the liver and Southern blot analysis of human genomic DNA suggested the presence of a single-copy gene.
DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY
A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...
DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY
A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...
Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi
2012-01-01
TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat
Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficientmore » in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.« less
NASA Astrophysics Data System (ADS)
Rocha Teixeira, Gleica; da Silva Marciano, Roberta; da Silva Sergio, Luiz Philippe; Castanheira Polignano, Giovanni Augusto; Roberto Guimarães, Oscar; Geller, Mauro; de Paoli, Flavia; de Souza da Fonseca, Adenilson
2014-12-01
Low-intensity infrared lasers are proposed in clinical protocols based on biostimulative effects, yet dosimetry is inaccurate and their effects on DNA at therapeutic doses are controversial. The aim of this work was to evaluate the effects of low-intensity infrared laser on survival and induction of filamentation of Escherichia coli cells, and induction of DNA lesions in bacterial plasmids. E. coli cultures were exposed to laser (808 nm, 100 mW, 40 and 60 J/cm2) to study bacterial survival and filamentation. Also, bacterial plasmids were exposed to laser to study DNA lesions by electrophoretic profile and action of DNA repair enzymes. Data indicate low-intensity infrared laser has no effect on survival of E. coli wild type and exonuclease III, but decreases the survival of formamidopyrimidine DNA glycosylase/MutM protein and endonuclease III deficient cells in stationary growth phase, induces bacterial filamentation, does not alter the electrophoretic profile of plasmids in agarose gels and does not alter the electrophoretic profile of plasmids incubated with endonuclease III, formamidopyrimidine DNA glycosylase/MutM protein and exonuclease III. Our findings show that low-intensity laser exposure causes DNA lesions at sub-lethal level and induces cellular mechanisms involved in repair of oxidative lesions in DNA. Studies about laser dosimetry and safety strategies are necessary for professionals and patients exposed to low-intensity lasers at therapeutic doses.
Cloned Viral Protein Vaccine for Foot-and-Mouth Disease: Responses in Cattle and Swine
NASA Astrophysics Data System (ADS)
Kleid, Dennis G.; Yansura, Daniel; Small, Barbara; Dowbenko, Donald; Moore, Douglas M.; Grubman, Marvin J.; McKercher, Peter D.; Morgan, Donald O.; Robertson, Betty H.; Bachrach, Howard L.
1981-12-01
A DNA sequence coding for the immunogenic capsid protein VP3 of foot-and-mouth disease virus A12, prepared from the virion RNA, was ligated to a plasmid designed to express a chimeric protein from the Escherichia coli tryptophan promoter-operator system. When Escherichia coli transformed with this plasmid was grown in tryptophan-depleted media, approximately 17 percent of the total cellular protein was found to be an insoluble and stable chimeric protein. The purified chimeric protein competed equally on a molar basis with VP3 for specific antibodies to foot-and-mouth disease virus. When inoculated into six cattle and two swine, this protein elicited high levels of neutralizing antibody and protection against challenge with foot-and-mouth disease virus.
Belperron, Alexia A.; Feltquate, David; Fox, Barbara A.; Horii, Toshihiro; Bzik, David J.
1999-01-01
The liver- and blood-stage-expressed serine repeat antigen (SERA) of Plasmodium falciparum is a candidate protein for a human malaria vaccine. We compared the immune responses induced in mice immunized with SERA-expressing plasmid DNA vaccines delivered by intramuscular (i.m.) injection or delivered intradermally by Gene Gun immunization. Mice were immunized with a pcdna3 plasmid encoding the entire 47-kDa domain of SERA (amino acids 17 to 382) or the N-terminal domain (amino acids 17 to 110) of SERA. Minimal antibody responses were detected following DNA vaccination with the N-terminal domain of SERA, suggesting that the N-terminal domain alone is not highly immunogenic by this route of vaccine delivery. Immunization of mice by Gene Gun delivery of the 47-kDa domain of SERA elicited a significantly higher serum antibody titer to the antigen than immunization of mice by i.m. injection with the same plasmid did. The predominant isotype subclass of the antibodies elicited to the SERA protein following i.m. and Gene Gun immunizations with SERA plasmid DNA was immunoglobulin G1. Coimmunization of mice with SERA plasmid DNA and a plasmid expressing the hepatitis B surface antigen (pCMV-s) by the i.m. route resulted in higher anti-SERA titers than those generated in mice immunized with the SERA DNA plasmid alone. Vaccination with DNA may provide a viable alternative or may be used in conjunction with protein-based subunit vaccines to maximize the efficacy of a human malaria vaccine that includes immunogenic regions of the SERA protein. PMID:10496891
Scaleable processes for the manufacture of therapeutic quantities of plasmid DNA.
Shamlou, Parviz Ayazi
2003-06-01
The need for scaleable processes to manufacture therapeutic plasmid DNA (pDNA) is easy to overlook when attention is focused primarily on vector design and establishment of early clinical results. pDNA is a large molecule and has properties that are similar to those of the contaminating chromosomal DNA. These, combined with the low initial concentration of plasmids in the host cell, provide unique process challenges that require significant upfront design to establish robust manufacturing processes that can also comply with current Good Manufacturing Practice ('cGMP') and produce milligram-to-kilogram quantities of pDNA product. This review describes promising scaleable processes that are currently being assessed for production of therapeutic supercoiled pDNA. Fermentation strategies for improving supercoiled plasmid yield and reducing contaminant concentrations are reviewed, and downstream processes are assessed for their ability to efficiently remove cellular contaminants, separate the supercoiled form of the pDNA from its open circular and linear forms, and prepare the purified drug substance for formulation. Current strategies are presented for developing stable delivery systems, and approaches to quality assurance and quality control are discussed.
Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter
2014-11-01
Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.
Kalariya, Mayurkumar; Amiji, Mansoor M
2013-09-10
The purpose of this study was to develop a water-in-oil-in-water (W/O/W) multiple emulsions-based vaccine delivery system for plasmid DNA encoding the gp100 peptide antigen for melanoma immunotherapy. The gp100 encoding plasmid DNA was encapsulated in the inner-most aqueous phase of squalane oil containing W/O/W multiple emulsions using a two-step emulsification method. In vitro transfection ability of the encapsulated plasmid DNA was investigated in murine dendritic cells by transgene expression analysis using fluorescence microscopy and ELISA methods. Prophylactic immunization using the W/O/W multiple emulsions encapsulated the gp100 encoding plasmid DNA vaccine significantly reduced tumor volume in C57BL/6 mice during subsequent B16-F10 tumor challenge. In addition, serum Th1 cytokine levels and immuno-histochemistry of excised tumor tissues indicated activation of cytotoxic T-lymphocytes mediated anti-tumor immunity causing tumor growth suppression. The W/O/W multiple emulsions-based vaccine delivery system efficiently delivers the gp100 plasmid DNA to induce cell-mediated anti-tumor immunity. Copyright © 2013 Elsevier B.V. All rights reserved.
The mechanism and control of DNA transfer by the conjugative relaxase of resistance plasmid pCU1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nash, Rebekah Potts; Habibi, Sohrab; Cheng, Yuan
2010-11-15
Bacteria expand their genetic diversity, spread antibiotic resistance genes, and obtain virulence factors through the highly coordinated process of conjugative plasmid transfer (CPT). A plasmid-encoded relaxase enzyme initiates and terminates CPT by nicking and religating the transferred plasmid in a sequence-specific manner. We solved the 2.3 {angstrom} crystal structure of the relaxase responsible for the spread of the resistance plasmid pCU1 and determined its DNA binding and nicking capabilities. The overall fold of the pCU1 relaxase is similar to that of the F plasmid and plasmid R388 relaxases. However, in the pCU1 structure, the conserved tyrosine residues (Y18,19,26,27) that aremore » required for DNA nicking and religation were displaced up to 14 {angstrom} out of the relaxase active site, revealing a high degree of mobility in this region of the enzyme. In spite of this flexibility, the tyrosines still cleaved the nic site of the plasmid's origin of transfer, and did so in a sequence-specific, metal-dependent manner. Unexpectedly, the pCU1 relaxase lacked the sequence-specific DNA binding previously reported for the homologous F and R388 relaxase enzymes, despite its high sequence and structural similarity with both proteins. In summary, our work outlines novel structural and functional aspects of the relaxase-mediated conjugative transfer of plasmid pCU1.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
McLaughlin, K. J.; Nash, R. P.; Redinbo, M. R.
The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. Inmore » this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.« less
Koh, J J; Ko, K S; Lee, M; Han, S; Park, J S; Kim, S W
2000-12-01
Recently, we have reported that biodegradable poly [alpha-(4-aminobutyl)-L-glycolic acid] (PAGA) can condense and protect plasmid DNA from DNase I. In this study, we investigated whether the systemic administration of pCAGGS mouse IL-10 (mIL-10) expression plasmid complexed with PAGA can reduce the development of insulitis in non-obese diabetic (NOD) mice. PAGA/mIL-10 plasmid complexes were stable for more than 60 min, but the naked DNA was destroyed within 10 min by DNase I. The PAGA/DNA complexes were injected into the tail vein of 3-week-old NOD mice. Serum mIL-10 level peaked at 5 days after injection, and could be detected for more than 9 weeks. The prevalence of severe insulitis on 12-week-old NOD mice was markedly reduced by the intravenous injection of PAGA/DNA complex (15.7%) compared with that of naked DNA injection (34.5%) and non-treated controls (90.9%). In conclusion, systemic administration of pCAGGS mIL-10 plasmid/PAGA complexes can reduce the severity of insulitis in NOD mice. This study shows that the PAGA/DNA complex has the potential for the prevention of autoimmune diabetes mellitus. Gene Therapy (2000) 7, 2099-2104.
Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H
2012-07-01
The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.
A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein
Sepulveda, Edgardo; Vogelmann, Jutta
2011-01-01
Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692
Novel RepA-MCM proteins encoded in plasmids pTAU4, pORA1 and pTIK4 from Sulfolobus neozealandicus
Greve, Bo; Jensen, Susanne; Phan, Hoa; Brügger, Kim; Zillig, Wolfram; She, Qunxin; Garrett, Roger A.
2005-01-01
Three plasmids isolated from the crenarchaeal thermoacidophile Sulfolobus neozealandicus were characterized. Plasmids pTAU4 (7,192 bp), pORA1 (9,689 bp) and pTIK4 (13,638 bp) show unusual properties that distinguish them from previously characterized cryptic plasmids of the genus Sulfolobus. Plasmids pORA1 and pTIK4 encode RepA proteins, only the former of which carries the novel polymerase–primase domain of other known Sulfolobus plasmids. Plasmid pTAU4 encodes a mini-chromosome maintenance protein homolog and no RepA protein; the implications for DNA replication are considered. Plasmid pORA1 is the first Sulfolobus plasmid to be characterized that does not encode the otherwise highly conserved DNA-binding PlrA protein. Another encoded protein appears to be specific for the New Zealand plasmids. The three plasmids should provide useful model systems for functional studies of these important crenarchaeal proteins. PMID:15876565
Fate of plasmids containing Mu DNA: chromosome association and mobilization.
Bialy, H; Waggoner, B T; Pato, M L
1980-01-01
The fluorescent dye, diamidinophenylindole-dihydrochloride (DAPI) can be added to CsCl gradients to enhance the density resolution of DNA species, independent of their topological configurations. When Proteus mirabilis and Escherichia coli strains carrying an RP4::Mucts plasmid were examined with the use of such a technique, it was found that after thermal induction of the prophage essentially al of the plasmid DNA became associated with the chromosome. This quantitative association is detergent-RNase- and pronase-resistant and dependent on the expression of Mu genes. The association is temporally, and probably functionally, correlated with the onset of Mu DNA replication. Genetic studies with F'::mini Mu plasmids indicate that some of the association results in stable Hfr formation, and does not require the product of Mu gene B.
Brownian Ratchet Mechanism for Faithful Segregation of Low-Copy-Number Plasmids.
Hu, Longhua; Vecchiarelli, Anthony G; Mizuuchi, Kiyoshi; Neuman, Keir C; Liu, Jian
2017-04-11
Bacterial plasmids are extrachromosomal DNA that provides selective advantages for bacterial survival. Plasmid partitioning can be remarkably robust. For high-copy-number plasmids, diffusion ensures that both daughter cells inherit plasmids after cell division. In contrast, most low-copy-number plasmids need to be actively partitioned by a conserved tripartite ParA-type system. ParA is an ATPase that binds to chromosomal DNA; ParB is the stimulator of the ParA ATPase and specifically binds to the plasmid at a centromere-like site, parS. ParB stimulation of the ParA ATPase releases ParA from the bacterial chromosome, after which it takes a long time to reset its DNA-binding affinity. We previously demonstrated in vitro that the ParA system can exploit this biochemical asymmetry for directed cargo transport. Multiple ParA-ParB bonds can bridge a parS-coated cargo to a DNA carpet, and they can work collectively as a Brownian ratchet that directs persistent cargo movement with a ParA-depletion zone trailing behind. By extending this model, we suggest that a similar Brownian ratchet mechanism recapitulates the full range of actively segregated plasmid motilities observed in vivo. We demonstrate that plasmid motility is tuned as the replenishment rate of the ParA-depletion zone progressively increases relative to the cargo speed, evolving from diffusion to pole-to-pole oscillation, local excursions, and, finally, immobility. When the plasmid replicates, the daughters largely display motilities similar to that of their mother, except that when the single-focus progenitor is locally excursive, the daughter foci undergo directed segregation. We show that directed segregation maximizes the fidelity of plasmid partition. Given that local excursion and directed segregation are the most commonly observed modes of plasmid motility in vivo, we suggest that the operation of the ParA-type partition system has been shaped by evolution for high fidelity of plasmid segregation. Published by Elsevier Inc.
Rudder, Steven; Doohan, Fiona; Creevey, Christopher J; Wendt, Toni; Mullins, Ewen
2014-04-07
Recently it has been shown that Ensifer adhaerens can be used as a plant transformation technology, transferring genes into several plant genomes when equipped with a Ti plasmid. For this study, we have sequenced the genome of Ensifer adhaerens OV14 (OV14) and compared it with those of Agrobacterium tumefaciens C58 (C58) and Sinorhizobium meliloti 1021 (1021); the latter of which has also demonstrated a capacity to genetically transform crop genomes, albeit at significantly reduced frequencies. The 7.7 Mb OV14 genome comprises two chromosomes and two plasmids. All protein coding regions in the OV14 genome were functionally grouped based on an eggNOG database. No genes homologous to the A. tumefaciens Ti plasmid vir genes appeared to be present in the OV14 genome. Unexpectedly, OV14 and 1021 were found to possess homologs to chromosomal based genes cited as essential to A. tumefaciens T-DNA transfer. Of significance, genes that are non-essential but exert a positive influence on virulence and the ability to genetically transform host genomes were identified in OV14 but were absent from the 1021 genome. This study reveals the presence of homologs to chromosomally based Agrobacterium genes that support T-DNA transfer within the genome of OV14 and other alphaproteobacteria. The sequencing and analysis of the OV14 genome increases our understanding of T-DNA transfer by non-Agrobacterium species and creates a platform for the continued improvement of Ensifer-mediated transformation (EMT).
2014-01-01
Background Recently it has been shown that Ensifer adhaerens can be used as a plant transformation technology, transferring genes into several plant genomes when equipped with a Ti plasmid. For this study, we have sequenced the genome of Ensifer adhaerens OV14 (OV14) and compared it with those of Agrobacterium tumefaciens C58 (C58) and Sinorhizobium meliloti 1021 (1021); the latter of which has also demonstrated a capacity to genetically transform crop genomes, albeit at significantly reduced frequencies. Results The 7.7 Mb OV14 genome comprises two chromosomes and two plasmids. All protein coding regions in the OV14 genome were functionally grouped based on an eggNOG database. No genes homologous to the A. tumefaciens Ti plasmid vir genes appeared to be present in the OV14 genome. Unexpectedly, OV14 and 1021 were found to possess homologs to chromosomal based genes cited as essential to A. tumefaciens T-DNA transfer. Of significance, genes that are non-essential but exert a positive influence on virulence and the ability to genetically transform host genomes were identified in OV14 but were absent from the 1021 genome. Conclusions This study reveals the presence of homologs to chromosomally based Agrobacterium genes that support T-DNA transfer within the genome of OV14 and other alphaproteobacteria. The sequencing and analysis of the OV14 genome increases our understanding of T-DNA transfer by non-Agrobacterium species and creates a platform for the continued improvement of Ensifer-mediated transformation (EMT). PMID:24708309
The effects of a low-intensity red laser on bacterial growth, filamentation and plasmid DNA
NASA Astrophysics Data System (ADS)
Roos, C.; Santos, J. N.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.
2013-07-01
Exposure of nonphotosynthesizing microorganisms to light could increase cell division in cultures, a phenomenon denominated as biostimulation. However, data concerning the importance of the genetic characteristics of cells on this effect are as yet scarce. The aim of this work was to evaluate the effects of a low-intensity red laser on the growth, filamentation and plasmids in Escherichia coli cells proficient and deficient in DNA repair. E. coli cultures were exposed to a laser (658 nm, 10 mW, 1 and 8 J cm-2) to study bacterial growth and filamentation. Also, bacterial cultures hosting pBSK plasmids were exposed to the laser to study DNA topological forms from the electrophoretic profile in agarose gels. Data indicate the low-intensity red laser: (i) had no effect on the growth of E. coli wild type and exonuclease III deficient cells; (ii) induced bacterial filamentation, (iii) led to no alteration in the electrophoretic profile of plasmids from exonuclease III deficient cells, but plasmids from wild type cells were altered. A low-intensity red laser at the low fluences used in phototherapy has no effect on growth, but induces filamentation and alters the topological forms of plasmid DNA in E. coli cultures depending on the DNA repair mechanisms.
Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost
Benoit, Roger M.; Ostermeier, Christian; Geiser, Martin; Li, Julia Su Zhou; Widmer, Hans; Auer, Manfred
2016-01-01
Seamless cloning methods, such as co-transformation cloning, sequence- and ligation-independent cloning (SLIC) or the Gibson assembly, are essential tools for the precise construction of plasmids. The efficiency of co-transformation cloning is however low and the Gibson assembly reagents are expensive. With the aim to improve the robustness of seamless cloning experiments while keeping costs low, we examined the importance of complementary single-stranded DNA ends for co-transformation cloning and the influence of single-stranded gaps in circular plasmids on SLIC cloning efficiency. Most importantly, our data show that single-stranded gaps in double-stranded plasmids, which occur in typical SLIC protocols, can drastically decrease the efficiency at which the DNA transforms competent E. coli bacteria. Accordingly, filling-in of single-stranded gaps using DNA polymerase resulted in increased transformation efficiency. Ligation of the remaining nicks did not lead to a further increase in transformation efficiency. These findings demonstrate that highly efficient insert-plasmid assembly can be achieved by using only T5 exonuclease and Phusion DNA polymerase, without Taq DNA ligase from the original Gibson protocol, which significantly reduces the cost of the reactions. We successfully used this modified Gibson assembly protocol with two short insert-plasmid overlap regions, each counting only 15 nucleotides. PMID:27073895
Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.
Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by themore » full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids. IMPORTANCEUnderstanding the mechanism of antimicrobial resistance transfer in bacteria such asStaphylococcus aureusis an important step toward potentially slowing the spread of antimicrobial-resistant infections. This work establishes protein-DNA interactions essential for the transfer of theStaphylococcus aureusmultiresistance plasmid pSK41 by its relaxase, NES. This enzyme also processed variantoriT-like sequences found on numerous plasmids previously considered nontransmissible, suggesting that in conjunction with an uncharacterized accessory protein, these plasmids may be transferred horizontally via a relaxase intransmechanism. These findings have important implications for our understanding of staphylococcal resistance plasmid evolution.« less
Freeman, S.; Redman, R.S.; Grantham, G.; Rodriguez, R.J.
1997-01-01
A 7.4-kilobase (kb) DNA plasmid was isolated from Glomerella musae isolate 927 and designated pGML1. Exonuclease treatments indicated that pGML1 was a linear plasmid with blocked 5' termini. Cell-fractionation experiments combined with sequence-specific PCR amplification revealed that pGML1 resided in mitochondria. The pGML1 plasmid hybridized to cesium chloride-fractionated nuclear DNA but not to A + T-rich mitochondrial DNA. An internal 7.0-kb section of pGML1 was cloned and did not hybridize with either nuclear or mitochondrial DNA from G. musae. Sequence analysis revealed identical terminal inverted repeats (TIR) of 520 bp at the ends of the cloned 7.0-kb section of pGML1. The occurrence of pGML1 did not correspond with the pathogenicity of G. musae on banana fruit. Four additional isolates of G. musae possessed extrachromosomal DNA fragments similar in size and sequence to pGML1.
Du, Yong-Zhong; Lu, Ping; Yuan, Hong; Zhou, Jian-Ping; Hu, Fu-Qiang
2011-01-01
Quaternary complexes with condensed core of plasmid DNA, protamine, fish sperm DNA and shell of stearic acid grafted chitosan oligosaccharide (CSO-SA), were prepared. The CSO-SA could self-assemble to form nano-sized micelles in aqueous solution and demonstrated excellent internalization ability of tumor cells. Dynamic light scattering (DLS) measurement and transmission electrostatic microscope (TEM) images showed that quaternary complexes had spherical shape with about 25 nm number average diameter, and the size of quaternary complexes was smaller than that of CSO-SA micelles and CSO-SA micelles/plasmid DNA binary complexes. The transfection efficiencies of quaternary complexes on HEK293 and MCF-7 cells increased with incubation time, and were significantly higher than that of CSO-SA micelles/plasmid DNA binary complexes. The optimal transfection efficiency of quaternary complexes on HEK293 and MCF-7 cells measured by flow cytometer after 96 h was 23.82% and 41.43%, respectively. Whereas, the transfection efficiency of Lipofectamine™ 2000 on HEK293 and MCF-7 cells after 96 h was 32.45% and 33.23%, respectively. The data of luciferease activity measurement showed that the optimal ratio of plasmid DNA:fish sperm DNA:protamine:CSO-SA was 1:1:5:5. The results indicated that the present quaternary complexes were potential non-viral gene delivery system. Copyright © 2010 Elsevier B.V. All rights reserved.
Sum, Chi Hong; Nafissi, Nafiseh; Slavcev, Roderick A.; Wettig, Shawn
2015-01-01
In combination with novel linear covalently closed (LCC) DNA minivectors, referred to as DNA ministrings, a gemini surfactant-based synthetic vector for gene delivery has been shown to exhibit enhanced delivery and bioavailability while offering a heightened safety profile. Due to topological differences from conventional circular covalently closed (CCC) plasmid DNA vectors, the linear topology of LCC DNA ministrings may present differences with regards to DNA interaction and the physicochemical properties influencing DNA-surfactant interactions in the formulation of lipoplexed particles. In this study, N,N-bis(dimethylhexadecyl)-α,ω-propanediammonium(16-3-16)gemini-based synthetic vectors, incorporating either CCC plasmid or LCC DNA ministrings, were characterized and compared with respect to particle size, zeta potential, DNA encapsulation, DNase sensitivity, and in vitro transgene delivery efficacy. Through comparative analysis, differences between CCC plasmid DNA and LCC DNA ministrings led to variations in the physical properties of the resulting lipoplexes after complexation with 16-3-16 gemini surfactants. Despite the size disparities between the plasmid DNA vectors (CCC) and DNA ministrings (LCC), differences in DNA topology resulted in the generation of lipoplexes of comparable particle sizes. The capacity for ministring (LCC) derived lipoplexes to undergo complete counterion release during lipoplex formation contributed to improved DNA encapsulation, protection from DNase degradation, and in vitro transgene delivery. PMID:26561857
Mishra, Om P; Pietrofesa, Ralph; Christofidou-Solomidou, Melpo
2014-07-01
Secoisolariciresinol diglucoside (SDG) is the major lignan in wholegrain flaxseed. However, extraction methods are complex and are associated with low yield and high costs. Using a novel synthetic pathway, our group succeeded in chemically synthesizing SDG (S,S and R,R enantiomers), which faithfully recapitulates the properties of their natural counterparts, possessing strong antioxidant and free radical scavenging properties. This study further extends initial findings by now investigating the DNA-radioprotective properties of the synthetic SDG enantiomers compared to the commercial SDG. DNA radioprotection was assessed by cell-free systems such as: (a) plasmid relaxation assay to determine the extent of the supercoiled (SC) converted to open-circular (OC) plasmid DNA (pBR322) after exposure of the plasmid to gamma radiation; and (b) determining the extent of genomic DNA fragmentation. Exposure of plasmid DNA to 25 Gy of γ radiation resulted in decreased supercoiled form and increased open-circular form, indicating radiation-induced DNA damage. Synthetic SDG (S,S) and SDG (R,R), and commercial SDG at concentrations of 25-250 μM significantly and equipotently reduced the radiation-induced supercoiled to open-circular plasmid DNA in a dose-dependent conversion. In addition, exposure of calf thymus DNA to 50 Gy of gamma radiation resulted in DNA fragments of low-molecular weight (<6,000 bps), which was prevented in a dose-dependence manner by all synthetic and natural SDG enantomers, at concentrations as low as 0.5 μM. These novel results demonstrated that synthetic SDG (S,S) and SDG (R,R) isomers and commercial SDG possess DNA-radioprotective properties. Such properties along with their antioxidant and free radical scavenging activity, reported earlier, suggest that SDGs are promising candidates for radioprotection for normal tissue damage as a result of accidental exposure during radiation therapy for cancer treatment.
Mishra, Om P.; Pietrofesa, Ralph; Christofidou-Solomidou, Melpo
2014-01-01
Secoisolariciresinol diglucoside (SDG) is the major lignan in wholegrain flaxseed. However, extraction methods are complex and are associated with low yield and high costs. Using a novel synthetic pathway, our group succeeded in chemically synthesizing SDG (S,S and R,R enantiomers), which faithfully recapitulates the properties of their natural counterparts, possessing strong antioxidant and free radical scavenging properties. This study further extends initial findings by now investigating the DNA-radioprotective properties of the synthetic SDG enantiomers compared to the commercial SDG. DNA radioprotection was assessed by cell-free systems such as: (a) plasmid relaxation assay to determine the extent of the supercoiled (SC) converted to open-circular (OC) plasmid DNA (pBR322) after exposure of the plasmid to gamma radiation; and (b) determining the extent of genomic DNA fragmentation. Exposure of plasmid DNA to 25 Gy of γ radiation resulted in decreased supercoiled form and increased open-circular form, indicating radiation-induced DNA damage. Synthetic SDG (S,S) and SDG (R,R), and commercial SDG at concentrations of 25–250 μM significantly and equipotently reduced the radiation-induced supercoiled to open-circular plasmid DNA in a dose-dependent conversion. In addition, exposure of calf thymus DNA to 50 Gy of gamma radiation resulted in DNA fragments of low-molecular weight (<6,000 bps), which was prevented in a dose-dependence manner by all synthetic and natural SDG enantomers, at concentrations as low as 0.5 μM. These novel results demonstrated that synthetic SDG (S,S) and SDG (R,R) isomers and commercial SDG possess DNA-radioprotective properties. Such properties along with their antioxidant and free radical scavenging activity, reported earlier, suggest that SDGs are promising candidates for radioprotection for normal tissue damage as a result of accidental exposure during radiation therapy for cancer treatment. PMID:24945894
Zhang, Yu; Yao, Youlin; Jiang, Siyuan; Lu, Yilu; Liu, Yunqiang; Tao, Dachang; Zhang, Sizhong; Ma, Yongxin
2015-04-01
To identify protein-protein interaction partners of PER1 (period circadian protein homolog 1), key component of the molecular oscillation system of the circadian rhythm in tumors using bacterial two-hybrid system technique. Human cervical carcinoma cell Hela library was adopted. Recombinant bait plasmid pBT-PER1 and pTRG cDNA plasmid library were cotransformed into the two-hybrid system reporter strain cultured in a special selective medium. Target clones were screened. After isolating the positive clones, the target clones were sequenced and analyzed. Fourteen protein coding genes were identified, 4 of which were found to contain whole coding regions of genes, which included optic atrophy 3 protein (OPA3) associated with mitochondrial dynamics and homo sapiens cutA divalent cation tolerance homolog of E. coli (CUTA) associated with copper metabolism. There were also cellular events related proteins and proteins which are involved in biochemical reaction and signal transduction-related proteins. Identification of potential interacting proteins with PER1 in tumors may provide us new insights into the functions of the circadian clock protein PER1 during tumorigenesis.
Community-wide plasmid gene mobilization and selection
Sentchilo, Vladimir; Mayer, Antonia P; Guy, Lionel; Miyazaki, Ryo; Green Tringe, Susannah; Barry, Kerrie; Malfatti, Stephanie; Goessmann, Alexander; Robinson-Rechavi, Marc; van der Meer, Jan R
2013-01-01
Plasmids have long been recognized as an important driver of DNA exchange and genetic innovation in prokaryotes. The success of plasmids has been attributed to their independent replication from the host's chromosome and their frequent self-transfer. It is thought that plasmids accumulate, rearrange and distribute nonessential genes, which may provide an advantage for host proliferation under selective conditions. In order to test this hypothesis independently of biases from culture selection, we study the plasmid metagenome from microbial communities in two activated sludge systems, one of which receives mostly household and the other chemical industry wastewater. We find that plasmids from activated sludge microbial communities carry among the largest proportion of unknown gene pools so far detected in metagenomic DNA, confirming their presumed role of DNA innovators. At a system level both plasmid metagenomes were dominated by functions associated with replication and transposition, and contained a wide variety of antibiotic and heavy metal resistances. Plasmid families were very different in the two metagenomes and grouped in deep-branching new families compared with known plasmid replicons. A number of abundant plasmid replicons could be completely assembled directly from the metagenome, providing insight in plasmid composition without culturing bias. Functionally, the two metagenomes strongly differed in several ways, including a greater abundance of genes for carbohydrate metabolism in the industrial and of general defense factors in the household activated sludge plasmid metagenome. This suggests that plasmids not only contribute to the adaptation of single individual prokaryotic species, but of the prokaryotic community as a whole under local selective conditions. PMID:23407308
A Simple And Rapid Minicircle DNA Vector Manufacturing System
Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying
2010-01-01
Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455
NASA Astrophysics Data System (ADS)
Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik
2016-12-01
Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.
Dröge, M; Pühler, A; Selbitschka, W
2000-04-01
In order to isolate antibiotic resistance plasmids from bacterial communities found in activated sludge, derivatives of the 3-chlorobenzoate-degrading strain Pseudomonas sp. B13, tagged with the green fluorescent protein as an identification marker, were used as recipients in filter crosses. Transconjugants were selected on agar plates containing 3-chlorobenzoate as the sole carbon source and the antibiotic tetracycline, streptomycin or spectinomycin, and were recovered at frequencies in the range of 10(-5) to 10(-8) per recipient. A total of 12 distinct plasmids, designated pB1-pB12, was identified. Their sizes ranged between 41 to 69 kb and they conferred various patterns of antibiotic resistance on their hosts. Two of the plasmids, pB10 and pB11, also mediated resistance to inorganic mercury. Seven of the 12 plasmids were identified as broad-host-range plasmids, displaying extremely high transfer frequencies in filter crosses, ranging from 10(-1) to 10(-2) per recipient cell. Ten of the 12 plasmids belonged to the IncP incompatibility group, based on replicon typing using IncP group-specific PCR primers. DNA sequencing of PCR amplification products further revealed that eight of the 12 plasmids belonged to the IncPbeta subgroup, whereas two plasmids were identified as IncPalpha plasmids. Analysis of the IncP-specific PCR products revealed considerable differences among the IncPbeta plasmids at the DNA sequence level. In order to characterize the gene "load" of the IncP plasmids, restriction fragments were cloned and their DNA sequences established. A remarkable diversity of putative proteins encoded by these fragments was identified. Besides transposases and proteins involved in antibiotic resistance, two putative DNA invertases belonging to the Din family, a methyltransferase of a type I restriction/modification system, a superoxide dismutase, parts of a putative efflux system belonging to the RND family, and proteins of unknown function were identified.
Sharma, Shukriti; Citti, Chistine; Sagné, Eveline; Marenda, Marc S.
2015-01-01
Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae. PMID:25746296
Li, Hedan; Zhang, Lirong; Guo, Wei; Xu, Daqing
2016-12-01
Gene disruption and replacement in Corynebacterium glutamicum is dependent upon a high transformation efficiency. The cglIR-cgIIR restriction system is a major barrier to introduction of foreign DNA into Corynebacterium glutamicum cells. To improve the transformation efficiency of C. glutamicum, the cglIM gene encoding methyltransferase in the cglIR-cglIIR-cglIM restriction-modification system of C. glutamicum ATCC 13032 was chromosomally integrated and expressed in Escherichia coli, resulting in an engineered strain E. coli AU1. The electro-transformation experiments of C. glutamicum ATCC 13032 with the E. coli-C. glutamicum shuttle plasmid pAU4 showed that the transformation efficiency of C. glutamicum with pAU4 DNA extracted from E. coli TG1/pAU4 was 1.80±0.21×10 2 cfu/μg plasmid DNA, while using pAU4 DNA extracted from E. coli AU1/pAU4, the transformation efficiency reached up to 5.22±0.33×10 6 cfu/μg plasmid DNA. The results demonstrated that E. coli AU1 is able to confer the cglIM-specific DNA methylation pattern to its resident plasmid, which makes the plasmid resistant to the cglIR-cglIIR restriction and efficiently transferred into C. glutamicum. E. coli AU1 is a useful intermediate host for efficient transformation of C. glutamicum. Copyright © 2016. Published by Elsevier B.V.
21 CFR 601.2 - Applications for biologics licenses; procedures for filing.
Code of Federal Regulations, 2011 CFR
2011-04-01
... section: (1) Therapeutic DNA plasmid products; (2) Therapeutic synthetic peptide products of 40 or fewer amino acids; (3) Monoclonal antibody products for in vivo use; and (4) Therapeutic recombinant DNA... licensure which is a therapeutic DNA plasmid product, therapeutic synthetic peptide product of 40 or fewer...
21 CFR 601.2 - Applications for biologics licenses; procedures for filing.
Code of Federal Regulations, 2010 CFR
2010-04-01
... section: (1) Therapeutic DNA plasmid products; (2) Therapeutic synthetic peptide products of 40 or fewer amino acids; (3) Monoclonal antibody products for in vivo use; and (4) Therapeutic recombinant DNA... licensure which is a therapeutic DNA plasmid product, therapeutic synthetic peptide product of 40 or fewer...
21 CFR 601.2 - Applications for biologics licenses; procedures for filing.
Code of Federal Regulations, 2013 CFR
2013-04-01
... section: (1) Therapeutic DNA plasmid products; (2) Therapeutic synthetic peptide products of 40 or fewer amino acids; (3) Monoclonal antibody products for in vivo use; and (4) Therapeutic recombinant DNA... licensure which is a therapeutic DNA plasmid product, therapeutic synthetic peptide product of 40 or fewer...
21 CFR 601.2 - Applications for biologics licenses; procedures for filing.
Code of Federal Regulations, 2014 CFR
2014-04-01
... section: (1) Therapeutic DNA plasmid products; (2) Therapeutic synthetic peptide products of 40 or fewer amino acids; (3) Monoclonal antibody products for in vivo use; and (4) Therapeutic recombinant DNA... licensure which is a therapeutic DNA plasmid product, therapeutic synthetic peptide product of 40 or fewer...
21 CFR 601.2 - Applications for biologics licenses; procedures for filing.
Code of Federal Regulations, 2012 CFR
2012-04-01
... section: (1) Therapeutic DNA plasmid products; (2) Therapeutic synthetic peptide products of 40 or fewer amino acids; (3) Monoclonal antibody products for in vivo use; and (4) Therapeutic recombinant DNA... licensure which is a therapeutic DNA plasmid product, therapeutic synthetic peptide product of 40 or fewer...
Plasmid P1 replication: negative control by repeated DNA sequences.
Chattoraj, D; Cordes, K; Abeles, A
1984-01-01
The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pieces of the incA fragment that each contain only three repeats destabilize P1 plasmids efficiently. This result makes it unlikely that incA specifies a regulatory product. Our in vivo results suggest that the repeating DNA sequence itself negatively controls replication by titrating a P1-determined protein, RepA, that is essential for replication. Consistent with this hypothesis is the observation that the RepA protein binds to the incA fragment in vitro. Images PMID:6387706
Nanofabrication and characterization of PVA-organofiller/Ag nanocoatings on pMAD plasmids
NASA Astrophysics Data System (ADS)
Erdonmez, D.; Mosayyebi, S.; Erkan, K.; Salimi, K.; Nagizade, N.; Saglam, N.; Rzayev, Z. M. O.
2014-11-01
Nowadays, the most important problem in microbial researches is bacterial resistance which is carried out by DNA plasmids against antibacterial agents. The effect of antibacterial nanoparticles on bacteria is remarkable, but studies on the interactions of these particles with plasmids do not search or there are no adequate studies. We proposed that the nanoparticles, which are disrupted the self-assembled structure of plasmids, may decrease the resistance of bacteria, and therefore, increase the activity of utilized antibacterial agents. In this work, we synthesized polymer nanofiber webs samples by electrospinning technique from pure water solution of nanocomposites with different contents of silver nanoparticles, and surface morphology of nanofibers composites were characterized by SEM microscopy. Their interactions with pMAD DNA plasmids were investigated. It was demonstrated that the synthesized Ag-carrying nanohybrid composites with higher surface contacted areas were significantly inhibited the activity of plasmid DNA against bacterial resistance. Agreeing with obtained results, synthesized nanofiber coatings can be recommended for the widely applications in nanobiotechnology, nanomedicine, and bioengineering processing.
McLaughlin, Krystle J; Nash, Rebekah P; Redinbo, Mathew R
2014-09-01
The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. In this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Palumbo, R. Noelle; Zhong, Xiao; Panus, David; Han, Wenqing; Ji, Weihang; Wang, Chun
2012-01-01
DNA vaccination using cationic polymers as carriers has the potential to be a very powerful method of immunotherapy, but typical immune responses generated have been less than robust. To better understand the details of DNA vaccine delivery in vivo, we prepared polymer/DNA complexes using three structurally distinct cationic polymers and fluorescently labeled plasmid DNA and injected them intradermally into mice. We analyzed transgene expression (luciferase) and the local tissue distribution of the labeled plasmid at the injection site at various time points (from hours to days). Comparable numbers of luciferase expressing cells were observed in the skin of mice receiving naked plasmid or polyplexes one day after transfection. At day 4, however, the polyplexes appeared to result in more transfected skin cells than naked plasmid. Live animal imaging revealed that naked plasmid dispersed quickly in the skin of mice after injection and had a wider distribution than any of the three types of polyplexes. However, naked plasmid level dropped to below detection limit after 24 h, whereas polyplexes persisted for up to 2 weeks. The PEGylated polyplexes had a significantly wider distribution in the tissue than the nonPEGylated polyplexes. PEGylated polyplexes also distributed more broadly among dermal fibroblasts and allowed greater interaction with antigen-presenting cells (APCs) (dendritic cells and macrophages) starting at around 24 h post-injection. By day 4, co-localization of polyplexes with APCs was observed at the injection site regardless of polymer structure, whereas small amounts of polyplexes were found in the draining lymph nodes. These in vivo findings demonstrate the superior stability of PEGylated polyplexes in physiological milieu and provide important insight on how cationic polymers could be optimized for DNA vaccine delivery. PMID:22300619
Electrotransfer of Plasmid Vector DNA into Muscle
NASA Astrophysics Data System (ADS)
Miyazaki, Satsuki; Miyazaki, Jun-Ichi
Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.
Rapid DNA transformation in Salmonella Typhimurium by the hydrogel exposure method.
Elabed, Hamouda; Hamza, Rim; Bakhrouf, Amina; Gaddour, Kamel
2016-07-01
Even with advances in molecular cloning and DNA transformation, new or alternative methods that permit DNA penetration in Salmonella enterica subspecies enterica serovar Typhimurium are required in order to use this pathogen in biotechnological or medical applications. In this work, an adapted protocol of bacterial transformation with plasmid DNA based on the "Yoshida effect" was applied and optimized on Salmonella enterica serovar Typhimurium LT2 reference strain. The plasmid transference based on the use of sepiolite as acicular materials to promote cell piercing via friction forces produced by spreading on the surface of a hydrogel. The transforming mixture containing sepiolite nanofibers, bacterial cells to be transformed and plasmid DNA were plated directly on selective medium containing 2% agar. In order to improve the procedure, three variables were tested and the transformation of Salmonella cells was accomplished using plasmids pUC19 and pBR322. Using the optimized protocol on Salmonella LT2 strain, the efficiency was about 10(5) transformed cells per 10(9) subjected to transformation with 0.2μg plasmid DNA. In summary, the procedure is fast, offers opportune efficiency and promises to become one of the widely used transformation methods in laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zheng, Fengrong; Sun, Xiuqin; Liu, Hongzhan; Wu, Xingan; Zhong, Nan; Wang, Bo; Zhou, Guodong
2010-01-01
Lymphocystis disease, caused by the lymphocystis disease virus (LCDV), is a significant worldwide problem in fish industry causing substantial economic losses. In this study, we aimed to develop the DNA vaccine against LCDV, using DNA vaccination technology. We evaluated plasmid pEGFP-N2-LCDV1.3 kb as a DNA vaccine candidate. The plasmid DNA was transiently expressed after liposome transfection into the eukaryotic COS 7 cell line. The distribution and expression of the DNA vaccine (pEGFP-N2-LCDV1.3kb) were also analyzed in tissues of the vaccinated Japanese flounder by PCR, RT-PCR and fluorescent microscopy. Results from PCR analysis indicated that the vaccine-containing plasmids were distributed in injected muscle, the muscle opposite the injection site, the hind intestine, gill, spleen, head, kidney and liver, 6 and 25 days after vaccination. The vaccine plasmids disappeared 100 d post-vaccination. Fluorescent microscopy revealed green fluorescence in the injected muscle, the muscle opposite the injection site, the hind intestine, gill, spleen, head, kidney and liver of fish 48 h post-vaccination, green fluorescence did not appear in the control treated tissue. Green fluorescence became weak at 60 days post-vaccination. RT-PCR analysis indicated that the mcp gene was expressed in all tested tissues of vaccinated fish 6-50 days post-vaccination. These results demonstrate that the antigen encoded by the DNA vaccine is distributed and expressed in all of the tissues analyzed in the vaccinated fish. The antigen would therefore potentially initiate a specific immune response. the plasmid DNA was injected into Japanese flounder ( Paralichthys olivaceus) intramuscularly and antibodies against LCDV were evaluated. The results indicate that the plasmid encoded DNA vaccine could induce an immune response to LCDV and would therefore offer immune protection against LCD. Further studies are required for the development and application of this promising DNA vaccine.
Ongkudon, Clarence M; Danquah, Michael K
2010-10-15
Anion exchange monolithic chromatography is increasingly becoming a prominent tool for plasmid DNA purification but no generic protocol is available to purify all types of plasmid DNA. In this work, we established a simple framework and used it to specifically purify a plasmid DNA model from a clarified alkaline-lysed plasmid-containing cell lysate. The framework involved optimising ligand functionalisation temperature (30-80°C), mobile phase flow rate (0.1-1.8mL/min), monolith pore size (done by changing the porogen content in the polymerisation reaction by 50-80%), buffer pH (6-10), ionic strength of binding buffer (0.3-0.7M) and buffer gradient elution slope (1-10% buffer B/min). We concluded that preferential pcDNA3F adsorption and optimum resolution could be achieved within the tested conditions by loading the clarified cell lysate into 400nm pore size of monolith in 0.7M NaCl (pH 6) of binding buffer followed by increasing the NaCl concentration to 1.0M at 3%B/min. Copyright © 2010 Elsevier B.V. All rights reserved.
Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong
2012-07-01
cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.
Le Chevanton, L; Leblon, G
1989-04-15
We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.
Zhang, Li; Wu, Yuhua; Wu, Gang; Cao, Yinglong; Lu, Changming
2014-10-01
Plasmid calibrators are increasingly applied for polymerase chain reaction (PCR) analysis of genetically modified organisms (GMOs). To evaluate the commutability between plasmid DNA (pDNA) and genomic DNA (gDNA) as calibrators, a plasmid molecule, pBSTopas, was constructed, harboring a Topas 19/2 event-specific sequence and a partial sequence of the rapeseed reference gene CruA. Assays of the pDNA showed similar limits of detection (five copies for Topas 19/2 and CruA) and quantification (40 copies for Topas 19/2 and 20 for CruA) as those for the gDNA. Comparisons of plasmid and genomic standard curves indicated that the slopes, intercepts, and PCR efficiency for pBSTopas were significantly different from CRM Topas 19/2 gDNA for quantitative analysis of GMOs. Three correction methods were used to calibrate the quantitative analysis of control samples using pDNA as calibrators: model a, or coefficient value a (Cva); model b, or coefficient value b (Cvb); and the novel model c or coefficient formula (Cf). Cva and Cvb gave similar estimated values for the control samples, and the quantitative bias of the low concentration sample exceeded the acceptable range within ±25% in two of the four repeats. Using Cfs to normalize the Ct values of test samples, the estimated values were very close to the reference values (bias -13.27 to 13.05%). In the validation of control samples, model c was more appropriate than Cva or Cvb. The application of Cf allowed pBSTopas to substitute for Topas 19/2 gDNA as a calibrator to accurately quantify the GMO.
Adsorption behavior of plasmid DNA onto perfusion chromatographic matrix.
Limonta, Miladys; Zumalacárregui, Lourdes; Soler, Dayana
2012-05-01
Anion exchange chromatography is the most popular chromatographic method for plasmid separation. POROS RI 50 is a perfusion chromatographic support which is a reversed phase matrix and is an alternative to conventional ones due to its mass transfer properties. The adsorption and elution of the pIDKE2 plasmid onto reversed phase POROS R1 50 was studied. Langmuir isotherm model was adjusted in order to get the maximum adsorption capacity and the dissociation constant for POROS R1 50-plasmid DNA (pDNA) system. Breakthrough curves were obtained for volumetric flows between 0.69-3.33 mL/min, given dynamic capacity up to 2.3 times higher than those reported for ionic exchange matrix used during the purification process of plasmids with similar size to that of pIDKE2. The efficiency was less than 45% for the flow conditions and initial concentration studied, which means that the support will not be operated under saturation circumstances.
Plasmid DNA Delivery: Nanotopography Matters.
Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong
2017-12-20
Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.
Solid lipid nanoparticles mediate non-viral delivery of plasmid DNA to dendritic cells
NASA Astrophysics Data System (ADS)
Penumarthi, Alekhya; Parashar, Deepti; Abraham, Amanda N.; Dekiwadia, Chaitali; Macreadie, Ian; Shukla, Ravi; Smooker, Peter M.
2017-06-01
There is an increasing demand for novel DNA vaccine delivery systems, mainly for the non-viral type as they are considered relatively safe. Therefore, solid lipid nanoparticles (SLNs) were investigated for their suitability as a non-viral DNA vaccine delivery system. SLNs were synthesised by a modified solvent-emulsification method in order to study their potential to conjugate with plasmid DNA and deliver them in vitro to dendritic cells using eGFP as the reporter plasmid. The DNA-SLN complexes were characterised by electron microscopy, gel retardation assays and dynamic light scattering. The cytotoxicity assay data supported their biocompatibility and was used to estimate safe threshold concentration resulting in high transfection rate. The transfection efficiency of these complexes in a dendritic cell line was shown to increase significantly compared to plasmid alone, and was comparable to that mediated by lipofectamine. Transmission electron microscopy studies delineated the pathway of cellular uptake. Endosomal escape was observed supporting the mechanism of transfection.
NASA Astrophysics Data System (ADS)
Billi, Daniela
2012-06-01
Two GFP-based plasmids, namely pTTQ18-GFP-pDU1mini and pDUCA7-GFP, of about 7 kbp and 15 kbp respectively, able to replicate in Chroococcidiopsis sp. CCMEE 029 and CCMEE 123, were developed. Both plasmids were maintained in Chroococcidiopsis cells after 18 months of dry storage as demonstrated by colony PCR, plasmid restriction analysis, GFP imaging and colony-forming ability under selection of dried transformants; thus suggesting that strategies employed by this cyanobacterium to stabilize dried chromosomal DNA, must have protected plasmid DNA. The suitability of pDU1mini-plasmid for GFP tagging in Chroococcidiopsis was investigated by using the RecA homolog of Synechocystis sp. PCC 6803. After 2 months of dry storage, the presence of dried cells with a GFP-RecASyn distribution resembling that of hydrated cells, supported its capability of preventing desiccation-induced genome damage, whereas the rewetted cells with filamentous GFP-RecASyn structures revealed sub-lethal DNA damage. The long-term stability of plasmid DNA in dried Chroococcidiopsis has implication for space research, for example when investigating the recovery of dried cells after Martian and space simulations or when developing life support systems based on phototrophs with genetically enhanced stress tolerance and stored in the dry state for prolonged periods.
Billi, Daniela
2012-06-01
Two GFP-based plasmids, namely pTTQ18-GFP-pDU1(mini) and pDUCA7-GFP, of about 7 kbp and 15 kbp respectively, able to replicate in Chroococcidiopsis sp. CCMEE 029 and CCMEE 123, were developed. Both plasmids were maintained in Chroococcidiopsis cells after 18 months of dry storage as demonstrated by colony PCR, plasmid restriction analysis, GFP imaging and colony-forming ability under selection of dried transformants; thus suggesting that strategies employed by this cyanobacterium to stabilize dried chromosomal DNA, must have protected plasmid DNA. The suitability of pDU1(mini)-plasmid for GFP tagging in Chroococcidiopsis was investigated by using the RecA homolog of Synechocystis sp. PCC 6803. After 2 months of dry storage, the presence of dried cells with a GFP-RecA(Syn) distribution resembling that of hydrated cells, supported its capability of preventing desiccation-induced genome damage, whereas the rewetted cells with filamentous GFP-RecA(Syn) structures revealed sub-lethal DNA damage. The long-term stability of plasmid DNA in dried Chroococcidiopsis has implication for space research, for example when investigating the recovery of dried cells after Martian and space simulations or when developing life support systems based on phototrophs with genetically enhanced stress tolerance and stored in the dry state for prolonged periods.
Carneiro, Marcia W.; Miranda, José Carlos; Clarêncio, Jorge; Barral-Netto, Manoel; Brodskyn, Cláudia; Barral, Aldina; Ribeiro, José M. C.; Valenzuela, Jesus G.; de Oliveira, Camila I.
2013-01-01
Background Leishmania parasites are transmitted in the presence of sand fly saliva. Together with the parasite, the sand fly injects salivary components that change the environment at the feeding site. Mice immunized with Phlebotomus papatasi salivary gland (SG) homogenate are protected against Leishmania major infection, while immunity to Lutzomyia intermedia SG homogenate exacerbated experimental Leishmania braziliensis infection. In humans, antibodies to Lu. intermedia saliva are associated with risk of acquiring L. braziliensis infection. Despite these important findings, there is no information regarding the repertoire of Lu. intermedia salivary proteins. Methods and Findings A cDNA library from the Salivary Glands (SGs) of wild-caught Lu. intermedia was constructed, sequenced, and complemented by a proteomic approach based on 1D SDS PAGE and mass/mass spectrometry to validate the transcripts present in this cDNA library. We identified the most abundant transcripts and proteins reported in other sand fly species as well as novel proteins such as neurotoxin-like proteins, peptides with ML domain, and three small peptides found so far only in this sand fly species. DNA plasmids coding for ten selected transcripts were constructed and used to immunize BALB/c mice to study their immunogenicity. Plasmid Linb-11—coding for a 4.5-kDa protein—induced a cellular immune response and conferred protection against L. braziliensis infection. This protection correlated with a decreased parasite load and an increased frequency of IFN-γ-producing cells. Conclusions We identified the most abundant and novel proteins present in the SGs of Lu. intermedia, a vector of cutaneous leishmaniasis in the Americas. We also show for the first time that immunity to a single salivary protein from Lu. intermedia can protect against cutaneous leishmaniasis caused by L. braziliensis. PMID:23717705
de Moura, Tatiana R; Oliveira, Fabiano; Carneiro, Marcia W; Miranda, José Carlos; Clarêncio, Jorge; Barral-Netto, Manoel; Brodskyn, Cláudia; Barral, Aldina; Ribeiro, José M C; Valenzuela, Jesus G; de Oliveira, Camila I
2013-01-01
Leishmania parasites are transmitted in the presence of sand fly saliva. Together with the parasite, the sand fly injects salivary components that change the environment at the feeding site. Mice immunized with Phlebotomus papatasi salivary gland (SG) homogenate are protected against Leishmania major infection, while immunity to Lutzomyia intermedia SG homogenate exacerbated experimental Leishmania braziliensis infection. In humans, antibodies to Lu. intermedia saliva are associated with risk of acquiring L. braziliensis infection. Despite these important findings, there is no information regarding the repertoire of Lu. intermedia salivary proteins. A cDNA library from the Salivary Glands (SGs) of wild-caught Lu. intermedia was constructed, sequenced, and complemented by a proteomic approach based on 1D SDS PAGE and mass/mass spectrometry to validate the transcripts present in this cDNA library. We identified the most abundant transcripts and proteins reported in other sand fly species as well as novel proteins such as neurotoxin-like proteins, peptides with ML domain, and three small peptides found so far only in this sand fly species. DNA plasmids coding for ten selected transcripts were constructed and used to immunize BALB/c mice to study their immunogenicity. Plasmid Linb-11--coding for a 4.5-kDa protein--induced a cellular immune response and conferred protection against L. braziliensis infection. This protection correlated with a decreased parasite load and an increased frequency of IFN-γ-producing cells. We identified the most abundant and novel proteins present in the SGs of Lu. intermedia, a vector of cutaneous leishmaniasis in the Americas. We also show for the first time that immunity to a single salivary protein from Lu. intermedia can protect against cutaneous leishmaniasis caused by L. braziliensis.
A fully decompressed synthetic bacteriophage øX174 genome assembled and archived in yeast.
Jaschke, Paul R; Lieberman, Erica K; Rodriguez, Jon; Sierra, Adrian; Endy, Drew
2012-12-20
The 5386 nucleotide bacteriophage øX174 genome has a complicated architecture that encodes 11 gene products via overlapping protein coding sequences spanning multiple reading frames. We designed a 6302 nucleotide synthetic surrogate, øX174.1, that fully separates all primary phage protein coding sequences along with cognate translation control elements. To specify øX174.1f, a decompressed genome the same length as wild type, we truncated the gene F coding sequence. We synthesized DNA encoding fragments of øX174.1f and used a combination of in vitro- and yeast-based assembly to produce yeast vectors encoding natural or designer bacteriophage genomes. We isolated clonal preparations of yeast plasmid DNA and transfected E. coli C strains. We recovered viable øX174 particles containing the øX174.1f genome from E. coli C strains that independently express full-length gene F. We expect that yeast can serve as a genomic 'drydock' within which to maintain and manipulate clonal lineages of other obligate lytic phage. Copyright © 2012 Elsevier Inc. All rights reserved.
Richie, Thomas L.; Charoenvit, Yupin; Wang, Ruobing; Epstein, Judith E.; Hedstrom, Richard C.; Kumar, Sanjai; Luke, Thomas C.; Freilich, Daniel A.; Aguiar, Joao C.; Sacci, Jr., John B.; Sedegah, Martha; Nosek, Jr., Ronald A.; De La Vega, Patricia; Berzins, Mara P.; Majam, Victoria F.; Abot, Esteban N.; Ganeshan, Harini; Richie, Nancy O.; Banania, Jo Glenna; Baraceros, Maria Fe B.; Geter, Tanya G.; Mere, Robin; Bebris, Lolita; Limbach, Keith; Hickey, Bradley W.; Lanar, David E.; Ng, Jennifer; Shi, Meng; Hobart, Peter M.; Norman, Jon A.; Soisson, Lorraine A.; Hollingdale, Michael R.; Rogers, William O.; Doolan, Denise L.; Hoffman, Stephen L.
2012-01-01
When introduced in the 1990s, immunization with DNA plasmids was considered potentially revolutionary for vaccine development, particularly for vaccines intended to induce protective CD8 T cell responses against multiple antigens. We conducted, in 1997−1998, the first clinical trial in healthy humans of a DNA vaccine, a single plasmid encoding Plasmodium falciparum circumsporozoite protein (PfCSP), as an initial step toward developing a multi-antigen malaria vaccine targeting the liver stages of the parasite. As the next step, we conducted in 2000–2001 a clinical trial of a five-plasmid mixture called MuStDO5 encoding pre-erythrocytic antigens PfCSP, PfSSP2/TRAP, PfEXP1, PfLSA1 and PfLSA3. Thirty-two, malaria-naïve, adult volunteers were enrolled sequentially into four cohorts receiving a mixture of 500 μg of each plasmid plus escalating doses (0, 20, 100 or 500 μg) of a sixth plasmid encoding human granulocyte macrophage-colony stimulating factor (hGM-CSF). Three doses of each formulation were administered intramuscularly by needle-less jet injection at 0, 4 and 8 weeks, and each cohort had controlled human malaria infection administered by five mosquito bites 18 d later. The vaccine was safe and well-tolerated, inducing moderate antigen-specific, MHC-restricted T cell interferon-γ responses but no antibodies. Although no volunteers were protected, T cell responses were boosted post malaria challenge. This trial demonstrated the MuStDO5 DNA and hGM-CSF plasmids to be safe and modestly immunogenic for T cell responses. It also laid the foundation for priming with DNA plasmids and boosting with recombinant viruses, an approach known for nearly 15 y to enhance the immunogenicity and protective efficacy of DNA vaccines. PMID:23151451
2012-01-01
Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256
Arginine homopeptides for plasmid DNA purification using monolithic supports.
Cardoso, Sara; Sousa, Ângela; Queiroz, João A; Azzoni, Adriano R; Sousa, Fani
2018-06-15
Purification of plasmid DNA targeting therapeutic applications still presents many challenges, namely on supports and specific ligand development. Monolithic supports have emerged as interesting approaches for purifying pDNA due to its excellent mass transfer properties and higher binding capacity values. Moreover, arginine ligands were already described to establish specific and preferential interactions with pDNA. Additionally, some studies revealed the ability of arginine based cationic peptides to condense plasmid DNA, which increased lengthening can result in strongest interactions with higher binding capacities for chromatographic purposes of large molecules such as pDNA. In this work, arginine homopeptides were immobilized in monolithic supports and their performance was evaluated and compared with a single arginine monolithic column regarding supercoiled (sc) plasmid DNA purification. Specific interactions of arginine based peptides with several nucleic acids present in a clarified Escherichia coli lysate sample showed potential for the sc pDNA purification. Effectively, the immobilization of the arginine homopeptides became more functional compared with the single arginine amino acid, showing higher binding capacities, which was also reflected in the intensity of the interactions. The combination of structural versatilities of monoliths with the specificity of arginine peptides raised as a promising strategy for sc pDNA purification. Copyright © 2018 Elsevier B.V. All rights reserved.
Structure-Function Aspects of Membrane Associated Prokaryotic DNA replication
1994-09-01
Membrane associated DNA replication in prokaryotes has been studied intensively using two model systems, Bacillus subtilis and plasmid RK2 cultured...in its Escherichia coli host. In the former a new membrane protein that had previously been found to act as an inhibitor of DNA replication was...prior to a round of DNA replication . In the latter, plasmid DNA replication has been found to be associated with the inner but not outer membrane of
Ruan, Junzhong; Duan, Yong; Li, Fugen; Wang, Zitong
2017-01-01
In order to achieve a synergistic effect on anti-tumour and anti-angiogenesis activity, we designed and constructed a DNA vaccine that expresses MUC1and VEGFR2 in the same reading frame. The aim of this study was to investigate the anti-tumour activity of this DNA vaccine. Furthermore, we also investigated the enhanced synergistic anti-Lewis lung carcinoma effect of this DNA vaccine by using GM-CSF as an adjuvant. A series of DNA plasmids encoding MUC1, VEGFR2, GM-CSF, and their conjugates were constructed and injected into mice intramuscularly (i.m.) followed by an electric pulse. The humoral and cellular immune responses after immunization were detected by enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunospot (ELISPOT), respectively. To evaluate the anti-tumour efficacy of these plasmids, murine models with MUC1-expressing tumours were generated. After injection into the tumour-bearing mouse model, the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed stronger inhibition of tumour growth than the plasmid expressing MUC1 or VEGFR2 alone, which indicated that MUC1 and VEGFR2 could exert a synergistic anti-tumour effect. Furthermore, mice vaccinated with the combination of the GM-CSF expressing plasmid and the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed an increased inhibition in the growth of MUC1-expressing tumours and prolonged mouse survival. These observations emphasize the potential of the synergistic anti-tumour and anti-angiogenesis strategy used in DNA vaccines, and the potential of the GM-CSF gene as an adjuvant for DNA vaccines, which could represent a promising approach for tumour immunotherapy. © 2016 John Wiley & Sons Australia, Ltd.
Andrade, B S; Góes-Neto, A
2015-10-30
The filamentous fungus Moniliophthora perniciosa is a hemibiotrophic basidiomycete that causes witches' broom disease of cacao (Theobroma cacao L.). Many fungal mitochondrial plasmids are DNA and RNA polymerase-encoding invertrons with terminal inverted repeats and 5'-linked proteins. The aim of this study was to carry out comparative and phylogenetic analyses of DNA and RNA polymerases for all known linear mitochondrial plasmids in fungi. We performed these analyses at both gene and protein levels and assessed differences between fungal and viral polymerases in order to test the lateral gene transfer (LGT) hypothesis. We analyzed all mitochondrial plasmids of the invertron type within the fungal clade, including five from Ascomycota, seven from Basidiomycota, and one from Chytridiomycota. All phylogenetic analyses generated similar tree topologies regardless of the methods and datasets used. It is likely that DNA and RNA polymerase genes were inserted into the mitochondrial genomes of the 13 fungal species examined in our study as a result of different LGT events. These findings are important for a better understanding of the evolutionary relationships between fungal mitochondrial plasmids.
Lian, Kaiqi; Yang, Fan; Zhu, Zixiang; Cao, Weijun; Jin, Ye; Li, Dan; Zhang, Keshan; Guo, Jianhong; Zheng, Haixue; Liu, Xiangtao
2015-10-02
We developed an RNA polymerase (pol) I- and II-driven plasmid-based reverse genetics system to rescue infectious foot-and-mouth disease virus (FMDV) from cloned cDNA. In this plasmid-based transfection, the full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta ribozyme (HdvRz) sequences, which were arranged downstream of the two promoters (cytomegalovirus (CMV) and pol I promoter) and upstream of the terminators and polyadenylation signal, respectively. The utility of this method was demonstrated by the recovery of FMDV Asia1 HN/CHA/06 in BHK-21 cells transfected with cDNA plasmids. Furthermore, infectious FMDV Asia1 HN/CHA/06 could be rescued from suckling mice directly inoculated with cDNA plasmids. Thus, this reverse genetics system can be applied to fundamental research and vaccine studies, most notably to rescue those viruses for which there is currently an absence of a suitable cell culture system. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.
1987-12-01
A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C tomore » A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation.« less
Dealtry, Simone; Ding, Guo-Chun; Weichelt, Viola; Dunon, Vincent; Schlüter, Andreas; Martini, María Carla; Papa, María Florencia Del; Lagares, Antonio; Amos, Gregory Charles Auton; Wellington, Elizabeth Margaret Helen; Gaze, William Hugo; Sipkema, Detmer; Sjöling, Sara; Springael, Dirk; Heuer, Holger; van Elsas, Jan Dirk; Thomas, Christopher; Smalla, Kornelia
2014-01-01
IncP-1, IncP-7 and IncP-9 plasmids often carry genes encoding enzymes involved in the degradation of man-made and natural contaminants, thus contributing to bacterial survival in polluted environments. However, the lack of suitable molecular tools often limits the detection of these plasmids in the environment. In this study, PCR followed by Southern blot hybridization detected the presence of plasmid-specific sequences in total community (TC-) DNA or fosmid DNA from samples originating from different environments and geographic regions. A novel primer system targeting IncP-9 plasmids was developed and applied along with established primers for IncP-1 and IncP-7. Screening TC-DNA from biopurification systems (BPS) which are used on farms for the purification of pesticide-contaminated water revealed high abundances of IncP-1 plasmids belonging to different subgroups as well as IncP-7 and IncP-9. The novel IncP-9 primer-system targeting the rep gene of nine IncP-9 subgroups allowed the detection of a high diversity of IncP-9 plasmid specific sequences in environments with different sources of pollution. Thus polluted sites are “hot spots” of plasmids potentially carrying catabolic genes. PMID:24587126
Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W
2010-08-01
The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.
Reddy, Kotla S; Rashmi, Brabhi R; Dechamma, Hosur J; Gopalakrishna, Susarla; Banumathi, N; Suryanarayana, Veluvarthy V S; Reddy, Golla R
2012-05-01
Foot and mouth disease (FMD) can be controlled by regular vaccination and restriction of the movement of infected animals in the endemic countries. Although presently used, tissue culture inactivated vaccine gives protection, it has several limitations, including a short duration of immunity. DNA vaccine delivered through microparticles could comprise an alternative approach to conventional vaccine when aiming to circumvent these limitations. We constructed the expression plasmid (pVAC-1D) containing 1D gene FMD virus serotype Asia 1. Poly(D,L-lactide-co-glycolide) (PLG) microparticles were prepared and coated with the pVAC-1D plasmid. Guinea pigs were vaccinated with PLG-coated and naked DNA vaccine constructs intramuscularly. The humoral response was measured by an enzyme-linked immunosorbent assay (ELISA) and the serum neutralization test (SNT). Analysis of the persistence and the expression of pVAC-1D plasmid construct was carried out by quantitative polymerase chain reaction (qPCR). The humoral response lasted for 1 year, as measured by ELISA and SNT. Analysis of the persistence and the expression of pVAC-1D plasmid construct by qPCR has shown that pVAC-1D expression was seen for a longer duration compared to the naked DNA vaccine. Microparticles coated plasmid DNA-injected guinea pigs were protected when challenged with FMD virus. The present study has shown that the delivery of plasmid coated on cationic PLG microparticles enhance the duration of immunity of the DNA vaccine constructs. Copyright © 2012 John Wiley & Sons, Ltd.
Vecchiarelli, Anthony G.; Hwang, Ling Chin; Mizuuchi, Kiyoshi
2013-01-01
Increasingly diverse types of cargo are being found to be segregated and positioned by ParA-type ATPases. Several minimalistic systems described in bacteria are self-organizing and are known to affect the transport of plasmids, protein machineries, and chromosomal loci. One well-studied model is the F plasmid partition system, SopABC. In vivo, SopA ATPase forms dynamic patterns on the nucleoid in the presence of the ATPase stimulator, SopB, which binds to the sopC site on the plasmid, demarcating it as the cargo. To understand the relationship between nucleoid patterning and plasmid transport, we established a cell-free system to study plasmid partition reactions in a DNA-carpeted flowcell. We observed depletion zones of the partition ATPase on the DNA carpet surrounding partition complexes. The findings favor a diffusion-ratchet model for plasmid motion whereby partition complexes create an ATPase concentration gradient and then climb up this gradient toward higher concentrations of the ATPase. Here, we report on the dynamic properties of the Sop system on a DNA-carpet substrate, which further support the proposed diffusion-ratchet mechanism. PMID:23479605
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, L.E.; Detter, C,; Barrie, K.
2006-06-01
Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less
An improved method for large-scale preparation of negatively and positively supercoiled plasmid DNA.
Barth, Marita; Dederich, Debra; Dedon, Peter
2009-07-01
A rigorous understanding of the biological function of superhelical tension in cellular DNA requires the development of new tools and model systems for study. To this end, an ethidium bromide[#x02013]free method has been developed to prepare large quantities of either negatively or positively super-coiled plasmid DNA. The method is based upon the known effects of ionic strength on the direction of binding of DNA to an archaeal histone, rHMfB, with low and high salt concentrations leading to positive and negative DNA supercoiling, respectively. In addition to fully optimized conditions for large-scale (>500 microg) supercoiling reactions, the method is advantageous in that it avoids the use of mutagenic ethidium bromide, is applicable to chemically modified plasmid DNA substrates, and produces both positively and negatively supercoiled DNA using a single set of reagents.
Zheng, Huabao; Wang, Xuan; Yomano, Lorraine P.; Shanmugam, Keelnatham T.
2012-01-01
Furfural is an inhibitory side product formed during the depolymerization of hemicellulose by mineral acids. Genomic libraries from three different bacteria (Bacillus subtilis YB886, Escherichia coli NC3, and Zymomonas mobilis CP4) were screened for genes that conferred furfural resistance on plates. Beneficial plasmids containing the thyA gene (coding for thymidylate synthase) were recovered from all three organisms. Expression of this key gene in the de novo pathway for dTMP biosynthesis improved furfural resistance on plates and during fermentation. A similar benefit was observed by supplementation with thymine, thymidine, or the combination of tetrahydrofolate and serine (precursors for 5,10-methylenetetrahydrofolate, the methyl donor for ThyA). Supplementation with deoxyuridine provided a small benefit, and deoxyribose was of no benefit for furfural tolerance. A combination of thymidine and plasmid expression of thyA was no more effective than either alone. Together, these results demonstrate that furfural tolerance is increased by approaches that increase the supply of pyrimidine deoxyribonucleotides. However, ThyA activity was not directly affected by the addition of furfural. Furfural has been previously shown to damage DNA in E. coli and to activate a cellular response to oxidative damage in yeast. The added burden of repairing furfural-damaged DNA in E. coli would be expected to increase the cellular requirement for dTMP. Increased expression of thyA (E. coli, B. subtilis, or Z. mobilis), supplementation of cultures with thymidine, and supplementation with precursors for 5,10-methylenetetrahydrofolate (methyl donor) are each proposed to increase furfural tolerance by increasing the availability of dTMP for DNA repair. PMID:22504824
Zheng, Huabao; Wang, Xuan; Yomano, Lorraine P; Shanmugam, Keelnatham T; Ingram, Lonnie O
2012-06-01
Furfural is an inhibitory side product formed during the depolymerization of hemicellulose by mineral acids. Genomic libraries from three different bacteria (Bacillus subtilis YB886, Escherichia coli NC3, and Zymomonas mobilis CP4) were screened for genes that conferred furfural resistance on plates. Beneficial plasmids containing the thyA gene (coding for thymidylate synthase) were recovered from all three organisms. Expression of this key gene in the de novo pathway for dTMP biosynthesis improved furfural resistance on plates and during fermentation. A similar benefit was observed by supplementation with thymine, thymidine, or the combination of tetrahydrofolate and serine (precursors for 5,10-methylenetetrahydrofolate, the methyl donor for ThyA). Supplementation with deoxyuridine provided a small benefit, and deoxyribose was of no benefit for furfural tolerance. A combination of thymidine and plasmid expression of thyA was no more effective than either alone. Together, these results demonstrate that furfural tolerance is increased by approaches that increase the supply of pyrimidine deoxyribonucleotides. However, ThyA activity was not directly affected by the addition of furfural. Furfural has been previously shown to damage DNA in E. coli and to activate a cellular response to oxidative damage in yeast. The added burden of repairing furfural-damaged DNA in E. coli would be expected to increase the cellular requirement for dTMP. Increased expression of thyA (E. coli, B. subtilis, or Z. mobilis), supplementation of cultures with thymidine, and supplementation with precursors for 5,10-methylenetetrahydrofolate (methyl donor) are each proposed to increase furfural tolerance by increasing the availability of dTMP for DNA repair.
Conjugative DNA Transfer Is Enhanced by Plasmid R1 Partitioning Proteins
Gruber, Christian J.; Lang, Silvia; Rajendra, Vinod K. H.; Nuk, Monika; Raffl, Sandra; Schildbach, Joel F.; Zechner, Ellen L.
2016-01-01
Bacterial conjugation is a form of type IV secretion used to transport protein and DNA directly to recipient bacteria. The process is cell contact-dependent, yet the mechanisms enabling extracellular events to trigger plasmid transfer to begin inside the cell remain obscure. In this study of plasmid R1 we investigated the role of plasmid proteins in the initiation of gene transfer. We find that TraI, the central regulator of conjugative DNA processing, interacts physically, and functionally with the plasmid partitioning proteins ParM and ParR. These interactions stimulate TraI catalyzed relaxation of plasmid DNA in vivo and in vitro and increase ParM ATPase activity. ParM also binds the coupling protein TraD and VirB4-like channel ATPase TraC. Together, these protein-protein interactions probably act to co-localize the transfer components intracellularly and promote assembly of the conjugation machinery. Importantly these data also indicate that the continued association of ParM and ParR at the conjugative pore is necessary for plasmid transfer to start efficiently. Moreover, the conjugative pilus and underlying secretion machinery assembled in the absence of Par proteins mediate poor biofilm formation and are completely dysfunctional for pilus specific R17 bacteriophage uptake. Thus, functional integration of Par components at the interface of relaxosome, coupling protein, and channel ATPases appears important for an optimal conformation and effective activation of the transfer machinery. We conclude that low copy plasmid R1 has evolved an active segregation system that optimizes both its vertical and lateral modes of dissemination. PMID:27486582
Reschner, Anca; Scohy, Sophie; Vandermeulen, Gaëlle; Daukandt, Marc; Jacques, Céline; Michel, Benjamin; Nauwynck, Hans; Xhonneux, Florence; Préat, Véronique; Vanderplasschen, Alain; Szpirer, Cédric
2013-01-01
The appearance of new viruses and the cost of developing certain vaccines require that new vaccination strategies now have to be developed. DNA vaccination seems to be a particularly promising method. For this application, plasmid DNA is injected into the subject (man or animal). This plasmid DNA encodes an antigen that will be expressed by the cells of the subject. In addition to the antigen, the plasmid also encodes a resistance to an antibiotic, which is used during the construction and production steps of the plasmid. However, regulatory agencies (FDA, USDA and EMA) recommend to avoid the use of antibiotics resistance genes. Delphi Genetics developed the Staby® technology to replace the antibiotic-resistance gene by a selection system that relies on two bacterial genes. These genes are small in size (approximately 200 to 300 bases each) and consequently encode two small proteins. They are naturally present in the genomes of bacteria and on plasmids. The technology is already used successfully for production of recombinant proteins to achieve higher yields and without the need of antibiotics. In the field of DNA vaccines, we have now the first data validating the innocuousness of this Staby® technology for eukaryotic cells and the feasibility of an industrial production of an antibiotic-free DNA vaccine. Moreover, as a proof of concept, mice have been successfully vaccinated with our antibiotic-free DNA vaccine against a deadly disease, pseudorabies (induced by Suid herpesvirus-1). PMID:24051431
Reschner, Anca; Scohy, Sophie; Vandermeulen, Gaëlle; Daukandt, Marc; Jacques, Céline; Michel, Benjamin; Nauwynck, Hans; Xhonneux, Florence; Préat, Véronique; Vanderplasschen, Alain; Szpirer, Cédric
2013-10-01
The appearance of new viruses and the cost of developing certain vaccines require that new vaccination strategies now have to be developed. DNA vaccination seems to be a particularly promising method. For this application, plasmid DNA is injected into the subject (man or animal). This plasmid DNA encodes an antigen that will be expressed by the cells of the subject. In addition to the antigen, the plasmid also encodes a resistance to an antibiotic, which is used during the construction and production steps of the plasmid. However, regulatory agencies (FDA, USDA and EMA) recommend to avoid the use of antibiotics resistance genes. Delphi Genetics developed the Staby(®) technology to replace the antibiotic-resistance gene by a selection system that relies on two bacterial genes. These genes are small in size (approximately 200 to 300 bases each) and consequently encode two small proteins. They are naturally present in the genomes of bacteria and on plasmids. The technology is already used successfully for production of recombinant proteins to achieve higher yields and without the need of antibiotics. In the field of DNA vaccines, we have now the first data validating the innocuousness of this Staby(®) technology for eukaryotic cells and the feasibility of an industrial production of an antibiotic-free DNA vaccine. Moreover, as a proof of concept, mice have been successfully vaccinated with our antibiotic-free DNA vaccine against a deadly disease, pseudorabies (induced by Suid herpesvirus-1).
Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J
1992-01-01
Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052
Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J
1999-03-05
DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.
Assessing the biocompatibility of click-linked DNA in Escherichia coli
Sanzone, A. Pia; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali
2012-01-01
The biocompatibility of a triazole mimic of the DNA phosphodiester linkage in Escherichia coli has been evaluated. The requirement for selective pressure on the click-containing gene was probed via a plasmid containing click DNA backbone linkages in each strand of the gene encoding the fluorescent protein mCherry. The effect of proximity of the click linkers on their biocompatibility was also probed by placing two click DNA linkers 4-bp apart at the region encoding the fluorophore of the fluorescent protein. The resulting click-containing plasmid was found to encode mCherry in E. coli at a similar level to the canonical equivalent. The ability of the cellular machinery to read through click-linked DNA was further probed by using the above click-linked plasmid to express mCherry using an in vitro transcription/translation system, and found to also be similar to that from canonical DNA. The yield and fluorescence of recombinant mCherry expressed from the click-linked plasmid was also compared to that from the canonical equivalent, and found to be the same. The biocompatibility of click DNA ligation sites at close proximity in a non-essential gene demonstrated in E. coli suggests the possibility of using click DNA ligation for the enzyme-free assembly of chemically modified genes and genomes. PMID:22904087
Ni, Lisheng; Jensen, Slade O; Ky Tonthat, Nam; Berg, Tracey; Kwong, Stephen M; Guan, Fiona H X; Brown, Melissa H; Skurray, Ronald A; Firth, Neville; Schumacher, Maria A
2009-11-01
Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partition are critical to the dissemination and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized DNA-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA bound to its cognate operator, ACATGACATG. The structure reveals that ArtA is representative of a new family of ribbon-helix-helix (RHH) DNA-binding proteins that contain extended, N-terminal basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by binding as a dimer-of-dimers and the extended N-terminal regions of ArtA were shown to be essential for this dimer-of-dimer binding mode. Thus, these data indicate that ArtA is a master regulator of genes critical for both horizontal and vertical transmission of pSK41 and that it can recognize DNA utilizing alternate binding modes.
Ni, Lisheng; Jensen, Slade O.; Ky Tonthat, Nam; Berg, Tracey; Kwong, Stephen M.; Guan, Fiona H. X.; Brown, Melissa H.; Skurray, Ronald A.; Firth, Neville; Schumacher, Maria A.
2009-01-01
Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partition are critical to the dissemination and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized DNA-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA bound to its cognate operator, ACATGACATG. The structure reveals that ArtA is representative of a new family of ribbon–helix–helix (RHH) DNA-binding proteins that contain extended, N-terminal basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by binding as a dimer-of-dimers and the extended N-terminal regions of ArtA were shown to be essential for this dimer-of-dimer binding mode. Thus, these data indicate that ArtA is a master regulator of genes critical for both horizontal and vertical transmission of pSK41 and that it can recognize DNA utilizing alternate binding modes. PMID:19759211
O'Mahony, Kevin; Freitag, Ruth; Hilbrig, Frank; Müller, Patrick; Schumacher, Ivo
2005-09-23
The paper addresses the question of how to achieve bacterial lysis in large-scale plasmid DNA production processes, where conventional alkaline lysis may become awkward to handle. Bacteria were grown in shaker flasks and a bioreactor. Suboptimal growth conditions were found advantageous for stable plasmid production at high copy numbers (up to 25mg/L could be achieved). Cells were harvested by filtration in the presence of a filter aid. A linear relationship between the biomass and the optimal filter aid concentration in terms of back pressure could be established. Bacteria-containing filter cakes were washed with isotonic buffer and lysis was achieved in situ by a two-step protocol calling for fragilisation of the cells followed by heat lysis in a suitable buffer. RNA and other soluble cell components where washed out of the cake during this step, while the plasmid DNA was retained. Afterwards a clear lysate containing relatively pure plasmid DNA could be eluted from the cake mostly as the desired supercoiled topoisomer, while cell debris and genomic DNA were retained. Lysis is, thus, integrated not only with cell capture but also with a significant degree of isolation/purification, as most impurities were considerably reduced during the procedure.
Tolmachov, Oleg E
2010-04-01
Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.
Effects of different cytokines on immune responses of rainbow trout in a virus DNA vaccination model
Cao, Yongsheng; Zhang, Qiya; Xu, Liming; Li, Shaowu; Wang, Di; Zhao, Jingzhuang; Liu, Hongbai; Feng, Jian; Lu, Tongyan
2017-01-01
Seven rainbow trout cytokine genes (interleukin (IL)-2, IL-8, IL-15, IL-17, IL-1β, intracellular interferon (iIFN) 1a, and IFN-γ2) were evaluated for their adjuvant effects on a DNA vaccine, called pG, containing the glycoprotein gene of infectious hematopoietic necrosis virus (IHNV). Distinct DNA constructs in expression plasmid pcDNA3.1 encoding a cytokine gene were generated. Immunofluorescence assays in rainbow trout gonadal cells demonstrated successful protein expression from all these constructs. Subsequently, fish were immunized with pG alone or together with a cytokine expression plasmid. Results showed that each cytokine plasmids at an appropriate dose showed notable effects on immune gene expression. IL-17 and IFN-γ2 can enhance early specific IgM response. All cytokines, except IL-8, can benefit initial neutralizing antibody (NAb) titers. At 35 days post immunization (dpi), NAb titers of fish immunized with pG and IL-2, iIFN1a, or IFN-γ2 plasmids remained at high levels (1:160). NAb titers of fish immunized with pG alone decreased to 1:40. IL-8 or IL-1β can enhance antigen-specific proliferative T-cell responses at 14 dpi. At 28 dpi, coinjection of pG with IL-2, IL-8, IL-15, or IL-17 plasmids induced considerably stronger lymphocyte proliferation than that with injection of pG alone. All cytokine plasmids delivered with pG plasmid enhanced protection of trout against IHNV-mediated mortality. These results indicate that the type and dose of trout cytokine genes injected into fish affect quality of immune response to DNA vaccination. PMID:29348820
High-throughput assays for DNA gyrase and other topoisomerases
Maxwell, Anthony; Burton, Nicolas P.; O'Hagan, Natasha
2006-01-01
We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format. PMID:16936317
High-throughput assays for DNA gyrase and other topoisomerases.
Maxwell, Anthony; Burton, Nicolas P; O'Hagan, Natasha
2006-01-01
We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format.
Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R
2004-07-01
The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.
Munseri, Patricia J; Kroidl, Arne; Nilsson, Charlotta; Joachim, Agricola; Geldmacher, Christof; Mann, Philipp; Moshiro, Candida; Aboud, Said; Lyamuya, Eligius; Maboko, Leonard; Missanga, Marco; Kaluwa, Bahati; Mfinanga, Sayoki; Podola, Lilly; Bauer, Asli; Godoy-Ramirez, Karina; Marovich, Mary; Moss, Bernard; Hoelscher, Michael; Gotch, Frances; Stöhr, Wolfgang; Stout, Richard; McCormack, Sheena; Wahren, Britta; Mhalu, Fred; Robb, Merlin L; Biberfeld, Gunnel; Sandström, Eric; Bakari, Muhammad
2015-01-01
Intradermal priming with HIV-1 DNA plasmids followed by HIV-1MVA boosting induces strong and broad cellular and humoral immune responses. In our previous HIVIS-03 trial, we used 5 injections with 2 pools of HIV-DNA at separate sites for each priming immunization. The present study explores whether HIV-DNA priming can be simplified by reducing the number of DNA injections and administration of combined versus separated plasmid pools. In this phase IIa, randomized trial, priming was performed using 5 injections of HIV-DNA, 1000 μg total dose, (3 Env and 2 Gag encoding plasmids) compared to two "simplified" regimens of 2 injections of HIV-DNA, 600 μg total dose, of Env- and Gag-encoding plasmid pools with each pool either administered separately or combined. HIV-DNA immunizations were given intradermally at weeks 0, 4, and 12. Boosting was performed intramuscularly with 108 pfu HIV-MVA at weeks 30 and 46. 129 healthy Tanzanian participants were enrolled. There were no differences in adverse events between the groups. The proportion of IFN-γ ELISpot responders to Gag and/or Env peptides after the second HIV-MVA boost did not differ significantly between the groups primed with 2 injections of combined HIV-DNA pools, 2 injections with separated pools, and 5 injections with separated pools (90%, 97% and 97%). There were no significant differences in the magnitude of Gag and/or Env IFN-γ ELISpot responses, in CD4+ and CD8+ T cell responses measured as IFN-γ/IL-2 production by intracellular cytokine staining (ICS) or in response rates and median titers for binding antibodies to Env gp160 between study groups. A simplified intradermal vaccination regimen with 2 injections of a total of 600 μg with combined HIV-DNA plasmids primed cellular responses as efficiently as the standard regimen of 5 injections of a total of 1000 μg with separated plasmid pools after boosting twice with HIV-MVA. World Health Organization International Clinical Trials Registry Platform PACTR2010050002122368.
Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J
2016-01-01
Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and fluid obtained from metal implant sites.
DNAVaxDB: the first web-based DNA vaccine database and its data analysis
2014-01-01
Since the first DNA vaccine studies were done in the 1990s, thousands more studies have followed. Here we report the development and analysis of DNAVaxDB (http://www.violinet.org/dnavaxdb), the first publically available web-based DNA vaccine database that curates, stores, and analyzes experimentally verified DNA vaccines, DNA vaccine plasmid vectors, and protective antigens used in DNA vaccines. All data in DNAVaxDB are annotated from reliable resources, particularly peer-reviewed articles. Among over 140 DNA vaccine plasmids, some plasmids were more frequently used in one type of pathogen than others; for example, pCMVi-UB for G- bacterial DNA vaccines, and pCAGGS for viral DNA vaccines. Presently, over 400 DNA vaccines containing over 370 protective antigens from over 90 infectious and non-infectious diseases have been curated in DNAVaxDB. While extracellular and bacterial cell surface proteins and adhesin proteins were frequently used for DNA vaccine development, the majority of protective antigens used in Chlamydophila DNA vaccines are localized to the inner portion of the cell. The DNA vaccine priming, other vaccine boosting vaccination regimen has been widely used to induce protection against infection of different pathogens such as HIV. Parasitic and cancer DNA vaccines were also systematically analyzed. User-friendly web query and visualization interfaces are available in DNAVaxDB for interactive data search. To support data exchange, the information of DNA vaccines, plasmids, and protective antigens is stored in the Vaccine Ontology (VO). DNAVaxDB is targeted to become a timely and vital source of DNA vaccines and related data and facilitate advanced DNA vaccine research and development. PMID:25104313
Allison, J; Hall, L; MacIntyre, I; Craig, R K
1981-01-01
(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146
Almeida, A M; Queiroz, J A; Sousa, F; Sousa, A
2015-01-26
The progress of DNA vaccines is dependent on the development of suitable chromatographic procedures to successfully purify genetic vectors, such as plasmid DNA. Human Papillomavirus is associated with the development of tumours due to the oncogenic power of E6 and E7 proteins, produced by this virus. The supercoiled HPV-16 E6/E7 plasmid-based vaccine was recently purified with the arginine monolith, with 100% of purity, but only 39% of recovery was achieved. Therefore, the present study describes the application of experimental design tools, a newly explored methodology in preparative chromatography, in order to improve the supercoiled plasmid DNA recovery with the arginine monolith, maintaining the high purity degree. In addition, the importance and influence of pH in the pDNA retention to the arginine ligand was also demonstrated. The Composite Central Face design was validated and the recovery of the target molecule was successfully improved from 39% to 83.5%, with an outstanding increase of more than double, while maintaining 100% of purity. Copyright © 2014 Elsevier B.V. All rights reserved.
SAXS Study of Sterically Stabilized Lipid Nanocarriers Functionalized by DNA
NASA Astrophysics Data System (ADS)
Angelov, Borislav; Angelova, Angelina; Filippov, Sergey; Karlsson, Göran; Terrill, Nick; Lesieur, Sylviane; Štěpánek, Petr
2012-03-01
The structure of novel spontaneously self-assembled plasmid DNA/lipid complexes is investigated by means of synchrotron radiation small-angle X-ray scattering (SAXS) and Cryo-TEM imaging. Liquid crystalline (LC) hydrated lipid systems are prepared using the non-ionic lipids monoolein and DOPE-PEG2000 and the cationic amphiphile CTAB. The employed plasmid DNA (pDNA) is encoding for the human protein brain-derived neurotrophic factor (BDNF). A coexistence of nanoparticulate objects with different LC inner organizations is established. A transition from bicontinuous membrane sponges, cubosome intermediates and unilamelar liposomes to multilamellar vesicles, functionalized by pDNA, is favoured upon binding and compaction of pBDNF onto the cationic PEGylated lipid nanocarriers. The obtained sterically stabilized multicompartment nanoobjects, with confined supercoiled plasmid DNA (pBDNF), are important in the context of multicompartment lipid nanocarriers of interest for gene therapy of neurodegenerative diseases.
Theethakaew, Chonchanok; Nakamura, Shota; Motooka, Daisuke; Matsuda, Shigeaki; Kodama, Toshio; Chonsin, Kaknokrat; Suthienkul, Orasa; Iida, Tetsuya
2017-07-01
Vibrio parahaemolyticus is a causative agent of acute hapatopancreatic necrosis syndrome (AHPNS) which causes early mortality in white shrimp. Emergence of AHPNS has caused tremendous economic loss for aquaculture industry particularly in Asia since 2010. Previous studies reported that strains causing AHPNS harbor a 69-kb plasmid with possession of virulence genes, pirA and pirB. However, genetic variation of the 69-kb plasmid among AHPNS related strains has not been investigated. This study aimed to analyze genetic composition and diversity of the 69-kb plasmid in strains isolated from shrimps affected by AHPNS. Plasmids recovered from V. parahaemolyticus strain VPE61 which represented typical AHPNS pathogenicity, strain VP2HP which did not represent AHPNS pathogenicity but was isolated from AHPNS affected shrimp and other AHPNS V. parahaemolyticus isolates in Genbank were investigated. Protein coding genes of the 69-kb plasmid from the strain VPE61 were identical to that of AHPNS strain from Vietnam except the inverted complement 3.4-kb transposon covering pirA and pirB. The strain VP2HP possessed remarkable large 183-kb plasmid which shared similar protein coding genes to those of the 69-kb plasmid from strain VPE61. However, the 3.4-kb transposon covering pirA and pirB was absent from the 183-kb plasmid in strain VP2HP. A number of protein coding genes from the 183-kb plasmid were also detected in other AHPNS strains. In summary, this study identified a novel 183-kb plasmid that is related to AHPNS causing strains. Homologous recombination of the 69-kb AHPNS plasmid and other naturally occurring plasmids together with loss and gain of AHPNS virulence genes in V. parahaemolyticus were observed. The outcome of this research enables understanding of plasmid dynamics that possibly affect variable degrees of AHPNS pathogenicity. Copyright © 2017 Elsevier B.V. All rights reserved.
Yu, Zhen; Chung, Woon-Gye; Sloat, Brian R.; Löhr, Christiane V.; Weiss, Richard; Rodriguez, B. Leticia; Li, Xinran; Cui, Zhengrong
2011-01-01
Objectives Non-invasive immunization by applying plasmid DNA topically onto the skin is an attractive immunization approach. However, the immune responses induced are generally weak. Previously, we showed that the antibody responses induced by topical DNA vaccine were significantly enhanced when hair follicles in the application area were induced into anagen (growth) stage by hair plucking. In the present study, we further investigated the mechanism of immune enhancement. Methods Three different methods, hair plucking or treatment with retinoic acid (RA) or O- tetradecanoylphorbol-13-acetate (TPA), were used to induce hair follicles into anagen stage before mice were dosed with a β-galactosidase-encoding plasmid, and the specific antibody responses induced were evaluated. Key findings The hair plucking method was more effective at enhancing the resultant antibody responses. Treatment with RA or TPA caused more damages to the skin and induced more severe local inflammations than hair plucking. However, hair plucking was most effective at enhancing the uptake or retention of the DNA in the application area. Conclusions The uptake of plasmid DNA in the application area correlated with the antibody responses induced by a topically applied DNA. PMID:21235583
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yagi, T.; Tatsumi-Miyajima, J.; Sato, M.
1991-06-15
To assess the contribution to mutagenesis by human DNA repair defects, a UV-treated shuttle vector plasmid, pZ189, was passed through fibroblasts derived from Japanese xeroderma pigmentosum (XP) patients in two different DNA repair complementation groups (A and F). Patients with XP have clinical and cellular UV hypersensitivity, increased frequency of skin cancer, and defects in DNA repair. The XP DNA repair defects represented by complementation groups A (XP-A) and F (XP-F) are more common in Japan than in Europe or the United States. In comparison to results with DNA repair-proficient human cells (W138-VA13), UV-treated pZ189 passed through the XP-A (XP2OS(SV))more » or XP-F (XP2YO(SV)) cells showed fewer surviving plasmids (XP-A less than XP-F) and a higher frequency of mutated plasmids (XP-A greater than XP-F). Base sequence analysis of more than 200 mutated plasmids showed the major type of base substitution mutation to be the G:C----A:T transition with all three cell lines. The XP-A and XP-F cells revealed a higher frequency of G:C----A:T transitions and a lower frequency of transversions among plasmids with single or tandem mutations and a lower frequency of plasmids with multiple point mutations compared to the normal line. The spectrum of mutations in pZ189 with the XP-A cells was similar to that with the XP-F cells. Seventy-six to 91% of the single base substitution mutations occurred at G:C base pairs in which the 5{prime}-neighboring base of the cytosine was thymine or cytosine. These studies indicate that the DNA repair defects in Japanese XP patients in complementation groups A and F result in different frequencies of plasmid survival and mutagenesis but in similar types of mutagenic abnormalities despite marked differences in clinical features.« less
Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete
2004-09-09
We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.
Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.
2004-01-01
We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966
Elimination of the cryptic plasmid in Leuconostoc citreum by CRISPR/Cas9 system.
Jang, Ye-Ji; Seo, Seung-Oh; Kim, Seul-Ah; Li, Ling; Kim, Tae-Jip; Kim, Sun Chang; Jin, Yong-Su; Han, Nam Soo
2017-06-10
Leuconostoc spp. are important lactic acid bacteria for the fermentation of foods. In particular, L. citreum strains isolated from various foods have been used as host strains for genetic and metabolic engineering studies. In order to develop a food-grade genetic engineering system, L. citreum CB2567 was isolated from Kimchi. However, the isolated bacterium contained a cryptic plasmid which was difficult to eliminate. As the existence of the plasmid might hinder strain engineering, we eliminated the plasmid using an RNA-guided DNA endonuclease CRISPR/Cas9 system. We demonstrated that a plasmid-free L. citreum CB2567 host strain could be efficiently constructed through a two-step procedure: 1) transformation of the "killer" plasmid expressing Cas9 endonuclease and a guide RNA (gRNA) targeting for a specific sequence in the cryptic plasmid, and 2) serial subculture without antibiotics for curing the killer plasmid. When the crude extract of L. citreum expressing Cas9 and the guide RNA was incubated with a PCR fragment containing the specific sequence recognized by the guide RNA, the PCR fragment was cleaved. Also, the cryptic plasmid pCB42 was successfully eliminated from the host strain after transforming the plasmid harboring Cas9 and the guide RNA. The Cas9 and gRNA expression plasmid used in this study can be applied for genome engineering purposes by additionally introducing an editing DNA template to repair the double strand DNA breakage caused by Cas9 in the genome of L. citreum. This study demonstrates the feasibility of developing CRISPR/Cas9-based genetic engineering tools to develop a safe host strain and construct food-grade lactic acid bacteria without residual antibiotic markers. Copyright © 2017 Elsevier B.V. All rights reserved.
A quantitative and high-throughput assay of human papillomavirus DNA replication.
Gagnon, David; Fradet-Turcotte, Amélie; Archambault, Jacques
2015-01-01
Replication of the human papillomavirus (HPV) double-stranded DNA genome is accomplished by the two viral proteins E1 and E2 in concert with host DNA replication factors. HPV DNA replication is an established model of eukaryotic DNA replication and a potential target for antiviral therapy. Assays to measure the transient replication of HPV DNA in transfected cells have been developed, which rely on a plasmid carrying the viral origin of DNA replication (ori) together with expression vectors for E1 and E2. Replication of the ori-plasmid is typically measured by Southern blotting or PCR analysis of newly replicated DNA (i.e., DpnI digested DNA) several days post-transfection. Although extremely valuable, these assays have been difficult to perform in a high-throughput and quantitative manner. Here, we describe a modified version of the transient DNA replication assay that circumvents these limitations by incorporating a firefly luciferase expression cassette in cis of the ori. Replication of this ori-plasmid by E1 and E2 results in increased levels of firefly luciferase activity that can be accurately quantified and normalized to those of Renilla luciferase expressed from a control plasmid, thus obviating the need for DNA extraction, digestion, and analysis. We provide a detailed protocol for performing the HPV type 31 DNA replication assay in a 96-well plate format suitable for small-molecule screening and EC50 determinations. The quantitative and high-throughput nature of the assay should greatly facilitate the study of HPV DNA replication and the identification of inhibitors thereof.
Characterization of a periplasmic S1-like nuclease coded by the Mesorhizobium loti symbiosis island
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pimkin, Maxim; Miller, C. Glenn; Blakesley, Lauryn
DNA sequences encoding hypothetical proteins homologous to S1 nuclease from Aspergillus oryzae are found in many organisms including fungi, plants, pathogenic bacteria, and eukaryotic parasites. One of these is the M1 nuclease of Mesorhizobium loti which we demonstrate herein to be an enzymatically active, soluble, and stable S1 homolog that lacks the extensive mannosyl-glycosylation found in eukaryotic S1 nuclease homologs. We have expressed the cloned M1 protein in M. loti and purified recombinant native M1 to near homogeneity and have also isolated a homogeneous M1 carboxy-terminal hexahistidine tag fusion protein. Mass spectrometry and N-terminal Edman degradation sequencing confirmed the proteinmore » identity. The enzymatic properties of the purified M1 nuclease are similar to those of S1. At acidic pH M1 is 25 times more active on single-stranded DNA than on double-stranded DNA and 3 times more active on single-stranded DNA than on single-stranded RNA. At neutral pH the RNase activity of M1 exceeds the DNase activity. M1 nicks supercoiled RF-I plasmid DNA and rapidly cuts the phosphodiester bond across from the nick in the resultant relaxed RF-II plasmid DNA. Therefore, M1 represents an active bacterial S1 homolog in spite of great sequence divergence. The biochemical characterization of M1 nuclease supports our sequence alignment that reveals the minimal 21 amino acid residues that are necessarily conserved for the structure and functions of this enzyme family. The ability of M1 to degrade RNA at neutral pH implies previously unappreciated roles of these nucleases in biological systems.« less
Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.
Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C
1997-01-01
We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus. PMID:9097439
Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.
Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C
1997-04-01
We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus.
Sakurai, Rakusa; Nomura, Hideo; Moriyam, Yohsuke; Kawano, Shigeyuki
2004-08-01
Mitochondrial DNA (mtDNA) is inherited maternally in most eukaryotes. Linear mitochondrial plasmids in higher plants and fungi are also transmitted from the maternal parent to the progeny. However, mF, which is a mitochondrial linear plasmid of Physarum polycephalum, evades uniparental mitochondrial inheritance. We examined 36 myxamoebal strains of Physarum and isolated three novel mF+ strains (JE8, TU111, NG111) that harbored free mF plasmids. These strains were mated with the mF- strain KM88. Of the three mF- x mF+ crosses, only KM88 x JE8 displayed complete uniparental inheritance. However, in KM88 x TU111 and KM88 x NG111, the mtDNA of KM88 and mF of TU111 and NG111 were inherited by the plasmodia and showed recombination. For example, although the mtDNA of TU111 was eliminated, the mF of TU111 persisted and became inserted into the mtDNA of KM88, such that recombinant mtDNA represented 80% of the total mtDNA. The parental mitochondria fused to yield giant mitochondria with two or more mitochondrial nucleoids. The mF appears to exchange mitochondria from the recipient (paternal) to the donor (maternal) by promoting mitochondrial fusion.
[The plasmid profile of Neisseria meningitidis strains].
Khetsuriani, K G; Namgaladze, M Z; Lomsadze, Kh V; Kakuberi, D R
1993-01-01
The distribution of plasmids in N. meningitidis strains according to their origin and serological groups has been studied. Plasmids have been discovered in N. meningitidis of all groups, plasmid-carrying strains constituting 55% of strains isolated from healthy carriers and 46.2% of strains isolated from patients. The molecular weight of N. meningitidis plasmid DNA varies from 2.9 MD to 95 MD.
Grote, Mathias
2008-01-01
Plasmids are non-chromosomal hereditary determinants, mostly found in prokaryotes. Whereas Joshua Lederberg coined the term "plasmid" as early as 1952, today's concept was not established until the early 1970s. In this eclipse period, the plasmid's place was taken by the episome, following the 1958 publication of Elie Wollman and François Jacob. This paper analyzes the transition from the episome to a renewed plasmid concept both on the experimental and the conceptual level. It will become clear that intergeneric transfer experiments were central to this development. These studies rely on conjugational transfer of extrachromosomal hereditary determinants between different bacterial genera. First, experimental systems employing intergeneric transfer shaped the new plasmid by enabling its representation as a species of circular DNA. Moreover, they had a destabilizing effect on the episome, leading to a crisis in the concepts of microbial genetics towards the end of the 1960s. The new plasmid then became one of the cornerstones of recombinant DNA technologies. In an historic perspective, intergeneric transfer experiments indicate a gradual transition of molecular biology from its early "analytic" to the "synthetic" phase of genetic engineering. Hence, the construction of genetic hybrids in vivo as epitomized in the studies shown here marks an intermediate state that one could designate as "recombinant DNA avant la lettre".
2016-01-08
Kan), and pBZ51 + pBZ52 (selected on Amp ) were grown overnight, and plasmid DNA was extracted and run on a 1% agarose gel. Cells co-transformed with...pBZ51 and pBZ52 were able to stably maintain both plasmids under Amp selection. SI Fig. 10 SI
Medicinal potential from in vivo and acclimatized plants of Cleome rosea.
Simões, Claudia; De Mattos, José Carlos P; Sabino, Kátia C C; Caldeira-de-Araújo, Adriano; Coelho, Marsen G P; Albarello, Norma; Figueiredo, Solange F L
2006-02-01
Methanolic extracts obtained from different organs of Cleome rosea, collected from its natural habitat and from in vitro-propagated plants, were submitted to in vitro biological assays. Inhibition of nitric oxide (NO) production by J774 macrophages and antioxidant effects by protecting the plasmid DNA from the SnCl(2)-induced damage were evaluated. Extracts from the stem of both origins and leaf of natural plants inhibited NO production. The plasmid DNA strand breaks induced by SnCl(2) were reduced by extracts from either leaf or stem of both sources. On the other hand, root extracts did not show any kind of effects on plasmid DNA, and presented significant toxic effects to J774 cells. The results showed that C. rosea presents medicinal potential and that the acclimatization process reduces the plant toxicity both to plasmid DNA and to J774 cells, suggesting the use of biotechnology tools to obtain elite plants as source of botanical material for pharmacological and phytochemical studies.
He, E; Yue, C Y; Simeon, F; Zhou, L H; Too, H P; Tam, K C
2009-12-01
Amphiphilic polyelectrolytes comprising cationic and uncharged hydrophilic segments condensed negatively charged DNA to form a core-shell structure stabilized by a layer of hydrophilic corona chains. At physiological pH, four-arm star-shaped poly(ethylene oxide)-b-poly(2-(diethylamino)ethyl methacrylate) (four-arm PEO-b-PDEAEMA) block copolymer possessed positively charged amine groups that interacted with negatively charged plasmid DNA to form polymer/DNA complexes. The mechanism and physicochemical properties of the complex formation were investigated at varying molar ratio of amine groups on polymer chains and phosphate group on plasmid DNA segments (N/P ratio). The capability of the star block copolymer to condense DNA was demonstrated through gel electrophoresis and ethidium bromide exclusion assay. In the absence of salt, the hydrodynamic radius of polyplexes was about 94 nm at low polymer/DNA ratio, and it decreased to about 34 nm at large N/P ratios, forming a compact spherical structure with a weighted average molecular weight of 4.39 +/- 0.22 x 10(6) g/mol. Approximately 15 polymeric chains were required to condense a plasmid DNA. The addition of monovalent salt to the polyplexes significantly altered the size of the complexes, which would have an impact on cell transfection. Because of the electrostatic interaction induced by the diffusion of small ions, the polyplex increased in size to about 53 nm with a less compact structure. In vitro cytotoxicty of polymer and polymer/pDNA complexes were evaluated, and the polyplexes exhibited low toxicity at low N/P ratios. At N/P ratio of 4.5, the four-arm PEO-b-PDEAEMA showed the highest level of transfection in Neuro-2A cells. These observations showed that the star-shaped multi-arm polymers offers interesting properties in self-association and condensation ability for plasmid DNA and can serve as a nonviral DNA delivery system. Copyright 2008 Wiley Periodicals, Inc.
Dong, Bo; Feng, Jing; Lin, Hai; Li, Lanxiang; Su, Dingding; Tu, Di; Zhu, Weijuan; Yang, Qing; Ren, Xiaofeng
2013-11-19
Porcine circovirus type 2 (PCV2) is associated with many kinds of diseases including postweaning multisystemic wasting syndrome (PMWS). It affects the immune system of swine and causes huge epidemic losses every year. In our previous study, we provided evidence that DNA plasmid bearing porcine IL-15 (pVAX-pIL-15) might serve as an immune enhancer for DNA plasmid encoding porcine reproductive and respiratory syndrome virus GP5 gene. In this study, PCV2 open reading frame (ORF)2 gene was cloned into the eukaryotic expression vector pVAX, resulting in the plasmid pVAX-PCV2-ORF2. Transient expression of the plasmid in BHK-21 cells could be detected using immunofluorescence assay. Experimental mice were divided into 5 groups and immunized with PBS, pVAX, pVAX-pIL-15, pVAX-PCV2-ORF2 or pVAX-pIL-15 plus pVAX-PCV2-ORF2. The results showed that the mice co-inoculated with pVAX-PCV2-ORF2 plus pVAX-pIL-15 had higher humoral and cellular immune responses than the others. In addition, DNA plasmid bearing PCV2 ORF2 gene had a protective effect against challenge with PCV2 in mice which could be promoted with the utilization of pIL-15. Copyright © 2013 Elsevier Ltd. All rights reserved.
Sentchilo, Vladimir S.; Perebituk, Alexander N.; Zehnder, Alexander J. B.; van der Meer, Jan Roelof
2000-01-01
Twenty different Pseudomonas strains utilizing m-toluate were isolated from oil-contaminated soil samples near Minsk, Belarus. Seventeen of these isolates carried plasmids ranging in size from 78 to about 200 kb (assigned pSVS plasmids) and encoding the meta cleavage pathway for toluene metabolism. Most plasmids were conjugative but of unknown incompatibility groups, except for one, which belonged to the IncP9 group. The organization of the genes for toluene catabolism was determined by restriction analysis and hybridization with xyl gene probes of pWW0. The majority of the plasmids carried xyl-type genes highly homologous to those of pWW53 and organized in a similar manner (M. T. Gallegos, P. A. Williams, and J. L. Ramos, J. Bacteriol. 179:5024–5029, 1997), with two distinguishable meta pathway operons, one upper pathway operon, and three xylS-homologous regions. All of these plasmids also possessed large areas of homologous DNA outside the catabolic genes, suggesting a common ancestry. Two other pSVS plasmids carried only one meta pathway operon, one upper pathway operon, and one copy each of xylS and xylR. The backbones of these two plasmids differed greatly from those of the others. Whereas these parts of the plasmids, carrying the xyl genes, were mostly conserved between plasmids of each group, the noncatabolic parts had undergone intensive DNA rearrangements. DNA sequencing of specific regions near and within the xylTE and xylA genes of the pSVS plasmids confirmed the strong homologies to the xyl genes of pWW53 and pWW0. However, several recombinations were discovered within the upper pathway operons of the pSVS plasmids and pWW0. The main genetic mechanisms which are thought to have resulted in the present-day configuration of the xyl operons are discussed in light of the diversity analysis carried out on the pSVS plasmids. PMID:10877777
DNA fusion product of phage P2 with plasmid pBR322 - A new phasmid
NASA Technical Reports Server (NTRS)
Nicoletti, M.; Bertani, G.
1983-01-01
The chromosome of the temperate bacteriophage P2 and that of the plasmid pBR322 have been joined in vitro after treatment with restriction endonuclease EcoRI. The fusion product - a phasmid - can behave as a plasmid, as a phage and as a prophage. It can replicate its DNA under the control of either the specific replication mechanism of the parent phage in a polA mutant or that of the parent plasmid in a rep mutant. Several interesting interactions between the two replication modes are indicated. In particular, phage particles may be produced even when the phage mode of DNA replication is blocked, and this throws new light on the involvement of the early gene A in the regulation of late gene expression in phage P2.
A multimodal histamine ligand for chromatographic purification of plasmid DNA.
Černigoj, Urh; Vidic, Urška; Barut, Miloš; Podgornik, Aleš; Peterka, Matjaž; Štrancar, Aleš
2013-03-15
To exploit different chromatographic modes for efficient plasmid DNA (pDNA) purification a novel monolithic chromatographic support bearing multimodal histamine (HISA) groups was developed and characterized. Electrostatic charge of HISA groups depends on the pH of the mobile phase, being neutral above pH 7 and becoming positively charged below. As a consequence, HISA groups exhibit predominantly ion-exchange character at low pH values, which decreases with titration of the HISA groups resulting in increased hydrophobicity. This feature enabled separation of supercoiled (sc) pDNA from other plasmid isoforms (and other process related impurities) by adjusting salt or pH gradient. The dynamic binding capacity (DBC) for a 5.1kbp large plasmid at pH 5 was 4.0 mg/ml under low salt binding conditions, remaining relatively high (3.0 mg/ml) even in the presence of 1.0 M NaCl due to the multimodal nature of HISA ligand. Only slightly lower DBC (2.7 mg/ml) was determined under preferentially hydrophobic conditions in 3.0 M (NH(4))(2)SO(4), pH 7.4. Open circular and sc pDNA isoforms were baseline separated in descending (NH(4))(2)SO(4) gradient. Furthermore, an efficient plasmid DNA separation was possible both on analytical as well as on preparative scale by applying the descending pH gradient at a constant concentration (above 3.0 M) of (NH(4))(2)SO(4). Copyright © 2013 Elsevier B.V. All rights reserved.
Sousa, A; Almeida, A M; Černigoj, U; Sousa, F; Queiroz, J A
2014-08-15
Preparation of high quantities of supercoiled plasmid DNA of pharmaceutical grade purity is a research area where intensive investigation is being performed. From this standpoint, several downstream methods have been proposed, among them the monolithic chromatographic strategies owing to excellent mass transfer properties of monolithic supports and their high binding capacity for large biomolecules. The present study explores the physicochemical properties of histamine ligand in a supercoiled plasmid DNA purification process from an Escherichia coli clarified lysate, where the emphasis is given to the elution strategy that allows higher selectivity and efficient removal of other impurities besides the open circular isoform. The combination of high NaCl concentration and acidic pH allowed the elimination of 89% of RNA during the preparative loading of the lysate sample. The results of the purification strategy with ascending sodium chloride gradient revealed that 97% of supercoiled plasmid DNA was recovered with a purity degree of 99%. In addition, using a combined purification strategy with ascending sodium chloride (capture step) and then descending ammonium sulfate (polishing step) gradient, it was achieved a lower supercoiled plasmid DNA recovery yield of 79% with a purity degree of 92%, although the dynamic binding capacity under these conditions was higher than in the previous strategy. A significant reduction of host contents, such as proteins, RNA and genomic DNA, was obtained in both purification strategies. Accordingly, histamine is a useful and versatile ligand that allows the desirable supercoiled plasmid purification with high yield and purity level. Copyright © 2014. Published by Elsevier B.V.
Campos-Neto, A; Webb, J R; Greeson, K; Coler, R N; Skeiky, Y A W; Reed, S G
2002-06-01
We have recently shown that a cocktail containing two leishmanial recombinant antigens (LmSTI1 and TSA) and interleukin-12 (IL-12) as an adjuvant induces solid protection in both a murine and a nonhuman primate model of cutaneous leishmaniasis. However, because IL-12 is difficult to prepare, is expensive, and does not have the stability required for a vaccine product, we have investigated the possibility of using DNA as an alternative means of inducing protective immunity. Here, we present evidence that the antigens TSA and LmSTI1 delivered in a plasmid DNA format either as single genes or in a tandem digene construct induce equally solid protection against Leishmania major infection in susceptible BALB/c mice. Immunization of mice with either TSA DNA or LmSTI1 DNA induced specific CD4(+)-T-cell responses of the Th1 phenotype without a requirement for specific adjuvant. CD8 responses, as measured by cytotoxic-T-lymphocyte activity, were generated after immunization with TSA DNA but not LmSTI1 DNA. Interestingly, vaccination of mice with TSA DNA consistently induced protection to a much greater extent than LmSTI1 DNA, thus supporting the notion that CD8 responses might be an important accessory arm of the immune response for acquired resistance against leishmaniasis. Moreover, the protection induced by DNA immunization was specific for infection with Leishmania, i.e., the immunization had no effect on the course of infection of the mice challenged with an unrelated intracellular pathogen such as Mycobacterium tuberculosis. Conversely, immunization of BALB/c mice with a plasmid DNA that is protective against challenge with M. tuberculosis had no effect on the course of infection of these mice with L. major. Together, these results indicate that the protection observed with the leishmanial DNA is mediated by acquired specific immune response rather than by the activation of nonspecific innate immune mechanisms. In addition, a plasmid DNA containing a fusion construct of the two genes was also tested. Similarly to the plasmids encoding individual proteins, the fusion construct induced both specific immune responses to the individual antigens and protection against challenge with L. major. These results confirm previous observations about the possibility of DNA immunization against leishmaniasis and lend support to the idea of using a single polygenic plasmid DNA construct to achieve polyspecific immune responses to several distinct parasite antigens.
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1991-03-26
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.
How-To-Do-It: Recombinant DNA Technology in the High School Biology Laboratory.
ERIC Educational Resources Information Center
Myers, Richard
1988-01-01
Describes a basic biotechnology investigation that includes restriction and ligation of plasmid DNA, transformation of bacteria and cloning of these bacterial cells. Discusses laboratory procedures and another activity in the identification of unknown plasmids by studying agarose gel electrophoresis photographs. (CW)
Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.
2001-01-01
We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified products can also be used for in vitro cloning, library construction, and other molecular biology applications. PMID:11381035
Bicho, Diana; Sousa, Ângela; Sousa, Fani; Queiroz, João; Tomaz, Cãndida
2014-09-01
DNA therapies are becoming recognized alternatives for the treatment and prevention of severe pathologies. Although most current trials have used plasmids <10 kbp, in the future larger plasmids would be required. The purpose of this work was to study the chromatographic behavior of nongrafted carbonyldiimidazole monolithic disks using plasmids with different sizes under hydrophobic conditions. Thereunto, the purification of several plasmids was performed. Higher size plasmids needed lower ammonium sulfate concentration, due to the greater number of interactions between the plasmids and monolith. The dynamic binding capacity experiments for the different plasmids revealed a lower capacity for bigger plasmids. It was also verified that the increase of salt concentration from 2.5 to 3 M of ammonium sulfate increased the capacity. At the highest salt concentration, a slight improvement in the capacity using lower flow rate was observed, possibly due to compaction of plasmid molecules and its better organization on the monolith channels. Finally, a low pH also had a positive effect on the capacity. So, this monolithic support proved to be appropriate to purify the supercoiled isoform of different plasmids with different sizes, providing a valuable instrument as a purification technique. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica.
Hoffmann, Maria; Pettengill, James B; Gonzalez-Escalona, Narjol; Miller, John; Ayers, Sherry L; Zhao, Shaohua; Allard, Marc W; McDermott, Patrick F; Brown, Eric W; Monday, Steven R
2017-01-01
Determinants of multidrug resistance (MDR) are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio) RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI), and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about resistance genes in plasmids, advances in plasmid sequencing, and phylogenetic analyses, and important insights about how MDR evolution occurs across diverse serotypes from different animal sources, particularly in agricultural settings where antimicrobial drug use practices vary.
Hormonal induction of transfected genes depends on DNA topology.
Piña, B; Haché, R J; Arnemann, J; Chalepakis, G; Slater, E P; Beato, M
1990-01-01
Plasmids containing the hormone regulatory element of mouse mammary tumor virus linked to the thymidine kinase promoter of herpes simplex virus and the reporter gene chloramphenicol acetyltransferase of Escherichia coli respond to glucocorticoids and progestins when transfected into appropriate cells. In the human mammary tumor cell line T47D, the response to progestins, but not to glucocorticoids, is highly dependent on the topology of the transfected DNA. Although negatively supercoiled plasmids respond optimally to the synthetic progestin R5020, their linearized counterparts exhibit markedly reduced progestin inducibility. This is not due to changes in the efficiency of DNA transfection, since the amount of DNA incorporated into the cell nucleus is not significantly dependent on the initial topology of the plasmids. In contrast, cotransfection experiments with glucocorticoid receptor cDNA in the same cell line show no significant influence of DNA topology on induction by dexamethasone. A similar result was obtained with fibroblasts that contain endogenous glucocorticoid receptors. When the distance between receptor-binding sites or between the binding sites and the promoter was increased, the dependence of progestin induction on DNA topology was more pronounced. In contrast to the original plasmid, these constructs also revealed a similar topological dependence for induction by glucocorticoids. The differential influence of DNA topology is not due to differences in the affinity of the two hormone receptors for DNA of various topologies, but probably reflects an influence of DNA topology on the interaction between different DNA-bound receptor molecules and between receptors and other transcription factors. Images PMID:2153920
Groom, Joseph; Chung, Daehwan; Kim, Sun-Ki; Guss, Adam; Westpheling, Janet
2018-05-28
A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (≥ 60 °C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a result also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ∆recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.
Adsorption of bacterial plasmids in pure mineral mixtures
NASA Astrophysics Data System (ADS)
Zhang, L.; Cochran, J. P.; Seaman, J. C.; Parrott, B.
2017-12-01
Microorganisms play an important role in controlling the fate and transport of subsurface contaminants through the direct degradation of organic contaminants to the control of chemical redox conditions that impact the speciation and partitioning of inorganic contaminants. Genes that control these processes, including the relative tolerance associated with direct exposure to toxic contaminants, are found within the bacteria's chromosomal DNA and also within distinct, circular DNA elements called plasmids. Plasmids are mobile genetic elements that can be exchanged with other bacterial species through horizontal gene transfer (HGT). The frequency of HGT in soil is influenced by several factors, with the physicochemical characteristics of soil possibly being a primary factor. Thus, the objective for our research was to determine the movement and persistence of bacterial plasmids within soil. Our current study focuses on batch sorption experiments designed to evaluate the partitioning of bacterial plasmids in idealized mineral mixtures that represent the clay mineralogy of highly weathered soils of the Southeastern US. Specifically, we compared plasmid adsorption among pure goethite, kaolinite, and a mixture of goethite and kaolinite. We also determined the adsorption of plasmids on the above minerals over increasing pH (3 to 10). Our results show that adsorption decreased in the following order: goethite > kaolinite > mixture of goethite and kaolinite. We also found that plasmids adsorption was higher at lower pH levels, with pH 3 having the adsorption maximum. However, at pH 3, DNA denaturing may have occurred, leading to aggregation or precipitation of plasmids on the mineral surfaces. Our study was the first steps in determining the influence of soil properties on plasmid adsorption. Our future goals are to determine the adsorption in other pure minerals and in natural soils.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chung, Daehwan; Groom, Joseph; Kim, Sun-Ki
A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (>/= 60 degrees C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a resultmore » also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ..delta..recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.« less
Ankri, S; Reyes, O; Leblon, G
1996-07-01
Differences of up to 33 000-fold in electro-transformability of highly DNA restrictive corynebacteria are observed in the DNA of a shuttle plasmid extracted from Escherichia coli hosts propagated in different nutritional conditions. Growth of the host in minimal medium increases plasmid transformability, whereas growth on rich media decreases it. In the E. coli DH5 alpha host, the starvation-dependent increase DNA transformability is reverted by supplementing with methionine, an obligate 5-adenosyl-methionine (SAM) precursor. This suggests that an E. coli nutritionally modulated SAM-dependent DNA-methyltransferase may be involved in this phenomenon.
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1987-08-28
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.
The "Frankenplasmid" Lab: An Investigative Exercise for Teaching Recombinant DNA Methods
ERIC Educational Resources Information Center
Dean, Derek M.; Wilder, Jason A.
2011-01-01
We describe an investigative laboratory module designed to give college undergraduates strong practical and theoretical experience with recombinant DNA methods within 3 weeks. After deducing restriction enzyme maps for two different plasmids, students ligate the plasmids together in the same reaction, transform "E. coli" with this mixture of…
USDA-ARS?s Scientific Manuscript database
Antibiotic resistant foodborne pathogens pose serious public health concerns and increase the burden of disease treatment. Antibiotic resistance genes can reside on the bacterial chromosome or on other self-replicating DNA molecules such as plasmids. The resistance genes/DNA can be transferred int...
PLASMID DNA DAMAGE CAUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN
PLASMID DNA DAMAGE CAOUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN
ABSTRACT
Both dimethylarsinic acid (DMA(V)) and dimethylarsinous acid (DMA(III)) release iron from human liver ferritin (HLF) with or without the presence of ascorbic acid. ...
PLASMID DNA DAMAGE CAUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN
Plasmid DNA damage caused by methylated arsenicals, ascorbic acid and human liver ferritin.
Arsenic causes cancer in human skin, urinary bladder, lung, liver and kidney and is a significant world-wide public health problem. Although the metabolism of inorganic arsenic is ...
Enhancement of anion-exchange chromatography of DNA using compaction agents
NASA Technical Reports Server (NTRS)
Murphy, Jason C.; Fox, George E.; Willson, Richard C.
2003-01-01
The use of adsorptive chromatography for preparative nucleic acid separations is often limited by low capacity. The possibility that the adsorbent surface area sterically accessible to nucleic acid molecules could be increased by reducing their radius of gyration with compaction agents has been investigated. The equilibrium adsorption capacity of Q Sepharose anion-exchange matrix for plasmid DNA at 600 mM NaCl was enhanced by up to ca. 40% in the presence of 2.5 mM spermine. In addition, compaction agent selectivity has been demonstrated. Spermine, for example, enhances the adsorption of both plasmid and genomic DNA, spermidine enhances binding only of plasmid, and hexamine cobalt enhances only the binding of genomic DNA. Compaction may be generally useful for enhancing adsorptive separations of nucleic acids.
Shchelkunov, S N; Taranov, O S; Tregubchak, T V; Maksyutov, R A; Silkov, A N; Nesterov, A E; Sennikov, S V
2016-07-01
Wistar rats with collagen-induced arthritis were intramuscularly injected with the recombinant plasmid pcDNA/sTNF-BD encoding the sequence of the TNF-binding protein domain of variola virus CrmB protein (VARV sTNF-BD) or the pcDNA3.1 vector. Quantitative analysis showed that the histopathological changes in the hind-limb joints of rats were most severe in the animals injected with pcDNA3.1 and much less severe in the group of rats injected with pcDNA/sTNF-BD, which indicates that gene therapy of rheumatoid arthritis is promising in the case of local administration of plasmids governing the synthesis of VARV immunomodulatory proteins.
Simon, J W; Slabas, A R
1998-09-18
The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.
Assembling the bacterial segrosome.
Hayes, Finbarr; Barillà, Daniela
2006-05-01
Genome segregation in prokaryotes is a highly ordered process that integrates with DNA replication, cytokinesis and other fundamental facets of the bacterial cell cycle. The segrosome is the nucleoprotein complex that mediates DNA segregation in bacteria, its assembly and organization is best understood for plasmid partition. The recent elucidation of structures of the ParB plasmid segregation protein bound to centromeric DNA, and of the tertiary structures of other segregation proteins, are key milestones in the path to deciphering the molecular basis of bacterial DNA segregation.
Arenskötter, Matthias; Baumeister, Dirk; Kalscheuer, Rainer; Steinbüchel, Alexander
2003-01-01
Gene transfer systems for Gordonia polyisoprenivorans strains VH2 and Y2K based on electroporation and conjugation, respectively, were established. Several parameters were optimized, resulting in transformation efficiencies of >4 × 105 CFU/μg of plasmid DNA. In contrast to most previously described electroporation protocols, the highest efficiencies were obtained by applying a heat shock after the intrinsic electroporation. Under these conditions, transfer and autonomous replication of plasmid pNC9503 was also demonstrated to proceed in G. alkanivorans DSM44187, G. nitida DSM44499T, G. rubropertincta DSM43197T, G. rubropertincta DSM46038, and G. terrae DSM43249T. Conjugational plasmid DNA transfer to G. polyisoprenivorans resulted in transfer frequencies of up to 5 × 10−6 of the recipient cells. Recombinant strains capable of polyhydroxyalkanoate synthesis from alkanes were constructed. PMID:12902293
Richardson, Ruth E.; Suzuki, Yo
2015-01-01
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330
Dichromatic laser radiation effects on DNA of Escherichia coli and plasmids
NASA Astrophysics Data System (ADS)
Martins, W. A.; Polignano, G. A. C.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.
2015-04-01
Dichromatic and consecutive laser radiations have attracted increased attention for clinical applications as offering new tools for the treatment of dysfunctional tissues in situations where monochromatic radiation is not effective. This work evaluated the survival, filamentation and morphology of Escherichia coli cells, and the induction of DNA lesions, in plasmid DNA exposed to low-intensity consecutive dichromatic laser radiation. Exponential and stationary wild type and formamidopyrimidine DNA glycosylase/MutM protein deficient E. coli cultures were exposed to consecutive low-intensity dichromatic laser radiation (infrared laser immediately after red laser) to study the survival, filamentation and morphology of bacterial cells. Plasmid DNA samples were exposed to dichromatic radiation to study DNA lesions by electrophoretic profile. Dichromatic laser radiation affects the survival, filamentation and morphology of E. coli cultures depending on the growth phase and the functional repair mechanism of oxidizing lesions in DNA, but does not induce single/double strands breaks or alkali-labile DNA lesions. Results show that low-intensity consecutive dichromatic laser radiation induces biological effects that differ from those induced by monochromatic laser radiation, suggesting that other therapeutic effects could be obtained using dichromatic radiation.
Use of DNA probes to study tetracycline resistance determinants in gram-negative bacteria from swine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, C.Y.
1989-01-01
Specific {sup 32}P-labeled DNA probes were prepared and used to evaluate the distribution of tetracycline resistance determinants carried by gram-negative enteric bacteria isolated from pigs in 3 swine herds with different histories of antibiotic exposure. Plasmid DNA, ranging in size from 2.1 to 186 Kb, was observed in over 84% of 114 isolates studied. Two of 78 tetracycline resistant strains did not harbor plasmids. The DNA probes were isolated from plasmids pSL18, pRT29/Tn10, pBR322 and pSL106, respectively, and they represented class A, B, C and D tetracycline resistance determinants. Hybridization conditions using 0.5X SSPE at 65{degrees}C minimize cross-hybridization between themore » different class of tetracycline resistance genes. Cross-hybridization between class A and class C determinants could be distinguished by simultaneous comparison of the intensity of their hybridization signals. Plasmids from over 44% of the tetracycline resistant isolates did not hybridize to DNA probes for the determinants tested. Class B determinant occurred more frequently than class A or C. None of the isolates hybridized with the class D probe.« less
Agúndez, Leticia; González-Prieto, Coral; Machón, Cristina; Llosa, Matxalen
2012-01-01
Background Bacterial conjugation is a mechanism for horizontal DNA transfer between bacteria which requires cell to cell contact, usually mediated by self-transmissible plasmids. A protein known as relaxase is responsible for the processing of DNA during bacterial conjugation. TrwC, the relaxase of conjugative plasmid R388, is also able to catalyze site-specific integration of the transferred DNA into a copy of its target, the origin of transfer (oriT), present in a recipient plasmid. This reaction confers TrwC a high biotechnological potential as a tool for genomic engineering. Methodology/Principal Findings We have characterized this reaction by conjugal mobilization of a suicide plasmid to a recipient cell with an oriT-containing plasmid, selecting for the cointegrates. Proteins TrwA and IHF enhanced integration frequency. TrwC could also catalyze integration when it is expressed from the recipient cell. Both Y18 and Y26 catalytic tyrosil residues were essential to perform the reaction, while TrwC DNA helicase activity was dispensable. The target DNA could be reduced to 17 bp encompassing TrwC nicking and binding sites. Two human genomic sequences resembling the 17 bp segment were accepted as targets for TrwC-mediated site-specific integration. TrwC could also integrate the incoming DNA molecule into an oriT copy present in the recipient chromosome. Conclusions/Significance The results support a model for TrwC-mediated site-specific integration. This reaction may allow R388 to integrate into the genome of non-permissive hosts upon conjugative transfer. Also, the ability to act on target sequences present in the human genome underscores the biotechnological potential of conjugative relaxase TrwC as a site-specific integrase for genomic modification of human cells. PMID:22292089
Kakui, Yasutaka; Sunaga, Tomonari; Arai, Kunio; Dodgson, James; Ji, Liang; Csikász-Nagy, Attila; Carazo-Salas, Rafael; Sato, Masamitsu
2015-01-01
Integration of an external gene into a fission yeast chromosome is useful to investigate the effect of the gene product. An easy way to knock-in a gene construct is use of an integration plasmid, which can be targeted and inserted to a chromosome through homologous recombination. Despite the advantage of integration, construction of integration plasmids is energy- and time-consuming, because there is no systematic library of integration plasmids with various promoters, fluorescent protein tags, terminators and selection markers; therefore, researchers are often forced to make appropriate ones through multiple rounds of cloning procedures. Here, we establish materials and methods to easily construct integration plasmids. We introduce a convenient cloning system based on Golden Gate DNA shuffling, which enables the connection of multiple DNA fragments at once: any kind of promoters and terminators, the gene of interest, in combination with any fluorescent protein tag genes and any selection markers. Each of those DNA fragments, called a ‘module’, can be tandemly ligated in the order we desire in a single reaction, which yields a circular plasmid in a one-step manner. The resulting plasmids can be integrated through standard methods for transformation. Thus, these materials and methods help easy construction of knock-in strains, and this will further increase the value of fission yeast as a model organism. PMID:26108218
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hansson, J.; Keyse, S.M.; Lindahl, T.
Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurementsmore » of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links.« less
Identification and DNA annotation of a plasmid isolated from Chromobacterium violaceum.
Lima, Daniel C; Nyberg, Lena K; Westerlund, Fredrik; Batistuzzo de Medeiros, Silvia R
2018-03-28
Chromobacterium violaceum is a ß-proteobacterium found widely worldwide with important biotechnological properties and is associated to lethal sepsis in immune-depressed individuals. In this work, we report the discover, complete sequence and annotation of a plasmid detected in C. violaceum that has been unnoticed until now. We used DNA single-molecule analysis to confirm that the episome found was a circular molecule and then proceeded with NGS sequencing. After DNA annotation, we found that this extra-chromosomal DNA is probably a defective bacteriophage of approximately 44 kilobases, with 39 ORFs comprising, mostly hypothetical proteins. We also found DNA sequences that ensure proper plasmid replication and partitioning as well as a toxin addiction system. This report sheds light on the biology of this important species, helping us to understand the mechanisms by which C. violaceum endures to several harsh conditions. This discovery could also be a first step in the development of a DNA manipulation tool in this bacterium.
Fast kinetic studies of plasmid DNA transfer in intact yeast cells mediated by electropulsation.
Ganeva, V; Galutzov, B; Teissie, J
1995-09-25
Intact yeast cell Electrotransformation process was investigated. It is a two step process. The plasmid must be pre-mixed and present in contact with the cells during the pulse. During the millisecond field pulse, plasmid DNA is associated to the envelope. It therefore crosses the membrane by a process which lasts several seconds as shown by its sensitivity to a post pulse addition of DNase. Electrotransformation is not supported by an electrophoretic transfer due to the external field nor by a free diffusion across the electropermeabilized envelope. DNA is first bound during the field pulse and then is transferred by a still unknown active process due to cell metabolism.
Willetts, Andrew; Kelly, David
2016-01-01
The progressive titres of key monooxygenases and their requisite native donors of reducing power were used to assess the relative contribution of various camphor plasmid (CAM plasmid)- and chromosome-coded activities to biodegradation of (rac)-camphor at successive stages throughout growth of Pseudomonas putida NCIMB 10007 on the bicylic monoterpenoid. A number of different flavin reductases (FRs) have the potential to supply reduced flavin mononucleotide to both 2,5- and 3,6-diketocamphane monooxygenase, the key isoenzymic two-component monooxygenases that delineate respectively the (+)- and (−)-camphor branches of the convergent degradation pathway. Two different constitutive chromosome-coded ferric reductases able to act as FRs can serve such as role throughout all stages of camphor-dependent growth, whereas Fred, a chromosome-coded inducible FR can only play a potentially significant role in the relatively late stages. Putidaredoxin reductase, an inducible CAM plasmid-coded flavoprotein that serves an established role as a redox intermediate for plasmid-coded cytochrome P450 monooxygenase also has the potential to serve as an important FR for both diketocamphane monooxygenases (DKCMOs) throughout most stages of camphor-dependent growth. PMID:27754389
FATE IN SOIL OF A RECOMBINANT PLASMID CARRYING A 'DROSOPHILA' GENE
A recombinant plasmid (C357;3.5 Mdal) containing heterologous DNA(pBR322(2.6 Mdal) with cDNA for an egg yolk protein from Drosophila grimshawi) in Escherichia coli strain HB 101 survived in and was recovered on selective media from sterile and nonsterile soil during 27 days at fr...
NASA Astrophysics Data System (ADS)
Lehner, Roman; Liu, Kegang; Wang, Xueya; Wolf, Marc; Hunziker, Patrick
2017-04-01
Cationic polymers as non-viral gene delivery carriers are widely used because of their strong condensing properties and long-term safety, but acute cytotoxicity is a persistent challenge. In this study, two types of polyplexes were prepared by co-formulating plasmid DNA and two cationic diblock copolymers PABOXA5-b-PMOXA33-PA (primary amine) and PABOXA5-b-PMOXA33-TA (tertiary amine) to check their transfection efficacies in HeLa cells and HEK293T cells, respectively. The plasmid DNA/PABOXA5-b-PMOXA33-PA polyplex showed higher transfection efficacy compared to the plasmid DNA/PABOXA5-b-PMOXA33-TA polyplex under an N/P ratio of 40. Both polymers exhibited low toxicity, attributed to the shielding effect of a hydrophilic, noncharged block. Mechanistic insight into differential transfection efficiencies of the polymers were gained by visualization and comparison of the condensates via transmission electron and atomic force microscopy. The results provide information suited for further structure optimization of polymers that are aimed for targeted gene delivery.
The "Frankenplasmid" lab: an investigative exercise for teaching recombinant DNA methods.
Dean, Derek M; Wilder, Jason A
2011-01-01
We describe an investigative laboratory module designed to give college undergraduates strong practical and theoretical experience with recombinant DNA methods within 3 weeks. After deducing restriction enzyme maps for two different plasmids, students ligate the plasmids together in the same reaction, transform E. coli with this mixture of ligated DNA, and plate the cells on media that specifically select for hybrid plasmids. The main goal of the assignment is for students to deduce the gene map of one hybrid "Frankenplasmid" using the LacZ phenotype of its transformants, PCR, and restriction mapping. Our protocol results in a number of possible outcomes, meaning that students are mapping truly unknown plasmids. The open-ended nature of this assignment results in an effective module that teaches recombinant DNA procedures while engaging students with its investigative approach, increasing complexity, and puzzle-like quality. Moreover, the modular design of the activity allows it to be adapted to a more limited schedule, introductory courses, or more advanced courses. Copyright © 2011 International Union of Biochemistry and Molecular Biology, Inc.
An oligonucleotide microarray to characterize multidrug resistant plasmids
USDA-ARS?s Scientific Manuscript database
Bacteria plasmids are fragments of extra-chromosomal double stranded deoxyribonucleic acid (DNA) that can contain a variety of genes beneficial to the host organism like antibiotic drug resistance. Many of the Enterobacteriaceae carry multiple drug resistance (MDR) genes on large plasmids of replic...
Sakurai, R; Sasaki, N; Takano, H; Abe, T; Kawano, S
2000-04-28
Pulsed-field gel electrophoresis (PFGE) was used to examine the in vivo and in vitro conformations of Physarum polycephalum mitochondrial DNA (mtDNA). We used plugs containing isolated mitochondria, isolated mitochondrial nucleoids (mt-nuclei), and isolated mtDNA, in addition to whole cells. The mtDNA contained in the myxamoebae, plasmodia, isolated mitochondria, and isolated mt-nuclei was circular, but most of the isolated mtDNA had been site-specifically fragmented and linearized during DNA preparation and storage under low ionic strength conditions. Restriction mapping of Physarum mtDNA by the direct digestion of the isolated mt-nuclei from two different strains, DP89 x AI16 and KM88 x AI16, resulted in the circular form. A linear mitochondrial plasmid, mF, is known to promote mitochondrial fusion and integration of itself into the mtDNA in Physarum. Linearization of mtDNA by the integration of the mF plasmid was demonstrated when we used PFGE to analyze isolated mitochondria from the plasmodial strain DP89 x NG7 carrying the mF plasmid (mF+). The PFGE system can be used not only to determine whether the form of mtDNA is linear or circular but also to analyze the dynamic conformational changes of mtDNA.
Runge, Roswitha; Oehme, Liane; Kotzerke, Jörg; Freudenberg, Robert
2016-12-01
DNA damage occurs as a consequence of both direct and indirect effects of ionizing radiation. The severity of DNA damage depends on the physical characteristics of the radiation quality, e.g., the linear energy transfer (LET). There are still contrary findings regarding direct or indirect interactions of high-LET emitters with DNA. Our aim is to determine DNA damage and the effect on cellular survival induced by (223)Ra compared to (188)Re and (99m)Tc modulated by the radical scavenger dimethyl sulfoxide (DMSO). Radioactive solutions of (223)Ra, (188)Re, or (99m)Tc were added to either plasmid DNA or to PC Cl3 cells in the absence or presence of DMSO. Following irradiation, single strand breaks (SSB) and double strand breaks (DSB) in plasmid DNA were analyzed by gel electrophoresis. To determine the radiosensitivity of the rat thyroid cell line (PC Cl3), survival curves were performed using the colony formation assay. Exposure to 120 Gy of (223)Ra, (188)Re, or (99m)Tc leads to maximal yields of SSB (80 %) in plasmid DNA. Irradiation with 540 Gy (223)Ra and 500 Gy (188)Re or (99m)Tc induced 40, 28, and 64 % linear plasmid conformations, respectively. DMSO prevented the SSB and DSB in a similar way for all radionuclides. However, with the α-emitter (223)Ra, a low level of DSB could not be prevented by DMSO. Irradiation of PC Cl3 cells with (223)Ra, (188)Re, and (99m)Tc pre-incubated with DMSO revealed enhanced survival fractions (SF) in comparison to treatment without DMSO. Protection factors (PF) were calculated using the fitted survival curves. These factors are 1.23 ± 0.04, 1.20 ± 0.19, and 1.34 ± 0.05 for (223)Ra, (188)Re, and (99m)Tc, respectively. For (223)Ra, as well as for (188)Re and (99m)Tc, dose-dependent radiation effects were found applicable for plasmid DNA and PC Cl3 cells. The radioprotection by DMSO was in the same range for high- and low-LET emitter. Overall, the results indicate the contribution of mainly indirect radiation effects for each of the radionuclides regarding DNA damage and cell survival. In summary, our findings may contribute to fundamental knowledge about the α-particle induced DNA damage.
Earthquakes Promote Bacterial Genetic Exchange in Serpentinite Crevices
NASA Astrophysics Data System (ADS)
Naoto, Yoshida; Fujiura, Nori
2009-04-01
We report the results of our efforts to study the effects of seismic shaking on simulated biofilms within serpentinite fissures. A colloidal solution consisting of recipient bacterial cells (Pseudomonas sp. or Bacillus subtilis), donor plasmid DNA encoded for antibiotic resistance, and chrysotile (an acicular clay mineral that forms in crevices of serpentinite layers) were placed onto an elastic body made from gellan gum, which acted as the biofilm matrix. Silica beads, as rock analogues (i.e., chemically inert mechanical serpentinite), were placed on the gellan surface, which was coated with the colloidal solution. A rolling vibration similar to vibrations generated by earthquakes was applied, and the silica beads moved randomly across the surface of the gellan. This resulted in the recipient cells' acquiring plasmid DNA and thus becoming genetically transformed to demonstrate marked antibiotic resistance. Neither Pseudomonas sp. nor B. subtilis were transformed by plasmid DNA when chrysotile was substituted for by kaolinite or bentonite in the colloidal solution. Tough gellan (1.0%) promoted the introduction of plasmid DNA into Pseudomonas sp., but soft gellan (0.3%) had no such effect. Genetic transformation of bacteria on the surface of gellan by exposure to exogenous plasmid DNA required seismic shaking and exposure to the acicular clay mineral chrysotile. These experimental results suggest that bacterial genetic exchange readily occurs when biofilms that form in crevices of serpentinite are exposed to seismic shaking. Seismic activity may be a key factor in bacterial evolution along with the formation of biofilms within crevices of serpentinite.
Bozzoni, I; Beccari, E; Luo, Z X; Amaldi, F
1981-01-01
Poly-A+ mRNA from Xenopus laevis oocytes, partially enriched for r-protein coding capacity has been used as starting material for preparing a cDNA bank in plasmid pBR322. The clones containing sequences specific for r-proteins have been selected by translation of the complementary mRNAs. Clones for six different r-proteins have been identified and utilized as probes for studying their genomic organization. Two gene copies per haploid genome were found for r-proteins L1, L14, S19, and four-five for protein S1, S8 and L32. Moreover a population polymorphism has been observed for the genomic regions containing sequences for r-protein S1, S8 and L14. Images PMID:6112733
Fricke, W Florian; Mammel, Mark K; McDermott, Patrick F; Tartera, Carmen; White, David G; Leclerc, J Eugene; Ravel, Jacques; Cebula, Thomas A
2011-07-01
Despite extensive surveillance, food-borne Salmonella enterica infections continue to be a significant burden on public health systems worldwide. As the S. enterica species comprises sublineages that differ greatly in antigenic representation, virulence, and antimicrobial resistance phenotypes, a better understanding of the species' evolution is critical for the prediction and prevention of future outbreaks. The roles that virulence and resistance phenotype acquisition, exchange, and loss play in the evolution of S. enterica sublineages, which to a certain extent are represented by serotypes, remains mostly uncharacterized. Here, we compare 17 newly sequenced and phenotypically characterized nontyphoidal S. enterica strains to 11 previously sequenced S. enterica genomes to carry out the most comprehensive comparative analysis of this species so far. These phenotypic and genotypic data comparisons in the phylogenetic species context suggest that the evolution of known S. enterica sublineages is mediated mostly by two mechanisms, (i) the loss of coding sequences with known metabolic functions, which leads to functional reduction, and (ii) the acquisition of horizontally transferred phage and plasmid DNA, which provides virulence and resistance functions and leads to increasing specialization. Matches between S. enterica clustered regularly interspaced short palindromic repeats (CRISPR), part of a defense mechanism against invading plasmid and phage DNA, and plasmid and prophage regions suggest that CRISPR-mediated immunity could control short-term phenotype changes and mediate long-term sublineage evolution. CRISPR analysis could therefore be critical in assessing the evolutionary potential of S. enterica sublineages and aid in the prediction and prevention of future S. enterica outbreaks.
Fricke, W. Florian; Mammel, Mark K.; McDermott, Patrick F.; Tartera, Carmen; White, David G.; LeClerc, J. Eugene; Ravel, Jacques; Cebula, Thomas A.
2011-01-01
Despite extensive surveillance, food-borne Salmonella enterica infections continue to be a significant burden on public health systems worldwide. As the S. enterica species comprises sublineages that differ greatly in antigenic representation, virulence, and antimicrobial resistance phenotypes, a better understanding of the species' evolution is critical for the prediction and prevention of future outbreaks. The roles that virulence and resistance phenotype acquisition, exchange, and loss play in the evolution of S. enterica sublineages, which to a certain extent are represented by serotypes, remains mostly uncharacterized. Here, we compare 17 newly sequenced and phenotypically characterized nontyphoidal S. enterica strains to 11 previously sequenced S. enterica genomes to carry out the most comprehensive comparative analysis of this species so far. These phenotypic and genotypic data comparisons in the phylogenetic species context suggest that the evolution of known S. enterica sublineages is mediated mostly by two mechanisms, (i) the loss of coding sequences with known metabolic functions, which leads to functional reduction, and (ii) the acquisition of horizontally transferred phage and plasmid DNA, which provides virulence and resistance functions and leads to increasing specialization. Matches between S. enterica clustered regularly interspaced short palindromic repeats (CRISPR), part of a defense mechanism against invading plasmid and phage DNA, and plasmid and prophage regions suggest that CRISPR-mediated immunity could control short-term phenotype changes and mediate long-term sublineage evolution. CRISPR analysis could therefore be critical in assessing the evolutionary potential of S. enterica sublineages and aid in the prediction and prevention of future S. enterica outbreaks. PMID:21602358
Lacks, Sanford A.; Balganesh, Tanjore S.
1988-01-01
Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.
Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization
NASA Astrophysics Data System (ADS)
Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.
1995-10-01
Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.
The 987P fimbrial gene cluster of enterotoxigenic Escherichia coli is plasmid encoded.
Schifferli, D M; Beachey, E H; Taylor, R K
1990-01-01
A clone containing the 987P fimbrial gene cluster was selected from a cosmid library of total DNA of the prototype Escherichia coli strain 987 by using 987P-specific antiserum. A subclone of 12 kilobases containing all of the genes required for fimbrial expression on a nonfimbriated K-12 strain of E. coli and a DNA fragment internal to the fimbrial subunit gene were used to probe the prototype strain and various isolates of 987P-fimbriated enterotoxigenic E. coli. All strains had several plasmids, as shown by agarose gel electrophoresis, and each of five strains which expressed 987P fimbriae showed a plasmid of 35 to 40 megadaltons (MDa) hybridizing to both 987P-specific probes. Hybridization to restricted DNA of strain 987 supported a plasmid origin for the cloned 987P gene cluster. Moreover, an isogenic strain which had lost its 35-MDa plasmid was no longer capable of synthesizing fimbrial subunits, but regained fimbrial expression after reintroduction of the TnphoA (Tn5 IS50L::phoA)-tagged 35-MDa plasmid. Absence of fimbrial subunit synthesis in K-12 strains transformed with the 35-MDa plasmid alone suggested the requirement of regulatory elements existing in strain 987 but missing in K-12 strains. A probe for the heat-stable enterotoxin STIa hybridized in each of the 987P-fimbriated strains to the plasmid containing the 987P genes and in most of these strains to an additional plasmid which contained the gene for the heat-stable enterotoxin STII. Occurrence of the 987P and STIa genes on the same replicon correlates with epidemiological observations, STIa being the most prevalent toxin produced by 987P-fimbriated E. coli. Images PMID:1967167
Kouass Sahbani, Saloua; Sanche, Leon; Cloutier, Pierre; Bass, Andrew D; Hunting, Darel J
2014-11-20
Low energy electrons (LEEs) of energies less than 20 eV are generated in large quantities by ionizing radiation in biological matter. While LEEs are known to induce single (SSBs) and double strand breaks (DSBs) in DNA, their ability to inactivate cells by inducing nonreparable lethal damage has not yet been demonstrated. Here we observe the effect of LEEs on the functionality of DNA, by measuring the efficiency of transforming Escherichia coli with a [pGEM-3Zf (-)] plasmid irradiated with 10 eV electrons. Highly ordered DNA films were prepared on pyrolitic graphite by molecular self-assembly using 1,3-diaminopropane ions (Dap(2+)). The uniformity of these films permits the inactivation of approximately 50% of the plasmids compared to <10% using previous methods, which is sufficient for the subsequent determination of their functionality. Upon LEE irradiation, the fraction of functional plasmids decreased exponentially with increasing electron fluence, while LEE-induced isolated base damage, frank DSB, and non DSB-cluster damage increased linearly with fluence. While DSBs can be toxic, their levels were too low to explain the loss of plasmid functionality observed upon LEE irradiation. Similarly, non-DSB cluster damage, revealed by transforming cluster damage into DSBs by digestion with repair enzymes, also occurred relatively infrequently. The exact nature of the lethal damage remains unknown, but it is probably a form of compact cluster damage in which the lesions are too close to be revealed by purified repair enzymes. In addition, this damage is either not repaired or is misrepaired by E. coli, since it results in plasmid inactivation, when they contain an average of three lesions. Comparison with previous results from a similar experiment performed with γ-irradiated plasmids indicates that the type of clustered DNA lesions, created directly on cellular DNA by LEEs, may be more difficult to repair than those produced by other species from radiolysis.
Plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B.
Khatri, Kapil; Goyal, Amit K; Gupta, Prem N; Mishra, Neeraj; Vyas, Suresh P
2008-04-16
This work investigates the preparation and in vivo efficacy of plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B. Chitosan pDNA nanoparticles were prepared using a complex coacervation process. Prepared nanoparticles were characterized for size, shape, surface charge, plasmid loading and ability of nanoparticles to protect DNA against nuclease digestion and for their transfection efficacy. Nasal administration of nanoparticles resulted in serum anti-HBsAg titre that was less compared to that elicited by naked DNA and alum adsorbed HBsAg, but the mice were seroprotective within 2 weeks and the immunoglobulin level was above the clinically protective level. However, intramuscular administration of naked DNA and alum adsorbed HBsAg did not elicit sIgA titre in mucosal secretions that was induced by nasal immunization with chitosan nanoparticles. Similarly, cellular responses (cytokine levels) were poor in case of alum adsorbed HBsAg. Chitosan nanoparticles thus produced humoral (both systemic and mucosal) and cellular immune responses upon nasal administration. The study signifies the potential of chitosan nanoparticles as DNA vaccine carrier and adjuvant for effective immunization through non-invasive nasal route.
Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate
Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook
2014-01-01
Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987
Fabrication of Size-Tunable Metallic Nanoparticles Using Plasmid DNA as a Biomolecular Reactor
Samson, Jacopo; Piscopo, Irene; Yampolski, Alex; Nahirney, Patrick; Parpas, Andrea; Aggarwal, Amit; Saleh, Raihan; Drain, Charles Michael
2011-01-01
Plasmid DNA can be used as a template to yield gold, palladium, silver, and chromium nanoparticles of different sizes based on variations in incubation time at 70 °C with gold phosphine complexes, with the acetates of silver or palladium, or chromium acetylacetonate. The employment of mild synthetic conditions, minimal procedural steps, and aqueous solvents makes this method environmentally greener and ensures general feasibility. The use of plasmids exploits the capabilities of the biotechnology industry as a source of nanoreactor materials. PMID:28348280
Danquah, Michael K; Forde, Gareth M
2007-06-15
The creation of a commercially viable and a large-scale purification process for plasmid DNA (pDNA) production requires a whole-systems continuous or semi-continuous purification strategy employing optimised stationary adsorption phase(s) without the use of expensive and toxic chemicals, avian/bovine-derived enzymes and several built-in unit processes, thus affecting overall plasmid recovery, processing time and economics. Continuous stationary phases are known to offer fast separation due to their large pore diameter making large molecule pDNA easily accessible with limited mass transfer resistance even at high flow rates. A monolithic stationary sorbent was synthesised via free radical liquid porogenic polymerisation of ethylene glycol dimethacrylate (EDMA) and glycidyl methacrylate (GMA) with surface and pore characteristics tailored specifically for plasmid binding, retention and elution. The polymer was functionalised with an amine active group for anion-exchange purification of pDNA from cleared lysate obtained from E. coli DH5alpha-pUC19 pellets in RNase/protease-free process. Characterization of the resin showed a unique porous material with 70% of the pores sizes above 300 nm. The final product isolated from anion-exchange purification in only 5 min was pure and homogenous supercoiled pDNA with no gDNA, RNA and protein contamination as confirmed with DNA electrophoresis, restriction analysis and SDS page. The resin showed a maximum binding capacity of 15.2 mg/mL and this capacity persisted after several applications of the resin. This technique is cGMP compatible and commercially viable for rapid isolation of pDNA.
Recombination between bacteriophage lambda and plasmid pBR322 in Escherichia coli.
Pogue-Geile, K L; Dassarma, S; King, S R; Jaskunas, S R
1980-01-01
Recombinant lambda phages were isolated that resulted from recombination between the lambda genome and plasmid pBR322 in Escherichia coli, even though these deoxyribonucleic acids (DNAs) did not share extensive regions of homology. The characterization of these recombinant DNAs by heteroduplex analysis and restriction endonucleases is described. All but one of the recombinants appeared to have resulted from reciprocal recombination between a site on lambda DNA and a site on the plasmid. In general, there were two classes of recombinants. One class appeared to have resulted from recombination at the phage attachment site that probably resulted from lambda integration into secondary attachment sites on the plasmid. Seven different secondary attachment sites on pBR322 were found. The other class resulted from plasmid integration at other sites that were widely scattered on the lambda genome. For this second class of recombinants, more than one site on the plasmid could recombine with lambda DNA. Thus, the recombination did not appear to be site specific with respect to lambda or the plasmid. Possible mechanisms for generating these recombinants are discussed. Images PMID:6247334
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Transformation of Saccharomyces cerevisiae with UV-irradiated single-stranded plasmid.
Zgaga, Z
1991-08-01
UV-irradiated single-stranded replicative plasmids were used to transform different yeast strains. The low doses of UV used in this study (10-75 J/m2) caused a significant decrease in the transforming efficiency of plasmid DNA in the Rad+ strain, while they had no effect on transformation with double-stranded plasmids of comparable size. Neither the rev3 mutation, nor the rad18 or rad52 mutations influenced the efficiency of transformation with irradiated single-stranded plasmid. However, it was found to be decreased in the double rev3 rad52 mutant. Extracellular irradiation of plasmid that contains both URA3 and LEU2 genes (psLU) gave rise to up to 5% Leu- transformants among selected Ura+ ones in the repair-proficient strain. Induction of Leu- transformants was dose-dependent and only partially depressed in the rev3 mutant. These results suggest that both mutagenic and recombinational repair processes operate on UV-damaged single-stranded DNA in yeast.
Yeast cohesin complex embraces 2 micron plasmid sisters in a tri-linked catenane complex
Ghosh, Santanu K.; Huang, Chu-Chun; Hajra, Sujata; Jayaram, Makkuni
2010-01-01
Sister chromatid cohesion, crucial for faithful segregation of replicated chromosomes in eukaryotes, is mediated by the multi-subunit protein complex cohesin. The Saccharomyces cerevisiae plasmid 2 micron circle mimics chromosomes in assembling cohesin at its partitioning locus. The plasmid is a multi-copy selfish DNA element that resides in the nucleus and propagates itself stably, presumably with assistance from cohesin. In metaphase cell lysates, or fractions enriched for their cohesed state by sedimentation, plasmid molecules are trapped topologically by the protein ring formed by cohesin. They can be released from cohesin’s embrace either by linearizing the DNA or by cleaving a cohesin subunit. Assays using two distinctly tagged cohesin molecules argue against the hand-cuff (an associated pair of monomeric cohesin rings) or the bracelet (a dimeric cohesin ring) model as responsible for establishing plasmid cohesion. Our cumulative results most easily fit a model in which a single monomeric cohesin ring, rather than a series of such rings, conjoins a pair of sister plasmids. These features of plasmid cohesion account for its sister-to-sister mode of segregation by cohesin disassembly during anaphase. The mechanistic similarities of cohesion between mini-chromosome sisters and 2 micron plasmid sisters suggest a potential kinship between the plasmid partitioning locus and centromeres. PMID:19920123
Sixt, Nathalie; Cardoso, Alicia; Vallier, Agnès; Fayolle, Joël; Buckland, Robin; Wild, T. Fabian
1998-01-01
We have studied the immune responses to the two glycoproteins of the Morbillivirus canine distemper virus (CDV) after DNA vaccination of BALB/c mice. The plasmids coding for both CDV hemagglutinin (H) and fusion protein (F) induce high levels of antibodies which persist for more than 6 months. Intramuscular inoculation of the CDV DNA induces a predominantly immunoglobulin G2a (IgG2a) response (Th1 response), whereas gene gun immunization with CDV H evokes exclusively an IgG1 response (Th2 response). In contrast, the CDV F gene elicited a mixed, IgG1 and IgG2a response. Mice vaccinated (by gene gun) with either the CDV H or F DNA showed a class I-restricted cytotoxic lymphocyte response. Immunized mice challenged intracerebrally with a lethal dose of a neurovirulent strain of CDV were protected. However, approximately 30% of the mice vaccinated with the CDV F DNA became obese in the first 2 months following the challenge. This was not correlated with the serum antibody levels. PMID:9765383
Development of Tat-Conjugated Dendrimer for Transdermal DNA Vaccine Delivery.
Bahadoran, Azadeh; Moeini, Hassan; Bejo, Mohd Hair; Hussein, Mohd Zobir; Omar, Abdul Rahman
In order to enhance cellular uptake and to facilitate transdermal delivery of DNA vaccine, polyamidoamine (PAMAM) dendrimers conjugated with HIV transactivator of transcription (TAT) was developed. First, the plasmid DNA (pIRES-H5/GFP) nanoparticle was formulated using PAMAM dendrimer and TAT peptide and then characterized for surface charge, particle size, DNA encapsulation and protection of the pIRES-H5/GFP DNA plasmid to enzymatic digestion. Subsequently, the potency of the TAT-conjugated dendrimer for gene delivery was evaluated through in vitro transfection into Vero cells followed by gene expression analysis including western blotting, fluorescent microscopy and PCR. The effect of the TAT peptide on cellular uptake of DNA vaccine was studied by qRT-PCR and flow cytometry. Finally, the ability of TAT-conjugated PAMAM dendrimer for transdermal delivery of the DNA plasmid was assessed through artificial membranes followed by qRT-PCR and flow cytometry. TAT-conjugated PAMAM dendrimer showed the ability to form a compact and nanometre-sized polyplexes with the plasmid DNA, having the size range of 105 to 115 nm and a positive charge of +42 to +45 mV over the N/P ratio of 6:1(+/-). In vitro transfection analysis into Vero cells confirms the high potency of TAT-conjugated PAMAM dendrimer to enhance the cellular uptake of DNA vaccine. The permeability value assay through artificial membranes reveals that TAT-conjugated PAMAM has more capacity for transdermal delivery of the DNA compared to unmodified PAMAM dendrimer (P<0.05). The findings of this study suggest that TAT-conjugated PAMAM dendrimer is a promising non-viral vector for transdermal use.This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.
Schmitt-Slomska, J; Caravano, R; El-Solh, N
1979-01-01
A group B streptococcus strain carrying plasmid DNA determining resistance to several drugs was converted by penicillin to cell wall (CW) defective and then to CW deficient variants (L-forms). The stable CW deficient variants became susceptible to antibiotics in study. Dye-buoyant density analysis of the DNA of CW deficient variants showed that the loss of antibiotic resistance was associated with the loss of extrachromosomal DNA.
Bipartite recognition of target RNAs activates DNA cleavage by the Type III-B CRISPR–Cas system
Elmore, Joshua R.; Sheppard, Nolan F.; Ramia, Nancy; Deighan, Trace; Li, Hong; Terns, Rebecca M.; Terns, Michael P.
2016-01-01
CRISPR–Cas systems eliminate nucleic acid invaders in bacteria and archaea. The effector complex of the Type III-B Cmr system cleaves invader RNAs recognized by the CRISPR RNA (crRNA ) of the complex. Here we show that invader RNAs also activate the Cmr complex to cleave DNA. As has been observed for other Type III systems, Cmr eliminates plasmid invaders in Pyrococcus furiosus by a mechanism that depends on transcription of the crRNA target sequence within the plasmid. Notably, we found that the target RNA per se induces DNA cleavage by the Cmr complex in vitro. DNA cleavage activity does not depend on cleavage of the target RNA but notably does require the presence of a short sequence adjacent to the target sequence within the activating target RNA (rPAM [RNA protospacer-adjacent motif]). The activated complex does not require a target sequence (or a PAM) in the DNA substrate. Plasmid elimination by the P. furiosus Cmr system also does not require the Csx1 (CRISPR-associated Rossman fold [CARF] superfamily) protein. Plasmid silencing depends on the HD nuclease and Palm domains of the Cmr2 (Cas10 superfamily) protein. The results establish the Cmr complex as a novel DNA nuclease activated by invader RNAs containing a crRNA target sequence and a rPAM. PMID:26848045
Lacks, S.A.; Balganesh, T.S.
1985-02-19
Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.
Soler, Nicolas; Marguet, Evelyne; Cortez, Diego; Desnoues, Nicole; Keller, Jenny; van Tilbeurgh, Herman; Sezonov, Guennadi; Forterre, Patrick
2010-01-01
Thermococcales (phylum Euryarchaeota) are model organisms for physiological and molecular studies of hyperthermophiles. Here we describe three new plasmids from Thermococcales that could provide new tools and model systems for genetic and molecular studies in Archaea. The plasmids pTN2 from Thermococcus nautilus sp. 30-1 and pP12-1 from Pyrococcus sp. 12-1 belong to the same family. They have similar size (∼12 kb) and share six genes, including homologues of genes encoded by the virus PAV1 from Pyrococcus abyssi. The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales. Our analyses confirm that viruses and plasmids are evolutionary related and co-evolve with their hosts. Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism. The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase. This strengthens the idea that plasmids and viruses are a reservoir of novel protein families involved in DNA replication. PMID:20403814
Cherif, Mahamoud Sama; Shuaibu, Mohammed Nasir; Kodama, Yukinobu; Kurosaki, Tomoaki; Helegbe, Gideon Kofi; Kikuchi, Mihoko; Ichinose, Akitoyo; Yanagi, Tetsuo; Sasaki, Hitoshi; Yui, Katsuyuki; Tien, Nguyen Huy; Karbwang, Juntra; Hirayama, Kenji
2014-04-07
We have previously reported the new formulation of polyethylimine (PEI) with gamma polyglutamic acid (γ-PGA) nanoparticle (NP) to have provided Plasmodium yoelii merozoite surface protein-1 (PyMSP-1) plasmid DNA vaccine with enhanced protective cellular and humoral immunity in the lethal mouse malaria model. PyGPI8p-transamidase-related protein (PyTAM) was selected as a possible candidate vaccine antigen by using DNA vaccination screening from 29 GPI anchor and signal sequence motif positive genes picked up using web-based bioinformatics tools; though the observed protection was not complete. Here, we observed augmented protective effect of PyTAM DNA vaccine by using PEI and γ-PGA complex as delivery system. NP-coated PyTAM plasmid DNA immunized mice showed a significant survival rate from lethal P. yoelii challenge infection compared with naked PyTAM plasmid or with NP-coated empty plasmid DNA group. Antigen-specific IgG1 and IgG2b subclass antibody levels, proportion of CD4 and CD8T cells producing IFN-γ in the splenocytes and IL-4, IFN-γ, IL-12 and TNF-α levels in the sera and in the supernatants from ex vivo splenocytes culture were all enhanced by the NP-coated PyTAM DNA vaccine. These data indicates that NP augments PyTAM protective immune response, and this enhancement was associated with increased DC activation and concomitant IL-12 production. Copyright © 2014 Elsevier Ltd. All rights reserved.
Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.
Kar, Indrani; Chattopadhyaya, Rajagopal
2017-11-01
The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.
Enterovirus A71 DNA-Launched Infectious Clone as a Robust Reverse Genetic Tool
Tan, Chee Wah; Tee, Han Kang; Lee, Michelle Hui Pheng; Sam, I-Ching; Chan, Yoke Fun
2016-01-01
Enterovirus A71 (EV-A71) causes major outbreaks of hand, foot and mouth disease, and is occasionally associated with neurological complications and death in children. Reverse genetics is widely used in the field of virology for functional study of viral genes. For EV-A71, such tools are limited to clones that are transcriptionally controlled by T7/SP6 bacteriophage promoter. This is often time-consuming and expensive. Here, we describe the development of infectious plasmid DNA-based EV-A71 clones, for which EV-A71 genome expression is under transcriptional control by the CMV-intermediate early promoter and SV40 transcriptional-termination signal. Transfection of this EV-A71 infectious DNA produces good virus yield similar to in vitro-transcribed EV-A71 infectious RNA, 6.4 and 5.8 log10PFU/ml, respectively. Infectious plasmid with enhanced green fluorescence protein and Nano luciferase reporter genes also produced good virus titers, with 4.3 and 5.0 log10 PFU/ml, respectively. Another infectious plasmid with both CMV and T7 promoters was also developed for easy manipulation of in vitro transcription or direct plasmid transfection. Transfection with either dual-promoter infectious plasmid DNA or infectious RNA derived from this dual-promoter clone produced infectious viral particles. Incorporation of hepatitis delta virus ribozyme, which yields precise 3’ ends of the DNA-launched EV-A71 genomic transcripts, increased infectious viral production. In contrast, the incorporation of hammerhead ribozyme in the DNA-launched EV-A71 resulted in lower virus yield, but improved the virus titers for T7 promoter-derived infectious RNA. This study describes rapid and robust reverse genetic tools for EV-A71. PMID:27617744
Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.; ...
2015-09-08
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less
Activation of a yeast replication origin near a double-stranded DNA break.
Raghuraman, M K; Brewer, B J; Fangman, W L
1994-03-01
Irradiation in the G1 phase of the cell cycle delays the onset of DNA synthesis and transiently inhibits the activation of replication origins in mammalian cells. It has been suggested that this inhibition is the result of the loss of torsional tension in the DNA after it has been damaged. Because irradiation causes DNA damage at an undefined number of nonspecific sites in the genome, it is not known how cells respond to limited DNA damage, and how replication origins in the immediate vicinity of a damage site would behave. Using the sequence-specific HO endonuclease, we have created a defined double-stranded DNA break in a centromeric plasmid in G1-arrested cells of the yeast Saccharomyces cerevisiae. We show that replication does initiate at the origin on the cut plasmid, and that the plasmid replicates early in the S phase after linearization in vivo. These observations suggest that relaxation of a supercoiled DNA domain in yeast need not inactivate replication origins within that domain. Furthermore, these observations rule out the possibility that the late replication context associated with chromosomal termini is a consequence of DNA ends.
Photoinduced silver nanoparticles/nanorings on plasmid DNA scaffolds.
Liu, Jianhua; Zhang, Xiaoliang; Yu, Mei; Li, Songmei; Zhang, Jindan
2012-01-23
Biological scaffolds are being actively explored for the synthesis of nanomaterials with novel structures and unexpected properties. Toroidal plasmid DNA separated from the Bacillus host is applied as a sacrificial mold for the synthesis of silver nanoparticles and nanorings. The photoirradiation method is applied to reduce Ag(I) on the plasmid. The nanoparticles are obtained by varying the concentration of the Ag(I) ion solution and the exposure time of the plasmid-Ag(I) complex under UV light at 254 nm and room temperature. It is found that the plasmid serves not only as a template but also as a reductant to drive the silver nucleation and deposition. The resulting nanoparticles have a face-centered cubic (fcc) crystal structure and 20-30 nm average diameter. The detailed mechanism is discussed, and other metals or alloys could also be synthesized with this method. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae
Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro
2011-01-01
Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137
Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.
Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro
2011-01-01
Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.
Tian, Ji-Yuan; Sun, Xiu-Qin; Chen, Xi-Guang
2008-05-01
Oral delivery of plasmid DNA (pDNA) is a desirable approach for fish immunization in intensive culture. However, its effectiveness is limited because of possible degradation of pDNA in the fish's digestive system. In this report, alginate microspheres loaded with pDNA coding for fish lymphocystis disease virus (LCDV) and green fluorescent protein were prepared with a modified oil containing water (W/O) emulsification method. Yield, loading percent and encapsulation efficiency of alginate microspheres were 90.5%, 1.8% and 92.7%, respectively. The alginate microspheres had diameters of less than 10 microm, and their shape was spherical. As compared to sodium alginate, a remarkable increase of DNA-phosphodiester and DNA-phosphomonoester bonds was observed for alginate microspheres loaded with pDNA by Fourier transform infrared (FTIR) spectroscopic analysis. Agarose gel electrophoresis showed a little supercoiled pDNA was transformed to open circular and linear pDNA during encapsulation. The cumulative release of pDNA in alginate microspheres was
A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement
Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.
2013-01-01
A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.
1989-01-01
Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Jufeng; Wang, Zhanli; Wei, Fang
2007-08-17
Herpes simplex virus type-1 thymidine kinase (HSV-1TK) and Escherichia coli cytosine deaminase (CD) fusion protein was designed using InsightII software. The structural rationality of the fusion proteins incorporating a series of flexible linker peptide was analyzed, and a suitable linker peptide was chosen for further investigated. The recombinant plasmid containing the coding regions of HSV-1TK and CD cDNA connected by this linker peptide coding sequence was generated and subsequently transfected into the human embryonic kidney 293 cells (HEK293). The Western blotting indicated that the recombinant fusion protein existed as a dimer with a molecular weight of approximately 90 kDa. Themore » toxicity of the prodrug on the recombinant plasmid-transfected human lung cancer cell line NCIH460 was evaluated, which showed that TKglyCD-expressing cells conferred upon cells prodrug sensitivities equivalent to that observed for each enzyme independently. Most noteworthy, cytotoxicity could be enhanced by concurrently treating TKglyCD-expressing cells with prodrugs GCV and 5-FC. The results indicate that we have successfully constructed a HSV-1TKglyCD fusion gene which might have a potential application for cancer gene therapy.« less
Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N
1978-11-16
Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.
Zylicz-Stachula, Agnieszka; Polska, Katarzyna; Skowron, Piotr; Rak, Janusz
2014-07-07
DNA strand breaks (SBs) are among the most cytotoxic forms of DNA damage, and their residual levels correlate directly with cell death. Hence, the type and amount of SBs is directly related to the efficacy of a given anticancer therapy. In this study, we describe a molecular tool that can differentiate between single (SSBs) and double (DSBs) strand breaks and also assess them quantitatively. Our method involves PCR amplification of a linear DNA fragment labeled with a sensitizing nucleotide, circularization of that fragment, and enzymatic introduction of supercoils to transform the circular relaxed form of the synthesized plasmid into a supercoiled one. After exposure of the molecule to a damaging factor, SSB and DSB levels can be easily assayed with gel electrophoresis. We applied this method to prepare an artificial plasmid labeled with 5-bromo-2'-deoxyuridine and to assay SBs photoinduced in the synthesized plasmid. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Haryati, Sri; Agung Prasetyo, Afiono; Sari, Yulia; Dharmawan, Ruben
2018-05-01
Toxoplasma gondii Surface Antigen 1 (SAG1) is often used as a diagnostic tool due to its immunodominant-specific as antigen. However, data of the Toxoplasma gondii SAG1 protein from Indonesian isolate is limited. To study the protein, genomic DNA was isolated from a Javanese acute toxoplasmosis blood samples patient. A complete coding sequence of Toxoplasma gondii SAG1 was cloned and inserted into an Escherichia coli expression plasmid and sequenced. The sequencing results were subjected to bioinformatics analysis. The Toxoplasma gondii SAG1 complete coding sequences were successfully cloned. Physicochemical analysis revealed the 336 aa of SAG1 had 34.7 kDa of weight. The isoelectric point and aliphatic index were 8.4 and 78.4, respectively. The N-terminal methionine half-life in Escherichia coli was more than 10 hours. The antigenicity, secondary structure, and identification of the HLA binding motifs also had been discussed. The results of this study would contribute information about Toxoplasma gondii SAG1 and benefits for further works willing to develop diagnostic and therapeutic strategies against the parasite.
Spiroplasma species share common DNA sequences among their viruses, plasmids and genomes.
Ranhand, J M; Nur, I; Rose, D L; Tully, J G
1987-01-01
Alkaline-Southern-blot analyses showed that a spiroplasma plasmid, pRA1, obtained from Spiroplasma citri (Maroc-R8A2), contained DNA sequences that were homologous to spiroplasma type 3 viruses (SV3) obtained from S. citri (Maroc-R8A2), S. citri (608) and S. mirum (SMCA). In addition, pRA1 and SV3(608) DNA shared common, but not necessarily related, sequences with extrachromosomal DNA derived from 11 Spiroplasma species or strains. Furthermore, SV3(608) had DNA homology with the chromosome from 6 distinct spiroplasmas but not with chromosomal DNA from eight other Spiroplasma species or strains. The biological function of these common sequences is unknown.
Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.
Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing
2016-02-02
Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.
Borthiry, Griselda R.; Antholine, William E.; Myers, Judith M.; Myers, Charles R.
2009-01-01
Chromium (Cr) is a cytotoxic metal that can be associated with a variety of types of DNA damage, including Cr-DNA adducts and strand breaks. Prior studies with purified human cytochrome b5 and NADPH :P450 reductase in reconstituted proteoliposomes (PLs) demonstrated rapid reduction of CrVI (hexavalent chromium, as CrO42− ), and the generation of CrV, superoxide (O2·−) , and hydroxyl radical (HO˙). Studies reported here examined the potential for the species produced by this system to interact with DNA. Strand breaks of purified plasmid DNA increased over time aerobically, but were not observed in the absence of O2. CrV is formed under both conditions, so the breaks are not mediated directly by CrV. The aerobic strand breaks were significantly prevented by catalase and EtOH, but not by the metal chelator diethylenetriaminepentaacetic acid (DTPA), suggesting that they are largely due to HO˙ from Cr-mediated redox cycling. EPR was used to assess the formation of Cr-DNA complexes. Following a 10-min incubation of PLs, CrO42− , and plasmid DNA, intense EPR signals at g = 5.7and g = 5.0 were observed. These signals are attributed to specific CrIII complexes with large zero field splitting (ZFS). Without DNA, the signals in the g = 5 region were weak. The large ZFS signals were not seen, when CrIIICl3 was incubated with DNA, suggesting that the CrIII–DNA interactions are different when generated by the PLs. After 24 h, a broad signal at g = 2 is attributed to CrIII complexes with a small ZFS. This g = 2 signal was observed without DNA, but it was different from that seen with plasmid. It is concluded that EPR can detect specific CrIII complexes that depend on the presence of plasmid DNA and the manner in which the CrIII is formed. PMID:18729091
1987-07-01
nontransformable Bacillus species such as B. anthracis. Our results suggest that plasmid pLS20 of Bacillus subtilis ( natto ), which promotes transfer of the...mobilizing pBC16, pLS20 mediates transfer of the B. subtills ( natto ) plasmid pLS19 and the Staphylococcus aureus plasmid pUB110. To facilitate direct...and (v) transformation of B. cereus and B. anthracis with plasmid DNA. The 55-kb plasmid, pLS20, of Bacillus subtilis ( natto ) 3335 promotes tr msfer
Preparation of Double-Stranded (Replicative Form) Bacteriophage M13 DNA.
Green, Michael R; Sambrook, Joseph
2017-11-01
The double-stranded, closed-circular, replicative form (RF) of M13 DNA is present in high copy numbers in infected cells, and its physical characteristics are essentially identical to those of closed-circular plasmid DNAs. Any of the methods commonly used to purify plasmid DNA can therefore be used to isolate M13 RF DNA. This protocol describes the isolation of M13 RF DNA by alkaline lysis from small volumes (1-2 mL) of infected bacterial cultures. The yield of DNA (1-4 mg, depending on the size of the M13 clone) is more than enough for most purposes in molecular cloning. However, should more DNA be needed, the procedure can easily be scaled up. © 2017 Cold Spring Harbor Laboratory Press.
Reversible entrapment of plasmid deoxyribonucleic acid on different chromatographic supports.
Gabor, Boštjan; Černigoj, Urh; Barut, Miloš; Štrancar, Aleš
2013-10-11
HPLC based analytical assay is a powerful technique that can be used to efficiently monitor plasmid DNA (pDNA) purity and quantity throughout the entire purification process. Anion exchange monolithic and non-porous particle based stationary phases were used to study the recovery of the different pDNA isoforms from the analytical column. Three differently sized pDNA molecules of 3.0kbp, 5.2kbp and 14.0kbp were used. Plasmid DNA was injected onto columns under the binding conditions and the separation of the isoforms took place by increasing the ionic strength of the elution buffer. While there was no substantial decrease of the recovered supercoiled and linear isoforms of the pDNA with the increase of the plasmid size and with the increase of the flow rate (recoveries in all cases larger than 75%), a pronounced decrease of the oc isoform recovery was observed. The entrapment of the oc pDNA isoform occurred under non-binding conditions as well. The partial oc isoform elution from the column could be achieved by decreasing the flow rate of the elution mobile phase. The results suggested a reversible entrapment of the oc isoform in the restrictions within the pores of the monolithic material as well as within the intra-particle space of the non-porous particles. This phenomenon was observed on both types of the stationary phase morphologies and could only be connected to the size of a void space through which the pDNA needs to migrate. A prediction of reversible pDNA entrapment was successfully estimated with the calculation of Peclet numbers, Pe, which defines the ratio between a convective and diffusive mass transport. Copyright © 2013 Elsevier B.V. All rights reserved.
Improvement of electroporation to deliver plasmid DNA into dental follicle cells
Yao, Shaomian; Rana, Samir; Liu, Dawen; Wise, Gary E.
2010-01-01
Electroporation DNA transfer is a simple and versatile approach to deliver genes. To develop an optimal electroporation protocol to deliver DNA into cells, we conducted square wave electroporation experiments with using rat dental follicle cells as follows: 1) the cells were electroporated at different electric field strengths with lac Z plasmid; 2) plasmid concentrations were tested to determine the optimal doses; 3) various concentrations of bovine serum albumin or fetal bovine serum were added to the pulsing buffer; and, 4) the pulsing durations were studied to determine the optimal duration. These experiments indicated that the optimal electroporation electric field strength was 375 V/cm, and that plasmid concentrations greater than 0.18 μg/μl were required to achieve high transfection efficiency. BSA or FBS in the pulsing buffer significantly improved cell survival and increased the number of transfected cells. The optimal pulsing duration was in the range of 45 to 120 milliseconds (ms) at 375 V/cm. Thus, an improved electroporation protocol was established by optimizing the above parameters. In turn, this electroporation protocol can be used to deliver DNA into dental follicle cells to study the roles of candidate genes in regulating tooth eruption. PMID:19830717
Johansson, Hans-Olof; Matos, Tiago; Luz, Juliana S; Feitosa, Eloi; Oliveira, Carla C; Pessoa, Adalberto; Bülow, Leif; Tjerneld, Folke
2012-04-13
Phase diagrams of poly(ethylene glycol)/polyacrylate/Na(2)SO(4) systems have been investigated with respect to polymer size and pH. Plasmid DNA from Escherichia coli can depending on pH and polymer molecular weight be directed to a poly(ethylene glycol) or to a polyacrylate-rich phase in an aqueous two-phase system formed by these polymers. Bovine serum albumin (BSA) and E. coli homogenate proteins can be directed opposite to the plasmid partitioning in these systems. Two bioseparation processes have been developed where in the final step the pDNA is partitioned to a salt-rich phase giving a total process yield of 60-70%. In one of them the pDNA is partitioned between the polyacrylate and PEG-phases in order to remove proteins. In a more simplified process the plasmid is partitioned to a PEG-phase and back-extracted into a Na(2)SO(4)-rich phase. The novel polyacrylate/PEG system allows a strong change of the partitioning between the phases with relatively small changes in composition or pH. Copyright © 2012 Elsevier B.V. All rights reserved.
Elsässer, Thilo; Brons, Stephan; Psonka, Katarzyna; Scholz, Michael; Gudowska-Nowak, Ewa; Taucher-Scholz, Gisela
2008-06-01
The investigation of fragment length distributions of plasmid DNA gives insight into the influence of localized energy distribution on the induction of DNA damage, particularly the clustering of double-strand breaks. We present an approach that determines the fragment length distributions of plasmid DNA after heavy-ion irradiation by using the Local Effect Model. We find a good agreement of our simulations with experimental fragment distributions derived from atomic force microscopy (AFM) studies by including experimental constraints typical for AFM. Our calculations reveal that by comparing the fragmentation in terms of fluence, we can uniquely distinguish the effect of different radiation qualities. For very high-LET irradiation using nickel or uranium ions, no difference between their fragment distributions can be expected for the same dose level. However, for carbon ions with an intermediate LET, the fragmentation pattern differs from the distribution for very high-LET particles. The results of the model calculations can be used to determine the optimal experimental parameters for a demonstration of the influence of track structure on primary radiation damage. Additionally, we compare the results of our model for two different plasmid geometries.
Tsai, Hsiu-Hui; Huang, Chih-Hung; Tessmer, Ingrid; Erie, Dorothy A.; Chen, Carton W.
2011-01-01
Linear chromosomes and linear plasmids of Streptomyces possess covalently bound terminal proteins (TPs) at the 5′ ends of their telomeres. These TPs are proposed to act as primers for DNA synthesis that patches the single-stranded gaps at the 3′ ends during replication. Most (‘archetypal’) Streptomyces TPs (designated Tpg) are highly conserved in size and sequence. In addition, there are a number of atypical TPs with heterologous sequences and sizes, one of which is Tpc that caps SCP1 plasmid of Streptomyces coelicolor. Interactions between the TPs on the linear Streptomyces replicons have been suggested by electrophoretic behaviors of TP-capped DNA and circular genetic maps of Streptomyces chromosomes. Using chemical cross-linking, we demonstrated intramolecular and intermolecular interactions in vivo between Tpgs, between Tpcs and between Tpg and Tpc. Interactions between the chromosomal and plasmid telomeres were also detected in vivo. The intramolecular telomere interactions produced negative superhelicity in the linear DNA, which was relaxed by topoisomerase I. Such intramolecular association between the TPs poses a post-replicational complication in the formation of a pseudo-dimeric structure that requires resolution by exchanging TPs or DNA. PMID:21109537
Demarre, Gaëlle; Chattoraj, Dhruba K
2010-05-06
DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated) sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII) of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.
Ajayi, B O; Otajevwo, F D
2012-01-01
Staphylococcus aureus and Pseudomonas aeruginosa strains were isolated from eye swab samples randomly obtained from 100 seropositive HIV/AIDS patients who reported to various anti-retroviral treatment clinics at the University of Benin Teaching Hospital and Central Hospital both based in Benin City, Nigeria. Invitro antibiotic sensitivity patterns of strains before curing were determined by the Kirby-Bauer disc diffusion technique. Resistance plasmid DNA of multidrug resistant strains was cured with 0.1% sodium dodecyl sulphate and cured strains were again subjected to in vitro antibiotic sensitivity testing. EcoRI and Hind III restriction endonuclease enzymes were used to make cuts on extracted plasmid DNA whose length sizes were then determined. A total of 36 (36.0%) strains made up of 27 (75.0%) Staphylococcus. aureus and 9 (25.0%) Pseudomonas aeruginosa were isolated of which 7 (19.4%) strains showed multidrug resistance to ciprofloxacin, pefloxacin, ofloxacine, gentamycin, tetracycline, ampicillin, chloramphenicol, nitrofurantoin and erythromycin. All seven multidrug resistant strains before curing, recorded 85.7%, 42.9%, 14.3% and 14.3% sensitivity in that decreasing order to ciprofloxacin, pefloxacin, ofloxacin and gentamycin respectively. There was 0.0% sensitivity each to tetracycline and ampicillin. After curing, there was enhanced sensitivity of 100.0%, 85.7%, 28.6% and 71.4% respectively. There was also 28.6% and 57.1% improved sensitivity to tetracycline and ampicillin after curing. Before curing, there was 76.2% average resistance to all used antibiotics and this reduced to 47.6% after curing Staph. aureus plasmid DNA. In the case of Pseudomonas aeruginosa, there was an average resistance of 76.3% before curing which fell to 42.5% after curing. EcoRI restriction enzyme gave the plasmid DNA length of Staphylococcus aureus strain 04 as 4.0Kb and this size depended upon the distance between recognition sites. Isolation of 36 (36.0%) strains of both isolates from 100 eye swabs shows the danger these organisms portend to all categories of opticians. The cheapness and high sensitivity of gentamycin justifies its use as eye drops for treatment of some eye infections. Curing of plasmid DNA is an indication that if SDS is administered to the organisms in sublethal doses, it can lead to the elimination of plasmid DNA without adverse effect on the genomic DNA of the bacterial strains.
B. O., Ajayi; F. D., Otajevwo
2012-01-01
Staphylococcus aureus and Pseudomonas aeruginosa strains were isolated from eye swab samples randomly obtained from 100 seropositive HIV/AIDS patients who reported to various anti-retroviral treatment clinics at the University of Benin Teaching Hospital and Central Hospital both based in Benin City, Nigeria. Invitro antibiotic sensitivity patterns of strains before curing were determined by the Kirby-Bauer disc diffusion technique. Resistance plasmid DNA of multidrug resistant strains was cured with 0.1% sodium dodecyl sulphate and cured strains were again subjected to invitro antibiotic sensitivity testing. EcoRI and Hind III restriction endonuclease enzymes were used to make cuts on extracted plasmid DNA whose length sizes were then determined. A total of 36 (36.0%) strains made up of 27 (75.0%) Staphylococcus. aureus and 9 (25.0%) Pseudomonas aeruginosa were isolated of which 7 (19.4%) strains showed multidrug resistance to ciprofloxacin, pefloxacin, ofloxacine, gentamycin, tetracycline, ampicillin, chloramphenicol, nitrofurantoin and erythromycin. All seven multidrug resistant strains before curing, recorded 85.7%, 42.9%, 14.3% and 14.3% sensitivity in that decreasing order to ciprofloxacin, pefloxacin, ofloxacin and gentamycin respectively. There was 0.0% sensitivity each to tetracycline and ampicillin. After curing, there was enhanced sensitivity of 100.0%, 85.7%, 28.6% and 71.4% respectively. There was also 28.6% and 57.1% improved sensitivity to tetracycline and ampicillin after curing. Before curing, there was 76.2% average resistance to all used antibiotics and this reduced to 47.6% after curing Staph. aureus plasmid DNA. In the case of Pseudomonas aeruginosa, there was an average resistance of 76.3% before curing which fell to 42.5% after curing. EcoRI restriction enzyme gave the plasmid DNA length of Staphylococcus aureus strain 04 as 4.0Kb and this size depended upon the distance between recognition sites. Isolation of 36 (36.0%) strains of both isolates from 100 eye swabs shows the danger these organisms portend to all categories of opticians. The cheapness and high sensitivity of gentamycin justifies its use as eye drops for treatment of some eye infections. Curing of plasmid DNA is an indication that if SDS is administered to the organisms in sublethal doses, it can lead to the elimination of plasmid DNA without adverse effect on the genomic DNA of the bacterial strains. PMID:22980121
NASA Astrophysics Data System (ADS)
Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad
2016-05-01
Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and 1H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol40 %) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.
Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.
2010-01-01
Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425
Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc
2004-03-01
Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.
Z-DNA binding protein from chicken blood nuclei
NASA Technical Reports Server (NTRS)
Herbert, A. G.; Spitzner, J. R.; Lowenhaupt, K.; Rich, A.
1993-01-01
A protein (Z alpha) that appears to be highly specific for the left-handed Z-DNA conformer has been identified in chicken blood nuclear extracts. Z alpha activity is measured in a band-shift assay by using a radioactive probe consisting of a (dC-dG)35 oligomer that has 50% of the deoxycytosines replaced with 5-bromodeoxycytosine. In the presence of 10 mM Mg2+, the probe converts to the Z-DNA conformation and is bound by Z alpha. The binding of Z alpha to the radioactive probe is specifically blocked by competition with linear poly(dC-dG) stabilized in the Z-DNA form by chemical bromination but not by B-form poly(dC-dG) or boiled salmon-sperm DNA. In addition, the binding activity of Z alpha is competitively blocked by supercoiled plasmids containing a Z-DNA insert but not by either the linearized plasmid or by an equivalent amount of the parental supercoiled plasmid without the Z-DNA-forming insert. Z alpha can be crosslinked to the 32P-labeled brominated probe with UV light, allowing us to estimate that the minimal molecular mass of Z alpha is 39 kDa.
Touihri, Leila; Ahmed, Sami Belhaj; Chtourou, Yacine; Daoud, Rahma; Bahloul, Chokri
2012-12-27
During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV) or distemper virus (CDV) after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV) 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an "Internal Ribosome Entry Site" (IRES) domain. The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The FMDV 2A was also efficient in the design of multivalent plasmids. In a single shot, the design of efficient multivalent plasmids will be very beneficial for DNA-based vaccination against numerous diseases.
Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P
1985-01-01
Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773
A mitochondrial mutator plasmid that causes senescence under dietary restricted conditions
Maas, Marc FPM; Hoekstra, Rolf F; Debets, Alfons JM
2007-01-01
Background Calorie or dietary restriction extends life span in a wide range of organisms including the filamentous fungus Podospora anserina. Under dietary restricted conditions, P. anserina isolates are several-fold longer lived. This is however not the case in isolates that carry one of the pAL2-1 homologous mitochondrial plasmids. Results We show that the pAL2-1 homologues act as 'insertional mutators' of the mitochondrial genome, which may explain their negative effect on life span extension. Sequencing revealed at least fourteen unique plasmid integration sites, of which twelve were located within the mitochondrial genome and two within copies of the plasmid itself. The plasmids were able to integrate in their entirety, via a non-homologous mode of recombination. Some of the integrated plasmid copies were truncated, which probably resulted from secondary, post-integrative, recombination processes. Integration sites were predominantly located within and surrounding the region containing the mitochondrial rDNA loci. Conclusion We propose a model for the mechanism of integration, based on innate modes of mtDNA recombination, and discuss its possible link with the plasmid's negative effect on dietary restriction mediated life span extension. PMID:17407571
Caufield, Page W; Saxena, Deepak; Fitch, David; Li, Yihong
2007-02-01
There are suggestions that the phylogeny of Streptococcus mutans, a member of the human indigenous biota that is transmitted mostly mother to child, might parallel the evolutionary history of its human host. The relatedness and phylogeny of plasmid-containing strains of S. mutans were examined based on chromosomal DNA fingerprints (CDF), a hypervariable region (HVR) of a 5.6-kb plasmid, the rRNA gene intergenic spacer region (IGSR), serotypes, and the genotypes of mutacin I and II. Plasmid-containing strains were studied because their genetic diversity was twice as great as that of plasmid-free strains. The CDF of S. mutans from unrelated human hosts were unique, except those from Caucasians, which were essentially identical. The evolutionary history of the IGSR, with or without the serotype and mutacin characters, clearly delineated an Asian clade. Also, a continuous association with mutacin II could be reconstructed through an evolutionary lineage with the IGSR, but not for serotype e. DNA sequences from the HVR of the plasmid produced a well-resolved phylogeny that differed from the chromosomal phylogeny, indicating that the horizontal transfer of the plasmid may have occurred multiple times. The plasmid phylogeny was more congruent with serotype e than with mutacin II evolution, suggesting a possible functional correlation. Thus, the history of this three-tiered relationship between human, bacterium, and plasmid supported both coevolution and independent evolution.
Application of methylation in improving plasmid transformation into Helicobacter pylori.
Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei
2018-05-23
Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.
Riedl, Petra; Reimann, Jörg; Schirmbeck, Reinhold
2004-02-01
We explored strategies to codeliver DNA- and peptide-based vaccines in a way that enhances the immunogenicity of both components of the combination vaccine for T cells. Specific CD8(+) T cell responses to an antigenic peptide are primed when the peptide is fused to a cationic peptide domain that is bound to plasmid DNA or oligonucleotides (ODN; with or without CpG motifs). Plasmid DNA mixed with antigenic/cationic peptides or histones forms large complexes with different biological properties depending on the molar ratios of peptide/protein and polynucleotide. Complexes containing high (but not low) molar ratios of cationic peptide to DNA facilitate transfection (DNA uptake and expression of the plasmid-encoded product) of cells. In contrast, complexes containing low (but not high) molar ratios of cationic peptide to DNA prime potent multispecific T cell responses after a single intramuscular injection of the complexes. The general validity of this observation was confirmed mixing different antigenic/cationic peptides with different DNA vaccines. In these vaccine formulations, multispecific CD8(+) T cell responses specific for epitopes of the peptide- as well as the DNA-based vaccine were efficiently coprimed, together with humoral antibody responses to conformational determinants of large viral antigens encoded by the DNA vaccine. The data indicate that mixtures of DNA vaccines with antigenic, cationic peptides are immunogenic vaccine formulations particularly suited for the induction of multispecific T cell responses.
Weiss, Julia; Ros-Chumillas, Maria; Peña, Leandro; Egea-Cortines, Marcos
2007-01-30
Recombinant DNA technology is an important tool in the development of plant varieties with new favourable features. There is strong opposition towards this technology due to the potential risk of horizontal gene transfer between genetically modified plant material and food-associated bacteria, especially if genes for antibiotic resistance are involved. Since horizontal transfer efficiency depends on size and length of homologous sequences, we investigated the effect of conditions required for orange juice processing on the stability of DNA from three different origins: plasmid DNA, yeast genomic DNA and endogenous genomic DNA from transgenic sweet orange (C. sinensis L. Osb.). Acidic orange juice matrix had a strong degrading effect on plasmid DNA which becomes apparent in a conformation change from supercoiled structure to nicked, linear structure within 5h of storage at 4 degrees C. Genomic yeast DNA was degraded during exposure to acidic orange juice matrix within 4 days, and also the genomic DNA of C. sinensis suffered degradation within 2 days of storage as indicated by amplification results from transgene markers. Standard pasteurization procedures affected DNA integrity depending on the method and time used. Our data show that the current standard industrial procedures to pasteurize orange juice as well as its acidic nature causes a strong degradation of both yeast and endogenous genomic DNA below sizes reported to be suitable for horizontal gene transfer.
The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome.
González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred; Llosa, Matxalen
2017-06-15
Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. Copyright © 2017 American Society for Microbiology.
The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome
González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred
2017-01-01
ABSTRACT Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. PMID:28411218
Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.
2016-01-01
The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid partitioning and suggest underlying biological roles shared by such elements. PMID:26865697
Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S
1987-07-01
Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.
2007-08-01
gonorrheae strain 2309 plasmid pOZ101; AF440277, Lactobacillus plantarum plasmid pMD5057; X75073, Neisseria meningitidis plasmid DNA for tet(M...tetracycline resistance tet(M) gene; AY057892, Staphylococcus aureus strain 1802 tetracycline resistance protein tet(M) gene; AY149596, Lactobacillus sakei
Erickson, J. R.; Johnston, M.
1993-01-01
We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124
Scholz, V; Weidner, J; Köhnlein, W; Frekers, D; Wörtche, H J
1997-01-01
The yield of single-strand breaks (ssb) and double-strand breaks (dsb) produced by alpha-particles at the end of their track in DNA-films was determined experimentally. Helium nuclei were accelerated to 600 keV in the 400 kV ion accelerator and scattered at a carbon target. The elastically scattered alpha-particles with energies of 344 keV and 485 keV were used to irradiate supercircular plasmid DNA in vacuo. For the dosimetry of the alpha-particles a surface barrier detector was used and the energy distribution of the alpha-particles determined. The energy loss of the particles in the DNA-layer was calculated. DNA samples were separated into the three conformational isomers using agarose gel electrophoresis. After fluorochromation the number of ssb and dsb per plasmid DNA molecule was established from the band intensities assuming the validity of Poisson statistics. Linear dose effect correlations were found for ssb and dsb per plasmid molecule. In the case of 344 keV-alpha-particles the yield of dsb was (8.6 +/- 0.9) x 10(-11) breaks/Gy x dalton. The ratio of ssb/dsb was 0.5 +/- 0.2. This is at least a factor of six larger than the ratio found in experiments with higher energy alpha-particles and from model calculations. Similar experiments with protons yielded a relative biological effectiveness (rbe) value of 2.8 for the induction of double-strand breaks by track end alpha-particles.
Fernández-López, Cris; Pluta, Radoslaw; Pérez-Luque, Rosa; Rodríguez-González, Lorena; Espinosa, Manuel; Coll, Miquel; Lorenzo-Díaz, Fabián; Boer, D Roeland
2013-07-01
A crucial element in the horizontal transfer of mobilizable and conjugative plasmids is the relaxase, a single-stranded endonuclease that nicks the origin of transfer (oriT) of the plasmid DNA. The relaxase of the pMV158 mobilizable plasmid is MobM (494 residues). In solution, MobM forms a dimer through its C-terminal domain, which is proposed to anchor the protein to the cell membrane and to participate in type 4 secretion system (T4SS) protein-protein interactions. In order to gain a deeper insight into the structural MobM requirements for efficient DNA catalysis, we studied two endonuclease domain variants that include the first 199 or 243 amino acid residues (MobMN199 and MobMN243, respectively). Our results confirmed that the two proteins behaved as monomers in solution. Interestingly, MobMN243 relaxed supercoiled DNA and cleaved single-stranded oligonucleotides harboring oriTpMV158, whereas MobMN199 was active only on supercoiled DNA. Protein stability studies using gel electrophoresis and mass spectrometry showed increased susceptibility to degradation at the domain boundary between the N- and C-terminal domains, suggesting that the domains change their relative orientation upon DNA binding. Overall, these results demonstrate that MobMN243 is capable of nicking the DNA substrate independently of its topology and that the amino acids 200 to 243 modulate substrate specificity but not the nicking activity per se. These findings suggest that these amino acids are involved in positioning the DNA for the nuclease reaction rather than in the nicking mechanism itself.
Efficient plasmid DNA cleavage by a mononuclear copper(II) complex.
Sissi, Claudia; Mancin, Fabrizio; Gatos, Maddalena; Palumbo, Manlio; Tecilla, Paolo; Tonellato, Umberto
2005-04-04
The Cu(II) complex of the ligand all-cis-2,4,6-triamino-1,3,5-trihydroxycyclohexane (TACI) is a very efficient catalyst of the cleavage of plasmid DNA in the absence of any added cofactor. The maximum rate of degradation of the supercoiled plasmid DNA form, obtained at pH 8.1 and 37 degrees C, in the presence of 48 microM TACI.Cu(II), is 2.3 x 10(-3) s(-1), corresponding to a half-life time of only 5 min for the cleavage of form I (supercoiled) to form II (relaxed circular). The dependence of the rate of plasmid DNA cleavage from the TACI.Cu(II) complex concentration follows an unusual and very narrow bell-like profile, which suggests an high DNA affinity of the complexes but also a great tendency to form unreactive dimers. The reactivity of the TACI.Cu(II) complexes is not affected by the presence of several scavengers for reactive oxygen species or when measured under anaerobic conditions. Moreover, no degradation of the radical reporter Rhodamine B is observed in the presence of such complexes. These results are consistent with the operation of a prevailing hydrolytic pathway under the normal conditions used, although the failure to obtain enzymatic religation of the linearized DNA does not allow one to rule out the occurrence of a nonhydrolytic oxygen-independent cleavage. A concurrent oxidative mechanism becomes competitive upon addition of reductants or in the presence of high levels of molecular oxygen: under such conditions, in fact, a remarkable increase in the rate of DNA cleavage is observed.
Mancha-Agresti, Pamela; de Castro, Camila Prosperi; Dos Santos, Janete S C; Araujo, Maíra A; Pereira, Vanessa B; LeBlanc, Jean G; Leclercq, Sophie Y; Azevedo, Vasco
2017-01-01
Tuberculosis (TB) remains a major threat throughout the world and in 2015 it caused the death of 1.4 million people. The Bacillus Calmette-Guérin is the only existing vaccine against this ancient disease; however, it does not provide complete protection in adults. New vaccines against TB are eminently a global priority. The use of bacteria as vehicles for delivery of vaccine plasmids is a promising vaccination strategy. In this study, we evaluated the use of, an engineered invasive Lactococcus lactis (expressing Fibronectin-Binding Protein A from Staphylococcus aureus ) for the delivery of DNA plasmid to host cells, especially to the mucosal site as a new DNA vaccine against tuberculosis. One of the major antigens documented that offers protective responses against Mycobacterium tuberculosis is the Ag85A. L. lactis FnBPA + (pValac: Ag85A) which was obtained and used for intranasal immunization of C57BL/6 mice and the immune response profile was evaluated. In this study we observed that this strain was able to produce significant increases in the amount of pro-inflammatory cytokines (IFN-γ, TNF-α, and IL-6) in the stimulated spleen cell supernatants, showing a systemic T helper 1 (Th1) cell response. Antibody production (IgG and sIgA anti-Ag85A) was also significantly increased in bronchoalveolar lavage, as well as in the serum of mice. In summary, these findings open new perspectives in the area of mucosal DNA vaccine, against specific pathogens using a Lactic Acid Bacteria such as L. lactis.
Willson, P J; Deneer, H G; Potter, A; Albritton, W
1989-01-01
An Actinobacillus pleuropneumoniae strain contained a plasmid (pHD8.1) conferring resistance to streptomycin and sulfonamide. Restriction endonuclease mapping and DNA-DNA hybridization showed that pHD8.1 is related to RSF1010 from Salmonella panama, which also confers resistance to streptomycin and sulfonamide, and to pHD148 from Haemophilus ducreyi, which confers resistance only to sulfonamide. Images PMID:2541656
Datta, Dibyadyuti; Bansal, Geetha P; Gerloff, Dietlind L; Ellefsen, Barry; Hannaman, Drew; Kumar, Nirbhay
2017-01-05
Pfs48/45 and Pfs25 are leading candidates for the development of Plasmodium falciparum transmission blocking vaccines (TBV). Expression of Pfs48/45 in the erythrocytic sexual stages and presentation to the immune system during infection in the human host also makes it ideal for natural boosting. However, it has been challenging to produce a fully folded, functionally active Pfs48/45, using various protein expression platforms. In this study, we demonstrate that full-length Pfs48/45 encoded by DNA plasmids is able to induce significant transmission reducing immune responses. DNA plasmids encoding Pfs48/45 based on native (WT), codon optimized (SYN), or codon optimized and mutated (MUT1 and MUT2), to prevent any asparagine (N)-linked glycosylation were compared with or without intramuscular electroporation (EP). EP significantly enhanced antibody titers and transmission blocking activity elicited by immunization with SYN Pfs48/45 DNA vaccine. Mosquito membrane feeding assays also revealed improved functional immunogenicity of SYN Pfs48/45 (N-glycosylation sites intact) as compared to MUT1 or MUT2 Pfs48/45 DNA plasmids (all N-glycosylation sites mutated). Boosting with recombinant Pfs48/45 protein after immunization with each of the different DNA vaccines resulted in significant boosting of antibody response and improved transmission reducing capabilities of all four DNA vaccines. Finally, immunization with a combination of DNA plasmids (SYN Pfs48/45 and SYN Pfs25) also provides support for the possibility of combining antigens targeting different life cycle stages in the parasite during transmission through mosquitoes. Copyright © 2016 Elsevier Ltd. All rights reserved.
[BLG gene knockout and hLF gene knock-in at BLG locus in goat by TALENs].
Song, Shaozheng; Zhu, Mengmin; Yuan, Yuguo; Rong, Yao; Xu, Sheng; Chen, Si; Mei, Junyan; Cheng, Yong
2016-03-01
To knock out β-lactoglobulin (BLG) gene and insert human lactoferrin (hLF) coding sequence at BLG locus of goat, the transcription activator-like effector nucleases (TALEN) mediated recombination was used to edit the BLG gene of goat fetal fibroblast, then as donor cells for somatic cell nuclear transfer. We designed a pair of specific plasmid TALEN-3-L/R for goat BLG exon III recognition sites, and BLC14-TK vector containing a negative selection gene HSV-TK, was used for the knock in of hLF gene. TALENs plasmids were transfected into the goat fetal fibroblast cells, and the cells were screened three days by 2 μg/mL puromycin. DNA cleavage activities of cells were verified by PCR amplification and DNA production sequencing. Then, targeting vector BLC14-TK and plasmids TALEN-3-L/R were co-transfected into goat fetal fibroblasts, both 700 μg/mL G418 and 2 μg/mL GCV were simultaneously used to screen G418-resistant cells. Detections of integration and recombination were implemented to obtain cells with hLF gene site-specific integration. We chose targeting cells as donor cells for somatic cell nuclear transfer. The mutagenicity of TALEN-3-L/R was between 25% and 30%. A total of 335 reconstructed embryos with 6 BLG-/hLF+ targeting cell lines were transferred into 16 recipient goats. There were 9 pregnancies confirmed by ultrasound on day 30 to 35 (pregnancy rate of 39.1%), and one of 50-day-old fetus with BLG-/hLF+ was achieved. These results provide the basis for hLF gene knock-in at BLG locus of goat and cultivating transgenic goat of low allergens and rich hLF in the milk.
Targeting with bovine CD154 enhances humoral immune responses induced by a DNA vaccine in sheep.
Manoj, Sharmila; Griebel, Philip J; Babiuk, Lorne A; van Drunen Littel-van den Hurk, Sylvia
2003-01-15
CD40-CD154 interactions play an important role in regulating humoral and cell-mediated immune responses. Recently, these interactions have been exploited for the development of therapeutic and preventive treatments. The objective of this study was to test the ability of bovine CD154 to target a plasmid-encoded Ag to CD40-expressing APCs. To achieve this, a plasmid coding for bovine CD154 fused to a truncated secreted form of bovine herpesvirus 1 glycoprotein D (tgD), pSLIAtgD-CD154, was constructed. The chimeric tgD-CD154 was expressed in vitro in COS-7 cells and reacted with both glycoprotein D- and CD154-specific Abs. Both tgD and tgD-CD154 were capable of binding to epithelial cells, whereas only tgD-CD154 bound to B cells. Furthermore, dual-labeling of ovine PBMCs revealed that tgD-CD154 was bound by primarily B cells. The functional integrity of the tgD-CD154 chimera was confirmed by the induction of both IL-4-dependent B cell proliferation and tgD-specific lymphoproliferative responses in vitro. Finally, sheep immunized with pSLIAtgD-CD154 developed a more rapid primary tgD-specific Ab response and a significantly stronger tgD-specific secondary response when compared with animals immunized with pSLIAtgD and control animals. Similarly, virus-neutralizing Ab titers were significantly higher after secondary immunization with pSLIAtgD-CD154. These results demonstrate that using CD154 to target plasmid-expressed Ag can significantly enhance immune responses induced by a DNA vaccine.
Nour, Eman H; Elsayed, Tarek R; Springael, Dirk; Smalla, Kornelia
2017-06-01
On-farm biopurification systems (BPSs) represent an efficient technology for treating pesticide-contaminated wastewater. Biodegradation by genetically adapted bacteria has been suggested to perform a major contribution to the removal of pesticides in BPSs. Recently, several studies pointed to the role of IncP-1 plasmids in the degradation of pesticides in BPSs but this was never linked with catabolic markers. Therefore, a microcosm experiment was conducted in order to examine whether changes in mobile genetic element (MGE) abundances in response to the application of phenylurea herbicide linuron are linked with changes in catabolic genes. Denaturing gradient gel electrophoresis (DGGE) fingerprints of 16S ribosomal RNA gene fragments amplified from total community (TC)-DNA suggested significant shifts in the bacterial community composition. PCR-Southern blot-based detection of genes involved in linuron hydrolysis (libA and hylA) or degradation of its metabolite 3,4-dichloroaniline (dcaQ I , dcaQ II , and ccdC) in TC-DNA showed that the abundance of the hylA gene was increased faster and stronger in response to linuron application than that of the libA gene, and that the dcaQ II gene was more abundant than the isofunctional gene dcaQ I 20 and 60 days after linuron addition. Furthermore, a significant increase in the relative abundance of the IncP-1-specific korB gene in response to linuron was recorded. Our data suggest that different bacterial populations bearing isofunctional genes coding for enzymes degrading linuron seemed to be enriched in BPSs in response to linuron and that IncP-1 plasmids might be involved in their dissemination.
Li, Meng-Nan; Zheng, Guang-Hong; Wang, Lei; Xiao, Wei; Fu, Xiao-Hua; Le, Yi-Quan; Ren, Da-Ming
2009-01-01
The discharge of recombinant DNA waste from biological laboratories into the eco-system may be one of the pathways resulting in horizontal gene transfer or "gene pollution". Heating at 100 degrees C for 5-10 min is a common method for treating recombinant DNA waste in biological research laboratories in China. In this study, we evaluated the effectiveness and the safety of the thermo-treatment method in the disposal of recombinant DNA waste. Quantitative PCR, plasmid transformation and electrophoresis technology were used to evaluate the decay/denaturation efficiency during the thermo-treatment process of recombinant plasmid, pET-28b. Results showed that prolonging thermo-treatment time could improve decay efficiency of the plasmid, and its decay half-life was 2.7-4.0 min during the thermo-treatment at 100 degrees C. However, after 30 min of thermo-treatment some transforming activity remained. Higher ionic strength could protect recombinant plasmid from decay during the treatment process. These results indicate that thermo-treatment at 100 degrees C cannot decay and inactivate pET-28b completely. In addition, preliminary results showed that thermo-treated recombinant plasmids were not degraded completely in a short period when they were discharged into an aquatic environment. This implies that when thermo-treated recombinant DNAs are discharged into the eco-system, they may have enough time to re-nature and transform, thus resulting in gene diffusion.
Interleukin-12 plasmid DNA delivery using l-thyroxine-conjugated polyethylenimine nanocarriers
NASA Astrophysics Data System (ADS)
Dehshahri, Ali; Sadeghpour, Hossein; Kazemi Oskuee, Reza; Fadaei, Mahin; Sabahi, Zahra; Alhashemi, Samira Hossaini; Mohazabieh, Erfaneh
2014-05-01
In this study, l-thyroxine was covalently grafted on 25 kDa branched polyethylenimine (PEI), and the ability of the nano-sized polyplexes for transferring plasmid encoding interleukin-12 (IL-12) gene was evaluated. As there are several problems in systemic administration of recombinant IL-12 protein, local expression of the plasmid encoding IL-12 gene inside the tumor tissue has been considered as an effective alternative approach. The l-thyroxine-conjugated PEI polyplexes were prepared using pUMVC3-hIL12 plasmid, and their transfection activity was determined in HepG2 human liver carcinoma and Neuro2A neuroblastoma cell lines. The polyplexes characterized in terms of DNA condensation ability, particle size, zeta potential, and buffering capacity as well as cytotoxicity and resistance to enzyme digestion. The results revealed that l-thyroxine conjugation of PEI increased gene transfer ability by up to two fold relative to unmodified 25 kDa PEI, the gold standard for non-viral gene delivery, with the highest increase occurring at degrees of conjugation around 10 %. pDNA condensation tests and dynamic light scattering measurements exhibited the ability of PEI conjugates to optimally condense the plasmid DNA into polyplexes in the size range around 200 nm. The modified polymers showed remarkable buffering capacity and protection against enzymatic degradation comparable to that of unmodified PEI. These results suggest that l-thyroxine conjugation of PEI is a simple modification strategy for future investigations aimed at developing a targeting gene vehicle.
Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J
2007-10-01
Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.
Martín-Blanco, E; Kornberg, T B
1993-11-16
Degenerate oligodeoxyribonucleotides were designed for both ends of the DNA-binding domain of members of the nuclear receptor superfamily. PCR amplified Drosophila melanogaster DNA was purified and cloned (DR plasmids). Genomic lambda DASH clones were identified at high stringency with an amplified DR-78 plasmid DNA and isolated. The partial sequence shows a very probable open reading frame which would encode a peptide highly homologous to members of the thyroid hormone-retinoic acid-vitamin D receptor subfamily. The fragment corresponds to a single copy gene and was mapped at position 78D of chromosome three by in situ hybridization.
Effect of cold atmospheric pressure He-plasma jet on DNA change and mutation
NASA Astrophysics Data System (ADS)
Yaopromsiri, C.; Yu, L. D.; Sarapirom, S.; Thopan, P.; Boonyawan, D.
2015-12-01
Cold atmospheric pressure plasma jet (CAPPJ) effect on DNA change was studied for assessment of its safety. The experiment utilized a home-developed CAPPJ using 100% helium to directly treat naked DNA plasmid pGFP (plasmid green fluorescent protein). A traversal electric field was applied to separate the plasma components and both dry and wet sample conditions were adopted to investigate various factor roles in changing DNA. Plasma species were measured by using optical emission spectroscopy. DNA topological form change was analyzed by gel electrophoresis. The plasma jet treated DNA was transferred into bacterial Escherichia coli cells for observing mutation. The results show that the He-CAPPJ could break DNA strands due to actions from charge, radicals and neutrals and potentially cause genetic modification of living cells.
Enzyme-linked immunosorbent assays for Z-DNA.
Thomas, M J; Strobl, J S
1988-10-01
Dot blot and transblot enzyme-linked immunosorbent assays (e.l.i.s.a.) are described which provide sensitive non-radioactive methods for screening Z-DNA-specific antisera and for detecting Z-DNA in polydeoxyribonucleotides and supercoiled plasmids. In the alkaline phosphatase dot blot e.l.i.s.a., Z-DNA, Br-poly(dG-dC).poly(dG-dC), or B-DNA, poly(dG-dC).poly(dG-dC), poly(dA-dT).poly(dA-dT), Br-poly(dI-dC).poly(dI-dC), or salmon sperm DNA were spotted onto nitrocellulose discs and baked. The e.l.i.s.a. was conducted in 48-well culture dishes at 37 degrees C using a rabbit polyclonal antiserum developed against Br-poly(dG-dC).poly(dG-dC), an alkaline phosphatase-conjugated second antibody, and p-nitrophenol as the substrate. Under conditions where antibody concentrations were not limiting, alkaline phosphatase activity was linear for 2 h. Dot blot e.l.i.s.a. conditions are described which allow quantification of Z-DNA [Br-poly(dG-dC).poly(dG-dC)] within the range 5-250 ng. Dot blot and transblot horseradish peroxidase e.l.i.s.a. are described that detect Z-DNA within supercoiled plasmid DNAs immobilized on diazophenylthioether (DPT) paper. In the transblot e.l.i.s.a., plasmid pUC8 derivatives containing 16, 24, or 32 residues of Z-DNA were electrophoresed in agarose gels and electrophoretically transferred to DPT paper. Z-DNA-antibody complexes were detected by the horseradish peroxidase-catalysed conversion of 4-chloro-1-naphthol to a coloured product that was covalently bound to the DPT paper. Z-DNA antibody reactivity was specific for supercoiled Z-DNA containing plasmids after removal of the antibodies cross-reactive with B-DNA by absorption onto native DNA-cellulose. The transblot e.l.i.s.a. was sensitive enough to detect 16 base pairs of alternating G-C residues in 100 ng of pUC8 DNA.
Suarez, D L; Schultz-Cherry, S
2000-01-01
Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.
Strategies and hurdles using DNA vaccines to fish
2014-01-01
DNA vaccinations against fish viral diseases as IHNV at commercial level in Canada against VHSV at experimental level are both success stories. DNA vaccination strategies against many other viral diseases have, however, not yet yielded sufficient results in terms of protection. There is an obvious need to combat many other viral diseases within aquaculture where inactivated vaccines fail. There are many explanations to why DNA vaccine strategies against other viral diseases fail to induce protective immune responses in fish. These obstacles include: 1) too low immunogenicity of the transgene, 2) too low expression of the transgene that is supposed to induce protection, 3) suboptimal immune responses, and 4) too high degradation rate of the delivered plasmid DNA. There are also uncertainties with regard distribution and degradation of DNA vaccines that may have implications for safety and regulatory requirements that need to be clarified. By combining plasmid DNA with different kind of adjuvants one can increase the immunogenicity of the transgene antigen – and perhaps increase the vaccine efficacy. By using molecular adjuvants with or without in combination with targeting assemblies one may expect different responses compared with naked DNA. This includes targeting of DNA vaccines to antigen presenting cells as a central factor in improving their potencies and efficacies by means of encapsulating the DNA vaccine in certain carriers systems that may increase transgene and MHC expression. This review will focus on DNA vaccine delivery, by the use of biodegradable PLGA particles as vehicles for plasmid DNA mainly in fish. PMID:24552235
Haubert, Louise; Cunha, Carlos Eduardo Pouey da; Lopes, Graciela Völz; Silva, Wladimir Padilha da
2018-05-01
The genetic basis of tetracycline resistance in a food isolate Listeria monocytogenes (Lm16) was evaluated. Resistance to tetracycline was associated with the presence of the tetM gene in plasmid DNA. The sequence of tetM showed 100% of similarity with the Enterococcus faecalis sequences found in the EMBL database, suggesting that Lm16 received this gene from E. faecalis. Various size bands were detected in the DNA plasmid analysis, the largest being approximately 54.38 kb. Transferability of the tetM gene was achieved in vitro by agar matings between Lm16 and E. faecalis JH2-2, proving the potential for the spread of tetM by horizontal gene transfer. Furthermore, the conjugation experiments were performed on the surface of processed cheese, confirming the transferability in a food matrix. PCR assays were used to confirm the identity of E. faecalis and to detect the tetM gene in transconjugant bacteria. Additionally, the minimal inhibitory concentration for tetracycline and rifampicin and plasmid profiling were performed. This is the first report of a food isolate L. monocytogenes carrying the tetM gene in plasmid DNA, and it highlights the potential risk of spreading antimicrobial resistance genes between different bacteria. Copyright © 2018 Elsevier Ltd. All rights reserved.
Chen, Baowei; Lin, Lan; Fang, Ling; Yang, Ying; Chen, Enzhong; Yuan, Ke; Zou, Shichun; Wang, Xiaowei; Luan, Tiangang
2018-05-01
The prevalence of antibiotic resistance in the modern world has raised global concerns for public health. Establishing relationships between antibiotic use and antibiotic resistance genes (ARGs) is essential to understanding the dissemination and accumulation of ARGs in a human-impacted environment. In this study, ARG profiles in the sediments from a bullfrog farm, where penicillin and amoxicillin (beta-lactams) and gentamicin (aminoglycoside) were used for prophylactic purposes, were analyzed using metagenomic approaches. Analysis of both extracellular and intracellular DNA (eDNA and iDNA) demonstrated that use of the above-mentioned antibiotics led to complex pollution of ARGs not only related to beta-lactams and aminoglycoside but also to sulfonamides, tetracyclines, and macrolides. Most of the ARGs in the sediments from the bullfrog farm were likely carried by plasmids. A significant correlation was observed between the total abundance of ARG-related plasmids and that of plasmid-carrying ARGs. Approximately 85% of the plasmids likely present in the sediment from the bullfrog farm possessed at least 3 ARG subtypes, which conferred the resistance of bacterial hosts to different antibiotic categories. Our results suggest that antibiotics could lead to complex pollution of ARGs unrelated to those administered due to the concurrence of ARGs in the plasmids. Copyright © 2018. Published by Elsevier Ltd.
Gunge, N; Murata, K; Sakaguchi, K
1982-01-01
Protoplasts of Saccharomyces cerevisiae were mixed with linear DNA plasmids, pGKl1 and pGKl2, isolated from a Kluyveromyces lactis killer strain and treated with polyethylene glycol. Out of 2,000 colonies regenerated on a nonselective medium, two killer transformants were obtained. The pGKl plasmids and the killer character were stably maintained in one (Pdh-1) of them. Another transformant, Pdl-1, was a weak killer, and the subclones consisted of a mixture of weak and nonkiller cells. The weak killers were characterized by the presence of pGKl1 in a decreased amount, and nonkillers were characterized by the absence of pGKl1. The occurrence of two new plasmids which migrated faster than pGKl1 in an agarose gel was observed in Pdl-1 and its subclones, whether weak or nonkillers. Staining with 4',6-diamidino-2-phenylindole revealed that the pGKl plasmids exist in the cytosol of transformant cells with numerous copy numbers. Images PMID:7045080
Metronidazole activation and isolation of Clostridium acetobutylicum electron transport genes.
Santangelo, J D; Jones, D T; Woods, D R
1991-01-01
An Escherichia coli F19 recA, nitrate reductase-deficient mutant was constructed by transposon mutagenesis and shown to be resistant to metronidazole. This mutant was a most suitable host for the isolation of Clostridium acetobutylicum genes on recombinant plasmids, which activated metronidazole and rendered the E. coli F19 strain sensitive to metronidazole. Twenty-five E. coli F19 clones containing different recombinant plasmids were isolated and classified into five groups on the basis of their sensitivity to metronidazole. The clones were tested for nitrate reductase, pyruvate-ferredoxin oxidoreductase, and hydrogenase activities. DNA hybridization and restriction endonuclease mapping revealed that four of the C. acetobutylicum insert DNA fragments on recombinant plasmids were linked in an 11.1-kb chromosomal fragment. DNA sequencing and amino acid homology studies indicated that this DNA fragment contained a flavodoxin gene which encoded a protein of 160 amino acids that activated metronidazole and made the E. coli F19 mutant very sensitive to metronidazole. The flavodoxin and hydrogenase genes which are involved in electron transfer systems were linked on the 11.1-kb DNA fragment from C. acetobutylicum. Images PMID:1991710
☆DNA assembly technique simplifies the construction of infectious clone of fowl adenovirus.
Zou, Xiao-Hui; Bi, Zhi-Xiang; Guo, Xiao-Juan; Zhang, Zun; Zhao, Yang; Wang, Min; Zhu, Ya-Lu; Jie, Hong-Ying; Yu, Yang; Hung, Tao; Lu, Zhuo-Zhuang
2018-07-01
Plasmid bearing adenovirus genome is generally constructed with the method of homologous recombination in E. coli BJ5183 strain. Here, we utilized Gibson gene assembly technique to generate infectious clone of fowl adenovirus 4 (FAdV-4). Primers flanked with partial inverted terminal repeat (ITR) sequence of FAdV-4 were synthesized to amplify a plasmid backbone containing kanamycin-resistant gene and pBR322 origin (KAN-ORI). DNA assembly was carried out by combining the KAN-ORI fragment, virus genomic DNA and DNA assembly master mix. E. coli competent cells were transformed with the assembled product, and plasmids (pKFAV4) were extracted and confirmed to contain viral genome by restriction analysis and sequencing. Virus was successfully rescued from linear pKFAV4-transfected chicken LMH cells. This approach was further verified in cloning of human adenovirus 5 genome. Our results indicated that DNA assembly technique simplified the construction of infectious clone of adenovirus, suggesting its possible application in virus traditional or reverse genetics. Copyright © 2018 Elsevier B.V. All rights reserved.
Lord, Megan S; Ellis, April L; Farrugia, Brooke L; Whitelock, John M; Grenett, Hernan; Li, Chuanyu; O'Grady, Robert L; DeCarlo, Arthur A
2017-03-28
The repair of dermal wounds, particularly in the diabetic population, poses a significant healthcare burden. The impaired wound healing of diabetic wounds is attributed to low levels of endogenous growth factors, including vascular endothelial growth factor (VEGF), that normally stimulate multiple phases of wound healing. In this study, chitosan scaffolds were prepared via freeze drying and loaded with plasmid DNA encoding perlecan domain I and VEGF189 and analyzed in vivo for their ability to promote dermal wound healing. The plasmid DNA encoding perlecan domain I and VEGF189 loaded scaffolds promoted dermal wound healing in normal and diabetic rats. This treatment resulted in an increase in the number of blood vessels and sub-epithelial connective tissue matrix components within the wound beds compared to wounds treated with chitosan scaffolds containing control DNA or wounded controls. These results suggest that chitosan scaffolds containing plasmid DNA encoding VEGF189 and perlecan domain I have the potential to induce angiogenesis and wound healing. Copyright © 2017 Elsevier B.V. All rights reserved.
Kasarjian, Julie K. A.; Iida, Masatake; Ryu, Junichi
2003-01-01
The presence of restriction enzymes in bacterial cells has been predicted by either classical phage restriction-modification (R-M) tests, direct in vitro enzyme assays or more recently from bacterial genome sequence analysis. We have applied phage R-M test principles to the transformation of plasmid DNA and established a plasmid R-M test. To validate this test, six plasmids that contain BamHI fragments of phage lambda DNA were constructed and transformed into Escherichia coli strains containing known R-M systems including: type I (EcoBI, EcoAI, Eco124I), type II (HindIII) and type III (EcoP1I). Plasmid DNA with a single recognition site showed a reduction of relative efficiency of transformation (EOT = 10–1–10–2). When multiple recognition sites were present, greater reductions in EOT values were observed. Once established in the cell, the plasmids were subjected to modification (EOT = 1.0). We applied this test to screen E.coli clinical strains and detected the presence of restriction enzymes in 93% (14/15) of cells. Using additional subclones and the computer program, RM Search, we identified four new restriction enzymes, Eco377I, Eco585I, Eco646I and Eco777I, along with their recognition sequences, GGA(8N)ATGC, GCC(6N)TGCG, CCA(7N)CTTC, and GGA(6N)TATC, respectively. Eco1158I, an isoschizomer of EcoBI, was also found in this study. PMID:12595571
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin-Ortigosa, Susana; Valenstein, Justin S.; Lin, Victor S.-Y.
2012-09-11
The synthesis and characterization of a gold nanoparticle functionalized mesoporous silica nanoparticle (Au-MSN) platform for codelivery of proteins and plasmid DNA to plant tissues using a biolistic particle delivery system is reported. The in vitro uptake and release profiles of fluorescently labeled bovine serum albumin (BSA) and enhanced green fluorescent protein (eGFP) are investigated. As a proof-of-concept demonstration, Au-MSN with large average pore diameters (10 nm) are shown to deliver and subsequently release proteins and plasmid DNA to the same cell after passing through the plant cell wall upon bombardment. Release of fluorescent eGFP indicates the delivery of active, non-denaturedmore » proteins to plant cells. This advance represents the first example of biolistic-mediated codelivery of proteins and plasmid DNA to plant cells via gold-functionalized MSN and provides a powerful tool for both fundamental and applied research of plant sciences.« less
Anti-cancer efficacy of biotinylated chitosan nanoparticles in liver cancer
Dai, Dejian; Hou, Yiming
2017-01-01
The present study investigated the synthesis of biotinylated chitosan (Bio-CS) from chitosan using a nanomaterial skeleton with biotin and the successful targeting of the formulation in liver cancer cells. Bio-CS was validated by fourier transformed infrared spectroscopy and hydrogen-1 nuclear magnetic resonance spectroscopy. Bio-CS and plasmid DNA were used to construct Bio-CS/plasmid DNA nanoparticles according to the optimal molar ratio of 1:1 and the optimal pH-value of 5.5. Under these conditions, the parameters mean particle size, potential, encapsulation rate and drug loading, were 82.9 nm, +21.8 mV, 85.7% and 35.4%, respectively. Bio-CS exhibited an apparent liver cancer targeting effect in vitro and in vivo, as demonstrated by confocal laser scanning, green fluorescent protein transfection, and in vivo imaging assays. In addition, the Bio-CS/plasmid DNA nanoparticles significantly increased the survival period of the orthotropic liver cancer mouse model compared with the plasmid DNA, with no apparent side effects on the cells. Bio-CS nanomaterials stimulated an immune response in hepatoma cells via increased expression of GM-CSF, IL-21 and Rae-1 markers. The data suggest that Bio-CS increased the inhibition of liver cancer cell proliferation in vitro and the activation of the cellular immunity in vivo. PMID:28938619
Toyota, Akie; Akiyama, Hiroshi; Sugimura, Mitsunori; Watanabe, Takahiro; Kikuchi, Hiroyuki; Kanamori, Hisayuki; Hino, Akihiro; Esaka, Muneharu; Maitani, Tamio
2006-04-01
Because the labeling of grains and feed- and foodstuffs is mandatory if the genetically modified organism (GMO) content exceeds a certain level of approved genetically modified varieties in many countries, there is a need for a rapid and useful method of GMO quantification in food samples. In this study, a rapid detection system was developed for Roundup Ready Soybean (RRS) quantification using a combination of a capillary-type real-time PCR system, a LightCycler real-time PCR system, and plasmid DNA as the reference standard. In addition, we showed for the first time that the plasmid and genomic DNA should be similar in the established detection system because the PCR efficiencies of using plasmid DNA and using genomic DNA were not significantly different. The conversion factor (Cf) to calculate RRS content (%) was further determined from the average value analyzed in three laboratories. The accuracy and reproducibility of this system for RRS quantification at a level of 5.0% were within a range from 4.46 to 5.07% for RRS content and within a range from 2.0% to 7.0% for the relative standard deviation (RSD) value, respectively. This system rapidly monitored the labeling system and had allowable levels of accuracy and precision.
Plasmid incidence in bacteria from deep subsurface sediments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fredrickson, J.K.; Hicks, R.J.; Li, S.W.
Bacteria were isolated from deep terrestrial subsurface sediments underlying the coastal plain of South Carolina. A total of 163 isolates from deep sediments, surface soil, and return drill muds were examined for plasmid DNA content and resistance to the antibiotics penicillin, ampicillin, carbenicillin, streptomycin, kanamycin, and tetracycline. MICs of Cu{sup 2+}, Cr{sup 3+}, and Hg{sup 2+} for each isolate were also determined. The overall frequency of plasmid occurrence in the subsurface bacteria was 33%. Resistance was most frequent to penicillin (70% of all isolates), ampicillin (49%), and carbenicillin (32%) and was concluded to be related to the concentrations of themore » individual antibiotics in the disks used for assaying resistance and to the production of low levels of {beta}-lactamase. The frequencies of resistance to penicillin and ampicillin were significantly greater for isolates bearing plasmids than for plasmidless isolates; however, resistance was not transferable to penicillin-sensitive Escherichia coli. Hybridization of subsurface bacterial plasmids and chromosomal DNA with a whole-TOL-plasmid (pWWO) probe revealed some homology of subsurface bacterial plasmid and chromosomal DNAs, indicating a potential for those bacterial to harbor catabolic genes on plasmids or chromosomes. The incidences of antibiotic resistance and MICs of metals for subsurface bacteria were significantly different from those drill mud bacteria, ruling out the possibility that bacteria from sediments were derived from drill muds.« less
Clark, Nancye; Patel, Jean B.
2013-01-01
Vancomycin-resistant Staphylococcus aureus (VRSA) is thought to result from the in vivo conjugative transfer of a vanA plasmid from an Enterococcus sp. to S. aureus. We studied bacterial isolates from VRSA cases that occurred in the United States to identify microbiological factors which may contribute to this plasmid transfer. First, vancomycin-susceptible, methicillin-resistant S. aureus (MRSA) isolates from five VRSA cases were tested for their ability to accept foreign DNA by conjugation in mating experiments with Enterococcus faecalis JH2-2 containing pAM378, a pheromone-response conjugative plasmid. All of the MRSA isolates accepted the plasmid DNA with similar transfer efficiencies (∼10−7/donor CFU) except for one isolate, MRSA8, for which conjugation was not successful. The MRSA isolates were also tested as recipients in mating experiments between an E. faecalis isolate with an Inc18-like vanA plasmid that was isolated from a VRSA case patient. Conjugative transfer was successful for 3/5 MRSA isolates. Successful MRSA recipients carried a pSK41-like plasmid, a staphylococcal conjugative plasmid, whereas the two unsuccessful MRSA recipients did not carry pSK41. The transfer of a pSK41-like plasmid from a successful MRSA recipient to the two unsuccessful recipients resulted in conjugal transfer of the Inc18-like vanA plasmid from E. faecalis at a frequency of 10−7/recipient CFU. In addition, conjugal transfer could be achieved for pSK41-negative MRSA in the presence of a cell-free culture filtrate from S. aureus carrying a pSK41-like plasmid at a frequency of 10−8/recipient CFU. These results indicated that a pSK41-like plasmid can facilitate the transfer of an Inc18-like vanA plasmid from E. faecalis to S. aureus, possibly via an extracellular factor produced by pSK41-carrying isolates. PMID:23089754
Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A; Agu, Chukwuma A; Wang, Xindan; Bernal, Juan A; Sherratt, David J; de la Cueva-Méndez, Guillermo
2014-02-18
Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid-bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs.
Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A.; Agu, Chukwuma A.; Wang, Xindan; Bernal, Juan A.; Sherratt, David J.; de la Cueva-Méndez, Guillermo
2014-01-01
Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid–bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs. PMID:24449860
Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features
NASA Astrophysics Data System (ADS)
Vernon, Matthew Martin
Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.
Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O
2011-07-01
Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.
CRISPR/Cas9 Inhibits Multiple Steps of HIV-1 Infection.
Yin, Lijuan; Hu, Siqi; Mei, Shan; Sun, Hong; Xu, Fengwen; Li, Jian; Zhu, Weijun; Liu, Xiaoman; Zhao, Fei; Zhang, Di; Cen, Shan; Liang, Chen; Guo, Fei
2018-05-09
CRISPR/Cas9 is an adaptive immune system where bacteria and archaea have evolved to resist the invading viruses and plasmid DNA by creating site-specific double-strand breaks in DNA. This study tested this gene editing system in inhibiting human immunodeficiency virus type 1 (HIV-1) infection by targeting the viral long terminal repeat and the gene coding sequences. Strong inhibition of HIV-1 infection by Cas9/gRNA was observed, which resulted not only from insertions and deletions (indels) that were introduced into viral DNA due to Cas9 cleavage, but also from the marked decrease in the levels of the late viral DNA products and the integrated viral DNA. This latter defect might have reflected the degradation of viral DNA that has not been immediately repaired after Cas9 cleavage. It was further observed that Cas9, when solely located in the cytoplasm, inhibits HIV-1 as strongly as the nuclear Cas9, except that the cytoplasmic Cas9 does not act on the integrated HIV-1 DNA and thus cannot be used to excise the latent provirus. Together, the results suggest that Cas9/gRNA is able to target and edit HIV-1 DNA both in the cytoplasm and in the nucleus. The inhibitory effect of Cas9 on HIV-1 is attributed to both the indels in viral DNA and the reduction in the levels of viral DNA.
Irradiation of DNA loaded with platinum containing molecules by fast atomic ions C(6+) and Fe(26+).
Usami, N; Kobayashi, K; Furusawa, Y; Frohlich, H; Lacombe, S; Sech, C Le
2007-09-01
In order to study the role of the Linear Energy Transfer (LET) of fast atomic ions in platinum-DNA complexes inducing breaks, DNA Plasmids were irradiated by C(6+) and Fe(26+) ions. DNA Plasmids (pBR322) loaded with different amounts of platinum contained in a terpyridine-platinum molecule (PtTC) were irradiated by C(6+) ions and Fe(26+) ions. The LET values ranged between 13.4 keV/microm and 550 keV/microm. In some experiments, dimethyl sulfoxide (DMSO) was added. In all experiments, a significant increase in DNA strand breaks was observed when platinum was present. The yield of breaks induced per Gray decreased when the LET increased. The yield of single and double strand breaks per plasmid per track increased with the LET, indicating that the number of DNA breaks per Gray was related to the number of tracks through the medium. These findings show that more DNA breaks are induced by atomic ions when platinum is present. This effect increases for low LET heavy atoms. As DSB induction may induce cell death, these results could open new perspectives with the association of hadrontherapy and chemotherapy. Thus the therapeutic index might be improved by loading the tumour with platinum salts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo
Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less
Katsy, E I; Petrova, L P
2015-12-01
Alphaproteobacteria of the species Azospirillum brasilense have a multicomponent genome that undergoes frequent spontaneous rearrangements, yielding changes in the plasmid profiles of strains. Specifically, variants (Cd, Sp7.K2, Sp7.1, Sp7.4, Sp7.8, etc.) of the type strainA. brasilense Sp7 that had lost a 115-MDa plasmid were previously selected. In many of them, the molecular weight of a 90-MDa plasmid (p90 or pRhico), which is a kind of "depot" for glycopolymer biosynthesis genes, increased. In this study, a collection of primers was designed to the plasmid pRhico and to the DNA of prophage phiAb-Cd integrated in it. The use ofthese primers in polymerase chain reactions allowed the detection of the probable excision of phiAb-Cd phage from the DNA of A. brasilense variants Sp7.4 and Sp7.8 and other alterations of the pRhico structure in A. brasilense strains Cd, Sp7.K2, and Sp7.8. The developed primers and PCR conditions may be recoin mended for primary analysis of spontaneous plasmid rearrangements in A. brasilense Sp7 and related strains.
Li, Xiaobin; Xie, Yingzhou; Liu, Meng; Tai, Cui; Sun, Jingyong; Deng, Zixin; Ou, Hong-Yu
2018-05-04
oriTfinder is a web server that facilitates the rapid identification of the origin of transfer site (oriT) of a conjugative plasmid or chromosome-borne integrative and conjugative element. The utilized back-end database oriTDB was built upon more than one thousand known oriT regions of bacterial mobile genetic elements (MGEs) as well as the known MGE-encoding relaxases and type IV coupling proteins (T4CP). With a combination of similarity searches for the oriTDB-archived oriT nucleotide sequences and the co-localization of the flanking relaxase homologous genes, the oriTfinder can predict the oriT region with high accuracy in the DNA sequence of a bacterial plasmid or chromosome in minutes. The server also detects the other transfer-related modules, including the potential relaxase gene, T4CP gene and the type IV secretion system gene cluster, and the putative genes coding for virulence factors and acquired antibiotic resistance determinants. oriTfinder may contribute to meeting the increasing demands of re-annotations for bacterial conjugative, mobilizable or non-transferable elements and aid in the rapid risk accession of disease-relevant trait dissemination in pathogenic bacteria of interest. oriTfinder is freely available to all users without any login requirement at http://bioinfo-mml.sjtu.edu.cn/oriTfinder.
Sri Lakshmi Sunita, M; Prashant, S; Bramha Chari, P V; Nageswara Rao, S; Balaravi, Padma; Kavi Kishor, P B
2012-01-01
In the present study, 44 arsenic-resistant bacteria were isolated through serial dilutions on agar plate with concentrations ≥0.05 mM of sodium arsenite and ≥10 mM of sodium arsenate from Mandovi and Zuari--estuarine water systems. The ars genotype characterization in 36 bacterial isolates (resistant to 100 mM of sodium arsenate) revealed that only 17 isolates harboured the arsA (ATPase), B (arsenite permease) and C (arsenate reductase) genes on the plasmid DNA. The arsA, B and C genes were individually detected using PCR in 16, 9 and 13 bacterial isolates respectively. Molecular identification of the 17 isolates bearing the ars genotype was carried using 16S rDNA sequencing. A 1300 bp full length arsB gene encoding arsenite efflux pump and a 409 bp fragment of arsC gene coding for arsenate reductase were isolated from the genera Halomonas and Acinetobacter. Phylogenetic analysis of arsB and arsC genes indicated their close genetic relationship with plasmid borne ars genes of E. coli and arsenate reductase of plant origin. The putative arsenate reductase gene isolated from Acinetobacter species complemented arsenate resistance in E. coli WC3110 and JM109 validating its function. This study dealing with isolation of native arsenic-resistant bacteria and characterization of their ars genes might be useful to develop efficient arsenic detoxification strategies for arsenic contaminated aquifers.
The antiviral defense mechanisms in mandarin fish induced by DNA vaccination against a rhabdovirus.
Chen, Zhong-Yuan; Lei, Xiao-Ying; Zhang, Qi-Ya
2012-06-15
Plasmid DNAs containing Siniperca chuatsi rhabdovirus (SCRV) glycoprotein gene (pcDNA-G) and nucleoprotein gene (pcDNA-N) were constructed, and used to determine the antiviral immune response elicited by DNA vaccination in mandarin fish. In vitro and in vivo expression of the plasmid constructs was confirmed in transfected cells and muscle tissues of vaccinated fish by Western blot, indirect immunofluorescence or RT-PCR analysis. Fish injected with pcDNA-G exhibited protective effect against SCRV challenge with a relative percent survival (RPS) of 77.5%, but no significant protection (RPS of 2.5%) was observed in fish vaccinated with pcDNA-N. Immunohistochemical analysis showed that vaccination with pcDNA-G decreased histological lesions and suppressed the virus replication in fish target organs, e.g. kidney, liver, spleen, gill and heart. Transcriptional analysis further revealed that the expression levels of type I IFN system genes including interferon regulation factor-7 (IRF-7) gene, myxovirus resistance (Mx) gene and virus inhibitory protein (Viperin) gene were strongly up-regulated after injection with pcDNA-G, whereas the level of transcription of immunoglobulin M (IgM) gene did not show a statistically significant change. These results reveal that type I IFN antiviral immune response is rapidly triggered by the plasmid DNA containing rhabdovirus glycoprotein gene in fish, which offers an explanation of molecular mechanisms for DNA vaccination inducing mandarin fish resist to SCRV disease. Copyright © 2011 Elsevier B.V. All rights reserved.
Saccharomyces cerevisiae Shuttle vectors.
Gnügge, Robert; Rudolf, Fabian
2017-05-01
Yeast shuttle vectors are indispensable tools in yeast research. They enable cloning of defined DNA sequences in Escherichia coli and their direct transfer into Saccharomyces cerevisiae cells. There are three types of commonly used yeast shuttle vectors: centromeric plasmids, episomal plasmids and integrating plasmids. In this review, we discuss the different plasmid systems and their characteristic features. We focus on their segregational stability and copy number and indicate how to modify these properties. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Li, Wei; Ma, Le; Guo, Li-Ping; Wang, Xiao-Lei; Zhang, Jing-Wei; Bu, Zhi-Gao; Hua, Rong-Hong
2017-06-12
West Nile virus (WNV) is a neurotropic pathogen which causes zoonotic disease in humans. Recently, there have been an increasing number of infected cases and there are no clinically approved vaccines or effective drugs to treat WNV infections in humans. The purpose of this study was to facilitate vaccine and antiviral drug discovery by developing a packaging cell line-restricted WNV infectious replicon particle system. We constructed a DNA-based WNV replicon lacking the C-prM-E coding region and replaced it with a GFP coding sequence. To produce WNV replicon particles, cell lines stably-expressing prM-E and C-prM-E were constructed. When the WNV replicon plasmid was co-transfected with a WNV C-expressing plasmid into the prM-E-expressing cell line or directly transfected the C-prM-E expressing cell line, the replicon particle was able to replicate, form green fluorescence foci, and exhibit cytopathic plaques similar to that induced by the wild type virus. The infectious capacity of the replicon particles was restricted to the packaging cell line as the replicons demonstrated only one round of infection in other permissive cells. Thus, this system provides a safe and convenient reporter WNV manipulating tool which can be used to study WNV viral invasion mechanisms, neutralizing antibodies and antiviral efficacy.
Scorza, T.; Grubb, K.; Smooker, P.; Rainczuk, A.; Proll, D.; Spithill, T. W.
2005-01-01
A major goal of current malaria vaccine programs is to develop multivalent vaccines that will protect humans against the many heterologous malaria strains that circulate in endemic areas. We describe a multiepitope DNA vaccine, derived from a genomic Plasmodium chabaudi adami DS DNA expression library of 30,000 plasmids, which induces strain-transcending immunity in mice against challenge with P. c. adami DK. Segregation of this library and DNA sequence analysis identified vaccine subpools encoding open reading frames (ORFs)/peptides of >9 amino acids [aa] (the V9+ pool, 303 plasmids) and >50 aa (V50+ pool, 56 plasmids), respectively. The V9+ and V50+ plasmid vaccine subpools significantly cross-protected mice against heterologous P. c. adami DK challenge, and protection correlated with the induction of both specific gamma interferon production by splenic cells and opsonizing antibodies. Bioinformatic analysis showed that 22 of the V50+ ORFs were polypeptides conserved among three or more Plasmodium spp., 13 of which are predicted hypothetical proteins. Twenty-nine of these ORFs are orthologues of predicted Plasmodium falciparum sequences known to be expressed in the blood stage, suggesting that this vaccine pool encodes multiple blood-stage antigens. The results have implications for malaria vaccine design by providing proof-of-principle that significant strain-transcending immunity can be induced using multiepitope blood-stage DNA vaccines and suggest that both cellular responses and opsonizing antibodies are necessary for optimal protection against P. c. adami. PMID:15845504
The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit
Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.
2013-01-01
IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419
An efficient transgenic system by TA cloning vectors and RNAi for C. elegans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako
2006-11-03
In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less
Somyoonsap, Peechapack; Kitpreechavanich, Vichein
2013-01-01
A sequence-specific nicking endonuclease from Streptomyces designated as DC13 was purified to near homogeneity. Starting with 30 grams of wet cells, the enzyme was purified by ammonium sulfate fractionation, DEAE cellulose, and phenyl-Sepharose chromatography. The purified protein had a specific activity 1000 units/mg and migrated on SDS-PAGE gel with an estimated molecular weight of 71 kDa. Determination of subunit composition by gel filtration chromatography indicated that the native enzyme is a monomer. When incubated with different DNA substrates including pBluescript II KS, pUC118, pET-15b, and pET-26b, the enzyme converted these supercoiled plasmids to a mixture of open circular and linear DNA products, with the open circular DNA as the major cleavage product. Analysis of the kinetic of DNA cleavage showed that the enzyme appeared to cleave super-coiled plasmid in two distinct steps: a rapid cleavage of super-coiled plasmid to an open circular DNA followed a much slower step to linear DNA. The DNA cleavage reaction of the enzyme required Mg2+ as a cofactor. Based on the monomeric nature of the enzyme, the kinetics of DNA cleavage exhibited by the enzyme, and cofactor requirement, it is suggested here that the purified enzyme is a sequence-specific nicking endonuclease that is similar to type IIS restriction endonuclease. PMID:25937959
Purification of influenza deoxyribonucleic acid-based vaccine using agmatine monolith.
Bicho, D; Caramelo-Nunes, C; Sousa, A; Sousa, F; Queiroz, J A; Tomaz, C T
2016-02-15
Lately, researchers have made several efforts to improve vaccine production to fight highly contagious respiratory diseases like influenza. One of the most promising options for reducing the impact of this virus is DNA vaccination. However, a large quantity of highly pure plasmid DNA (pDNA) is necessary to attain this goal. The present work describes the production and purification of the plasmid NTC7482-41H-VA2HA expressing influenza virus hemagglutinin using an agmatine monolith. This ligand was chosen to purify supercoiled (sc) pDNA from complex lysates because of its versatile multimodal character. Its natural intervention in several biological systems together with its similarity with the highly studied arginine ligand allowed the development of a simpler and more specific purification process. Agmatine works under two strategies: descending ammonium sulfate gradient and ascending sodium chloride gradient. Furthermore, pH manipulation revealed an important role in pDNA isoforms selectivity. Dynamic binding capacity (DBC) experiments were performed varying different parameters and showed an increase with pDNA concentration, while high flow rate and high pH had the opposite effect. Sc pDNA was purified with high yield and was efficient with respect to cell transfection and cell viability. This monolith showed to be appropriate to purify the plasmid NTC7482-41H-VA2HA, providing a valuable tool for pDNA influenza vaccines preparation. Copyright © 2016. Published by Elsevier B.V.
Tiwari, Purushottam Babu; Annamalai, Thirunavukkarasu; Cheng, Bokun; Narula, Gagandeep; Wang, Xuewen; Tse-Dinh, Yuk-Ching; He, Jin; Darici, Yesim
2014-01-01
To date, the bacterial DNA topoisomerases are one of the major target biomolecules for the discovery of new antibacterial drugs. DNA topoisomerase regulates the topological state of DNA, which is very important for replication, transcription and recombination. The relaxation of negatively supercoiled DNA is catalyzed by bacterial DNA topoisomerase I (topoI) and this reaction requires Mg2+. In this report, we first quantitatively studied the intermolecular interactions between Escherichia coli topoisomerase I (EctopoI) and pBAD/Thio supercoiled plasmid DNA using surface plasmon resonance (SPR) technique. The equilibrium dissociation constant (Kd) for EctopoI-pBAD/Thio interactions is determined to be about 8 nM. We then studied the effect of Mg2+ on the catalysis of EctopoI-pBAD/Thio reaction. A slightly higher equilibrium dissociation constant (~15 nM) was obtained for Mg2+ coordinated EctopoI (Mg2+EctopoI)-pBAD/Thio interactions. In addition, we observed a larger dissociation rate constant (kd) for Mg2+EctopoI-pBAD/Thio interactions (~0.043 s−1), compared to EctopoI-pBAD/Thio interactions (~0.017 s−1). These results suggest that enzyme turnover during plasmid DNA relaxation is enhanced due to the presence of Mg2+ and furthers the understanding of importance of the Mg2+ ion for bacterial topoisomerase I catalytic activity. PMID:24530905
Agrobacterium-mediated transformation of lipomyces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Ziyu; Magnuson, Jon K.; Deng, Shuang
This disclosure provides Agrobacterium-mediated transformation methods for the oil-producing (oleaginous) yeast Lipomyces sp., as well as yeast produced by the method. Such methods utilize Agrobacterium sp. cells that have a T-DNA binary plasmid, wherein the T-DNA binary plasmid comprises a first nucleic acid molecule encoding a first protein and a second nucleic acid molecule encoding a selective marker that permits growth of transformed Lipomyces sp. cells in selective culture media comprising an antibiotic.
Survey of Navy Funded Marine Mammal Research and Studies FY 00-01
2001-05-10
protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to
Zhang, Yan; Li, Wenhua; Wang, Liming; Shen, Ping; Xie, Zhixiong
2013-11-01
Artificial plasmid DNA transformation of Escherichia coli induced by calcium chloride is a routine technique in molecular biology and genetic engineering processes, but its mechanism has remained elusive. Because adenosine monophosphate (AMP) has been found to regulate natural transformation in Haemophilus influenza, we aimed to investigate the effects of AMP and its derivatives on E. coli transformation by treating competence with different concentrations of them. Analysis of the transformation efficiencies revealed that AMP inhibited the artificial plasmid DNA transformation of E. coli in a concentration- and time-dependent manner. Furthermore, we found that AMP had no effect on the expression of the transformed gene but that the intracellular AMP level of the competent cells rose after a 6 h treatment. These results suggested that the intracellular AMP level had an important role in E. coli transformation. And these have useful implications for the further investigation of the mechanism of E. coli transformation.
Polka, Jessica K.; Kollman, Justin M.; Mullins, R. Dyche
2014-01-01
In bacteria, some plasmids are partitioned to daughter cells by assembly of actin-like proteins (ALPs). The best understood ALP, ParM, has a core set of biochemical properties that contributes to its function, including dynamic instability, spontaneous nucleation, and bidirectional elongation. AlfA, an ALP that pushes plasmids apart in Bacillus, relies on a different set of underlying properties to segregate DNA. AlfA elongates unidirectionally and is not dynamically unstable; its assembly and disassembly are regulated by a cofactor, AlfB. Free AlfB breaks up AlfA bundles and promotes filament turnover. However, when AlfB is bound to the centromeric DNA sequence, parN, it forms a segrosome complex that nucleates and stabilizes AlfA filaments. When reconstituted in vitro, this system creates polarized, motile comet tails that associate by antiparallel filament bundling to form bipolar, DNA-segregating spindles. PMID:24481252
Genetic transformation of the plant pathogens Phytophthora capsici and Phytophthora parasitica.
Bailey, A M; Mena, G L; Herrera-Estrella, L
1991-01-01
Phytophthora capsici and P.parasitica were transformed to hygromycin B resistance using plasmids pCM54 and pHL1, which contain the bacterial hygromycin B phosphotransferase gene (hph) fused to promoter elements of the Ustilago maydis heat shock hsp70 gene. Enzymes Driselase and Novozyme 234 were used to generate protoplasts which were then transformed following exposure to plasmid DNA and polyethylene glycol 6000. Transformation frequencies of over 500 transformants per micrograms of DNA per 1 x 10(6) protoplasts were obtained. Plasmid pCM54 appears to be transmitted in Phytophthora spp. as an extra-chromosomal element through replication, as shown by Southern blot hybridization and by the loss of plasmid methylation. In addition, transformed strains retained their capacity of infecting Serrano pepper seedlings and Mc. Intosh apple fruits, the host plants for P.capsici and P.parasitica, respectively. Images PMID:1651483
Farias, Pedro; Espírito Santo, Christophe; Branco, Rita; Francisco, Romeu; Santos, Susana; Hansen, Lars; Sorensen, Soren
2015-01-01
Microorganisms are responsible for multiple antibiotic resistances that have been associated with resistance/tolerance to heavy metals, with consequences to public health. Many genes conferring these resistances are located on mobile genetic elements, easily exchanged among phylogenetically distant bacteria. The objective of the present work was to isolate arsenic-, antimonite-, and antibiotic-resistant strains and to determine the existence of plasmids harboring antibiotic/arsenic/antimonite resistance traits in phenotypically resistant strains, in a nonanthropogenically impacted environment. The hydrothermal Lucky Strike field in the Azores archipelago (North Atlantic, between 11°N and 38°N), at the Mid-Atlantic Ridge, protected under the OSPAR Convention, was sampled as a metal-rich pristine environment. A total of 35 strains from 8 different species were isolated in the presence of arsenate, arsenite, and antimonite. ACR3 and arsB genes were amplified from the sediment's total DNA, and 4 isolates also carried ACR3 genes. Phenotypic multiple resistances were found in all strains, and 7 strains had recoverable plasmids. Purified plasmids were sequenced by Illumina and assembled by EDENA V3, and contig annotation was performed using the “Rapid Annotation using the Subsystems Technology” server. Determinants of resistance to copper, zinc, cadmium, cobalt, and chromium as well as to the antibiotics β-lactams and fluoroquinolones were found in the 3 sequenced plasmids. Genes coding for heavy metal resistance and antibiotic resistance in the same mobile element were found, suggesting the possibility of horizontal gene transfer and distribution of theses resistances in the bacterial population. PMID:25636836
Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.
Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero
2003-09-01
The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.
Polintons: a hotbed of eukaryotic virus, transposon and plasmid evolution
Krupovic, Mart; Koonin, Eugene V.
2018-01-01
Polintons (also known as Mavericks) are large DNA transposons that are widespread in the genomes of eukaryotes. We have recently shown that Polintons encode virus capsid proteins, which suggests that these transposons might form virions, at least under some conditions. In this Opinion article, we delineate the evolutionary relationships among bacterial tectiviruses, Polintons, adenoviruses, virophages, large and giant DNA viruses of eukaryotes of the proposed order ‘Megavirales’, and linear mitochondrial and cytoplasmic plasmids. We hypothesize that Polintons were the first group of eukaryotic double-stranded DNA viruses to evolve from bacteriophages and that they gave rise to most large DNA viruses of eukaryotes and various other selfish genetic elements. PMID:25534808
Automated sample-preparation technologies in genome sequencing projects.
Hilbert, H; Lauber, J; Lubenow, H; Düsterhöft, A
2000-01-01
A robotic workstation system (BioRobot 96OO, QIAGEN) and a 96-well UV spectrophotometer (Spectramax 250, Molecular Devices) were integrated in to the process of high-throughput automated sequencing of double-stranded plasmid DNA templates. An automated 96-well miniprep kit protocol (QIAprep Turbo, QIAGEN) provided high-quality plasmid DNA from shotgun clones. The DNA prepared by this procedure was used to generate more than two mega bases of final sequence data for two genomic projects (Arabidopsis thaliana and Schizosaccharomyces pombe), three thousand expressed sequence tags (ESTs) plus half a mega base of human full-length cDNA clones, and approximately 53,000 single reads for a whole genome shotgun project (Pseudomonas putida).
Garver, K.A.; Conway, C.M.; Kurath, G.
2006-01-01
A highly efficacious DNA vaccine against a fish rhabdovirus, infectious hematopoietic necrosis virus (IHNV), was mutated to introduce two stop codons to prevent glycoprotein translation while maintaining the plasmid DNA integrity and RNA transcription ability. The mutated plasmid vaccine, denoted pIHNw-G2stop, when injected intramuscularly into fish at high doses, lacked detectable glycoprotein expression in the injection site muscle, and did not provide protection against lethal virus challenge 7 days post-vaccination. These results suggest that the G-protein itself is required to stimulate the early protective antiviral response observed after vaccination with the nonmutated parental DNA vaccine. ?? Springer Science+Business Media, Inc. 2006.
Garver, Kyle A.; Conway, Carla M.; Kurath, Gael
2006-01-01
A highly efficacious DNA vaccine against a fish rhabdovirus, infectious hematopoietic necrosis virus (IHNV), was mutated to introduce two stop codons to prevent glycoprotein translation while maintaining the plasmid DNA integrity and RNA transcription ability. The mutated plasmid vaccine, denoted pIHNw-G2stop, when injected intramuscularly into fish at high doses, lacked detectable glycoprotein expression in the injection site muscle, and did not provide protection against lethal virus challenge 7 days post-vaccination. These results suggest that the G-protein itself is required to stimulate the early protective antiviral response observed after vaccination with the nonmutated parental DNA vaccine.
Gritz, L; Davies, J
1983-11-01
The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.
Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique
2003-01-01
The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947
Perwez, T; Meyer, R
1996-01-01
An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623
Biochemistry and genetics of autotrophy in Methanococcus. Progress report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whitman, W.B.
In the last two years of this research, the most exciting results have come from the work on the genetics of methanococci. First, the author demonstrated that the cryptic plasmid from Methanococcus maripaludis C5, pURB500, could be transformed into Methanococcus maripaludis JJ. Strain JJ is the type strain of M. maripaludis and has only about 65% DNA:DNA hybridization to strain C5. Because of the low relatedness of these strains, it was not obvious that pURB500 could be transferred between them. This goal was achieved by first transforming strain C5 with a series of suicide plasmids containing the pac cassette, whichmore » possessed the selectable puromycin resistance marker, and different cloned fragments of pURB500. From the puromycin-resistant transformants, a plasmid was isolated that transformed strain JJ. However, when this plasmid was electroporated into E. coli, only rearrangement products were obtained that contained small portions of the original pURB500. These plasmids no longer transformed Methanococcus. While these experiments did not yield a shuttle vector, they demonstrated that pURB500 could replicate in strain JJ.« less
Ends-in Vs. Ends-Out Recombination in Yeast
Hastings, P. J.; McGill, C.; Shafer, B.; Strathern, J. N.
1993-01-01
Integration of linearized plasmids into yeast chromosomes has been used as a model system for the study of recombination initiated by double-strand breaks. The linearized plasmid DNA recombines efficiently into sequences homologous to the ends of the DNA. This efficient recombination occurs both for the configuration in which the break is in a contiguous region of homology (herein called the ends-in configuration) and for ``omega'' insertions in which plasmid sequences interrupt a linear region of homology (herein called the ends-out configuration). The requirements for integration of these two configurations are expected to be different. We compared these two processes in a yeast strain containing an ends-in target and an ends-out target for the same cut plasmid. Recovery of ends-in events exceeds ends-out events by two- to threefold. Possible causes for the origin of this small bias are discussed. The lack of an extreme difference in frequency implies that cooperativity between the two ends does not contribute to the efficiency with which cut circular plasmids are integrated. This may also be true for the repair of chromosomal double-strand breaks. PMID:8307337
AFEAP cloning: a precise and efficient method for large DNA sequence assembly.
Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin
2017-11-14
Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.
Bergsveinson, Jordyn; Friesen, Vanessa; Ziola, Barry
2016-10-17
Lactobacillus brevis BSO 464 (Lb464) is a beer-spoilage-related (BSR) isolate of interest given its unique physiological attributes; specifically, it is highly hop-tolerant and exhibits very rapid growth in pressurized/gassed beer. RNA sequencing was performed on Lb464 grown in pressurized and non-pressurized beer to determine important genetic mechanisms for growth in these environments. The data generated were compared against data in a previous transcriptional study of another lactic acid bacterium (LAB) during growth in beer, namely, Pediococcus claussenii ATCC BAA-344(T) (Pc344). Results revealed that the most important genetic elements for Lb464 growth in beer are related to biogenic amine metabolism, membrane transport and fortification, nutrient scavenging, and efficient transcriptional regulation. Comparison with the previous transcriptional study of Pc344 indicated that the total coding capacity (plasmid profile and genome size) of a LAB isolate allows for beer-spoilage virulence and adaptation to different beer environments, i.e., the ability to grow in degassed beer (during production) or gassed beer (packaged product). Further, differences in gene expression of Lb464 and Pc344 during mid-exponential growth in beer may dictate how rapidly each isolate exhausts particular carbon sources during. The presence of headspace pressure/dissolved CO2 was found to drive Lb464 transcription during mid-exponential growth in beer towards increasing cell wall and membrane modification, transport, osmoregulation, and DNA metabolism and transposition events. This transcriptional activity resembles transcriptional patterns or signatures observed in a viable, but non-culturable state established by non-related organisms, suggesting that Lb464 overall uses complex cellular regulation to maintain cell division and growth in the stressful beer environment. Additionally, increased expression of several hypothetical proteins, the hop-tolerance gene horC, and DNA repair and recombination genes from plasmids pLb464-2, -4, and -8 were observed in the gassed beer environment. Thus, plasmids can harbor genes with specific (gassed) beer growth advantages, and confirm that plasmid transfer and acquisition as important activities for adaptation to the beer environment. Copyright © 2016 Elsevier B.V. All rights reserved.
Feng, Mao-Hui; Cui, Jing-Chun; Nakane, Akio; Hu, Dong-Liang
2013-09-01
Staphylococcal toxic shock syndrome toxin-1 (TSST-1), a superantigenic toxin produced by Staphylococcus (S.) aureus, is a major cause of septic shock and toxic shock syndrome. To investigate whether vaccination with a plasmid DNA encoding a non-toxic mutant TSST-1 (mTSST-1) can protect mice against wild-type TSST-1-induced lethal shock, the mice were intranasally immunized with the plasmid DNA (named pcDNA-mTSST-1) plus a mucosal adjuvant, a non-toxic mutant labile toxin (mLT). After the immunization, the mice were challenged with TSST-1 and lipopolysaccharide (LPS). The survival rate of mice immunized with pcDNA-mTSST-1 plus mLT was higher than that of the control mice immunized with PBS alone, mLT alone, pcDNA-mTSST-1 alone, or a parent plasmid plus mLT. The titers of interferon-γ (IFN-γ) in the sera of mice immunized with pcDNA-mTSST-1 plus mLT were significantly lower than those of the mLT control mice. Immunization with pcDNA-mTSST-1 plus mLT increased the serum levels of TSST-1-specific antibodies, especially immunoglobulin G1 (IgG1) and IgG2a subclasses. Furthermore, the sera obtained from mice immunized with pcDNA-mTSST-1 plus mLT significantly inhibited the TSST-1-induced secretion of IFN-γ and tumor necrosis factor-α (TNF-α) in murine spleen cells in vitro. These results indicate that immunization with pcDNA-mTSST-1 plus mLT provides protection against the lethal toxic shock of mice induced by wild-type TSST-1. The protective effect could be due to TSST-1-specific neutralizing antibodies as well as the inhibition of IFN-γ and TNF-α secretions. Since TSST-1 is commonly released by invasive S. aureus, the pcDNA-mTSST-1 should be useful in preventing toxin-induced shock resulting from S. aureus infection.
Cloning of an origin of DNA replication of Xenopus laevis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, S.; Taylor, J.H.
1980-09-01
DNA fragments of Xenopus laevis, the African frog, were cloned in the EcoRI site of the Eschrichia coli plasmid pACYC189 and tested for ability to initiate and complete replication of the recombinant plasmid when injected into unfertilized eggs of X. laevis. After measurement of the (/sup 3/H)-thymidine incorporation per egg for a number of recombinant plasmids, pSW14 and pSW9, which respectively contain a small segment (550 base pairs) and several kilobases of frog DNA, were selected for more extensive analysis. In spite of the small size of th segment in pSW14, it incorporates in 2 hr at least 3 timesmore » as much labeled thymidine as either pSW9 or the vector alone. To determine the number of replications of pSW14, a novel method was employed. The results showed that about 50% of the labeled, supercoiled DNA recovered from eggs after 4 hr was sensitive to EcoRI digestion, which indicates that most of the DNA that incorporated (/sup 3/H)thymidine had replicated twice during the 4 hr in the unfertilized eggs of X. laevis. We conclude the pSW14 has a functional origin in the Xenopus DNA segment.« less
Harker, A R; Olsen, R H; Seidler, R J
1989-01-01
Plasmid pJP4 enables Alcaligenes eutrophus JMP134 to degrade 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid (TFD). Plasmid pRO101 is a derivative of pJP4 obtained by insertion of Tn1721 into a nonessential region of pJP4. Plasmid pRO101 was transferred by conjugation to several Pseudomonas strains and to A. eutrophus AEO106, a cured isolate of JMP134. AEO106(pRO101) and some Pseudomonas transconjugants grew on TFD. Transconjugants with a chromosomally encoded phenol hydroxylase also degraded phenoxyacetic acid (PAA) in the presence of an inducer of the TFD pathway, namely, TFD or 3-chlorobenzoate. A mutant of one such phenol-degrading strain, Pseudomonas putida PPO300(pRO101), grew on PAA as the sole carbon source in the absence of inducer. This isolate carried a mutant plasmid, designated pRO103, derived from pRO101 through the deletion of a 3.9-kilobase DNA fragment. Plasmid pRO103 constitutively expressed the TFD pathway, and this allowed the metabolism of PAA in the absence of the inducer, TFD. Complementation of pRO103 in trans by a DNA fragment corresponding to the fragment deleted in pRO101 indicates that a negative control-regulatory gene (tfdR) is located on the BamHI E fragment of pRO101. Other subcloning experiments resulted in the cloning of the tfdA monooxygenase gene on a 3.5-kilobase fragment derived from pRO101. This subclone, in the absence of other pRO101 DNA, constitutively expressed the tfdA gene and allowed PPO300 to grow on PAA. Preliminary evidence suggests that the monooxygenase activity encoded by this DNA fragment is feedback-inhibited by phenols. Images PMID:2914848
Portlock, Joylette L; Keravala, Annahita; Bertoni, Carmen; Lee, Solomon; Rando, Thomas A; Calos, Michele P
2006-08-01
Peripheral vascular disease (PVD), characterized by insufficient blood supply to extremities, can be a devastating illness. Although many gene therapy strategies for PVD using vascular endothelial growth factor (VEGF) have resulted in increased blood vessel formation, the vessels are often impermanent and regress after therapy, probably because of the short-lived VEGF expression mediated by gene therapy vectors (14 days or less). phiC31 integrase is a recombinase originally isolated from a bacteriophage of Streptomyces. This integrase performs efficient chromosomal integration of plasmid DNA into mammalian genomes that results in long-term transgene expression. In this study, gene transfer was achieved by intramuscular injection of VEGF and integrase plasmid DNAs into the tibialis anterior muscle in the mouse hindlimb, followed by electroporation of the muscle with needle electrodes. We observed VEGF levels significantly above background 40 days after injection in animals that received phiC31 integrase and the VEGF plasmid. Site-specific integration of plasmid DNA in the chromosomes of muscle tissue was verified by polymerase chain reaction at a common integration site. These results suggest the possible utility of the phiC31 integrase system to treat ischemic disease.
Electrotransfer of the full-length dog dystrophin into mouse and dystrophic dog muscles.
Pichavant, Christophe; Chapdelaine, Pierre; Cerri, Daniel G; Bizario, Joao C S; Tremblay, Jacques P
2010-11-01
Duchenne muscular dystrophy (DMD) is an X-linked genetic disease characterized by the absence of dystrophin (427 kDa). An approach to eventually restore this protein in patients with DMD is to introduce into their muscles a plasmid encoding dystrophin cDNA. Because the phenotype of the dystrophic dog is closer to the human phenotype than is the mdx mouse phenotype, we have studied the electrotransfer of a plasmid carrying the full-length dog dystrophin (FLDYS(dog)) in dystrophic dog muscle. To achieve this nonviral delivery, the FLDYS(dog) cDNA was cloned in two plasmids containing either a cytomegalovirus or a muscle creatine kinase promoter. In both cases, our results showed that the electrotransfer of these large plasmids (∼17 kb) into mouse muscle allowed FLDYS(dog) expression in the treated muscle. The electrotransfer of pCMV.FLDYS(dog) in a dystrophic dog muscle also led to the expression of dystrophin. In conclusion, introduction of the full-length dog dystrophin cDNA by electrotransfer into dystrophic dog muscle is a potential approach to restore dystrophin in patients with DMD. However, the electrotransfer procedure should be improved before applying it to humans.
Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917
Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.
Kasarjian, Julie K. A.; Hidaka, Masumi; Horiuchi, Takashi; Iida, Masatake; Ryu, Junichi
2004-01-01
Using an in vivo plasmid transformation method, we have determined the DNA sequences recognized by the KpnAI, StySEAI, StySENI and StySGI R-M systems from Klebsiella oxytoca strain M5a1, Salmonella eastbourne, Salmonella enteritidis and Salmonella gelsenkirchen, respectively. These type I restriction-modification systems were originally identified using traditional phage assay, and described here is the plasmid transformation test and computer program used to determine their DNA recognition sequences. For this test, we constructed two sets of plasmids, pL and pE, that contain phage lambda and Escherichia coli K-12 chromosomal DNA fragments, respectively. Further, using the methylation sensitivities of various known type II restriction enzymes, we identified the target adenines for methylation (listed in bold italics below as A or T in case of the complementary strand). The recognition sequence and methylation sites are GAA(6N)TGCC (KpnAI), ACA(6N)TYCA (StySEAI), CGA(6N)TACC (StySENI) and TAAC(7N)RTCG (StySGI). These DNA recognition sequences all have a typical type I bipartite pattern and represent three novel specificities and one isoschizomer (StySENI). For confirmation, oligonucleotides containing each of the predicted sequences were synthesized, cloned into plasmid pMECA and transformed into each strain, resulting in a large reduction in efficiency of transformation (EOT). PMID:15199175
Fonseca, A S; Campos, V M A; Magalhães, L A G; Paoli, F
2015-10-01
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers.
Fonseca, A.S.; Campos, V.M.A.; Magalhães, L.A.G.; Paoli, F.
2015-01-01
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. PMID:26445337
Shrestha, Bimmi; Ng, Terry; Chu, Hsien-Jue; Noll, Michelle; Diamond, Michael S
2008-04-07
West Nile virus (WNV) is a mosquito borne, neurotropic flavivirus that causes a severe central nervous system (CNS) infection in humans and animals. Although commercial vaccines are available for horses, none is currently approved for human use. In this study, we evaluated the efficacy and mechanism of immune protection of two candidate WNV vaccines in mice. A formalin-inactivated WNV vaccine induced higher levels of specific and neutralizing antibodies compared to a DNA plasmid vaccine that produces virus-like particles. Accordingly, partial and almost complete protection against a highly stringent lethal intracranial WNV challenge were observed in mice 60 days after single dose immunization with the DNA plasmid and inactivated virus vaccines, respectively. In mice immunized with a single dose of DNA plasmid or inactivated vaccine, antigen-specific CD8(+) T cells were induced and contributed to protective immunity as acquired or genetic deficiencies of CD8(+) T cells lowered the survival rates. In contrast, in boosted animals, WNV-specific antibody titers were higher, survival rates after challenge were greater, and an absence of CD8(+) T cells did not appreciably affect mortality. Overall, our experiments suggest that in mice, both inactivated WNV and DNA plasmid vaccines are protective after two doses, and the specific contribution of antibody and CD8(+) T cells to vaccine immunity against WNV is modulated by the prime-boost strategy.
Hüttinger, Cornelia; Hirschberger, Johannes; Jahnke, Anika; Köstlin, Roberto; Brill, Thomas; Plank, Christian; Küchenhoff, Helmut; Krieger, Stefan; Schillinger, Ulrike
2008-06-01
Despite aggressive pre- or postoperative treatment, feline fibrosarcomas have high recurrence rates. Immunostimulatory gene therapy is a promising approach in veterinary oncology. This phase I dose-escalation study was performed to determine toxicity and feasibility of gene therapy with feline granulocyte-macrophage colony-stimulating factor (feGM-CSF) in cats with fibrosarcomas. Twenty cats were treated with plasmid coding for feGM-CSF attached to magnetic nanoparticles in doses of 50, 250, 750 and 1250 microg. Two preoperative intratumoral injections followed by magnetofection were given. Four control cats received only surgical treatment. Adverse events were recorded and correlated according to the veterinary co-operative oncology group toxicity scale. An enzyme-linked immunosorbent assay was performed to detect plasma feGM-CSF concentrations. No significant treatment related toxicity was observed. Preliminary recurrence results were encouraging as, on day 360, ten of 20 treated cats were recurrence-free. In conclusion, 1250 microg of feGM-CSF plasmid DNA applied by magnetofection is safe and feasible for phase II testing.
Thiel, Cora S; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver
2014-01-01
Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.
Optimization of a one-step heat-inducible in vivo mini DNA vector production system.
Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A
2014-01-01
While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.
Thiel, Cora S.; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver
2014-01-01
Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130°C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000°C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukariotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites. PMID:25426925
Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System
Wettig, Shawn; Slavcev, Roderick A.
2014-01-01
While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704
Affinity analysis and application of dipeptides derived from l-tyrosine in plasmid purification.
Ferreira, Soraia; Carvalho, Josué; Valente, Joana F A; Corvo, Marta C; Cabrita, Eurico J; Sousa, Fani; Queiroz, João A; Cruz, Carla
2015-12-01
The developments in the use of plasmid DNA (pDNA) in gene therapy and vaccines have motivated the search and improvement of optimized purification processes. In this context, dipeptides l-tyrosine-l-tyrosine and l-tyrosine-l-arginine are synthetized to explore their application as affinity ligands for supercoiled (sc) plasmid DNA (pDNA) purification. The synthesis is based on the protection of N-Boc-l-tyrosine, followed by condensation with l-tyrosine or l-arginine methyl esters in the presence of dicyclohexylcarbodiimide (DCC), which after hydrolysis and acidification give the afforded dipeptides. The supports are then obtained by coupling l-tyrosine, l-tyrosine-l-tyrosine and l-tyrosine-l-arginine to epoxy-activated Sepharose and are characterized by high resolution magic angle spinning (HR-MAS) NMR and Fourier transform infrared spectroscopy (FTIR). Surface plasmon resonance (SPR) biosensor is used to establish the promising ligand to be used in the chromatographic experiments and ascertain experimental conditions. Sc isoform showed the highest affinity to the dipeptides, followed by linear (ln) pDNA, being the open circular (oc) the one that promoted the lowest affinity to l-tyrosine-l-arginine. Saturation transfer difference (STD)-NMR experiments show that the interaction is mainly hydrophobic with the majority of the 5'-mononucleotides, except for 5'-GMP with l-tyrosine-l-arginine Sepharose that is mainly electrostatic. The support l-tyrosine Sepharose used in chromatographic experiments promotes the separation of native pVAX1-LacZ and pcDNA3-FLAG-p53 samples (oc+sc) by decreasing the salt concentration. The results suggest that it is possible to purify different plasmids with the l-tyrosine Sepharose, with slight adjustments in the gradient conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Wang, Ledan; Cai, Yiqi; Xiong, Yirong; Du, Wangqi; Cen, Danwei; Zhang, Chanqiong; Song, Yiling; Zhu, Shanli; Xue, Xiangyang; Zhang, Lifang
2017-05-16
Chlamydia trachomatis (Ct) is one of the most frequently encountered sexual infection all over the world, yielding tremendous reproductive problems (e.g. infertility and ectopic pregnancy) in the women. This work described the design of a plasmid vaccine that protect mice from Ct infection, and reduce productive tract damage by generating effective antibody and cytotoxic T cell immunity. The vaccine, s was composed of MOMP multi-epitope and HPV16L2 genes carried in pcDNA plasmid (i.e. pcDNA3.1/MOMP/HPV16L). In transfection, the vaccine expressed the chimeric genes (i.e. MOMP and HPV16L2), as demonstrated via western blot, RT-PCR and fluorescence imaging. In vitro, the vaccine transfected COS-7 cells and expressed the proteins corresponding to the genes carried in the vaccine. Through intramuscular immunization in BALB/c mice, the vaccine induced higher levels of anti-Ct IgG titer, anti-HPV16L2 IgG titer in serum and IgA titer in local mucosal secretions, compared to plasmid vaccines that carry only Ct MOMP multi-epitope or HPV16L2 chimeric component only. In mice intravaginally challenged with Ct, the vaccines pcDNA3.1/MOMP/HPV16L2 generated a higher level of genital protection compared to other vaccine formulations. Additionally, histochemical staining indicated that pcDNA3.1/MOMP/HPV16L2 eliminated mouse genital tract tissue pathologies induced by Ct infection. This work demonstrated that pcDNA/MOMP/HPV16L2 vaccine can protect against Ct infection by regulating antibody production, cytotoxic T cell killing functions and reducing pathological damage in mice genital tract. This work can potentially offer us a new vaccine platform against Ct infection.
Jubeli, Emile; Maginty, Amanda B; Khalique, Nada Abdul; Raju, Liji; Nicholson, David G; Larsen, Helge; Pungente, Michael D; Goldring, William P D
2017-01-05
In this communication we describe the construction of four succinic-based cationic lipids, their formulation with plasmid DNA (pDNA), and an evaluation of their in vitro gene delivery into Chinese hamster ovarian (CHO-K1) cells. The cationic lipids employed in this work possess either a dimethylamine or trimethylamine headgroup, and a macrocyclic or an acyclic hydrophobic domain composed of, or derived from two 16-atom, succinic-based acyl chains. The synthesized lipids and a co-lipid of neutral charge, either cholesterol or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), were formulated in an overall 3:2 cationic-to-neutral lipid molar ratio, then complexed with plasmid DNA (pDNA). The relative transfection performance was evaluated via a comparison between matched versus mismatched formulations defined by the rigidity relationship between the lipids employed. Gel electrophoresis was used to characterize the binding of the lipid formulations with plasmid DNA and the relative degree of plasmid degradation using a DNase I degradation assay. Small angle X-ray diffraction (SAXD) was employed to characterize the packing morphology of the lipid-DNA complexes. In general, the succinic unit embedded within the hydrophobic domain of the cationic lipids was found to improve lipid hydration. The transfection assays revealed a general trend in which mismatched formulations that employed a rigid lipid combined with a non-rigid (or flexible) lipid, outperformed the matched formulations. The results from this work suggest that the design of the cationic lipid structure and the composition of the lipoplex formulation play key roles in governing the transfection performance of nonviral gene delivery agents. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Hilbrig, Frank; Freitag, Ruth
2012-01-01
Hydroxyapatite and related stationary phases increasingly play a role in the downstream processing of high-value biological materials, such as recombinant proteins, therapeutic antibodies and pharmaceutical-grade plasmid DNA. Chromatographic hydroxyapatite is an inorganic, ceramic material identical in composition, if not in structure, to calcium phosphate found in human bones and teeth. The interaction of hydroxyapatite with biomacromolecules is complex and highly dynamic, which can make predicting performance difficult, but also allows the design of very selective isolation processes. This review discusses the currently commercially available chromatographic materials, different retention mechanisms supported by these materials and differential exploitation for the design of highly specific isolation procedures. The state of the art of antibody purification by hydroxy- and fluoroapatite is reviewed together with tested routines for method development and implementation. Finally, the isolation of plasmid DNA is discussed, since the purification of DNA therapeutics at a sufficiently large scale is an emerging need in bioprocess development and perhaps the area in bioseparation where apatite chromatography can make its most important contribution to date. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Genotoxic activity of 4,4',5'-trimethylazapsoralen on plasmid DNA.
Lagatolla, C; Dolzani, L; Granzotto, M; Monti-Bragadin, C
1998-01-01
The genotoxic activities of 8-methoxypsoralen (8-MOP) and 4,4',5'-trimethylazapsoralen (4,4',5'-TMAP) on plasmid DNA have been compared. In a previous work, 4,4',5'-TMAP, a methyl derivative of a psoralen isoster, had shown potential photochemotherapeutic activity. The mutagenic activity of mono- and bifunctional lesions caused by these compounds was evaluated both after UVA irradiation, which causes the formation of both kinds of lesions, and after a two-step irradiation procedure of the psoralen-plasmid DNA complex, which allowed monoadducts and interstrand crosslinks to be studied separately. Furthermore, we used a procedure that allowed us to evaluate both the mutagenic and recombinogenic activity of the two compounds. Results indicate that the most important difference between 8-MOP and 4,4',5'-TMAP consists in their mode of photoreaction with DNA rather than in their mutagenic potential. In fact, in all of the experimental procedures, 4,4',5'-TMAP shows a lower ability than 8-MOP to generate interstrand crosslinks. However, when comparable toxicity levels are reached, the two compounds show the same mutagenic potentiality.
Use of Ti plasmid DNA probes for determining tumorigenicity of agrobacterium strains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burr, T.J.; Norelli, J.L.; Katz, B.H.
1990-06-01
Probes consisting of T-DNA genes from the Ti plasmid of Agrobacterium tumefaciens were used for determining tumorigenicity of strains. Two {sup 32}P-labeled probes hybridized with 28 of 28 tumorigenic strains of the pathogen but not with 20 of 22 nontumorigenic strains. One probe, pTHE17, consists of all but the far left portion of the T-DNA of strain C58. Probe SmaI7 consists of SmaI fragment 7 of pTiC58, including onc genes 1, 4, and 6a and most of 2. Another probe, pAL4044, consisting of the vir region of strain Ach-5, hybridized with several nontumorigenic as well as tumorigenic strains. Colony hybridizationsmore » were done with 28 tumorigenic and 22 nontumorigenic Agrobacterium strains. About 10{sup 6} CFU of the different tumorigenic strains were detectable with this method. Southern analyses confirmed the presence or absence of Ti plasmids in strains for which tumorigenicity was questioned. Colony hybridization with the T-DNA probes provides a rapid and sensitive means for determining the tumorigenic nature of Agrobacterium strains.« less
[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].
Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua
2013-02-01
To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.
Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C
1986-04-01
The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.
Phage Lambda P Protein: Trans-Activation, Inhibition Phenotypes and their Suppression
Hayes, Sidney; Erker, Craig; Horbay, Monique A.; Marciniuk, Kristen; Wang, Wen; Hayes, Connie
2013-01-01
The initiation of bacteriophage λ replication depends upon interactions between the oriλ DNA site, phage proteins O and P, and E. coli host replication proteins. P exhibits a high affinity for DnaB, the major replicative helicase for unwinding double stranded DNA. The concept of P-lethality relates to the hypothesis that P can sequester DnaB and in turn prevent cellular replication initiation from oriC. Alternatively, it was suggested that P-lethality does not involve an interaction between P and DnaB, but is targeted to DnaA. P-lethality is assessed by examining host cells for transformation by ColE1-type plasmids that can express P, and the absence of transformants is attributed to a lethal effect of P expression. The plasmid we employed enabled conditional expression of P, where under permissive conditions, cells were efficiently transformed. We observed that ColE1 replication and plasmid establishment upon transformation is extremely sensitive to P, and distinguish this effect from P-lethality directed to cells. We show that alleles of dnaB protect the variant cells from P expression. P-dependent cellular filamentation arose in ΔrecA or lexA[Ind-] cells, defective for SOS induction. Replication propagation and restart could represent additional targets for P interference of E. coli replication, beyond the oriC-dependent initiation step. PMID:23389467
Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng
2008-01-01
To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong
2012-11-15
Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less
Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H
1994-01-01
We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710
Sato, Toshinori; Nakata, Mitsuhiro; Yang, Zhihong; Torizuka, Yu; Kishimoto, Satoko; Ishihara, Masayuki
2017-08-01
Lyophilization is an effective method for preserving nonviral gene vectors. To improve the stability and transgene expression of lyophilized plasmid DNA (pDNA) complexes, we coated the surfaces of pDNA/chitosan complexes with hyaluronic acid (HA) of varying molecular masses. The transgene expression of pDNA/chitosan/HA ternary complexes was characterized in vitro and in vivo. pDNA complexes were lyophilized overnight and the resultant products with spongy, porous consistencies were stored at -30, 4 or 25°C for 2 weeks. Rehydrated complexes were characterized using gel retardation assays, aiming to confirm complex formation, measure particle size and evaluate zeta potential, as well as conduct luciferase gene reporter assays. The anti-tumor effects of pDNA ternary complexes were evaluated using suicide gene (pTK) coding thymidine kinase in Huh7-implanted mice. Transfection efficiencies of pDNA/chitosan/HA ternary complexes were dependent on the average molecular masses of HA. The coating of pDNA/chitosan complexes with HA maintained the cellular transfection efficiencies of lyophilized pDNA ternary complexes. Furthermore, intratumoral injection of lyophilized, rehydrated pDNA ternary complexes into tumor-bearing mice showed a significant suppression of tumor growth. The coating of pDNA/chitosan complexes with high-molecular-weight HA augmented the stability and cellular transfection ability of the complexes after lyophilization-rehydration. Copyright © 2017 John Wiley & Sons, Ltd.
Cloning and expression of Tenebrio molitor antifreeze protein in Escherichia coli.
Yue, Chang-Wu; Zhang, Yi-Zheng
2009-03-01
A novel antifreeze protein cDNA was cloned by RT-PCR from the larva of the yellow mealworm Tenebrio molitor. The coding fragment of 339 bp encodes a protein of 112 amino acid residues and was fused to the expression vectors pET32a and pTWIN1. The resulted expression plasmids were transformed into Escherischia coli strains BL21 (DE3), ER2566, and Origami B (DE3), respectively. Several strategies were used for expression of the highly disulfide-bonded beta-helix-contained protein with the activity of antifreeze in different expression systems. A protocol for production of refolded and active T. molitor antifreeze protein in bacteria was obtained.
[Detection of linear chromosomes and plasmids among 15 genera in the Actinomycetales].
Ma, Ning; Ma, Wei; Jiang, Chenglin; Fang, Ping; Qin, Zhongjun
2003-10-01
Bacterial chromosomes and plasmids are commonly circular, however, linear chromosomes and plasmids were discovered among 5 genera of the Actinomycetales. Here, we use pulsed field gel electrophoresis to study the genomes of 19 species which belong to 15 genera in the Actinomycetales. All chromosomes of 19 species are linear DNA, and linear plasmids with different sizes and copy numbers are detected among 5 species. This work provide basis for investigating the possible novel functions of linear replicons beyond Streptomyces and also helps to develop Actinomycetales artificial linear chromosome.
Wang, Chuan; Zhang, Chaowu; Pei, Xiaofang; Liu, Hengchuan
2007-11-01
For being further applied and studied, one strain of Lactobacillus delbrueckii subsp. bulgaricus (wch9901) separated from yoghourt which had been identified by phenotype characteristic analysis was identified by 16S rDNA and phylogenetic analyzed. The 16S rDNA of wch9901 was amplified with the genomic DNA of wch9901 as template, and the conservative sequences of the 16S rDNA as primers. Inserted 16S rDNA amplified into clonal vector pGEM-T under the function of T4 DNA ligase to construct recombined plasmid pGEM-wch9901 16S rDNA. The recombined plasmid was identified by restriction enzyme digestion, and the eligible plasmid was presented to sequencing company for DNA sequencing. Nucleic acid sequence was blast in GenBank and phylogenetic tree was constructed using neighbor-joining method of distance methods by Mega3.1 soft. Results of blastn showed that the homology of 16S rDNA of wch9901 with the 16S rDNA of Lactobacillus delbrueckii subsp. bulgaricus strains was higher than 96%. On the phylogenetic tree, wch9901 formed a separate branch and located between Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch and another evolution branch which was composed of Lactobacillus delbrueckii subsp. bulgaricus DL2 evolution cluster and Lactobacillus delbrueckii subsp. bulgaricus JSQ evolution cluster. The distance between wch9901 evolution branch and Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch was the closest. wch9901 belonged to Lactobacillus delbrueckii subsp. bulgaricus. wch9901 showed the closest evolution relationship to Lactobacillus delbrueckii subsp. bulgaricus LGM2.
The bacterial segrosome: a dynamic nucleoprotein machine for DNA trafficking and segregation.
Hayes, Finbarr; Barillà, Daniela
2006-02-01
The genomes of unicellular and multicellular organisms must be partitioned equitably in coordination with cytokinesis to ensure faithful transmission of duplicated genetic material to daughter cells. Bacteria use sophisticated molecular mechanisms to guarantee accurate segregation of both plasmids and chromosomes at cell division. Plasmid segregation is most commonly mediated by a Walker-type ATPase and one of many DNA-binding proteins that assemble on a cis-acting centromere to form a nucleoprotein complex (the segrosome) that mediates intracellular plasmid transport. Bacterial chromosome segregation involves a multipartite strategy in which several discrete protein complexes potentially participate. Shedding light on the basis of genome segregation in bacteria could indicate new strategies aimed at combating pathogenic and antibiotic-resistant bacteria.
Zhan, Sien; Li, Jinming; Xu, Ruihuan; Wang, Lunan; Zhang, Kuo; Zhang, Rui
2009-01-01
The branched DNA (bDNA) assay is a reliable method for quantifying the RNA of human immunodeficiency virus type 1 (HIV-1). The positive controls and standards for this assay for the detection of HIV-1 consist of naked RNA, which is susceptible to degradation by RNase. Armored RNA is a good candidate for an RNase-resistant positive control or standard. However, its use has been limited by the maximal length of the exogenous RNA packaged into virus-like particles by routine armored RNA technology. In the present study, we produced armored long RNA (armored L-RNA) controls or standards (AR-HIV-pol-3034b) for a bDNA assay of HIV-1 by increasing the amount and affinity of the pac sites (the pac site is a specific 19-nucleotide stem-loop region located at the 5′ terminus of the MS2 bacteriophage replicase gene) by a one-plasmid double-expression system. AR-HIV-pol-3034b was completely resistant to DNase and RNase, was stable in normal human EDTA-preserved plasma at 4°C for at least 6 months, and produced reproducible, linear results in the Versant HIV-1 RNA 3.0 assay. In conclusion, AR-HIV-pol-3034b could act as a positive control or standard in a bDNA assay for the detection of HIV-1. In addition, the one-plasmid double-expression system can be used as a better platform than the one-plasmid expression system and the two-plasmid coexpression system for expressing armored L-RNA. PMID:19494069
Zhan, Sien; Li, Jinming; Xu, Ruihuan; Wang, Lunan; Zhang, Kuo; Zhang, Rui
2009-08-01
The branched DNA (bDNA) assay is a reliable method for quantifying the RNA of human immunodeficiency virus type 1 (HIV-1). The positive controls and standards for this assay for the detection of HIV-1 consist of naked RNA, which is susceptible to degradation by RNase. Armored RNA is a good candidate for an RNase-resistant positive control or standard. However, its use has been limited by the maximal length of the exogenous RNA packaged into virus-like particles by routine armored RNA technology. In the present study, we produced armored long RNA (armored L-RNA) controls or standards (AR-HIV-pol-3034b) for a bDNA assay of HIV-1 by increasing the amount and affinity of the pac sites (the pac site is a specific 19-nucleotide stem-loop region located at the 5' terminus of the MS2 bacteriophage replicase gene) by a one-plasmid double-expression system. AR-HIV-pol-3034b was completely resistant to DNase and RNase, was stable in normal human EDTA-preserved plasma at 4 degrees C for at least 6 months, and produced reproducible, linear results in the Versant HIV-1 RNA 3.0 assay. In conclusion, AR-HIV-pol-3034b could act as a positive control or standard in a bDNA assay for the detection of HIV-1. In addition, the one-plasmid double-expression system can be used as a better platform than the one-plasmid expression system and the two-plasmid coexpression system for expressing armored L-RNA.
Candidate Cancer Allele cDNA Collection | Office of Cancer Genomics
CTD2 researchers at the Broad Institute/DFCI have developed a collection of plasmids including mutant alleles found in sequencing studies of cancer. It includes somatic variants found in lung adenocarcinoma and across other cancer types. The clones enable researchers to characterize the function of the cancer variants in a high throughput experiments. These plasmids are collectively called the “Broad Target Accelerator Plasmid Collections”.
Roberts, D P; Berman, P M; Allen, C; Stromberg, V K; Lacy, G H; Mount, M S
1986-07-01
Several genes encoding enzymes capable of degrading plant cell wall components have been cloned from Erwinia carotovora subsp. carotovora EC14. Plasmids containing cloned EC14 DNA mediate the production of endo-pectate lyases, exo-pectate lyase, endo-polygalacturonase, and cellulase(s). Escherichia coli strains containing one of these plasmids or combinations of two plasmids were tested for their ability to macerate potato tuber slices. Only one E. coli strain, containing two plasmids that encode endo-pectate lyases, exo-pectate lyase, and endo-polygalacturonase, caused limited maceration. The pectolytic proteins associated with one of these plasmids, pDR1, have been described previously (D. P. Roberts, P. M. Berman, C. Allen, V. K. Stromberg, G. H. Lacy, and M. S. Mount, Can. J. Plant Pathol. 8:17-27, 1986) and include two secreted endo-pectate lyases. The second plasmid, pDR30, contains a 2.1-kilobase EC14 DNA insert that mediates the production of an exo-pectate lyase and an endo-polygalacturonase. These enzymes are similar in physicochemical properties to those produced by EC14. Our results suggest that the concerted activities of endo-pectate lyases with endo-polygalacturonase or exo-pectate lyase or both cause maceration.
Roberts, D P; Berman, P M; Allen, C; Stromberg, V K; Lacy, G H; Mount, M S
1986-01-01
Several genes encoding enzymes capable of degrading plant cell wall components have been cloned from Erwinia carotovora subsp. carotovora EC14. Plasmids containing cloned EC14 DNA mediate the production of endo-pectate lyases, exo-pectate lyase, endo-polygalacturonase, and cellulase(s). Escherichia coli strains containing one of these plasmids or combinations of two plasmids were tested for their ability to macerate potato tuber slices. Only one E. coli strain, containing two plasmids that encode endo-pectate lyases, exo-pectate lyase, and endo-polygalacturonase, caused limited maceration. The pectolytic proteins associated with one of these plasmids, pDR1, have been described previously (D. P. Roberts, P. M. Berman, C. Allen, V. K. Stromberg, G. H. Lacy, and M. S. Mount, Can. J. Plant Pathol. 8:17-27, 1986) and include two secreted endo-pectate lyases. The second plasmid, pDR30, contains a 2.1-kilobase EC14 DNA insert that mediates the production of an exo-pectate lyase and an endo-polygalacturonase. These enzymes are similar in physicochemical properties to those produced by EC14. Our results suggest that the concerted activities of endo-pectate lyases with endo-polygalacturonase or exo-pectate lyase or both cause maceration. Images PMID:3013836
Rajagopalan, Rema; Wani, Khalida; Huilgol, Nagaraj G; Kagiya, Tsutomu V; Nair, Cherupally K Krishnan
2002-06-01
Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of alpha-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of gamma-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 microM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by gamma-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC.
Thomason, Lynn C; Costantino, Nina; Court, Donald L
2016-09-13
Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.
Shin, Min Jae; Tan, Lihan; Jeong, Min Ho; Kim, Ji-Heung; Choe, Woo-Seok
2011-08-05
Immobilized metal affinity monolith column as a new class of chromatographic support is shown to be superior to conventional particle-based column as plasmid DNA (pDNA) purification platform. By harnessing the affinity of endotoxin to copper ions in the solution, a majority of endotoxin (90%) was removed from the alkaline cell lysate using CuCl(2)-induced precipitation. RNA and remaining endotoxin were subsequently removed to below detection limit with minimal loss of pDNA using either monolith or particle-based column. Monolith column has the additional advantage of feed concentration and flowrate-independent dynamic binding capacity for RNA molecules, enabling purification process to be conducted at high feed RNA concentration and flowrate. The use of monolith column gives three fold increased productivity of pDNA as compared to particle-based column, providing a more rapid and economical platform for pDNA purification. Copyright © 2011 Elsevier B.V. All rights reserved.
Properties of an unusual DNA primase from an archaeal plasmid
Beck, Kirsten; Lipps, Georg
2007-01-01
Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343
Occurrence of small Hsd plasmids in Salmonella typhi, Shigella boydii, and Escherichia coli.
Yoshida, Y; Mise, K
1986-01-01
The natural occurrence of small Hsd (host specificity for DNA) plasmids was demonstrated in restriction endonuclease-producing strains of Salmonella typhi, Shigella boydii, and Escherichia coli. The five Hsd plasmids isolated were between 5.0 and 12.2 kilobases long. The copy number of all the Hsd plasmids was high (more than 10 copies per cell). Introduction of these small plasmids into E. coli strain 0 drastically lowered the efficiency of plating of the lambda.0 phages (the efficiency of plating was less than 5 X 10(-5) PFU-1). High restriction endonuclease activities were detected in the Hsd plasmid-positive strains because of the elevated copy numbers of the hsdR+ gene. The advantages of using E. coli strains containing the small Hsd plasmids for purification of type II restriction endonucleases are discussed. Images PMID:3003023
Wetzel, Margaret E.; Olsen, Gary J.; Chakravartty, Vandana; ...
2015-11-19
The large repABC plasmids of the order Rhizobiales with Class I quorum-regulated conjugative transfer systems often define the nature of the bacterium that harbors them. These otherwise diverse plasmids contain a core of highly conserved genes for replication and conjugation raising the question of their evolutionary relationships. In an analysis of 18 such plasmids these elements fall into two organizational classes, Group I and Group II, based on the sites at which cargo DNA is located. Cladograms constructed from proteins of the transfer and quorum-sensing components indicated that those of the Group I plasmids, while coevolving, have diverged from thosemore » coevolving proteins of the Group II plasmids. Moreover, within these groups the phylogenies of the proteins usually occupy similar, if not identical, tree topologies. Remarkably, such relationships were not seen among proteins of the replication system; although RepA and RepB coevolve, RepC does not. Nor do the replication proteins coevolve with the proteins of the transfer and quorum-sensing systems. Functional analysis was mostly consistent with phylogenies. TraR activated promoters from plasmids within its group, but not between groups and dimerized with TraR proteins from within but not between groups. However, oriT sequences, which are highly conserved, were processed by the transfer system of plasmids regardless of group. Here, we conclude that these plasmids diverged into two classes based on the locations at which cargo DNA is inserted, that the quorum-sensing and transfer functions are coevolving within but not between the two groups, and that this divergent evolution extends to function.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wetzel, Margaret E.; Olsen, Gary J.; Chakravartty, Vandana
The large repABC plasmids of the order Rhizobiales with Class I quorum-regulated conjugative transfer systems often define the nature of the bacterium that harbors them. These otherwise diverse plasmids contain a core of highly conserved genes for replication and conjugation raising the question of their evolutionary relationships. In an analysis of 18 such plasmids these elements fall into two organizational classes, Group I and Group II, based on the sites at which cargo DNA is located. Cladograms constructed from proteins of the transfer and quorum-sensing components indicated that those of the Group I plasmids, while coevolving, have diverged from thosemore » coevolving proteins of the Group II plasmids. Moreover, within these groups the phylogenies of the proteins usually occupy similar, if not identical, tree topologies. Remarkably, such relationships were not seen among proteins of the replication system; although RepA and RepB coevolve, RepC does not. Nor do the replication proteins coevolve with the proteins of the transfer and quorum-sensing systems. Functional analysis was mostly consistent with phylogenies. TraR activated promoters from plasmids within its group, but not between groups and dimerized with TraR proteins from within but not between groups. However, oriT sequences, which are highly conserved, were processed by the transfer system of plasmids regardless of group. Here, we conclude that these plasmids diverged into two classes based on the locations at which cargo DNA is inserted, that the quorum-sensing and transfer functions are coevolving within but not between the two groups, and that this divergent evolution extends to function.« less
Wong, S W; Schaffer, P A
1991-05-01
Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.
DNA Inversion on Conjugative Plasmid pVT745
Chen, Jinbiao; Leblanc, Donald J.; Galli, Dominique M.
2002-01-01
Plasmid pVT745 from Actinobacillus actinomycetemcomitans strain VT745 can be transferred to other A. actinomycetemcomitans strains at a frequency of 10−6. Screening of transconjugants revealed that the DNA of pDMG21A, a pVT745 derivative containing a kanamycin resistance gene, displayed a structural rearrangement after transfer. A 9-kb segment on the plasmid had switched orientation. The inversion was independent of RecA and required the activity of the pVT745-encoded site-specific recombinase. This recombinase, termed Inv, was highly homologous to invertases of the Din family. Two recombination sites of 22 bp, which are arranged in opposite orientation and which function as DNA crossover sequences, were identified on pVT745. One of the sites was located adjacent to the 5′ end of the invertase gene, inv. Inversion of the 9-kb segment on pVT745 derivatives has been observed in all A. actinomycetemcomitans strains tested except for the original host, VT745. This would suggest that a host factor that is either inactive or absent in VT745 is required for efficient recombination. Inactivation of the invertase in the donor strain resulted in a 1,000-fold increase in the number of transconjugants upon plasmid transfer. It is proposed that an activated invertase causes the immediate loss of the plasmid in most recipient cells after mating. No biological role has been associated with the invertase as of yet. PMID:12374826
Modulatory effects of mycobacterial heat-shock protein 70 in DNA vaccination against lymphoma.
Liso, Arcangelo; Benedetti, Roberta; Fagioli, Marta; Mariano, Angela; Falini, Brunangelo
2005-01-01
Pathogen-derived molecules are danger signals and are able to activate innate immunity that in turn controls and regulates generation of adaptive immune responses. Mycobacterium tuberculosis heat shock protein 70 (myc HSP70) has been shown to exert a potent adjuvant effect in vaccination against both infectious agents and solid tumors. Here we explore the use of myc HSP70, as an adjuvant, in DNA vaccination against lymphoma. We describe the effects of vaccination using myc HSP70 encoding plasmid (pHSP70) co-injected with idiotype encoding plasmid (pId), in the 38C13 murine lymphoma model. We dissect mechanisms of anti-tumor immune response and compared efficacy with that of other DNA vaccination strategies. We show that myc HSP70 plasmid prolongs survival of immunized mice challenged with a high number (2000) of tumor cells. The magnitude of the anti-tumor effect is comparable to that obtained using granulocyte-macrophage colony-stimulating factor (GM-CSF) in the same setting. Moreover, HSP-induced protection is independent from the generation of IgG1 and IgG2a antibodies. Instead, anti-idiotype antibodies of IgG2b subclass develop after vaccination with pHSP as well as with pId and Id-GM-CSF fusion plasmid (pId-GM). Co-injection of HSP70 and Id plasmids induces a specific pattern of anti-idiotype immune response able to improve survival of immunized mice.
Licitra, C M; Brooks, R G; Terry, P M; Shaw, K J; Hare, R S
1989-01-01
We compared disk susceptibility, plasmid analysis, aminoglycoside resistance patterns, and DNA hybridization for their usefulness in characterizing isolates from a hospital outbreak of methicillin-resistant Staphylococcus aureus. Fifteen isolates were susceptible (group 1) and 28 were resistant (group 2) to gentamicin. A total of 15 of 15 (100%) group 1 and 22 of 28 (79%) group 2 isolates carried a 21.5-megadalton plasmid. All group 2 isolates and none of the group 1 isolates possessed a 33-megadalton plasmid. Aminoglycoside resistance pattern determinations revealed the presence of the ANT(4')-I enzyme (aminoglycoside 4' adenyltransferase) in all group 1 isolates but was unable to demonstrate presence of this enzyme in group 2 organisms. The APH(2") + AAC(6')-II enzyme (aminoglycoside 2" phosphotransferase plus 6' acetyltransferase) was found in all of the group 2 isolates but in none of the group 1 isolates. Use of DNA hybridization revealed the presence of the ANT(4')-I enzyme in both groups (group 1, 14 of 15; group 2, 26 of 28). In this hospital outbreak, we found good correlation between disk susceptibility, plasmid profile, aminoglycoside resistance patterns, and DNA hybridization results. It was difficult to predict the presence of the ANT(4')-I enzyme in the presence of the bifunctional [APH(2") + AAC(6')-II] enzyme by the aminoglycoside resistance pattern method because of overlap of the substrate profile. Images PMID:2808676
Vander Lugt correlation of DNA sequence data
NASA Astrophysics Data System (ADS)
Christens-Barry, William A.; Hawk, James F.; Martin, James C.
1990-12-01
DNA, the molecule containing the genetic code of an organism, is a linear chain of subunits. It is the sequence of subunits, of which there are four kinds, that constitutes the unique blueprint of an individual. This sequence is the focus of a large number of analyses performed by an army of geneticists, biologists, and computer scientists. Most of these analyses entail searches for specific subsequences within the larger set of sequence data. Thus, most analyses are essentially pattern recognition or correlation tasks. Yet, there are special features to such analysis that influence the strategy and methods of an optical pattern recognition approach. While the serial processing employed in digital electronic computers remains the main engine of sequence analyses, there is no fundamental reason that more efficient parallel methods cannot be used. We describe an approach using optical pattern recognition (OPR) techniques based on matched spatial filtering. This allows parallel comparison of large blocks of sequence data. In this study we have simulated a Vander Lugt1 architecture implementing our approach. Searches for specific target sequence strings within a block of DNA sequence from the Co/El plasmid2 are performed.
Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A
2013-06-13
Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.
Chénard, Caroline; Wirth, Jennifer F.
2016-01-01
ABSTRACT Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. PMID:27302758
Vercoe, Reuben B; Chang, James T; Dy, Ron L; Taylor, Corinda; Gristwood, Tamzin; Clulow, James S; Richter, Corinna; Przybilski, Rita; Pitman, Andrew R; Fineran, Peter C
2013-04-01
In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated (Cas) proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2) involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas-mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM) beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA-targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity.
Hoffmann, N; Steinbüchel, A; Rehm, B H
2000-11-01
Various pseudomonads are capable of the synthesis of polyhydroxyalkanoate (PHA), composed of medium chain length (MCL) 3-hydroxy fatty acids (C6-C14), when grown on simple carbon sources such as, for example, gluconate or acetate. In Pseudomonas putida, the fatty acid de novo synthesis and PHA synthesis are linked by the transacylase PhaG. Southern hybridization experiments with digoxigenin-labeled phaG(Pp) from P. putida and genomic DNA from various pseudomonads indicate that phaG homologues are present in various other pseudomonads. Although P. oleovorans does not accumulate PHA(MCL) from non-related carbon sources, its genomic DNA reveals a strong hybridization signal. We employed PCR to amplify this phaG homologue. The respective PCR product comprising the coding region of phaG(Po) was cloned into pBBR1MCS-2, resulting in plasmid pBHR84. DNA sequencing revealed that putative PhaG(Po) from P. oleovorans exhibited about 95% amino acid sequence identity to PhaG(Pp) from P. putida. Reverse transcriptase-PCR analysis demonstrated that phaG(Po) was not transcribed even tinder inducing conditions, i.e. in the presence of gluconate as carbon source, whereas induction of phaG(Pp) transcription was obtained in P. putida. When octanoate was used as sole carbon source, only low levels of phaG mRNA were detected in P. putida. Plasmid pBHR84 complemented the phaG-negative mutant PhaG(N)-21 from P. putida. Interestingly, reintroduction of phaG(Po) under lac promoter control into the natural host P. oleovorans established PHA(MCL) synthesis from non-related carbon sources in this bacterium. These data indicated that phaG(Po) in P. oleovorans is not functionally expressed and does not exert its original function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun Xingmin; Goehler, Andre; Heller, Knut J.
2006-06-20
The ltp gene, located within the lysogeny module of temperate Streptococcus thermophilus phage TP-J34, has been shown to be expressed in lysogenic strain S. thermophilus J34. It codes for a lipoprotein, as demonstrated by inhibition of cleavage of the signal sequence by globomycin. Exposure of Ltp on the surface of Lactococcus lactis protoplasts bearing a plasmid-encoded copy of ltp has been demonstrated by immunogold labeling and electron microscopy. Expression of ltp in prophage- and plasmid-cured S. thermophilus J34-6f interfered with TP-J34 infection. While plating efficiency was reduced by a factor of about 40 and lysis of strain J34-6f in liquidmore » medium was delayed considerably, phage adsorption was not affected at all. Intracellular accumulation of phage DNA was shown to be inhibited by Ltp. This indicates interference of Ltp with infection at the stage of triggering DNA release and injection into the cell, indicating a role of Ltp in superinfection exclusion. Expression of ltp in L. lactis Bu2-60 showed that the same superinfection exclusion mechanism was strongly effective against phage P008, a member of the lactococcal 936 phage species: no plaque-formation was detectable with even 10{sup 9} phage per ml applied, and lysis in liquid medium did not occur. In Lactococcus also, Ltp apparently inhibited phage DNA release and/or injection. Ltp appears to be a member of a family of small, secreted proteins with a 42 amino acids repeat structure encoded by genes of Gram-positive bacteria. Some of these homologous genes are part of the genomes of prophages.« less
Shayakhmetov, D; Kovalenko, D; Yurov, G; Borisenko, A; Tikchonenko, T
1997-08-01
Use of viral inducible promoters which can be activated by virus-specific transactivator proteins to drive expression of antisense (as)RNA genes appears to be an attractive approach to inhibit virus infections in vivo. To this end, we have constructed an asRNA gene expressed from the bovine leukaemia virus (BLV) U3 promoter that is complementary to the R-U5 region of the BLV genome. This is the region that is most susceptible to inhibition by asRNA. With plasmid pLU, which expresses the asRNA gene under the control of the BLV U3 promoter, 75% inhibition of virus replication was attained in CC81 cells (the molar ratio of pLU DNA over BLV proviral DNA in the transfection mixture was 5:1). Plasmid pLT, which contains only the BLV U3 promoter without any asRNA-coding region, also efficiently (up to 60%) inhibited virus replication when cotransfected with BLV proviral DNA at a ratio of 20:1. It was suggested that competition between functional and 'empty' viral promoters for the viral transactivator protein p38tax could account for this inhibition. An immunoblotting assay showed that in the presence of nuclear extracts from CC81 cells exogenous BLV p38tax specifically associates with its responsive sequence located in the BLV U3 promoter. Moreover, the additional expression of p38tax in CC81 cells abolishes the inhibitory effect of the empty viral promoter. These observations suggest a new mechanism of BLV inhibition caused, most probably, by sequestering of the viral transactivator protein.
2013-01-01
Background Halomonas sp. ZM3 was isolated from Zelazny Most post-flotation mineral waste repository (Poland), which is highly contaminated with heavy metals and various organic compounds. Mobile DNA of the strain (i.e. plasmids and transposons) were analyzed in order to identify genetic information enabling adaptation of the bacterium to the harsh environmental conditions. Results The analysis revealed that ZM3 carries plasmid pZM3H1 (31,370 bp), whose replication system may be considered as an archetype of a novel subgroup of IncU-like replicons. pZM3H1 is a narrow host range, mobilizable plasmid (encodes a relaxase of the MOBV family) containing mercury resistance operon (mer) and czcD genes (mediate resistance to zinc and cobalt), which are part of a large truncated Tn3 family transposon. Further analysis demonstrated that the phenotypes determined by the pZM3H1 resistance cassette are highly dependent on the host strain. In another strand of the study, the trap plasmid pMAT1 was employed to identify functional transposable elements of Halomonas sp. ZM3. Using the sacB positive selection strategy two insertion sequences were identified: ISHsp1 - representing IS5 group of IS5 family and ISHsp2 - a distinct member of the IS630 family. Conclusions This study provides the first detailed description of mobile DNA in a member of the family Halomonadaceae. The identified IncU plasmid pZM3H1 confers resistance phenotypes enabling adaptation of the host strain to the Zelazny Most environment. The extended comparative analysis has shed light on the distribution of related IncU plasmids among bacteria, which, in many cases, reflects the frequency and direction of horizontal gene transfer events. Our results also identify plasmid-encoded modules, which may form the basis of novel shuttle vectors, specific for this group of halophilic bacteria. PMID:23497212
Kinnear, Ekaterina; Caproni, Lisa J; Tregoning, John S
2015-01-01
DNA vaccines can be manufactured cheaply, easily and rapidly and have performed well in pre-clinical animal studies. However, clinical trials have so far been disappointing, failing to evoke a strong immune response, possibly due to poor antigen expression. To improve antigen expression, improved technology to monitor DNA vaccine transfection efficiency is required. In the current study, we compared plasmid encoded tdTomato, mCherry, Katushka, tdKatushka2 and luciferase as reporter proteins for whole animal in vivo imaging. The intramuscular, subcutaneous and tattooing routes were compared and electroporation was used to enhance expression. We observed that overall, fluorescent proteins were not a good tool to assess expression from DNA plasmids, with a highly heterogeneous response between animals. Of the proteins used, intramuscular delivery of DNA encoding either tdTomato or luciferase gave the clearest signal, with some Katushka and tdKatushka2 signal observed. Subcutaneous delivery was weakly visible and nothing was observed following DNA tattooing. DNA encoding haemagglutinin was used to determine whether immune responses mirrored visible expression levels. A protective immune response against H1N1 influenza was induced by all routes, even after a single dose of DNA, though qualitative differences were observed, with tattooing leading to high antibody responses and subcutaneous DNA leading to high CD8 responses. We conclude that of the reporter proteins used, expression from DNA plasmids can best be assessed using tdTomato or luciferase. But, the disconnect between visible expression level and immunogenicity suggests that in vivo whole animal imaging of fluorescent proteins has limited utility for predicting DNA vaccine efficacy.
Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei
2015-08-01
DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.
Saurer, Eric M.; Yamanouchi, Dai; Liu, Bo; Lynn, David M.
2010-01-01
We report an approach for the localized delivery of plasmid DNA to vascular tissue from the surfaces of inflatable embolectomy catheter balloons. Using a layer-by-layer approach, ultrathin multilayered polyelectrolyte films were fabricated on embolectomy catheter balloons by alternately adsorbing layers of a hydrolytically degradable poly(β-amino ester) and plasmid DNA. Fluorescence microscopy revealed that the films coated the surfaces of the balloons uniformly. Coated balloons that were incubated in phosphate-buffered saline at 37 °C released ~25 μg DNA/cm2 over 24 hours. Analysis of the DNA by gel electrophoresis showed that the DNA was released in open-circular (‘nicked’) and supercoiled conformations, and in vitro cell transfection assays confirmed that the released DNA was transcriptionally active. Arterial injury was induced in the internal carotid arteries of Sprague-Dawley rats using uncoated balloons, followed by treatment with film-coated balloons for 20 minutes. X-gal, immunohistochemical, and immunofluorescence staining of sectioned arteries indicated high levels of β-galactosidase or enhanced green fluorescent protein (EGFP) expression in arteries treated with film-coated balloons. β-galactosidase and EGFP expression were observed throughout the medial layers of arterial tissue, and around approximately two-thirds of the circumference of the treated arteries. The layer-by-layer approach reported here provides a general platform for the balloon-mediated delivery of DNA to vascular tissue. Our results suggest the potential of this approach to deliver therapeutically relevant DNA to prevent complications such as intimal hyperplasia that arise after vascular interventions. PMID:20933275
DNA damage induced by the direct effect of radiation
NASA Astrophysics Data System (ADS)
Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.
2008-10-01
We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.
Smith, M D; Flickinger, J L; Lineberger, D W; Schmidt, B
1986-01-01
The goal of this study was to investigate the likelihood of developing useful transformation systems for coryneform bacteria. Two species of coryneform bacteria, Brevibacterium lactofermentum and Corynebacterium lilium, were transformed with chimeras constructed from pUB110 and a cryptic coryneform plasmid (pGX1901). C. lilium protoplasts were also efficiently transfected with phage CS1 DNA. High transformation and transfection frequencies were obtained after only 2 min of lysozyme treatment of lysozyme-sensitive mutants. A series of experiments was also conducted to determine whether DNA from other species of important industrial microbes from the genus Bacillus could be expressed in coryneform bacteria. Evidence of restriction of Bacillus subtilis DNA by B. lactofermentum was observed but could be overcome. A Bacillus amyloliquefaciens alpha-amylase gene (amyEBamP) was subcloned onto a plasmid able to replicate in B. lactofermentum. B. lactofermentum transformants for this plasmid expressed amylase activity and produced material cross-reactive to amylase antibody. Images PMID:3008649
Amon, Wolfgang; White, Robert E; Farrell, Paul J
2006-05-01
Epstein-Barr virus (EBV) establishes a latent persistence from which it can be reactivated to undergo lytic replication. Late lytic-cycle gene expression is linked to lytic DNA replication, as it is sensitive to the same inhibitors that block lytic replication, and it has recently been shown that the viral origin of lytic replication (ori lyt) is required in cis for late-gene expression. During the lytic cycle, the viral genome forms replication compartments, which are usually adjacent to promyelocytic leukaemia protein (PML) nuclear bodies. A tetracycline repressor DNA-binding domain-enhanced green fluorescent protein fusion was used to visualize replicating plasmids carrying a tetracycline operator sequence array. ori lyt mediated the production of plasmid replication compartments that were associated with PML nuclear bodies. Plasmids carrying ori lyt and EBV itself were visualized in the same cells and replicated in similar regions of the nucleus, further supporting the validity of the plasmids for studying late-gene regulation.
Influence of Space Flight Factors on the Genetic Properties of Streptomyces Lividans 66 (PIJ702)
NASA Technical Reports Server (NTRS)
Tabakov, V. Yu.; Voeikova, T. A.; Tairbekov, M. G.; Goins, T. L.; Martinson, V. G.; Pyle, B. H.
2006-01-01
Gram-positive Streptomyces bacteria display genetic instability in response to external factors. Strain S. lividans 66 harbors the multicopy plasmid pIJ702 with selective and differential marker genes for antibiotic thiostrepton resistance and melanin production. Culture plates of modified ISP agar medium with and without thiostrepton were flown on Foton-M2. Suboptimal flight temperatures, which were simulated for asynchronous ground controls, resulted in slow growth and failure to differentiate and sporulate. Flight samples and asynchronous controls showed a high frequency of failing to express plasmid markers compared to laboratory controls. This was associated with loss of plasmid DNA and likely resulted from suboptimal temperatures for flight cultures and controls. Neither restriction fragment length polymorphism, nor polymerase chain reaction amplification coupled with denaturing gradient gel electrophoresis, revealed differences between pIJ702 DNA from flight vs. control clones. Mutations of the plasmid marker genes resulting from specific spaceflight factors, e.g., microgravity and radiation, were not detected.
Metal chelate affinity precipitation of RNA and purification of plasmid DNA
NASA Technical Reports Server (NTRS)
Balan, Sindhu; Murphy, Jason; Galaev, Igor; Kumar, Ashok; Fox, George E.; Mattiasson, Bo; Willson, Richard C.
2003-01-01
The affinity of metal chelates for amino acids, such as histidine, is widely used in purifying proteins, most notably through six-histidine 'tails'. We have found that metal affinity interactions can also be applied to separation of single-stranded nucleic acids through interactions involving exposed purines. Here we describe a metal affinity precipitation method to resolve RNA from linear and plasmid DNA. A copper-charged copolymer of N-isopropyl acrylamide (NIPAM) and vinyl imidazole (VI) is used to purify plasmid from an alkaline lysate of E. coli. The NIPAM units confer reversible solubility on the copolymer while the imidazole chelates metal ions in a manner accessible to interaction with soluble ligands. RNA was separated from the plasmid by precipitation along with the polymer in the presence of 800 mM NaCl. Bound RNA could be recovered by elution with imidazole and separated from copolymer by a second precipitation step. RNA binding showed a strong dependence on temperature and on the type of buffer used.
Saccharomyces boulardii improves humoral immune response to DNA vaccines against leptospirosis.
Silveira, Marcelle Moura; Conceição, Fabricio Rochedo; Mendonça, Marcelo; Moreira, Gustavo Marçal Schmidt Garcia; Da Cunha, Carlos Eduardo Pouey; Conrad, Neida Lucia; Oliveira, Patrícia Diaz de; Hartwig, Daiane Drawanz; De Leon, Priscila Marques Moura; Moreira, Ângela Nunes
2017-02-01
Saccharomyces boulardii may improve the immune response by enhancing the production of anti-inflammatory cytokines, T-cell proliferation and dendritic cell activation. The immunomodulator effect of this probiotic has never been tested with DNA vaccines, which frequently induce low antibody titers. This study evaluated the capacity of Saccharomyces boulardii to improve the humoral and cellular immune responses using DNA vaccines coding for the leptospiral protein fragments LigAni and LigBrep. BALB/c mice were fed with rodent-specific feed containing 108 c.f.u. of Saccharomycesboulardii per gram. Animals were immunized three times intramuscularly with 100 µg of pTARGET plasmids containing the coding sequences for the above mentioned proteins. Antibody titers were measured by indirect ELISA. Expression levels of IL-4, IL-10, IL-12, IL-17, IFN-γ and TGF-β were determined by quantitative real-time PCR from RNA extracted from whole blood, after an intraperitoneal boost with 50 µg of the recombinant proteins.Results/Key findings. Antibody titers increased significantly after the second and third application when pTARGET/ligAni and pTARGET/ligBrep were used to vaccinate the animals in comparison with the control group (P<0.05). In addition, there was a significant increase in the expression of the IL-10 in mice immunized with pTARGET/ligBrep and fed with Saccharomyces boulardii. The results suggested that Saccharomyces boulardii has an immunomodulator effect in DNA vaccines, mainly by stimulating the humoral response, which is often limited in this kind of vaccine. Therefore, the use of Saccharomyces boulardii as immunomodulator represents a new alternative strategy for more efficient DNA vaccination.
Woloj, M; Tolmasky, M E; Roberts, M C; Crosa, J H
1986-01-01
Two multiresistant Klebsiella pneumoniae strains isolated from cerebrospinal fluid of human neonates were analyzed for their plasmid content. Two of the plasmids harbored by these strains, pJHCMW1 (11 kilobase pairs) and pJHCMW4 (75 kilobase pairs), carried genetic determinants for amikacin resistance. These plasmids also encoded resistance to kanamycin, tobramycin, and ampicillin which could be transferred to Escherichia coli by conjugation. Extracts from transconjugant derivatives carrying pJHCMW4 produced an acetyltransferase activity that acetylated all three aminoglycosides. Transconjugant derivatives carrying pJHCMW1 encoded both acetylating and phosphorylating activities. Southern blot hybridization analysis indicated considerable DNA homology between these two plasmids. Images PMID:3521478
Rajasekar, Karthik V.; Lovering, Andrew L.; Dancea, Felician; Scott, David J.; Harris, Sarah A.; Bingle, Lewis E.H.; Roessle, Manfred; Thomas, Christopher M.; Hyde, Eva I.; White, Scott A.
2016-01-01
Abstract The IncP (Incompatibility group P) plasmids are important carriers in the spread of antibiotic resistance across Gram-negative bacteria. Gene expression in the IncP-1 plasmids is stringently controlled by a network of four global repressors, KorA, KorB, TrbA and KorC interacting cooperatively. Intriguingly, KorA and KorB can act as co-repressors at varying distances between their operators, even when they are moved to be on opposite sides of the DNA. KorA is a homodimer with the 101-amino acid subunits, folding into an N-terminal DNA-binding domain and a C-terminal dimerization domain. In this study, we have determined the structures of the free KorA repressor and two complexes each bound to a 20-bp palindromic DNA duplex containing its consensus operator sequence. Using a combination of X-ray crystallography, nuclear magnetic resonance spectroscopy, SAXS and molecular dynamics calculations, we show that the linker between the two domains is very flexible and the protein remains highly mobile in the presence of DNA. This flexibility allows the DNA-binding domains of the dimer to straddle the operator DNA on binding and is likely to be important in cooperative binding to KorB. Unexpectedly, the C-terminal domain of KorA is structurally similar to the dimerization domain of the tumour suppressor p53. PMID:27016739
Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor
2015-07-27
The dinuclear iron(II) supramolecular helicates [Fe2 L3 ]Cl4 (L=C25 H20 N4 ) bind to DNA through noncovalent (i.e., hydrogen-bonding, electrostatic) interactions and exhibit antimicrobial and anticancer effects. In this study, we show that the helicates condense plasmid DNA with a much higher potency than conventional DNA-condensing agents. Notably, molecules of DNA in the presence of the M enantiomer of [Fe2 L3 ]Cl4 do not form intermolecular aggregates typically formed by other condensing agents, such as spermidine or spermine. The helicates inhibit the activity of several DNA-processing enzymes, such as RNA polymerase, DNA topoisomerase I, deoxyribonuclease I, and site-specific restriction endonucleases. However, the results also indicate that the DNA condensation induced by the helicates does not play a crucial role in these inhibition reactions. The mechanisms for the inhibitory effects of [Fe2 L3 ]Cl4 helicates on DNA-related enzymatic activities have been proposed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A Versatile Microfluidic Device for Automating Synthetic Biology.
Shih, Steve C C; Goyal, Garima; Kim, Peter W; Koutsoubelis, Nicolas; Keasling, Jay D; Adams, Paul D; Hillson, Nathan J; Singh, Anup K
2015-10-16
New microbes are being engineered that contain the genetic circuitry, metabolic pathways, and other cellular functions required for a wide range of applications such as producing biofuels, biobased chemicals, and pharmaceuticals. Although currently available tools are useful in improving the synthetic biology process, further improvements in physical automation would help to lower the barrier of entry into this field. We present an innovative microfluidic platform for assembling DNA fragments with 10× lower volumes (compared to that of current microfluidic platforms) and with integrated region-specific temperature control and on-chip transformation. Integration of these steps minimizes the loss of reagents and products compared to that with conventional methods, which require multiple pipetting steps. For assembling DNA fragments, we implemented three commonly used DNA assembly protocols on our microfluidic device: Golden Gate assembly, Gibson assembly, and yeast assembly (i.e., TAR cloning, DNA Assembler). We demonstrate the utility of these methods by assembling two combinatorial libraries of 16 plasmids each. Each DNA plasmid is transformed into Escherichia coli or Saccharomyces cerevisiae using on-chip electroporation and further sequenced to verify the assembly. We anticipate that this platform will enable new research that can integrate this automated microfluidic platform to generate large combinatorial libraries of plasmids and will help to expedite the overall synthetic biology process.
Jain, Shardool; Tran, Thanh-Huyen; Amiji, Mansoor
2015-01-01
In this study, we have shown for the first time the effectiveness of a non-viral gene transfection strategy to re-polarize macrophages from M1 to M2 functional sub-type for the treatment of rheumatoid arthritis (RA). An anti-inflammatory (IL-10) cytokine encoding plasmid DNA was successfully encapsulated into non-condensing alginate based nanoparticles and the surface of the nano-carriers was modified with tuftsin peptide to achieve active macrophage targeting. Enhanced localization of tuftsin-modified alginate nanoparticles was observed in the inflamed paws of arthritic rats upon intraperitoneal administration. Importantly, targeted nanoparticle treatment was successful in reprogramming macrophage phenotype balance as ~66% of total synovial macrophages from arthritic rats treated with the IL-10 plasmid DNA loaded tuftsin/alginate nanoparticles were in the M2 state compared to ~9% of macrophages in the M2 state from untreated arthritic rats. Treatment significantly reduced systemic and joint tissue pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) expression and prevented the progression of inflammation and joint damage as revealed by magnetic resonance imaging and histology. Treatment enabled animals to retain their mobility throughout the course of study, whereas untreated animals suffered from impaired mobility. Overall, this study demonstrates that targeted alginate nanoparticles loaded with IL-10 plasmid DNA can efficiently re-polarize macrophages from an M1 to an M2 state, offering a novel treatment paradigm for treatment of chronic inflammatory diseases. PMID:26004232
Fumoto, Shintaro; Nishimura, Koyo; Nishida, Koyo; Kawakami, Shigeru
2016-01-01
Evaluation methods for determining the distribution of transgene expression in the body and the in vivo fate of viral and non-viral vectors are necessary for successful development of in vivo gene delivery systems. Here, we evaluated the spatial distribution of transgene expression using tissue clearing methods. After hydrodynamic injection of plasmid DNA into mice, whole tissues were subjected to tissue clearing. Tissue clearing followed by confocal laser scanning microscopy enabled evaluation of the three-dimensional distribution of transgene expression without preparation of tissue sections. Among the tested clearing methods (ClearT2, SeeDB, and CUBIC), CUBIC was the most suitable method for determining the spatial distribution of transgene expression in not only the liver but also other tissues such as the kidney and lung. In terms of the type of fluorescent protein, the observable depth for green fluorescent protein ZsGreen1 was slightly greater than that for red fluorescent protein tdTomato. We observed a depth of ~1.5 mm for the liver and 500 μm for other tissues without preparation of tissue sections. Furthermore, we succeeded in multicolor deep imaging of the intracellular fate of plasmid DNA in the murine liver. Thus, tissue clearing would be a powerful approach for determining the spatial distribution of plasmid DNA and transgene expression in various murine tissues.
A three-dimensional ParF meshwork assembles through the nucleoid to mediate plasmid segregation
McLeod, Brett N.; Allison-Gamble, Gina E.; Barge, Madhuri T.; Tonthat, Nam K.; Schumacher, Maria A.; Hayes, Finbarr
2017-01-01
Abstract Genome segregation is a fundamental step in the life cycle of every cell. Most bacteria rely on dedicated DNA partition proteins to actively segregate chromosomes and low copy-number plasmids. Here, by employing super resolution microscopy, we establish that the ParF DNA partition protein of the ParA family assembles into a three-dimensional meshwork that uses the nucleoid as a scaffold and periodically shuttles between its poles. Whereas ParF specifies the territory for plasmid trafficking, the ParG partner protein dictates the tempo of ParF assembly cycles and plasmid segregation events by stimulating ParF adenosine triphosphate hydrolysis. Mutants in which this ParG temporal regulation is ablated show partition deficient phenotypes as a result of either altered ParF structure or dynamics and indicate that ParF nucleoid localization and dynamic relocation, although necessary, are not sufficient per se to ensure plasmid segregation. We propose a Venus flytrap model that merges the concepts of ParA polymerization and gradient formation and speculate that a transient, dynamic network of intersecting polymers that branches into the nucleoid interior is a widespread mechanism to distribute sizeable cargos within prokaryotic cells. PMID:28034957
Lin, Tzu-Lung; Pan, Yi-Jiun; Hsieh, Pei-Fang; Hsu, Chun-Ru; Wu, Meng-Chuan; Wang, Jin-Town
2016-08-17
Analysis of the genome of Klebsiella pneumoniae NTUH-K2044 strain revealed the presence of two clustered regularly interspaced short palindromic repeats (CRISPR) arrays separated with CRISPR-associated (cas) genes. Carbapenem-resistant K. pneumoniae isolates were observed to be less likely to have CRISPR-Cas than sensitive strains (5/85 vs. 22/132). Removal of the transcriptional repressor, H-NS, was shown to prevent the transformation of plasmids carrying a spacer and putative proto-spacer adjacent motif (PAM). The CRISPR-Cas system also decreased pUC-4K plasmid stability, resulting in plasmid loss from the bacteria with acquisition of new spacers. Analysis of the acquired proto-spacers in pUC-4K indicated that 5'-TTN-3' was the preferred PAM in K. pneumoniae. Treatment of cells by imipenem induced hns expression, thereby decreasing cas3 expression and consequently repressed CRISPR-Cas activity resulted in increase of plasmid stability. In conclusion, NTUH-K2044 CRISPR-Cas contributes to decrease of plasmid transformation and stability. Through repression of CRISPR-Cas activity by induced H-NS, bacteria might be more able to acquire DNA to confront the challenge of imipenem.
Papenfort, Kai; Espinosa, Elena; Casadesús, Josep; Vogel, Jörg
2015-08-25
Horizontal gene transfer via plasmid conjugation is a major driving force in microbial evolution but constitutes a complex process that requires synchronization with the physiological state of the host bacteria. Although several host transcription factors are known to regulate plasmid-borne transfer genes, RNA-based regulatory circuits for host-plasmid communication remain unknown. We describe a posttranscriptional mechanism whereby the Hfq-dependent small RNA, RprA, inhibits transfer of pSLT, the virulence plasmid of Salmonella enterica. RprA employs two separate seed-pairing domains to activate the mRNAs of both the sigma-factor σ(S) and the RicI protein, a previously uncharacterized membrane protein here shown to inhibit conjugation. Transcription of ricI requires σ(S) and, together, RprA and σ(S) orchestrate a coherent feedforward loop with AND-gate logic to tightly control the activation of RicI synthesis. RicI interacts with the conjugation apparatus protein TraV and limits plasmid transfer under membrane-damaging conditions. To our knowledge, this study reports the first small RNA-controlled feedforward loop relying on posttranscriptional activation of two independent targets and an unexpected role of the conserved RprA small RNA in controlling extrachromosomal DNA transfer.
Current strategies for mobilome research.
Jørgensen, Tue S; Kiil, Anne S; Hansen, Martin A; Sørensen, Søren J; Hansen, Lars H
2014-01-01
Mobile genetic elements (MGEs) are pivotal for bacterial evolution and adaptation, allowing shuffling of genes even between distantly related bacterial species. The study of these elements is biologically interesting as the mode of genetic propagation is kaleidoscopic and important, as MGEs are the main vehicles of the increasing bacterial antibiotic resistance that causes thousands of human deaths each year. The study of MGEs has previously focused on plasmids from individual isolates, but the revolution in sequencing technology has allowed the study of mobile genomic elements of entire communities using metagenomic approaches. The problem in using metagenomic sequencing for the study of MGEs is that plasmids and other mobile elements only comprise a small fraction of the total genetic content that are difficult to separate from chromosomal DNA based on sequence alone. The distinction between plasmid and chromosome is important as the mobility and regulation of genes largely depend on their genetic context. Several different approaches have been proposed that specifically enrich plasmid DNA from community samples. Here, we review recent approaches used to study entire plasmid pools from complex environments, and point out possible future developments for and pitfalls of these approaches. Further, we discuss the use of the PacBio long-read sequencing technology for MGE discovery.
Lin, Tzu-Lung; Pan, Yi-Jiun; Hsieh, Pei-Fang; Hsu, Chun-Ru; Wu, Meng-Chuan; Wang, Jin-Town
2016-01-01
Analysis of the genome of Klebsiella pneumoniae NTUH-K2044 strain revealed the presence of two clustered regularly interspaced short palindromic repeats (CRISPR) arrays separated with CRISPR-associated (cas) genes. Carbapenem-resistant K. pneumoniae isolates were observed to be less likely to have CRISPR-Cas than sensitive strains (5/85 vs. 22/132). Removal of the transcriptional repressor, H-NS, was shown to prevent the transformation of plasmids carrying a spacer and putative proto-spacer adjacent motif (PAM). The CRISPR-Cas system also decreased pUC-4K plasmid stability, resulting in plasmid loss from the bacteria with acquisition of new spacers. Analysis of the acquired proto-spacers in pUC-4K indicated that 5′-TTN-3′ was the preferred PAM in K. pneumoniae. Treatment of cells by imipenem induced hns expression, thereby decreasing cas3 expression and consequently repressed CRISPR-Cas activity resulted in increase of plasmid stability. In conclusion, NTUH-K2044 CRISPR-Cas contributes to decrease of plasmid transformation and stability. Through repression of CRISPR-Cas activity by induced H-NS, bacteria might be more able to acquire DNA to confront the challenge of imipenem. PMID:27531594
Ray, F A; Peabody, D S; Cooper, J L; Cram, L S; Kraemer, P M
1990-01-01
To define the role of SV40 large T antigen in the transformation and immortalization of human cells, we have constructed a plasmid lacking most of the unique coding sequences of small t antigen as well as the SV40 origin of replication. The promoter for T antigen, which lies within the origin of replication, was deleted and replaced by the Rous sarcoma virus promoter. This minimal construct was co-electroporated into normal human fibroblasts of neonatal origin along with a plasmid containing the neomycin resistance gene (neo). Three G418-resistant, T antigen-positive clones were expanded and compared to three T antigen-positive clones that received the pSV3neo plasmid (capable of expressing large and small T proteins and having two origins of replication). Autonomous replication of plasmid DNA was observed in all three clones that received pSV3neo but not in any of the three origin minus clones. Immediately after clonal expansion, several parameters of neoplastic transformation were assayed. Low percentages of cells in T antigen-positive populations were anchorage independent or capable of forming colonies in 1% fetal bovine serum. The T antigen-positive clones generally exhibited an extended lifespan in culture but rarely became immortalized. Large numbers of dead cells were continually generated in all T antigen-positive, pre-crisis populations. Ninety-nine percent of all T antigen-positive cells had numerical or structural chromosome aberrations. Control cells that received the neo gene did not have an extended life span, did not have noticeable numbers of dead cells, and did not exhibit karyotype instability. We suggest that the role of T antigen protein in the transformation process is to generate genetic hypervariability, leading to various consequences including neoplastic transformation and cell death.