[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization

NASA Astrophysics Data System (ADS)

Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.

1995-10-01

Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.

Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

PubMed

Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

2012-01-01

TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

Plasmid DNA Delivery: Nanotopography Matters.

PubMed

Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

2017-12-20

Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.

PubMed

Hassan, Sally; Keshavarz-Moore, Eli; Ward, John

2016-09-01

With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.

Survey of Navy Funded Marine Mammal Research and Studies FY 00-01

DTIC Science & Technology

2001-05-10

protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to

Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae

PubMed Central

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137

Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.

PubMed

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.

Transformation of Saccharomyces cerevisiae and Schizosaccharomyces pombe with linear plasmids containing 2 micron sequences.

PubMed Central

Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P

1985-01-01

Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773

High-efficiency transformation of Pichia stipitis based on its URA3 gene and a homologous autonomous replication sequence, ARS2.

PubMed Central

Yang, V W; Marks, J A; Davis, B P; Jeffries, T W

1994-01-01

This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063

Deletion of the Clostridium thermocellum recA gene reveals that it is required for thermophilic plasmid replication but not plasmid integration at homologous DNA sequences.

PubMed

Groom, Joseph; Chung, Daehwan; Kim, Sun-Ki; Guss, Adam; Westpheling, Janet

2018-05-28

A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (≥ 60 °C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a result also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ∆recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.

Deletion of the Clostridium thermocellum recA Gene Reveals that it is Required for Thermophilic Plasmid Replication but not Plasmid Integration at Homologous DNA Sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chung, Daehwan; Groom, Joseph; Kim, Sun-Ki

A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (>/= 60 degrees C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a resultmore » also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ..delta..recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.« less

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1991-03-26

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1987-08-28

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.

PubMed

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

PubMed Central

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908

A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

PubMed Central

Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

2017-01-01

We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

Ultra-low background DNA cloning system.

PubMed

Goto, Kenta; Nagano, Yukio

2013-01-01

Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

PubMed Central

Sharma, Nynne; Cai, Yujia; Bak, Rasmus O; Jakobsen, Martin R; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2013-01-01

DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB) DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs) devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system. PMID:23443502

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.

PubMed

Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu

2015-05-01

Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Optimization of a one-step heat-inducible in vivo mini DNA vector production system.

PubMed

Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.

Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System

PubMed Central

Wettig, Shawn; Slavcev, Roderick A.

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704

Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.

PubMed

Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M

1985-10-30

A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.

Electrotransfer of Plasmid Vector DNA into Muscle

NASA Astrophysics Data System (ADS)

Miyazaki, Satsuki; Miyazaki, Jun-Ichi

Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

PubMed Central

Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

2013-01-01

IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

Development of plasmid vector and electroporation condition for gene transfer in sporogenic lactic acid bacterium, Bacillus coagulans.

PubMed

Rhee, Mun Su; Kim, Jin-Woo; Qian, Yilei; Ingram, L O; Shanmugam, K T

2007-07-01

Bacillus coagulans is a sporogenic lactic acid bacterium that ferments glucose and xylose, major components of plant biomass, a potential feedstock for cellulosic ethanol. The temperature and pH for optimum rate of growth of B. coagulans (50 to 55 degrees C, pH 5.0) are very similar to that of commercially developed fungal cellulases (50 degrees C; pH 4.8). Due to this match, simultaneous saccharification and fermentation (SSF) of cellulose to products by B. coagulans is expected to require less cellulase than needed if the SSF is conducted at a sub-optimal temperature, such as 30 degrees C, the optimum for yeast, the main biocatalyst used by the ethanol industry. To fully exploit B. coagulans as a platform organism, we have developed an electroporation method to transfer plasmid DNA into this genetically recalcitrant bacterium. We also constructed a B. coagulans/E. coli shuttle vector, plasmid pMSR10 that contains the rep region from a native plasmid (pMSR0) present in B. coagulans strain P4-102B. The native plasmid, pMSR0 (6823bp), has 9 ORFs, and replicates by rolling-circle mode of replication. Plasmid pNW33N, developed for Geobacillus stearothermophilus, was also transformed into this host and stably maintained while several other Bacillus/Escherichia coli shuttle vector plasmids were not transformed into B. coagulans. The transformation efficiency of B. coagulans strain P4-102B using the plasmids pNW33N or pMSR10 was about 1.5x10(16) per mole of DNA. The availability of shuttle vectors and an electroporation method is expected to aid in genetic and metabolic engineering of B. coagulans.

pLS010 plasmid vector

DOEpatents

Lacks, Sanford A.; Balganesh, Tanjore S.

1988-01-01

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

Biophysical characterization of an integrin-targeted lipopolyplex gene delivery vector.

PubMed

Mustapa, M Firouz Mohd; Bell, Paul C; Hurley, Christopher A; Nicol, Alastair; Guénin, Erwann; Sarkar, Supti; Writer, Michele J; Barker, Susie E; Wong, John B; Pilkington-Miksa, Michael A; Papahadjopoulos-Sternberg, Brigitte; Shamlou, Parviz Ayazi; Hailes, Helen C; Hart, Stephen L; Zicha, Daniel; Tabor, Alethea B

2007-11-13

Nonviral gene delivery vectors now show good therapeutic potential: however, detailed characterization of the composition and macromolecular organization of such particles remains a challenge. This paper describes experiments to elucidate the structure of a ternary, targeted, lipopolyplex synthetic vector, the LID complex. This consists of a lipid component, Lipofectin (L) (1:1 DOTMA:DOPE), plasmid DNA (D), and a dual-function, cationic peptide component (I) containing DNA condensation and integrin-targeting sequences. Fluorophore-labeled lipid, peptide, and DNA components were used to formulate the vector, and the stoichiometry of the particles was established by fluorescence correlation spectroscopy (FCS). The size of the complex was measured by FCS, and the sizes of LID, L, LD, and ID complexes were measured by dynamic light scattering (DLS). Fluorescence quenching experiments and freeze-fracture electron microscopy were then used to demonstrate the arrangement of the lipid, peptide, and DNA components within the complex. These experiments showed that the cationic portion of the peptide, I, interacts with the plasmid DNA, resulting in a tightly condensed DNA-peptide inner core; this is surrounded by a disordered lipid layer, from which the integrin-targeting sequence of the peptide partially protrudes.

Transposon-containing DNA cloning vector and uses thereof

DOEpatents

Berg, C.M.; Berg, D.E.; Wang, G.

1997-07-08

The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed. 4 figs.

Transposon-containing DNA cloning vector and uses thereof

DOEpatents

Berg, Claire M.; Berg, Douglas E.; Wang, Gan

1997-01-01

The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed.

An 'instant gene bank' method for gene cloning by mutant complementation.

PubMed

Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J

1994-02-01

We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.

A novel dual vector coexpressing PhiX174 lysis E gene and staphylococcal nuclease A gene on the basis of lambda promoter pR and pL, respectively.

PubMed

Fu, Lixia; Lu, Chengping

2013-06-01

Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).

Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis.

PubMed

Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo

2015-01-01

To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.

pLS101 plasmid vector

DOEpatents

Lacks, S.A.; Balganesh, T.S.

1985-02-19

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

Advances in Non-Viral DNA Vectors for Gene Therapy

PubMed Central

Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

2017-01-01

Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

Rapid Amplification of Plasmid and Phage DNA Using Phi29 DNA Polymerase and Multiply-Primed Rolling Circle Amplification

PubMed Central

Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.

2001-01-01

We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified products can also be used for in vitro cloning, library construction, and other molecular biology applications. PMID:11381035

A stable shuttle vector system for efficient genetic complementation of Helicobacter pylori strains by transformation and conjugation.

PubMed

Heuermann, D; Haas, R

1998-03-01

A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.

The ability of a collagen/calcium phosphate scaffold to act as its own vector for gene delivery and to promote bone formation via transfection with VEGF(165).

PubMed

Keeney, Michael; van den Beucken, Jeroen J J P; van der Kraan, Peter M; Jansen, John A; Pandit, Abhay

2010-04-01

Collagen/calcium phosphate scaffolds have been used for bone reconstruction due to their inherent similarities to the bone extracellular matrix. Calcium phosphate alone has also been used as a non-viral vector for gene delivery. The aim of this study was to determine the capability of a collagen/calcium phosphate scaffold to deliver naked plasmid DNA and mediate transfection in vivo. The second goal of the study was to deliver a plasmid encoding vascular endothelial growth factor(165) (pVEGF(165)) to promote angiogenesis, and hence bone formation, in a mouse intra-femoral model. The delivery of naked plasmid DNA resulted in a 7.6-fold increase in mRNA levels of beta-Galactosidase compared to the delivery of plasmid DNA complexed with a partially degraded PAMAM dendrimer (dPAMAM) in a subcutaneous murine model. When implanted in a muirne intra-femoral model, the delivery of pVEGF(165) resulted in a 2-fold increase in bone volume at the defect site relative to control scaffolds without pVEGF(165). It was concluded that a collagen/calcium phosphate scaffold can mediate transfection without the use of additional transfection vectors and can promote bone formation in a mouse model via the delivery of pVEGF(165). 2009 Elsevier Ltd. All rights reserved.

Construction of a food-grade cloning vector for Lactobacillus plantarum and its utilization in a food model.

PubMed

Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

2012-01-01

The development of Lactobacillus plantarum to be used in starter cultures in the food industry has been limited because of the lack of a food-grade cloning vector for the bacterium. In this study, the plasmid pFLP1 was constructed by joining 2 DNA fragments derived from food-approved organisms. The 5.2-kb BamHI/KpnI DNA fragment of pRV566 containing the theta-type replicon of Lactobacillus sakei was ligated to the BamHI/KpnI DNA fragment of a 2.9-kb lactococcal cadmium resistance determinant amplified from pND918. The 8.1-kb newly constructed plasmid could transform L. plantarum N014, a bacteriocin-producing bacteria originally isolated from nham, a traditional Thai fermented sausage. The resulting transformant, L. plantarum N014-FLP, and its parent strain were shown to be very similar in growth rate and bacteriocin activity. In addition, the plasmid was very stable in its host bacteria under nonselective pressure for 100 generations in MRS medium and for 5 days in a nham model. These results suggest that pFLP1 is a potential food-grade cloning vector for L. plantarum.

The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

NASA Technical Reports Server (NTRS)

Ludwig, D. L.; Bruschi, C. V.

1991-01-01

The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

Construction and production of oncotropic vectors, derived from MVM(p), that share reduced sequence homology with helper plasmids.

PubMed

Clément, Nathalie; Velu, Thierry; Brandenburger, Annick

2002-09-01

The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.

Scaleable processes for the manufacture of therapeutic quantities of plasmid DNA.

PubMed

Shamlou, Parviz Ayazi

2003-06-01

The need for scaleable processes to manufacture therapeutic plasmid DNA (pDNA) is easy to overlook when attention is focused primarily on vector design and establishment of early clinical results. pDNA is a large molecule and has properties that are similar to those of the contaminating chromosomal DNA. These, combined with the low initial concentration of plasmids in the host cell, provide unique process challenges that require significant upfront design to establish robust manufacturing processes that can also comply with current Good Manufacturing Practice ('cGMP') and produce milligram-to-kilogram quantities of pDNA product. This review describes promising scaleable processes that are currently being assessed for production of therapeutic supercoiled pDNA. Fermentation strategies for improving supercoiled plasmid yield and reducing contaminant concentrations are reviewed, and downstream processes are assessed for their ability to efficiently remove cellular contaminants, separate the supercoiled form of the pDNA from its open circular and linear forms, and prepare the purified drug substance for formulation. Current strategies are presented for developing stable delivery systems, and approaches to quality assurance and quality control are discussed.

Plasmid P1 replication: negative control by repeated DNA sequences.

PubMed Central

Chattoraj, D; Cordes, K; Abeles, A

1984-01-01

The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pieces of the incA fragment that each contain only three repeats destabilize P1 plasmids efficiently. This result makes it unlikely that incA specifies a regulatory product. Our in vivo results suggest that the repeating DNA sequence itself negatively controls replication by titrating a P1-determined protein, RepA, that is essential for replication. Consistent with this hypothesis is the observation that the RepA protein binds to the incA fragment in vitro. Images PMID:6387706

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

Analysis of point mutations in an ultraviolet-irradiated shuttle vector plasmid propagated in cells from Japanese xeroderma pigmentosum patients in complementation groups A and F

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagi, T.; Tatsumi-Miyajima, J.; Sato, M.

1991-06-15

To assess the contribution to mutagenesis by human DNA repair defects, a UV-treated shuttle vector plasmid, pZ189, was passed through fibroblasts derived from Japanese xeroderma pigmentosum (XP) patients in two different DNA repair complementation groups (A and F). Patients with XP have clinical and cellular UV hypersensitivity, increased frequency of skin cancer, and defects in DNA repair. The XP DNA repair defects represented by complementation groups A (XP-A) and F (XP-F) are more common in Japan than in Europe or the United States. In comparison to results with DNA repair-proficient human cells (W138-VA13), UV-treated pZ189 passed through the XP-A (XP2OS(SV))more » or XP-F (XP2YO(SV)) cells showed fewer surviving plasmids (XP-A less than XP-F) and a higher frequency of mutated plasmids (XP-A greater than XP-F). Base sequence analysis of more than 200 mutated plasmids showed the major type of base substitution mutation to be the G:C----A:T transition with all three cell lines. The XP-A and XP-F cells revealed a higher frequency of G:C----A:T transitions and a lower frequency of transversions among plasmids with single or tandem mutations and a lower frequency of plasmids with multiple point mutations compared to the normal line. The spectrum of mutations in pZ189 with the XP-A cells was similar to that with the XP-F cells. Seventy-six to 91% of the single base substitution mutations occurred at G:C base pairs in which the 5{prime}-neighboring base of the cytosine was thymine or cytosine. These studies indicate that the DNA repair defects in Japanese XP patients in complementation groups A and F result in different frequencies of plasmid survival and mutagenesis but in similar types of mutagenic abnormalities despite marked differences in clinical features.« less

Plasmids of corynebacteria.

PubMed

Deb, J K; Nath, N

1999-06-01

Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

Stable transformation of a mosquito cell line results in extraordinarily high copy numbers of the plasmid.

PubMed Central

Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J

1992-01-01

Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052

In vitro excision of adeno-associated virus DNA from recombinant plasmids: Isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gottlieb, J.; Muzyczka, N.

1988-06-01

When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less

Cloning of Pf3, a filamentous bacteriophage of Pseudomonas aeruginosa, into the pBD214 vector of Bacillus subtilis.

PubMed Central

Putterman, D G; Gryczan, T J; Dubnau, D; Day, L A

1983-01-01

The genome of Pf3, a filamentous single-stranded DNA bacteriophage of Pseudomonas aeruginosa (a gram-negative organism) was cloned into pBD214, a plasmid cloning vector of Bacillus subtilis (a gram-positive organism). Cloning in the gram-positive organism was done to avoid anticipated lethal effects. The entire Pf3 genome was inserted in each orientation at a unique Bc/I site within a thymidylate synthetase gene (from B. subtilis phage beta 22) on the plasmid. Additional clones were made by inserting EcoRI fragments of Pf3 DNA into a unique EcoRI site within this gene. Images PMID:6306273

The gene therapy of collagen-induced arthritis in rats by intramuscular administration of the plasmid encoding TNF-binding domain of variola virus CrmB protein.

PubMed

Shchelkunov, S N; Taranov, O S; Tregubchak, T V; Maksyutov, R A; Silkov, A N; Nesterov, A E; Sennikov, S V

2016-07-01

Wistar rats with collagen-induced arthritis were intramuscularly injected with the recombinant plasmid pcDNA/sTNF-BD encoding the sequence of the TNF-binding protein domain of variola virus CrmB protein (VARV sTNF-BD) or the pcDNA3.1 vector. Quantitative analysis showed that the histopathological changes in the hind-limb joints of rats were most severe in the animals injected with pcDNA3.1 and much less severe in the group of rats injected with pcDNA/sTNF-BD, which indicates that gene therapy of rheumatoid arthritis is promising in the case of local administration of plasmids governing the synthesis of VARV immunomodulatory proteins.

Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features

NASA Astrophysics Data System (ADS)

Vernon, Matthew Martin

Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.

Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

USDA-ARS?s Scientific Manuscript database

A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

Comparison of immune responses to different foot-and-mouth disease genetically engineered vaccines in guinea pigs.

PubMed

Yao, Qingxia; Qian, Ping; Huang, Qinfeng; Cao, Yi; Chen, Huanchun

2008-01-01

The P12A3C gene from FMDV (serotype O) encoding the capsid precursor protein, and the highly immunogenic gene FHG, which encodes multiple epitopes of FMDV capsid proteins, were inserted into eukaryotic expression vectors to compare different candidate genetically engineered vaccines for foot-and-mouth disease (FMD). A modified live pseudorabies virus (MLPRV) was also used to deliver P12A3C. Guinea pigs were inoculated intramuscularly with the candidate vaccines to compare the ability to elicit immunity of the DNA vector and a live viral vector. An indirect enzyme-linked immunosorbent assay (iELISA), virus-neutralization test and lymphoproliferation assay were used to detect antibody and cellular responses. The group immunized with P12A3C delivered by MLPRV produced significantly greater antibody and cellular responses indicating that MLPRV has a greater ability to mediate exogenous gene delivery than the plasmid DNA vector. Comparison of the immune responses induced by P12A3C and FHG, which were both mediated by DNA plasmids, showed that FHG and P12A3C elicited similar cellular responses, while P12A3C induced higher antibody levels, suggesting that P12A3C is a more powerful immunogen than FHG. In challenge experiments, guinea pigs vaccinated with P12A3C delivered by MLPRV were protected fully from FMDV challenge, whereas guinea pigs vaccinated with P12A3C or FHG delivered by DNA plasmid were only protected partially. This study provides a basis for future construction of a genetically engineered vaccine for FMDV.

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

PubMed

Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

2009-11-20

In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.

A recombinant plasmid containing CpG motifs as a novel vaccine adjuvant for immune protection against herpes simplex virus 2.

PubMed

He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan

2016-08-01

The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.

The vector homology problem in diagnostic nucleic acid hybridization of clinical specimens.

PubMed Central

Ambinder, R F; Charache, P; Staal, S; Wright, P; Forman, M; Hayward, S D; Hayward, G S

1986-01-01

Nucleic acid hybridization techniques using cloned probes are finding application in assays of clinical specimens in research and diagnostic laboratories. The probes that we and others have used are recombinant plasmids composed of viral inserts and bacterial plasmid vectors such as pBR322. We suspected that there was material homologous to pBR322 present in many clinical samples. because hybridization occurred in samples which lacked evidence of virus by other techniques. If the presence of this vector-homologous material was unrecognized, hybridization in the test sample might erroneously be interpreted as indicating the presence of viral sequences. In this paper we demonstrate specific hybridization of labeled pBR322 DNA with DNA from various clinical samples. Evidence is presented that nonspecific probe trapping could not account for this phenomenon. In mixing experiments, it is shown that contamination of clinical samples with bacteria would explain such a result. Approaches tested to circumvent this problem included the use of isolated insert probes, alternate cloning vectors, and cold competitor pBR322 DNA in prehybridization and hybridization mixes. None proved entirely satisfactory. We therefore emphasize that it is essential that all hybridization detection systems use a control probe of the vector alone in order to demonstrate the absence of material with vector homology in the specimen tested. Images PMID:3013928

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

A convenient method of preparing gene vector for real time monitoring transfection process based on the quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong

2012-11-15

Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less

Transformation of Rhodococcus fascians by High-Voltage Electroporation and Development of R. fascians Cloning Vectors

PubMed Central

Desomer, Jan; Dhaese, Patrick; Montagu, Marc Van

1990-01-01

The analysis of the virulence determinants of phytopathogenic Rhodococcus fascians has been hampered by the lack of a system for introducing exogenous DNA. We investigated the possibility of genetic transformation of R. fascians by high-voltage electroporation of intact bacterial cells in the presence of plasmid DNA. Electrotransformation in R. fascians D188 resulted in transformation frequencies ranging from 105/μg of DNA to 107/μg of DNA, depending on the DNA concentration. The effects of different electrical parameters and composition of electroporation medium on transformation efficiency are presented. By this transformation method, a cloning vector (pRF28) for R. fascians based on an indigenous 160-kilobase (chloramphenicol and cadmium resistance-encoding) plasmid pRF2 from strain NCPPB 1675 was developed. The origin of replication and the chloramphenicol resistance gene on pRF28 were used to construct cloning vectors that are capable of replication in R. fascians and Escherichia coli. The electroporation method presented was efficient enough to allow detection of the rare integration of replication-deficient pRF28 derivatives in the R. fascians D188 genome via either homologous or illegitimate recombination. Images PMID:16348290

Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.

1987-12-01

A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C tomore » A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation.« less

Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

PubMed

Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

2010-06-01

To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model.

PubMed

Suarez, D L; Schultz-Cherry, S

2000-01-01

Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

PubMed

Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

2003-05-01

Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.

PubMed

Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng

2007-01-01

Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.

Facile Recovery of Individual High-Molecular-Weight, Low-Copy-Number Natural Plasmids for Genomic Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, L.E.; Detter, C,; Barrie, K.

2006-06-01

Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less

Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

PubMed

Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

2016-03-01

Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

Part I: Minicircle vector technology limits DNA size restrictions on ex vivo gene delivery using nanoparticle vectors: Overcoming a translational barrier in neural stem cell therapy.

PubMed

Fernandes, Alinda R; Chari, Divya M

2016-09-28

Genetically engineered neural stem cell (NSC) transplant populations offer key benefits in regenerative neurology, for release of therapeutic biomolecules in ex vivo gene therapy. NSCs are 'hard-to-transfect' but amenable to 'magnetofection'. Despite the high clinical potential of this approach, the low and transient transfection associated with the large size of therapeutic DNA constructs is a critical barrier to translation. We demonstrate for the first time that DNA minicircles (small DNA vectors encoding essential gene expression components but devoid of a bacterial backbone, thereby reducing construct size versus conventional plasmids) deployed with magnetofection achieve the highest, safe non-viral DNA transfection levels (up to 54%) reported so far for primary NSCs. Minicircle-functionalized magnetic nanoparticle (MNP)-mediated gene delivery also resulted in sustained gene expression for up to four weeks. All daughter cell types of engineered NSCs (neurons, astrocytes and oligodendrocytes) were transfected (in contrast to conventional plasmids which usually yield transfected astrocytes only), offering advantages for targeted cell engineering. In addition to enhancing MNP functionality as gene delivery vectors, minicircle technology provides key benefits from safety/scale up perspectives. Therefore, we consider the proof-of-concept of fusion of technologies used here offers high potential as a clinically translatable genetic modification strategy for cell therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

Optimization of supercoiled HPV-16 E6/E7 plasmid DNA purification with arginine monolith using design of experiments.

PubMed

Almeida, A M; Queiroz, J A; Sousa, F; Sousa, A

2015-01-26

The progress of DNA vaccines is dependent on the development of suitable chromatographic procedures to successfully purify genetic vectors, such as plasmid DNA. Human Papillomavirus is associated with the development of tumours due to the oncogenic power of E6 and E7 proteins, produced by this virus. The supercoiled HPV-16 E6/E7 plasmid-based vaccine was recently purified with the arginine monolith, with 100% of purity, but only 39% of recovery was achieved. Therefore, the present study describes the application of experimental design tools, a newly explored methodology in preparative chromatography, in order to improve the supercoiled plasmid DNA recovery with the arginine monolith, maintaining the high purity degree. In addition, the importance and influence of pH in the pDNA retention to the arginine ligand was also demonstrated. The Composite Central Face design was validated and the recovery of the target molecule was successfully improved from 39% to 83.5%, with an outstanding increase of more than double, while maintaining 100% of purity. Copyright © 2014 Elsevier B.V. All rights reserved.

Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

PubMed

Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter

2012-05-14

Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand, displayed high DNA binding efficiency and pH-sensitive release.

Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis with Various Plasmids

PubMed Central

Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle

2002-01-01

We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607

Design of a Retrovirus-Derived Vector for Expression and Transduction of Exogenous Genes in Mammalian Cells

PubMed Central

Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard

1983-01-01

We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426

Multiple Antibiotic Resistance Plasmids Allow Scalable,
PCR-Mediated DNA Manipulation and Near-Zero Background Cloning

PubMed Central

Arnak, Remigiusz; Altun, Burcin; Tosato, Valentina

2016-01-01

Summary We have constructed two plasmids that can be used for cloning as templates for PCR- -based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418) and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications. PMID:27956856

Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel

1991-01-01

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.

1989-01-01

Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less

Genetic alteration of Mycobacterium smegmatis to improve mycobacterium-mediated transfer of plasmid DNA into mammalian cells and DNA immunization.

PubMed

Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J

2007-10-01

Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.

Facile Construction of Random Gene Mutagenesis Library for Directed Evolution Without the Use of Restriction Enzyme in Escherichia coli.

PubMed

Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival

2016-09-01

A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

A novel immunization method to induce cytotoxic T-lymphocyte responses (CTL) against plasmid-encoded herpes simplex virus type-1 glycoprotein D.

PubMed

Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J

1999-03-05

DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.

In vitro gene expression by cationized derivatives of an artificial protein with repeated RGD sequences, Pronectin.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2003-01-09

The objective of this study is to investigate the efficiency of a non-viral gene carrier with RGD sequences, Pronectin F(+) for gene transfection. The Pronectin F(+) was cationized by introducing ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) to the hydroxyl groups while the corresponding gelatin derivative was prepared similarly because gelatin also has one RGD sequence per molecule. The zeta potential and molecular size of Pronectin F(+) and gelatin derivatives were examined before and after polyion complexation with a plasmid DNA of luciferase. When complexed with the plasmid DNA at the Pronectin F(+)/plasmid DNA mixing ratio of 50, the complex exhibited a zeta potential of about 10 mV, which is similar to that of the gelatin derivative-plasmid DNA complex. Irrespective of the type of Pronectin F(+) and gelatin derivatives, their complexation enabled the apparent molecular size of plasmid DNA to reduce to about 200 nm, the size decreasing with the increased derivative/plasmid DNA weight mixing ratio. The rat gastric mucosal (RGM)-1 cells treated with both complexes exhibited significantly stronger luciferase activities than free plasmid DNA although the enhanced extent was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. Cell attachment was enhanced by the Pronectin F(+) derivative to a significant high extent compared with the gelatin derivative. The amount of plasmid DNA internalized into the cells was enhanced by the complexation with every Pronectin F(+) derivative compared with the gelatin derivative. For both of Pronectin F(+) and gelatin carriers, the buffering capacity of Sm derivatives was higher than that of Ed and Sd derivatives and comparable to that of polyethyleneimine. It is likely that the high efficiency of gene transfection for the Sm derivative is due to the superior buffering effect. We conclude that the Sm derivative of Pronectin F(+) is promising as a non-viral vector of gene transfection.

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-10-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed Central

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-01-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624

Construction of a Schizosaccharomyces pombe gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.

PubMed

Beach, D; Piper, M; Nurse, P

1982-01-01

A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.

Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

PubMed

Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

2017-01-01

Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

Introduction to the ultrasound targeted microbubble destruction technique.

PubMed

Walton, Chad B; Anderson, Cynthia D; Boulay, Rachel; Shohet, Ralph V

2011-06-12

In UTMD, bioactive molecules, such as negatively charged plasmid DNA vectors encoding a gene of interest, are added to the cationic shells of lipid microbubble contrast agents. In mice these vector-carrying microbubbles can be administered intravenously or directly to the left ventricle of the heart. In larger animals they can also be infused through an intracoronary catheter. The subsequent delivery from the circulation to a target organ occurs by acoustic cavitation at a resonant frequency of the microbubbles. It seems likely that the mechanical energy generated by the microbubble destruction results in transient pore formation in or between the endothelial cells of the microvasculature of the targeted region. As a result of this sonoporation effect, the transfection efficiency into and across the endothelial cells is enhanced, and transgene-encoding vectors are deposited into the surrounding tissue. Plasmid DNA remaining in the circulation is rapidly degraded by nucleases in the blood, which further reduces the likelihood of delivery to non-sonicated tissues and leads to highly specific target-organ transfection.

A Plasmodium vivax Plasmid DNA- and Adenovirus-Vectored Malaria Vaccine Encoding Blood-Stage Antigens AMA1 and MSP142 in a Prime/Boost Heterologous Immunization Regimen Partially Protects Aotus Monkeys against Blood-Stage Challenge.

PubMed

Obaldia, Nicanor; Stockelman, Michael G; Otero, William; Cockrill, Jennifer A; Ganeshan, Harini; Abot, Esteban N; Zhang, Jianfeng; Limbach, Keith; Charoenvit, Yupin; Doolan, Denise L; Tang, De-Chu C; Richie, Thomas L

2017-04-01

Malaria is caused by parasites of the genus Plasmodium , which are transmitted to humans by the bites of Anopheles mosquitoes. After the elimination of Plasmodium falciparum , it is predicted that Plasmodium vivax will remain an important cause of morbidity and mortality outside Africa, stressing the importance of developing a vaccine against P. vivax malaria. In this study, we assessed the immunogenicity and protective efficacy of two P. vivax antigens, apical membrane antigen 1 (AMA1) and the 42-kDa C-terminal fragment of merozoite surface protein 1 (MSP1 42 ) in a plasmid recombinant DNA prime/adenoviral (Ad) vector boost regimen in Aotus monkeys. Groups of 4 to 5 monkeys were immunized with plasmid DNA alone, Ad alone, prime/boost regimens with each antigen, prime/boost regimens with both antigens, and empty vector controls and then subjected to blood-stage challenge. The heterologous immunization regimen with the antigen pair was more protective than either antigen alone or both antigens delivered with a single vaccine platform, on the basis of their ability to induce the longest prepatent period and the longest time to the peak level of parasitemia, the lowest peak and mean levels of parasitemia, the smallest area under the parasitemia curve, and the highest self-cure rate. Overall, prechallenge MSP1 42 antibody titers strongly correlated with a decreased parasite burden. Nevertheless, a significant proportion of immunized animals developed anemia. In conclusion, the P. vivax plasmid DNA/Ad serotype 5 vaccine encoding blood-stage parasite antigens AMA1 and MSP1 42 in a heterologous prime/boost immunization regimen provided significant protection against blood-stage challenge in Aotus monkeys, indicating the suitability of these antigens and this regimen for further development. Copyright © 2017 American Society for Microbiology.

Molecular cloning and expression in Saccharomyces cerevisiae and Neurospora crassa of the invertase gene from Neurospora crassa.

PubMed

Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A

1989-10-01

A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.

Immune responses of mice immunized by DNA plasmids encoding PCV2 ORF 2 gene, porcine IL-15 or the both.

PubMed

Dong, Bo; Feng, Jing; Lin, Hai; Li, Lanxiang; Su, Dingding; Tu, Di; Zhu, Weijuan; Yang, Qing; Ren, Xiaofeng

2013-11-19

Porcine circovirus type 2 (PCV2) is associated with many kinds of diseases including postweaning multisystemic wasting syndrome (PMWS). It affects the immune system of swine and causes huge epidemic losses every year. In our previous study, we provided evidence that DNA plasmid bearing porcine IL-15 (pVAX-pIL-15) might serve as an immune enhancer for DNA plasmid encoding porcine reproductive and respiratory syndrome virus GP5 gene. In this study, PCV2 open reading frame (ORF)2 gene was cloned into the eukaryotic expression vector pVAX, resulting in the plasmid pVAX-PCV2-ORF2. Transient expression of the plasmid in BHK-21 cells could be detected using immunofluorescence assay. Experimental mice were divided into 5 groups and immunized with PBS, pVAX, pVAX-pIL-15, pVAX-PCV2-ORF2 or pVAX-pIL-15 plus pVAX-PCV2-ORF2. The results showed that the mice co-inoculated with pVAX-PCV2-ORF2 plus pVAX-pIL-15 had higher humoral and cellular immune responses than the others. In addition, DNA plasmid bearing PCV2 ORF2 gene had a protective effect against challenge with PCV2 in mice which could be promoted with the utilization of pIL-15. Copyright © 2013 Elsevier Ltd. All rights reserved.

Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

PubMed Central

Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

2015-01-01

The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

Stable expression of the hepatitis B virus surface antigen containing pre-S2 protein in mouse cells using a bovine papillomavirus vector.

PubMed

Yoneyama, T; Akatsuka, T; Miyamura, T

1988-08-01

The large BglII fragment (2.8 kilobases) of hepatitis B virus DNA including the transcription unit for the hepatitis B surface antigen (HBsAg) was inserted into a bovine papillomavirus vector containing the neomycin resistance gene. The recombinant DNA was transfected into mouse C127 cells. A stable transformed cell line (MS128) secreting a large amount of 22 nm HBsAg particles containing pre-S2 protein was established. The secreted HBsAg particles had the receptor for polymerized human serum albumin. Immunoprecipitation and Western blot analyses showed that HBsAg particles consisted of two major proteins of 22K and 26K encoded by the S gene and a minor protein of 35K encoded by the pre-S2 and S genes. Southern blot analysis revealed that the transfected plasmid was integrated into the host chromosomal DNA and that most of the plasmid sequences were present. These results suggest that the stable expression of the HBsAg in MS128 cells is related to the integrated state of the recombinant DNA.

The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

PubMed

Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

2010-06-01

Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

GeneGuard: A modular plasmid system designed for biosafety.

PubMed

Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom

2015-03-20

Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.

Deletions at short direct repeats and base substitutions are characteristic mutations for bleomycin-induced double- and single-strand breaks, respectively, in a human shuttle vector system

NASA Technical Reports Server (NTRS)

Dar, M. E.; Jorgensen, T. J.

1995-01-01

Using the radiomimetic drug, bleomycin, we have determined the mutagenic potential of DNA strand breaks in the shuttle vector pZ189 in human fibroblasts. The bleomycin treatment conditions used produce strand breaks with 3'-phosphoglycolate termini as > 95% of the detectable dose-dependent lesions. Breaks with this end group represent 50% of the strand break damage produced by ionizing radiation. We report that such strand breaks are mutagenic lesions. The type of mutation produced is largely determined by the type of strand break on the plasmid (i.e. single versus double). Mutagenesis studies with purified DNA forms showed that nicked plasmids (i.e. those containing single-strand breaks) predominantly produce base substitutions, the majority of which are multiples, which presumably originate from error-prone polymerase activity at strand break sites. In contrast, repair of linear plasmids (i.e. those containing double-strand breaks) mainly results in deletions at short direct repeat sequences, indicating the involvement of illegitimate recombination. The data characterize the nature of mutations produced by single- and double-strand breaks in human cells, and suggests that deletions at direct repeats may be a 'signature' mutation for the processing of DNA double-strand breaks.

Contamination of sequence databases with adaptor sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

PubMed

Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

2013-05-01

Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

A quantitative and high-throughput assay of human papillomavirus DNA replication.

PubMed

Gagnon, David; Fradet-Turcotte, Amélie; Archambault, Jacques

2015-01-01

Replication of the human papillomavirus (HPV) double-stranded DNA genome is accomplished by the two viral proteins E1 and E2 in concert with host DNA replication factors. HPV DNA replication is an established model of eukaryotic DNA replication and a potential target for antiviral therapy. Assays to measure the transient replication of HPV DNA in transfected cells have been developed, which rely on a plasmid carrying the viral origin of DNA replication (ori) together with expression vectors for E1 and E2. Replication of the ori-plasmid is typically measured by Southern blotting or PCR analysis of newly replicated DNA (i.e., DpnI digested DNA) several days post-transfection. Although extremely valuable, these assays have been difficult to perform in a high-throughput and quantitative manner. Here, we describe a modified version of the transient DNA replication assay that circumvents these limitations by incorporating a firefly luciferase expression cassette in cis of the ori. Replication of this ori-plasmid by E1 and E2 results in increased levels of firefly luciferase activity that can be accurately quantified and normalized to those of Renilla luciferase expressed from a control plasmid, thus obviating the need for DNA extraction, digestion, and analysis. We provide a detailed protocol for performing the HPV type 31 DNA replication assay in a 96-well plate format suitable for small-molecule screening and EC50 determinations. The quantitative and high-throughput nature of the assay should greatly facilitate the study of HPV DNA replication and the identification of inhibitors thereof.

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

DNAVaxDB: the first web-based DNA vaccine database and its data analysis

PubMed Central

2014-01-01

Since the first DNA vaccine studies were done in the 1990s, thousands more studies have followed. Here we report the development and analysis of DNAVaxDB (http://www.violinet.org/dnavaxdb), the first publically available web-based DNA vaccine database that curates, stores, and analyzes experimentally verified DNA vaccines, DNA vaccine plasmid vectors, and protective antigens used in DNA vaccines. All data in DNAVaxDB are annotated from reliable resources, particularly peer-reviewed articles. Among over 140 DNA vaccine plasmids, some plasmids were more frequently used in one type of pathogen than others; for example, pCMVi-UB for G- bacterial DNA vaccines, and pCAGGS for viral DNA vaccines. Presently, over 400 DNA vaccines containing over 370 protective antigens from over 90 infectious and non-infectious diseases have been curated in DNAVaxDB. While extracellular and bacterial cell surface proteins and adhesin proteins were frequently used for DNA vaccine development, the majority of protective antigens used in Chlamydophila DNA vaccines are localized to the inner portion of the cell. The DNA vaccine priming, other vaccine boosting vaccination regimen has been widely used to induce protection against infection of different pathogens such as HIV. Parasitic and cancer DNA vaccines were also systematically analyzed. User-friendly web query and visualization interfaces are available in DNAVaxDB for interactive data search. To support data exchange, the information of DNA vaccines, plasmids, and protective antigens is stored in the Vaccine Ontology (VO). DNAVaxDB is targeted to become a timely and vital source of DNA vaccines and related data and facilitate advanced DNA vaccine research and development. PMID:25104313

[Overexpression of SEPP1 inhibits the proliferation and induces cell cycle G2/M arrest of 786-O and 769-P human renal carcinoma cells].

PubMed

Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu

2016-06-01

Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.

High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

PubMed

Sakai, Y; Goh, T K; Tani, Y

1993-06-01

We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.

Novel Antigen Identification Method for Discovery of Protective Malaria Antigens by Rapid Testing of DNA Vaccines Encoding Exons from the Parasite Genome

PubMed Central

Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.

2004-01-01

We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966

Supercoiled Minivector DNA resists shear forces associated with gene therapy delivery

PubMed Central

Catanese, D J; Fogg, J M; Schrock, D E; Gilbert, B E; Zechiedrich, L

2012-01-01

Supercoiled DNAs varying from 281 to 5302 bp were subjected to shear forces generated by aerosolization or sonication. DNA shearing strongly correlated with length. Typical sized plasmids (⩾3000 bp) degraded rapidly. DNAs 2000–3000 bp persisted ∼10 min. Even in the absence of condensing agents, supercoiled DNA <1200 bp survived nebulization, and increased forces of sonication were necessary to shear it. Circular vectors were considerably more resistant to shearing than linear vectors of the same length. DNA supercoiling afforded additional protection. These results show the potential of shear-resistant Minivector DNAs to overcome one of the major challenges associated with gene therapy delivery. PMID:21633394

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae

DOEpatents

Lacks, Sanford A.

1990-01-01

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae

DOEpatents

Lacks, S.A.

1990-10-02

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.

Transformation of Schwanniomyces occidentalis with an ADE2 gene cloned from S. occidentalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, R.D.; Favreau, M.A.

1988-12-01

We have developed an efficient transformation system for the industrial yeast Schwanniomyces occidentalis (formerly Schwanniomyces castellii). The transformation system is based on ade2 mutants of S. occidentalis deficient for phosphoribosylaminoimidazole carboxylase that were generated by mutagenesis. As a selectable marker, we isolated and characterized the S. occidentalis ADE2 gene by complementation in an ade2 strain of Saccharomyces cerevisiae. S. occidentalis was transformed with the recombinant plasmid pADE, consisting of a 4.5-kilobase-pair (kbp) DNA fragment from S. occidentalis containing the ADE2 gene inserted into the S. cerevisiae expression vector pYcDE8 by a modification of the spheroplasting procedure of Beggs. Intact plasmidsmore » were recovered in Escherichia coli from whole-cell lysates of ADE+ transformants, indicating that plasmids were replicating autonomously. High-molecular-mass species of pADE2 were found by Southern hybridization analysis of intact genomic DNA preparations. The shift to higher molecular mass of these plasmids during electrophoresis in the presence ethidium bromide after exposure to shortwave UV suggests that they exist in a supercoiled form in the transformed host. Subclones of the 4.5-kbp insert indicated that ADE2-complementing activity and sequences conferring autonomous replication in S. occidentalis were located within a 2.7-kbp EcoRI-SphI fragment. Plasmids containing this region cloned into the bacterial vector pUC19 complemented ade2 mutants of S. occidentalis with efficiencies identical to those of the original plasmid pADE.« less

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

PubMed Central

Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

2007-01-01

While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

Construction of promoter-probe shuttle vectors for Escherichia coli and corynebacteria on the basis of promoterless alpha-amylase gene.

PubMed

Ugorcáková, J; Bukovská, G; Timko, J

2000-01-01

We constructed new promoter-probe vectors for E. coli and corynebacteria based on the promoterless alpha-amylase gene originating from Bacillus subtilis. Vectors pJUPAE1 and pJUPAE2 are suitable for isolation of transcriptionally active fragments from plasmids, phages or genomic DNA. alpha-Amylase activity can be easily visually detected on agar plates containing a chromogenic substrate, or by direct measurement of alpha-amylase activity.

Toward DNA-based Security Circuitry: First Step - Random Number Generation.

PubMed

Bogard, Christy M; Arazi, Benjamin; Rouchka, Eric C

2008-08-10

DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. Our team investigates the implications of DNA-based circuit design in serving security applications. As an initial step we develop a random number generation circuitry. A novel prototype schema employs solid-phase synthesis of oligonucleotides for random construction of DNA sequences. Temporary storage and retrieval is achieved through plasmid vectors.

Enhanced immune response and protective efficacy of a Treponema pallidum Tp92 DNA vaccine vectored by chitosan nanoparticles and adjuvanted with IL-2.

PubMed

Zhao, Feijun; Wu, Yimou; Zhang, Xiaohong; Yu, Jian; Gu, Weiming; Liu, Shuangquan; Zeng, Tiebing; Zhang, Yuejun; Wang, Shiping

2011-10-01

In this study, the immune-modulatory and protective efficacy of using an interleukin-2 (IL-2) expression plasmid as a genetic adjuvant and chitosan (CS) nanoparticles as vectors to enhance a Tp92 DNA vaccine candidate were investigated in a Treponema pallidum (Tp) rabbit challenge model. CS vectoring of pTp92 or pIL-2 were both demonstrated to augment anti-Tp92 antibody levels induced by pTp92 DNA vaccines. Interestingly, the combination of CS vectored Tp92 and pIL-2 led to the greatest enhancements of anti-Tp92 antibodies and T-cell proliferation (p < 0.05). At week 10 after the first immunization, 15 of the 18 rabbits in each group were challenged with Tp Nichols strain and monitored for skin lesions and ulcer lesions. Ratios of positive skin lesions and ratios of ulcer lesions in groups immunized with pTp92 were significantly lower than those of the empty vector or PBS groups (p < 0.05), demonstrating that pTp92 immunization elicited significant protective efficacy against the Tp Nichols strain challenge. CS vectored and pIL-2 adjuvanted pTp92 immunized animals exhibited the lowest rates of positive skin and ulcer lesions. Male New Zealand white rabbits were randomly assigned to groups (n = 18/group) and immunized intramuscularly with pTp92 based plasmid DNA constructs (100 μg of DNA/rabbit/immunization). Two weeks before Tp challenge (Week 8), three rabbits from each group were used to determine cytokine measurements and fifteen rabbits from each group were used for Tp challenge studies. Intramuscular injection of pTp92 induced strong humoral and cellular immune responses and conferred protection from Tp challenge in rabbits. The use of CS as a pTp92 vector or pIL-2 as an adjuvant achieved a superior level of protective efficacy against Tp challenge, however CS vectored, IL-2 adjuvanted pTp92 immunization conferred the highest level of protective efficacy.

Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli

NASA Astrophysics Data System (ADS)

Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz

1981-02-01

Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki

Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS,more » and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.« less

[Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

2009-04-01

This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Biochemistry and genetics of autotrophy in Methanococcus. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whitman, W.B.

In the last two years of this research, the most exciting results have come from the work on the genetics of methanococci. First, the author demonstrated that the cryptic plasmid from Methanococcus maripaludis C5, pURB500, could be transformed into Methanococcus maripaludis JJ. Strain JJ is the type strain of M. maripaludis and has only about 65% DNA:DNA hybridization to strain C5. Because of the low relatedness of these strains, it was not obvious that pURB500 could be transferred between them. This goal was achieved by first transforming strain C5 with a series of suicide plasmids containing the pac cassette, whichmore » possessed the selectable puromycin resistance marker, and different cloned fragments of pURB500. From the puromycin-resistant transformants, a plasmid was isolated that transformed strain JJ. However, when this plasmid was electroporated into E. coli, only rearrangement products were obtained that contained small portions of the original pURB500. These plasmids no longer transformed Methanococcus. While these experiments did not yield a shuttle vector, they demonstrated that pURB500 could replicate in strain JJ.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyereisen-Koener, J.M.

Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

Multiple point mutations in a shuttle vector propagated in human cells: evidence for an error-prone DNA polymerase activity.

PubMed

Seidman, M M; Bredberg, A; Seetharam, S; Kraemer, K H

1987-07-01

Mutagenesis was studied at the DNA-sequence level in human fibroblast and lymphoid cells by use of a shuttle vector plasmid, pZ189, containing a suppressor tRNA marker gene. In a series of experiments, 62 plasmids were recovered that had two to six base substitutions in the 160-base-pair marker gene. Approximately 20-30% of the mutant plasmids that were recovered after passing ultraviolet-treated pZ189 through a repair-proficient human fibroblast line contained these multiple mutations. In contrast, passage of ultraviolet-treated pZ189 through an excision-repair-deficient (xeroderma pigmentosum) line yielded only 2% multiple base substitution mutants. Introducing a single-strand nick in otherwise unmodified pZ189 adjacent to the marker, followed by passage through the xeroderma pigmentosum cells, resulted in about 66% multiple base substitution mutants. The multiple mutations were found in a 160-base-pair region containing the marker gene but were rarely found in an adjacent 170-base-pair region. Passing ultraviolet-treated or nicked pZ189 through a repair-proficient human B-cell line also yielded multiple base substitution mutations in 20-33% of the mutant plasmids. An explanation for these multiple mutations is that they were generated by an error-prone polymerase while filling gaps. These mutations share many of the properties displayed by mutations in the immunoglobulin hypervariable regions.

Application of methylation in improving plasmid transformation into Helicobacter pylori.

PubMed

Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

2018-05-23

Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

An Efficient Intergeneric Conjugation of DNA from Escherichia coli to Mycelia of the Lincomycin-Producer Streptomyces lincolnensis

PubMed Central

Du, Lei; Liu, Rui-Hua; Ying, Li; Zhao, Guang-Rong

2012-01-01

Streptomyces lincolnensis is a producer of lincomycin, which is a lincosamide antibiotic for the treatment of infective diseases caused by Gram-positive bacteria. S. lincolnensis is refractory to introducing plasmid DNA into cells because of resistance of foreign DNAs and poor sporulation. In this study, a simple and efficient method of transferring plasmids into S. lincolnensis through the intergeneric Escherichia coli-mycelia conjugation was established and optimized for the first time. The recipient mycelia of S. lincolnensis were prepared in liquid SM medium containing 10.3% sucrose for three days. The dispersed mycelia were conjugated with competent E. coli donor cells. The exconjugants were regenerated efficiently on solid mannitol soya flour (MS) medium containing 20 mM MgCl2. The average conjugation frequency was observed at 1.1 × 10−4 per input donor cell and validated functionally by transferring two types of vectors containing lincomycin resistance genes lmrA, lmrB and lmrC into S. lincolnensis mycelia. The data of fermentation in shaking flasks showed the lincomycin yield of the exconjugants increased by 52.9% for the multiple copy vector and 38.3% for the integrative one, compared with the parental strain. The efficient and convenient method of intergeneric E. coli-mycelia conjugation in this study provides a promising procedure to introduce plasmid DNA into other refractory streptomycetes. PMID:22606009

[Construction and expression of recombinant human serum albumin-EPO fusion protein].

PubMed

Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing

2011-05-01

OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.

Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp.

PubMed

Zhou, Jingxiang; Xue, Jiangdong; Wang, Qiuju; Zhu, Xia; Li, Xingwei; Lv, Wenliang; Zhang, Dongming

2014-06-01

In order to construct the recombinant plasmid of pIRES-ORF81, the nucleic acid isolated from Koi herpes virus-CJ (KHV-CJ) strains was used as a template to insert the ORF81 gene fragments amplified by PCR into the pIRES-neo, a kind of eukaryotic expression vector. Using Western blotting analysis, it was verified that ORF81 gene protein can be expressed correctly by pIRES-ORF81, after MFC cells were transfected. The recombinant plasmid pIRES-ORF81 was set into three immunization dose gradients: 1, 10, and 50 μg/carp. Empty plasmid group, PBS group, and blank control group were set simultaneously. Giving intramuscular injections to healthy carps with an average body mass of 246 ± 20 g, indirect ELISA was used to regularly determine antibody levels after three times immunization injection. Neutralizing antibodies were detected by neutralization assay. The results of inoculation tests showed that the pIRES-ORF81 recombinant plasmid can induce the production of carp-specific antibodies. The differences of immune effect between the three different doses of immune gradients were not significant (P > 0.05), but they can induce the production of neutralizing antibodies. After 25 d of inoculation, carp mortality of pIRES-neo empty vector treatment groups was 85%, while the carp mortality of eukaryotic expression recombinant plasmid pIRES-ORF81 injected with three different doses of immune gradients was 20, 17.5, and 12.5%, respectively. Differences in comparison to the control group were highly significant (P < 0.01). However, histopathological section of immunohistochemistry organization revealed no significant changes. It demonstrated that the DNA vaccine pIRES-ORF81 constructed in the experiment displayed a good protective effect against KHV, which had the potential to industrial applications.

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

PubMed

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

Enhanced Control of Pathogenic Simian Immunodeficiency Virus SIVmac239 Replication in Macaques Immunized with an Interleukin-12 Plasmid and a DNA Prime-Viral Vector Boost Vaccine Regimen ▿ §

PubMed Central

Winstone, Nicola; Wilson, Aaron J.; Morrow, Gavin; Boggiano, Cesar; Chiuchiolo, Maria J.; Lopez, Mary; Kemelman, Marina; Ginsberg, Arielle A.; Mullen, Karl; Coleman, John W.; Wu, Chih-Da; Narpala, Sandeep; Ouellette, Ian; Dean, Hansi J.; Lin, Feng; Sardesai, Niranjan Y.; Cassamasa, Holly; McBride, Dawn; Felber, Barbara K.; Pavlakis, George N.; Schultz, Alan; Hudgens, Michael G.; King, C. Richter; Zamb, Timothy J.; Parks, Christopher L.; McDermott, Adrian B.

2011-01-01

DNA priming has previously been shown to elicit augmented immune responses when administered by electroporation (EP) or codelivered with a plasmid encoding interleukin-12 (pIL-12). We hypothesized that the efficacy of a DNA prime and recombinant adenovirus 5 boost vaccination regimen (DNA/rAd5) would be improved when incorporating these vaccination strategies into the DNA priming phase, as determined by pathogenic simian immunodeficiency virus SIVmac239 challenge outcome. The whole SIVmac239 proteome was delivered in 5 separate DNA plasmids (pDNA-SIV) by EP with or without pIL-12, followed by boosting 4 months later with corresponding rAd5-SIV vaccine vectors. Remarkably, after repeated low-dose SIVmac239 mucosal challenge, we demonstrate 2.6 and 4.4 log reductions of the median SIV peak and set point viral loads in rhesus macaques (RMs) that received pDNA-SIV by EP with pIL-12 compared to the median peak and set point viral loads in mock-immunized controls (P < 0.01). In 5 out of 6 infected RMs, strong suppression of viremia was observed, with intermittent “blips” in virus replication. In 2 RMs, we could not detect the presence of SIV RNA in tissue and lymph nodes, even after 13 viral challenges. RMs immunized without pIL-12 demonstrated a typical maximum of 1.5 log reduction in virus load. There was no significant difference in the overall magnitude of SIV-specific antibodies or CD8 T-cell responses between groups; however, pDNA delivery by EP with pIL-12 induced a greater magnitude of SIV-specific CD4 T cells that produced multiple cytokines. This vaccine strategy is relevant for existing vaccine candidates entering clinical evaluation, and this model may provide insights into control of retrovirus replication. PMID:21734035

DNA compaction into new DNA vectors based on cyclodextrin polymer: surface enhanced Raman spectroscopy characterization.

PubMed

Burckbuchler, V; Wintgens, V; Lecomte, S; Percot, A; Leborgne, C; Danos, O; Kichler, A; Amiel, C

2006-04-05

The ability of DNA to bind polycation yielding polyplexes is widely used in nonviral gene delivery. The aim of the present study was to evaluate the DNA compaction with a new DNA vector using Raman spectroscopy. The polyplexes result from an association of a beta-cyclodextrin polymer (polybeta-CD), an amphiphilic cationic connector (DC-Chol or adamantane derivative Ada2), and DNA. The charge of the polymeric vector is effectively controlled by simple addition of cationic connector in the medium. We used surface enhanced Raman spectroscopy (SERS) to characterize this ternary complex, monitoring the accessibility of adenyl residues to silver colloids. The first experiments were performed using model systems based on polyA (polyadenosine monophosphate) well characterized by SERS. This model was then extended to plasmid DNA to study polybeta-CD/Ada2/DNA and polybeta-CD/DC-Chol/DNA polyplexes. The SERS spectra show a decrease of signal intensity when the vector/DNA charge ratio (Z+/-) increases. At the highest ratio (Z+/- = 10) the signal is 6-fold and 3-fold less intense than the DNA reference signal for Ada2 and DC-Chol polyplexes, respectively. Thus adenyl residues have a reduced accessibility as DNA is bound to the vector. Moreover, the SERS intensity variations are in agreement with gel electrophoresis and zeta potential experiments on the same systems. The overall study clearly demonstrates that the cationic charges neutralizing the negative charges of DNA result in the formation of stable polyplexes. In vitro transfection efficiency of those DNA vectors are also presented and compared to the classical DC-Chol lipoplexes (DC-Chol/DNA). The results show an increase of the transfection efficiency 2-fold higher with our vector based on polybeta-CD. Copyright 2005 Wiley Periodicals, Inc.

Long-term increase in mVEGF164 in mouse hindlimb muscle mediated by phage phiC31 integrase after nonviral DNA delivery.

PubMed

Portlock, Joylette L; Keravala, Annahita; Bertoni, Carmen; Lee, Solomon; Rando, Thomas A; Calos, Michele P

2006-08-01

Peripheral vascular disease (PVD), characterized by insufficient blood supply to extremities, can be a devastating illness. Although many gene therapy strategies for PVD using vascular endothelial growth factor (VEGF) have resulted in increased blood vessel formation, the vessels are often impermanent and regress after therapy, probably because of the short-lived VEGF expression mediated by gene therapy vectors (14 days or less). phiC31 integrase is a recombinase originally isolated from a bacteriophage of Streptomyces. This integrase performs efficient chromosomal integration of plasmid DNA into mammalian genomes that results in long-term transgene expression. In this study, gene transfer was achieved by intramuscular injection of VEGF and integrase plasmid DNAs into the tibialis anterior muscle in the mouse hindlimb, followed by electroporation of the muscle with needle electrodes. We observed VEGF levels significantly above background 40 days after injection in animals that received phiC31 integrase and the VEGF plasmid. Site-specific integration of plasmid DNA in the chromosomes of muscle tissue was verified by polymerase chain reaction at a common integration site. These results suggest the possible utility of the phiC31 integrase system to treat ischemic disease.

Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

NASA Technical Reports Server (NTRS)

Kohli, M.; Jorgensen, T. J.

1999-01-01

The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

Progress in directed energy control of vectors for microbes and other cells

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva; Sloan, Mark A.; Stribling, Lucille J. V.

2004-07-01

Biosynthetic semiconductor, diazoluminomelanin (DALM), is a polymer of tyrosine, luminol, and nitrite. DALM has a very large cross section of absorption for light from ultraviolet to radio frequencies. This polymer can be made efficiently in a genetically engineered E.coli, JM109/pIC2ORNR1.1 (ATCC# 69905). We have been pursuing ways to couple electromagnetic radiation to vectors using this polymer. DNA capture elements (DCEs; formerly aptamers) have made this possible. We incorporated DCEs into the plasmid of this E. coli to direct binding to whatever microbe or cell desired and to produce DALM attached to the plasmid DNA. Using two other vectors pSV2neoNR101 or pSV2neoNR8005 (ATCC # 69617 and 69618, respectively), both propagated in the E. coli host HB101, we have also inserted genes necessary for DALM production into animal and human cell lines (mouse monocytic leukemia: ATCC # CRL- 11771, -11772, -1173, mouse mammary adenocarcinoma: ATCC# CRL-12184, -12185; and human carcinoma of the cervix: ATCC # CRL-12510). The DCE/DALM vectors can be used to tag target cells, detectable by broad-spectrum light absorbance, luminescence, or fluorescence. DCE/DALM can further be activated with light, microwave energy, or by oxidative chemistry to kill the targeted microbes or other cells.

Homologous Recombination-Independent Large Gene Cassette Knock-in in CHO Cells Using TALEN and MMEJ-Directed Donor Plasmids

PubMed Central

Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi

2015-01-01

Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins. PMID:26473830

Homologous Recombination-Independent Large Gene Cassette Knock-in in CHO Cells Using TALEN and MMEJ-Directed Donor Plasmids.

PubMed

Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi

2015-10-09

Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins.

Generation of Marker- and/or Backbone-Free Transgenic Wheat Plants via Agrobacterium-Mediated Transformation.

PubMed

Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin

2016-01-01

Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.

Development of Tat-Conjugated Dendrimer for Transdermal DNA Vaccine Delivery.

PubMed

Bahadoran, Azadeh; Moeini, Hassan; Bejo, Mohd Hair; Hussein, Mohd Zobir; Omar, Abdul Rahman

In order to enhance cellular uptake and to facilitate transdermal delivery of DNA vaccine, polyamidoamine (PAMAM) dendrimers conjugated with HIV transactivator of transcription (TAT) was developed. First, the plasmid DNA (pIRES-H5/GFP) nanoparticle was formulated using PAMAM dendrimer and TAT peptide and then characterized for surface charge, particle size, DNA encapsulation and protection of the pIRES-H5/GFP DNA plasmid to enzymatic digestion. Subsequently, the potency of the TAT-conjugated dendrimer for gene delivery was evaluated through in vitro transfection into Vero cells followed by gene expression analysis including western blotting, fluorescent microscopy and PCR. The effect of the TAT peptide on cellular uptake of DNA vaccine was studied by qRT-PCR and flow cytometry. Finally, the ability of TAT-conjugated PAMAM dendrimer for transdermal delivery of the DNA plasmid was assessed through artificial membranes followed by qRT-PCR and flow cytometry. TAT-conjugated PAMAM dendrimer showed the ability to form a compact and nanometre-sized polyplexes with the plasmid DNA, having the size range of 105 to 115 nm and a positive charge of +42 to +45 mV over the N/P ratio of 6:1(+/-).  In vitro transfection analysis into Vero cells confirms the high potency of TAT-conjugated PAMAM dendrimer to enhance the cellular uptake of DNA vaccine.  The permeability value assay through artificial membranes reveals that TAT-conjugated PAMAM has more capacity for transdermal delivery of the DNA compared to unmodified PAMAM dendrimer (P<0.05). The findings of this study suggest that TAT-conjugated PAMAM dendrimer is a promising non-viral vector for transdermal use.This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.

Ultrashort laser pulse cell manipulation using nano- and micro- materials

NASA Astrophysics Data System (ADS)

Schomaker, Markus; Killian, Doreen; Willenbrock, Saskia; Diebold, Eric; Mazur, Eric; Bintig, Willem; Ngezahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo; Junghanß, Christian; Lubatschowski, Holger; Heisterkamp, Alexander

2010-08-01

The delivery of extra cellular molecules into cells is essential for cell manipulation. For this purpose genetic materials (DNA/RNA) or proteins have to overcome the impermeable cell membrane. To increase the delivery efficiency and cell viability of common methods different nano- and micro material based approaches were applied. To manipulate the cells, the membrane is in contact with the biocompatible material. Due to a field enhancement of the laser light at the material and the resulting effect the cell membrane gets perforated and extracellular molecules can diffuse into the cytoplasm. Membrane impermeable dyes, fluorescent labelled siRNA, as well as plasmid vectors encoded for GFP expression were used as an indicator for successful perforation or transfection, respectively. Dependent on the used material, perforation efficiencies over 90 % with a cell viability of about 80 % can be achieved. Additionally, we observed similar efficiencies for siRNA transfection. Due to the larger molecule size and the essential transport of the DNA into the nucleus cells are more difficult to transfect with GFP plasmid vectors. Proof of principle experiments show promising and adequate efficiencies by applying micro materials for plasmid vector transfection. For all methods a weakly focused fs laser beam is used to enable a high manipulation throughput for adherent and suspension cells. Furthermore, with these alternative optical manipulation methods it is possible to perforate the membrane of sensitive cell types such as primary and stem cells with a high viability.

Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

PubMed Central

2014-01-01

Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

Cloning of an origin of DNA replication of Xenopus laevis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, S.; Taylor, J.H.

1980-09-01

DNA fragments of Xenopus laevis, the African frog, were cloned in the EcoRI site of the Eschrichia coli plasmid pACYC189 and tested for ability to initiate and complete replication of the recombinant plasmid when injected into unfertilized eggs of X. laevis. After measurement of the (/sup 3/H)-thymidine incorporation per egg for a number of recombinant plasmids, pSW14 and pSW9, which respectively contain a small segment (550 base pairs) and several kilobases of frog DNA, were selected for more extensive analysis. In spite of the small size of th segment in pSW14, it incorporates in 2 hr at least 3 timesmore » as much labeled thymidine as either pSW9 or the vector alone. To determine the number of replications of pSW14, a novel method was employed. The results showed that about 50% of the labeled, supercoiled DNA recovered from eggs after 4 hr was sensitive to EcoRI digestion, which indicates that most of the DNA that incorporated (/sup 3/H)thymidine had replicated twice during the 4 hr in the unfertilized eggs of X. laevis. We conclude the pSW14 has a functional origin in the Xenopus DNA segment.« less

Cloning and Sequencing of Defective Particles Derived from the Autonomous Parvovirus Minute Virus of Mice for the Construction of Vectors with Minimal cis-Acting Sequences

PubMed Central

Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick

2001-01-01

The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501

The abundant extrachromosomal DNA content of the Spiroplasma citri GII3-3X genome

PubMed Central

Saillard, Colette; Carle, Patricia; Duret-Nurbel, Sybille; Henri, Raphaël; Killiny, Nabil; Carrère, Sébastien; Gouzy, Jérome; Bové, Joseph-Marie; Renaudin, Joël; Foissac, Xavier

2008-01-01

Background Spiroplama citri, the causal agent of citrus stubborn disease, is a bacterium of the class Mollicutes and is transmitted by phloem-feeding leafhopper vectors. In order to characterize candidate genes potentially involved in spiroplasma transmission and pathogenicity, the genome of S. citri strain GII3-3X is currently being deciphered. Results Assembling 20,000 sequencing reads generated seven circular contigs, none of which fit the 1.8 Mb chromosome map or carried chromosomal markers. These contigs correspond to seven plasmids: pSci1 to pSci6, with sizes ranging from 12.9 to 35.3 kbp and pSciA of 7.8 kbp. Plasmids pSci were detected as multiple copies in strain GII3-3X. Plasmid copy numbers of pSci1-6, as deduced from sequencing coverage, were estimated at 10 to 14 copies per spiroplasma cell, representing 1.6 Mb of extrachromosomal DNA. Genes encoding proteins of the TrsE-TraE, Mob, TraD-TraG, and Soj-ParA protein families were predicted in most of the pSci sequences, in addition to members of 14 protein families of unknown function. Plasmid pSci6 encodes protein P32, a marker of insect transmissibility. Plasmids pSci1-5 code for eight different S. citri adhesion-related proteins (ScARPs) that are homologous to the previously described protein P89 and the S. kunkelii SkARP1. Conserved signal peptides and C-terminal transmembrane alpha helices were predicted in all ScARPs. The predicted surface-exposed N-terminal region possesses the following elements: (i) 6 to 8 repeats of 39 to 42 amino acids each (sarpin repeats), (ii) a central conserved region of 330 amino acids followed by (iii) a more variable domain of about 110 amino acids. The C-terminus, predicted to be cytoplasmic, consists of a 27 amino acid stretch enriched in arginine and lysine (KR) and an optional 23 amino acid stretch enriched in lysine, aspartate and glutamate (KDE). Plasmids pSci mainly present a linear increase of cumulative GC skew except in regions presenting conserved hairpin structures. Conclusion The genome of S. citri GII3-3X is characterized by abundant extrachromosomal elements. The pSci plasmids could not only be vertically inherited but also horizontally transmitted, as they encode proteins usually involved in DNA element partitioning and cell to cell DNA transfer. Because plasmids pSci1-5 encode surface proteins of the ScARP family and pSci6 was recently shown to confer insect transmissibility, diversity and abundance of S. citri plasmids may essentially aid the rapid adaptation of S. citri to more efficient transmission by different insect vectors and to various plant hosts. PMID:18442384

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.

PubMed

Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina

2011-12-01

Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. © 2011 New York Academy of Sciences.

Synthesis and evaluation of cationic nanomicelles for in vitro and in vivo gene delivery

NASA Astrophysics Data System (ADS)

Mandke, Rhishikesh Subhash

The goal of proposed study was to contribute towards the development of a nano size, high efficiency and low toxicity non-viral polymeric vector for gene delivery in vitro and in vivo. A series of fatty acid grafted low-molecular-weight chitosan (N-acyl LMWCs) were synthesized, purified and characterized for their physicochemical properties using various analytical techniques such as infrared spectroscopy, elemental analysis and dynamic light scattering. The formulation parameters including pH, sonication duration, and filtration altered the physicochemical characteristics of N-acyl LMWC nanomicelles. The acyl chain length and degree of unsaturation in fatty acids also had an impact on the physicochemical properties and the transfection efficiency of nanomicelles. N-acyl LMWC nanomicelles showed efficient in vitro transfection as visualized and quantified using a reporter plasmid (encoding green fluorescent protein), and therapeutic plasmids (encoding for interleukin-4 and interleukin-10), respectively. The in vitro transfection efficiencies of N-acyl LMWCs with 18:1 and 18:2 grafts (oleic and linoleic acids) were comparable with FuGENERTM HD (marketed non-viral vector) but were ˜8-fold and 35-fold higher as compared to LMWC and naked DNA, respectively. The in vivo transfection efficiency of N-acyl LMWC to deliver plasmids individually encoding IL-4 and IL-10 as well as a bicistronic plasmid encoding both IL-4 and IL-10 was studied in a multiple, low-dose streptozotocin induced diabetic mouse model. The transfection efficiency of pDNA/N-acyl LMWC polyplexes injected via intramuscular route showed significant improvement (p<0.05) over passive (naked DNA) or positive (FuGENE HD) controls. Additionally, a sustained and efficient expression of IL-4 and IL-10 was observed, accompanied by a reduction in interferon-gamma (INF-gamma), and tumor necrosis factor-alpha (TNF-alpha) levels. The pancreas of pDNA/N-acyl LMWC polyplex treated animals exhibited protection from streptozotocin-induced insulitis and the delivery systems were biocompatible. Histological studies revealed that there were no signs of chronic inflammation at the injection site. The bicistronic plasmid exhibited significantly (p<0.05) greater expression of IL-4 and IL-10, and demonstrated the feasibility of bicistronic IL-4/IL-10 plasmid/N-acyl LMWC nanomicelles-based polyplexes as an efficient and biocompatible system for the prevention of autoimmune diabetes.

Viral load and clinical disease enhancement associated with a lentivirus cytotoxic T lymphocyte vaccine regimen

PubMed Central

Mealey, Robert H.; Leib, Steven R.; Littke, Matt H.; Wagner, Bettina; Horohov, David W.; McGuire, Travis C.

2009-01-01

Effective DNA-based vaccines against lentiviruses will likely induce CTL against conserved viral proteins. Equine infectious anemia virus (EIAV) infects horses worldwide, and serves as a useful model for lentiviral immune control. Although attenuated live EIAV vaccines have induced protective immune responses, DNA-based vaccines have not. In particular, DNA-based vaccines have had limited success in inducing CTL responses against intracellular pathogens in the horse. We hypothesized that priming with a codon-optimized plasmid encoding EIAV Gag p15/p26 with co-administration of a plasmid encoding an equine IL-2/IgG fusion protein as a molecular adjuvant, followed by boosting with a vaccinia vector expressing Gag p15/p26, would induce protective Gag-specific CTL responses. Although the regimen induced Gag-specific CTL in four of seven vaccinated horses, CTL were not detected until after the vaccinia boost, and protective effects were not observed in EIAV challenged vaccinates. Unexpectedly, vaccinates had significantly higher viral loads and more severe clinical disease, associated with the presence of vaccine-induced CTL. It was concluded that 1.) further optimization of the timing and route of DNA immunization was needed for efficient CTL priming in vivo, 2.) co-administration of the IL-2/IgG plasmid did not enhance CTL priming by the Gag p15/p26 plasmid, 3.) vaccinia vectors are useful for lentivirus-specific CTL induction in the horse, 4.) Gag-specific CTL alone are either insufficient or a more robust Gag-specific CTL response is needed to limit EIAV viremia and clinical disease, and 5.) CTL-inducing vaccines lacking envelope immunogens can result in lentiviral disease enhancement. Although the mechanisms for enhancement associated with this vaccine regimen remain to be elucidated, these results have important implications for development of lentivirus T cell vaccines. PMID:19368787

Construction of a novel gene bank of Bacillus subtilis using a low copy number vector in Escherichia coli.

PubMed

Hasnain, S; Thomas, C M

1986-07-01

Low copy number vector plasmid pCT571 was constructed to clone Bacillus subtilis genomic fragments in Escherichia coli. pCT571 confers KmR, TcR and CmR in E. coli and CmR in B. subtilis. It has unique restriction sites within the KmR and TcR markers to allow screening for recombinant plasmids by insertional inactivation of these genes. It contains the pSC101 replicon and replicates normally at six to eight copies per chromosome equivalent in E. coli. It also contains oriVRK2, which when supplied with the product of the trfA gene of RK2 in trans, allows pCT571 to replicate at 35-40 copies per chromosome equivalent. A B. subtilis gene bank was created by cloning partially Sau3A-digested and size-fractionated fragments of B. subtilis chromosomal DNA into the BamHI site of pCT571. DNA from 1097 KmR TcS transformants was extracted and analysed electrophoretically as supercoiled DNA and after digesting with EcoRI or EcoRI and SalI. Approximately 1000 hybrid plasmids were found with reasonably sized B. subtilis fragments. The mean size of the inserts in pCT571 is 8 kb, ranging from 4 to 20 kb in different plasmids. The gene bank covers most of the B. subtilis chromosome, as demonstrated by the results of screening the gene bank for selectable nutritional markers in E. coli and B. subtilis. Hybrid plasmids which complement E. coli mutants for arg, his, lys, met, pdx, pyr and thr markers were identified from the gene bank. In B. subtilis the presence of argC, cysA, dal, hisA, ilvA, leuA, lys, metB, metC, phe, purA, purB, thr and trpC was established by transformation experiments. The effects of copy number on cloning and long-term maintenance in the bacterial strains were also investigated. At high copy number some hybrid plasmids cannot be maintained at all, while others show an increased rate of structural deletions and rearrangements.

A Method for Preparing DNA Sequencing Templates Using a DNA-Binding Microplate

PubMed Central

Yang, Yu; Hebron, Haroun R.; Hang, Jun

2009-01-01

A DNA-binding matrix was immobilized on the surface of a 96-well microplate and used for plasmid DNA preparation for DNA sequencing. The same DNA-binding plate was used for bacterial growth, cell lysis, DNA purification, and storage. In a single step using one buffer, bacterial cells were lysed by enzymes, and released DNA was captured on the plate simultaneously. After two wash steps, DNA was eluted and stored in the same plate. Inclusion of phosphates in the culture medium was found to enhance the yield of plasmid significantly. Purified DNA samples were used successfully in DNA sequencing with high consistency and reproducibility. Eleven vectors and nine libraries were tested using this method. In 10 μl sequencing reactions using 3 μl sample and 0.25 μl BigDye Terminator v3.1, the results from a 3730xl sequencer gave a success rate of 90–95% and read-lengths of 700 bases or more. The method is fully automatable and convenient for manual operation as well. It enables reproducible, high-throughput, rapid production of DNA with purity and yields sufficient for high-quality DNA sequencing at a substantially reduced cost. PMID:19568455

Overview of post Cohen-Boyer methods for single segment cloning and for multisegment DNA assembly

PubMed Central

Sands, Bryan; Brent, Roger

2016-01-01

In 1973, Cohen and coworkers published a foundational paper describing the cloning of DNA fragments into plasmid vectors. In it, they used DNA segments made by digestion with restriction enzymes and joined these in vitro with DNA ligase. These methods established working recombinant DNA technology and enabled the immediate start of the biotechnology industry. Since then, “classical” recombinant DNA technology using restriction enzymes and DNA ligase has matured. At the same time, researchers have developed numerous ways to generate large, complex, multisegment DNA constructions that offer advantages over classical techniques. Here, we provide an overview of “post-Cohen-Boyer” techniques used for cloning single segments into vectors (T/A, Topo cloning, Gateway and Recombineering) and for multisegment DNA assembly (Biobricks, Golden Gate, Gibson, Yeast homologous recombination in vivo, and Ligase Cycling Reaction). We compare and contrast these methods and also discuss issues that researchers should consider before choosing a particular multisegment DNA assembly method. PMID:27152131

Manipulation for plasmid elimination by transforming synthetic competitors diversifies lactococcus lactis starters applicable to food products.

PubMed

Kobayashi, Miho; Nomura, Masaru; Kimoto, Hiromi

2007-11-01

This study was designed selectively to eliminate a theta-plasmid from Lactococcus lactis strains by transforming synthetic competitors. A shuttle vector for Escherichia coli and L. lactis, pDB1, was constructed by ligating a partial replicon of pDR1-1B, which is a 7.3 kb theta-plasmid in L. lactis DRC1, with an erythromycin resistance gene into pBluescript II KS(+). This versatile vector was used to construct competitors to common lactococcal theta-plasmids. pDB1 contains the 5' half of the replication origin and the 3' region of repB of pDR1-1B, but lacks the 1.1-kb region normally found between these two segments. A set of primers, Pv3 and Pv4, was designed to amplify the 1.1-kb middle parts of the general theta-replicons of lactococcal plasmids. When the PCR products were cloned into the Nru I and Xho I sites of pDB1, synthetic replicons were constructed and replication activity was restored. A number of theta-plasmids in L. lactis ssp. lactis and cremoris were eliminated selectively by transforming the synthetic competitors. These competitors were easily eliminated by subculture for a short time in the absence of selection. The resulting variants contained no exogenous DNA and are suitable for food products, since part of the phenotype was altered without altering other plasmids indispensable for fermentation.

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

Reverse Genetics of Newcastle Disease Virus.

PubMed

Cardenas-Garcia, Stivalis; Afonso, Claudio L

2017-01-01

Reverse genetics allows for the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique enables genetic manipulation and cloning of viral genomes, gene mutation through site-directed mutagenesis, along with gene insertion or deletion, among other studies. An in vitro infection-based system including the highly attenuated vaccinia virus Ankara strain expressing the T7 RNA polymerase from bacteriophage T7, with co-transfection of three helper plasmids and a full-length cDNA plasmid, was successfully developed to rescue genetically modified Newcastle disease viruses in 1999. In this chapter, the materials and the methods involved in rescuing Newcastle disease virus (NDV) from cDNA, utilizing site-directed mutagenesis and gene replacement techniques, are described in detail.

Cloning of the active thymidine kinase gene of herpes simplex virus type 1 in Escherichia coli K-12.

PubMed

Colbere-Garapin, F; Chousterman, S; Horodniceanu, F; Kourilsky, P; Garapin, A C

1979-08-01

A herpes simplex virus DNA fragment that is produced by digestion with BamHI endonuclease and carries the thymidine kinase (TK; ATP:thymidine 5'-phosphotransferase, EC 2.7.1.21) gene has been cloned in Escherichia coli. A recombinat plasmid, pFG5, has been analyzed extensively and a detailed restriction map is presented. pFG5 DNA efficiently transforms TK- mouse L cells. The TK coding sequence in the cloned fragment has been localized and a smaller recombinant plasmid, pAG0, also carrying an active TK gene, has been constructed to serve as a more convenient vector for transfer, into TK- cells, of genes previously cloned in E. coli.

Regulated release of a novel non-viral gene delivery vector from electrospun coaxial fiber mesh scaffolds

NASA Astrophysics Data System (ADS)

Saraf, Anita

The development of novel strategies for tissue engineering entails the evolution of biopolymers into multifunctional constructs that can support the proliferation of cells and stimulate their differentiation into functional tissues. With that in mind, biocompatible polymers were fabricated into a novel gene delivery agent as well as three dimensional scaffolds that act as reservoirs and controlled release constructs. To fabricate a novel gene delivery agent a commercially available cationic polymer, poly(ethylenimine), PEI, was chemically conjugated to a ubiquitous glycosaminoglycan, hyaluronic acid (HA). The novel polymer, PEI-HA, had significantly reduced toxicity and improved transfection efficiency with multipotent human mesenchymal stem cells. This transfection efficiency could further be modulated by changing the concentration of sodium chloride and temperature used to assemble PEI-HA/DNA complexes. To facilitate the regulated delivery of these complexes in the context of tissue engineering, an emerging technology for scaffold fabrication, coaxial electrospinning was adapted to include PEI-HA and plasmid DNA within the scaffold fibers. Initially, a factorial design was employed to assess the influence of processing parameters in the absence of gene delivery vectors and plasmids. The study elucidated the role of sheath polymer concentration and core polymer concentration and molecular weight and the presence of sodium chloride on fiber diameters and morphologies. Subsequently, PEI-HA and plasmid DNA were entrapped within the sheath and core compartments of these fibers and the influence of processing parameters was assessed in the context of fiber diameter, release kinetics and transfection efficiency over a period of 60 days. The release of PEI-HA was found to be dependent upon the loading dose of the vector and plasmid. However, the transfection efficiency correlated to the core polymer properties, concentration and molecular weight. The processing parameters could modulate cell transfection for up to 21 days and continue to transfect cells for up to 60 days. Thus, scaffolds with tunable release kinetics and transfection efficiencies can be fabricated using coaxial electrospinning, which can further be used for tissue engineering and gene delivery applications.

Dextran and protamine-based solid lipid nanoparticles as potential vectors for the treatment of X-linked juvenile retinoschisis.

PubMed

Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R

2012-04-01

The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.

Identification and characterization of plasmids from the western aster yellows mycoplasmalike organism.

PubMed Central

Kuske, C R; Kirkpatrick, B C

1990-01-01

Supercoiled double-stranded DNA molecules (plasmids) were isolated from plants infected with three laboratory strains of western aster yellows mycoplasma-like organism (AY-MLO) by using cesium chloride-ethidium bromide density gradients. Southern blot analysis, using plasmids from the severe strain of AY-MLO (SAY-MLO) as the probe, identified at least four plasmids in celery, aster, and periwinkle plants and in Macrosteles severini leafhopper vectors infected with either the dwarf AY-MLO, Tulelake AY-MLO, or SAY-MLO strain. Plasmids were also detected in two California field isolates of AY-MLO but not in plants infected with the beet leafhopper-transmitted virescence agent, western X, or elm yellows MLOs. SAY-MLO plasmids were 5.2, 4.9, 3.4, and 1.7 kilobase pairs in size. Plasmids isolated from dwarf AY- and Tulelake AY-MLOs were 7.4, 5.1, 3.5, and 1.7 kilobase pairs in size. No evidence was obtained for integration of SAY-MLO plasmids into the MLO chromosome. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 FIG. 5 PMID:2307660

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Transformation of Sordaria macrospora to hygromycin B resistance: characterization of transformants by electrophoretic karyotyping and tetrad analysis.

PubMed

Walz, M; Kück, U

1995-12-01

The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.

Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli

PubMed Central

Jacobus, Ana Paula; Gross, Jeferson

2015-01-01

PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528

CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) for Near-Perfect Selective Transformation

NASA Technical Reports Server (NTRS)

Rothschild, Lynn J.; Greenberg, Daniel T.; Takahashi, Jack R.; Thompson, Kirsten A.; Maheshwari, Akshay J.; Kent, Ryan E.; McCutcheon, Griffin; Shih, Joseph D.; Calvet, Charles; Devlin, Tyler D.;

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

A prototype subunit vaccine to IHN virus is being developed by recombinant DNA techniques. The techniques involve the isolation and characterization of the glycoprotein gene, which encodes the viral protein responsible for inducing a protective immune response in fish. The viral glycoprotein gene has been cloned and a restriction map of the cloned gene has been prepared. Preliminary DNA sequence analysis of the cloned gene has been initiated so that manipulation of the gene for maximum expression in appropriate plasmid vectors is possible. A recombinant plasmid containing the viral gene inserted in the proper orientation adjacent to a very strongmore » lambda promoter and ribosome binding site has been constructed. Evaluation of this recombinant plasmid for gene expression is being conducted. Immunization trials with purified viral glycoprotein indicate that fish are protected against lethal doses of IHNV after immersion and intraperitoneal methods of immunization. In addition, cross protection immunization trials indicate that Type 2 and Type 1 IHN virus produce glycoproteins that are cross-protective.« less

Mitochondrial Gene Therapy: Advances in Mitochondrial Gene Cloning, Plasmid Production, and Nanosystems Targeted to Mitochondria.

PubMed

Coutinho, Eduarda; Batista, Cátia; Sousa, Fani; Queiroz, João; Costa, Diana

2017-03-06

Mitochondrial gene therapy seems to be a valuable and promising strategy to treat mitochondrial disorders. The use of a therapeutic vector based on mitochondrial DNA, along with its affinity to the site of mitochondria, can be considered a powerful tool in the reestablishment of normal mitochondrial function. In line with this and for the first time, we successfully cloned the mitochondrial gene ND1 that was stably maintained in multicopy pCAG-GFP plasmid, which is used to transform E. coli. This mitochondrial-gene-based plasmid was encapsulated into nanoparticles. Furthermore, the functionalization of nanoparticles with polymers, such as cellulose or gelatin, enhances their overall properties and performance for gene therapy. The fluorescence arising from rhodamine nanoparticles in mitochondria and a fluorescence microscopy study show pCAG-GFP-ND1-based nanoparticles' cell internalization and mitochondria targeting. The quantification of GFP expression strongly supports this finding. This work highlights the viability of gene therapy based on mitochondrial DNA instigating further in vitro research and clinical translation.

[Identification and phylogenetic analysis of one strain of Lactobacillus delbrueckii subsp. bulgaricus separated from yoghourt].

PubMed

Wang, Chuan; Zhang, Chaowu; Pei, Xiaofang; Liu, Hengchuan

2007-11-01

For being further applied and studied, one strain of Lactobacillus delbrueckii subsp. bulgaricus (wch9901) separated from yoghourt which had been identified by phenotype characteristic analysis was identified by 16S rDNA and phylogenetic analyzed. The 16S rDNA of wch9901 was amplified with the genomic DNA of wch9901 as template, and the conservative sequences of the 16S rDNA as primers. Inserted 16S rDNA amplified into clonal vector pGEM-T under the function of T4 DNA ligase to construct recombined plasmid pGEM-wch9901 16S rDNA. The recombined plasmid was identified by restriction enzyme digestion, and the eligible plasmid was presented to sequencing company for DNA sequencing. Nucleic acid sequence was blast in GenBank and phylogenetic tree was constructed using neighbor-joining method of distance methods by Mega3.1 soft. Results of blastn showed that the homology of 16S rDNA of wch9901 with the 16S rDNA of Lactobacillus delbrueckii subsp. bulgaricus strains was higher than 96%. On the phylogenetic tree, wch9901 formed a separate branch and located between Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch and another evolution branch which was composed of Lactobacillus delbrueckii subsp. bulgaricus DL2 evolution cluster and Lactobacillus delbrueckii subsp. bulgaricus JSQ evolution cluster. The distance between wch9901 evolution branch and Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch was the closest. wch9901 belonged to Lactobacillus delbrueckii subsp. bulgaricus. wch9901 showed the closest evolution relationship to Lactobacillus delbrueckii subsp. bulgaricus LGM2.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

DTIC Science & Technology

1986-11-26

cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a

Development of DNA probes for Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheung, L.L.; Hudson, J.B.

1988-07-01

An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves.more » It became evident that, although both /sup 32/P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis.« less

Enhancement of reverse transfection efficiency by combining stimulated DNA surface desorption and electroporation

NASA Astrophysics Data System (ADS)

Creasey, Rhiannon; Hook, Andrew; Thissen, Helmut; Voelcker, Nicolas H.

2007-12-01

Transfection cell microarrays (TCMs) are a high-throughput, miniaturised cell-culture system utilising reverse transfection, in which cells are seeded onto a DNA array resulting in localised regions of transfected cells. TCMs are useful for the analysis of gene expression, and can be used to identify genes involved in many cellular processes. This is of significant interest in fields such as tissue engineering, diagnostic screening, and drug testing [1, 2]. Low transfection efficiency has so far limited the application and utility of this technique. Recently, the transfection efficiency of TCMs was improved by an application of a high voltage for a short period of time to the DNA array resulting in the electroporation of cells attached to the surface [3, 4]. Furthermore, application of a low voltage for a longer period of time to the DNA array was shown to improve the transfection efficiency by stimulating the desorption of attached DNA, increasing the concentration of DNA available for cellular uptake [5]. In the present study, the optimisation of the uptake of adsorbed DNA vectors by adherent cells, utilising a voltage bias without compromising cell viability was investigated. This was achieved by depositing negatively charged DNA plasmids onto a positively charged allylamine plasma polymer (ALAPP) layer deposited on highly doped p-type silicon wafers either using a pipettor or a microarray contact printer. Surface-dependant human embryonic kidney (HEK 293 line) cells were cultured onto the DNA vector loaded ALAPP spots and the plasmid transfection events were detected by fluorescence microscopy. Cell viability assays, including fluorescein diacetate (FDA) / Hoechst DNA labelling, were carried out to determine the number of live adherent cells before and after application of a voltage. A protocol was developed to screen for voltage biases and exposure times in order to optimise transfection efficiency and cell viability. Cross-contamination between the microarray spots carrying different DNA vectors was also investigated. By application of a voltage of 286 V/cm for 10 ms, transfection efficiency was doubled compared to using only transfection reagent, whilst maintaining a cell viability of 60-70% of the positive control.

Three-Dimensional Imaging of the Intracellular Fate of Plasmid DNA and Transgene Expression: ZsGreen1 and Tissue Clearing Method CUBIC Are an Optimal Combination for Multicolor Deep Imaging in Murine Tissues.

PubMed

Fumoto, Shintaro; Nishimura, Koyo; Nishida, Koyo; Kawakami, Shigeru

2016-01-01

Evaluation methods for determining the distribution of transgene expression in the body and the in vivo fate of viral and non-viral vectors are necessary for successful development of in vivo gene delivery systems. Here, we evaluated the spatial distribution of transgene expression using tissue clearing methods. After hydrodynamic injection of plasmid DNA into mice, whole tissues were subjected to tissue clearing. Tissue clearing followed by confocal laser scanning microscopy enabled evaluation of the three-dimensional distribution of transgene expression without preparation of tissue sections. Among the tested clearing methods (ClearT2, SeeDB, and CUBIC), CUBIC was the most suitable method for determining the spatial distribution of transgene expression in not only the liver but also other tissues such as the kidney and lung. In terms of the type of fluorescent protein, the observable depth for green fluorescent protein ZsGreen1 was slightly greater than that for red fluorescent protein tdTomato. We observed a depth of ~1.5 mm for the liver and 500 μm for other tissues without preparation of tissue sections. Furthermore, we succeeded in multicolor deep imaging of the intracellular fate of plasmid DNA in the murine liver. Thus, tissue clearing would be a powerful approach for determining the spatial distribution of plasmid DNA and transgene expression in various murine tissues.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Construction of KHV-CJ ORF25 DNA vaccine and immune challenge test.

PubMed

Zhou, J-X; Wang, H; Li, X-W; Zhu, X; Lu, W-L; Zhang, D-M

2014-04-01

KHV ORF25 fragments were cloned from Koi Herpes Virus-CJ (KHV-CJ) strains isolated in our laboratory. The amplified products were inserted into the eukaryotic expression vector pIRES-neo, forming recombinant plasmid pIRES-ORF25. The recombinant plasmid pIRES-ORF25 at 1 μg per koi, 10 μg per koi and 50 μg per koi was intramuscularly injected into healthy kois, respectively. The results showed that the recombinant pIRES-ORF25 could induce the production of specific antibodies in koi determined by indirect ELISA. The differences of immune effect between three doses were not significant (P > 0.05), but all of them could induce the production of neutralizing antibodies. The immune challenge test showed that the mortality of koi injected with PBS, blank pIRES-neo vector and nothing was 90%, 92.5% and 85% at 25 days. While the mortalities of koi injected with eukaryotic expression plasmid pIRES-ORF25 were 20%, 17.5% and 12.5%. Differences in comparison with the control group were highly significant (P < 0.01). Histopathological staining revealed that the tissues of the immunized koi did not change apparently. In conclusion, the DNA vaccine pIRES-ORF25 construct could well protect koi against KHV and had the potential to be applied in practice. © 2013 John Wiley & Sons Ltd.

Cationic amino acid based lipids as effective nonviral gene delivery vectors for primary cultured neurons.

PubMed

Aoshima, Yumiko; Hokama, Ryosuke; Sou, Keitaro; Sarker, Satya Ranjan; Iida, Kabuto; Nakamura, Hideki; Inoue, Takafumi; Takeoka, Shinji

2013-12-18

The delivery of specific genes into neurons offers a potent approach for treatment of diseases as well as for the study of neuronal cell biology. Here we investigated the capabilities of cationic amino acid based lipid assemblies to act as nonviral gene delivery vectors in primary cultured neurons. An arginine-based lipid, Arg-C3-Glu2C14, and a lysine-based lipid, Lys-C3-Glu2C14, with two different types of counterion, chloride ion (Cl-) and trifluoroacetic acid (TFA-), were shown to successfully mediate transfection of primary cultured neurons with plasmid DNA encoding green fluorescent protein. Among four types of lipids, we optimized their conditions such as the lipid-to-DNA ratio and the amount of pDNA and conducted a cytotoxicity assay at the same time. Overall, Arg-C3-Glu2C14 with TFA- induced a rate of transfection in primary cultured neurons higher than that of Lys-C3-Glu2C14 using an optimal weight ratio of lipid-to-plasmid DNA of 1. Moreover, it was suggested that Arg-C3-Glu2C14 with TFA- showed the optimized value higher than that of Lipofectamine2000 in experimental conditions. Thus, Arg-C3-Glu2C14 with TFA- is a promising candidate as a reliable transfection reagent for primary cultured neurons with a relatively low cytotoxicity.

Cationic Amino Acid Based Lipids as Effective Nonviral Gene Delivery Vectors for Primary Cultured Neurons

PubMed Central

2013-01-01

The delivery of specific genes into neurons offers a potent approach for treatment of diseases as well as for the study of neuronal cell biology. Here we investigated the capabilities of cationic amino acid based lipid assemblies to act as nonviral gene delivery vectors in primary cultured neurons. An arginine-based lipid, Arg-C3-Glu2C14, and a lysine-based lipid, Lys-C3-Glu2C14, with two different types of counterion, chloride ion (Cl–) and trifluoroacetic acid (TFA–), were shown to successfully mediate transfection of primary cultured neurons with plasmid DNA encoding green fluorescent protein. Among four types of lipids, we optimized their conditions such as the lipid-to-DNA ratio and the amount of pDNA and conducted a cytotoxicity assay at the same time. Overall, Arg-C3-Glu2C14 with TFA– induced a rate of transfection in primary cultured neurons higher than that of Lys-C3-Glu2C14 using an optimal weight ratio of lipid-to-plasmid DNA of 1. Moreover, it was suggested that Arg-C3-Glu2C14 with TFA– showed the optimized value higher than that of Lipofectamine2000 in experimental conditions. Thus, Arg-C3-Glu2C14 with TFA– is a promising candidate as a reliable transfection reagent for primary cultured neurons with a relatively low cytotoxicity. PMID:24087930

[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

PubMed

Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

2006-09-01

To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

Binding and condensation of plasmid DNA onto functionalized carbon nanotubes: toward the construction of nanotube-based gene delivery vectors.

PubMed

Singh, Ravi; Pantarotto, Davide; McCarthy, David; Chaloin, Olivier; Hoebeke, Johan; Partidos, Charalambos D; Briand, Jean-Paul; Prato, Maurizio; Bianco, Alberto; Kostarelos, Kostas

2005-03-30

Carbon nanotubes (CNTs) constitute a class of nanomaterials that possess characteristics suitable for a variety of possible applications. Their compatibility with aqueous environments has been made possible by the chemical functionalization of their surface, allowing for exploration of their interactions with biological components including mammalian cells. Functionalized CNTs (f-CNTs) are being intensively explored in advanced biotechnological applications ranging from molecular biosensors to cellular growth substrates. We have been exploring the potential of f-CNTs as delivery vehicles of biologically active molecules in view of possible biomedical applications, including vaccination and gene delivery. Recently we reported the capability of ammonium-functionalized single-walled CNTs to penetrate human and murine cells and facilitate the delivery of plasmid DNA leading to expression of marker genes. To optimize f-CNTs as gene delivery vehicles, it is essential to characterize their interactions with DNA. In the present report, we study the interactions of three types of f-CNTs, ammonium-functionalized single-walled and multiwalled carbon nanotubes (SWNT-NH3+; MWNT-NH3+), and lysine-functionalized single-walled carbon nanotubes (SWNT-Lys-NH3+), with plasmid DNA. Nanotube-DNA complexes were analyzed by scanning electron microscopy, surface plasmon resonance, PicoGreen dye exclusion, and agarose gel shift assay. The results indicate that all three types of cationic carbon nanotubes are able to condense DNA to varying degrees, indicating that both nanotube surface area and charge density are critical parameters that determine the interaction and electrostatic complex formation between f-CNTs with DNA. All three different f-CNT types in this study exhibited upregulation of marker gene expression over naked DNA using a mammalian (human) cell line. Differences in the levels of gene expression were correlated with the structural and biophysical data obtained for the f-CNT:DNA complexes to suggest that large surface area leading to very efficient DNA condensation is not necessary for effective gene transfer. However, it will require further investigation to determine whether the degree of binding and tight association between DNA and nanotubes is a desirable trait to increase gene expression efficiency in vitro or in vivo. This study constitutes the first thorough investigation into the physicochemical interactions between cationic functionalized carbon nanotubes and DNA toward construction of carbon nanotube-based gene transfer vector systems.

The history of vaccination against cytomegalovirus.

PubMed

Plotkin, Stanley

2015-06-01

Cytomegalovirus vaccine development started in the 1970s with attenuated strains. In the 1980s, one of the strains was shown to be safe and effective in renal transplant patients. Then, attention switched to glycoprotein gB, which was shown to give moderate but transient protection against acquisition of the virus by women. The identification of the pp65 tegument protein as the principal target of cellular immune responses resulted in new approaches, particularly DNA, plasmids to protect hematogenous stem cell recipients. The subsequent discovery of the pentameric protein complex that generates most neutralizing antibodies led to efforts to incorporate that complex into vaccines. At this point, there are many candidate CMV vaccines, including live recombinants, replication-defective virus, DNA plasmids, soluble pentameric proteins, peptides, virus-like particles and vectored envelope proteins.

Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bredberg, A.; Kraemer, K.H.; Seidman, M.M.

1986-11-01

A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less

Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

PubMed Central

Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

2012-01-01

Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

Folic acid-decorated polyamidoamine dendrimer mediates selective uptake and high expression of genes in head and neck cancer cells.

PubMed

Xu, Leyuan; Kittrell, Shannon; Yeudall, W Andrew; Yang, Hu

2016-11-01

Folic acid (FA)-decorated polyamidoamine dendrimer G4 (G4-FA) was synthesized and studied for targeted delivery of genes to head and neck cancer cells expressing high levels of folate receptors (FRs). Cellular uptake, targeting specificity, cytocompatibility and transfection efficiency were evaluated. G4-FA competes with free FA for the same binding site. G4-FA facilitates the cellular uptake of DNA plasmids in a FR-dependent manner and selectively delivers plasmids to FR-high cells, leading to enhanced gene expression. G4-FA is a suitable vector to deliver genes selectively to head and neck cancer cells. The fundamental understandings of G4-FA as a vector and its encouraging transfection results for head and neck cancer cells provided support for its further testing in vivo.

Cationic Lipid-Nucleic Acid Complexes for Gene Delivery And Silencing: Pathways And Mechanisms for Plasmid Dna And Sirna

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ewert, K.K.; Zidovska, A.; Ahmad, A.

2012-07-17

Motivated by the promises of gene therapy, there is great interest in developing non-viral lipid-based vectors for therapeutic applications due to their low immunogenicity, low toxicity, ease of production, and the potential of transferring large pieces of DNA into cells. In fact, cationic liposome (CL) based vectors are among the prevalent synthetic carriers of nucleic acids (NAs) currently used in gene therapy clinical trials worldwide. These vectors are studied both for gene delivery with CL-DNA complexes and gene silencing with CL-siRNA (short interfering RNA) complexes. However, their transfection efficiencies and silencing efficiencies remain low compared to those of engineered viralmore » vectors. This reflects the currently poor understanding of transfection-related mechanisms at the molecular and self-assembled levels, including a lack of knowledge about interactions between membranes and double stranded NAs and between CL-NA complexes and cellular components. In this review we describe our recent efforts to improve the mechanistic understanding of transfection by CL-NA complexes, which will help to design optimal lipid-based carriers of DNA and siRNA for therapeutic gene delivery and gene silencing.« less

Plasmid Vectors for Xylella fastidiosa Utilizing a Toxin-Antitoxin System for Stability in the Absence of Antibiotic Selection.

PubMed

Burbank, Lindsey P; Stenger, Drake C

2016-08-01

The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacterial genetics but there are only a limited number of plasmid vectors available that replicate in X. fastidiosa, and even fewer that are retained without antibiotic selection. Two plasmids are described here that show stable replication in X. fastidiosa and are effective for gene complementation both in vitro and in planta. Plasmid maintenance is facilitated by incorporation of the PemI/PemK plasmid addiction system, consisting of PemK, an endoribonuclease toxin, and its cognate antitoxin, PemI. Vector pXf20pemIK utilizes a native X. fastidiosa replication origin as well as a high-copy-number pUC origin for propagation in Escherichia coli cloning strains. Broad-host-range vector pBBR5pemIK is a medium- to low-copy-number plasmid based on the pBBR1 backbone. Both plasmids are maintained for extended periods of time in the absence of antibiotic selection, as well as up to 14 weeks in grapevine, without affecting bacterial fitness. These plasmids present an alternative to traditional complementation and expression vectors which rely on antibiotic selection for plasmid retention.

Design of magnetic polyplexes taken up efficiently by dendritic cell for enhanced DNA vaccine delivery.

PubMed

Nawwab Al-Deen, F M; Selomulya, C; Kong, Y Y; Xiang, S D; Ma, C; Coppel, R L; Plebanski, M

2014-02-01

Dendritic cells (DC) targeting vaccines require high efficiency for uptake, followed by DC activation and maturation. We used magnetic vectors comprising polyethylenimine (PEI)-coated superparamagnetic iron oxide nanoparticles, with hyaluronic acid (HA) of different molecular weights (<10 and 900 kDa) to reduce cytotoxicity and to facilitate endocytosis of particles into DCs via specific surface receptors. DNA encoding Plasmodium yoelii merozoite surface protein 1-19 and a plasmid encoding yellow fluorescent gene were added to the magnetic complexes with various % charge ratios of HA: PEI. The presence of magnetic fields significantly enhanced DC transfection and maturation. Vectors containing a high-molecular-weight HA with 100% charge ratio of HA: PEI yielded a better transfection efficiency than others. This phenomenon was attributed to their longer molecular chains and higher mucoadhesive properties aiding DNA condensation and stability. Insights gained should improve the design of more effective DNA vaccine delivery systems.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Trial and error: how the unclonable human mitochondrial genome was cloned in yeast.

PubMed

Bigger, Brian W; Liao, Ai-Yin; Sergijenko, Ana; Coutelle, Charles

2011-11-01

Development of a human mitochondrial gene delivery vector is a critical step in the ability to treat diseases arising from mutations in mitochondrial DNA. Although we have previously cloned the mouse mitochondrial genome in its entirety and developed it as a mitochondrial gene therapy vector, the human mitochondrial genome has been dubbed unclonable in E. coli, due to regions of instability in the D-loop and tRNA(Thr) gene. We tested multi- and single-copy vector systems for cloning human mitochondrial DNA in E. coli and Saccharomyces cerevisiae, including transformation-associated recombination. Human mitochondrial DNA is unclonable in E. coli and cannot be retained in multi- or single-copy vectors under any conditions. It was, however, possible to clone and stably maintain the entire human mitochondrial genome in yeast as long as a single-copy centromeric plasmid was used. D-loop and tRNA(Thr) were both stable and unmutated. This is the first report of cloning the entire human mitochondrial genome and the first step in developing a gene delivery vehicle for human mitochondrial gene therapy.

[Construction and function identification of luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR].

PubMed

Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min

2016-01-01

This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.

Undetectable Transcription of cap in a Clinical AAV Vector: Implications for Preformed Capsid in Immune Responses

PubMed Central

Hauck, Bernd; Murphy, Samuel L; Smith, Peter H; Qu, Guang; Liu, Xingge; Zelenaia, Olga; Mingozzi, Federico; Sommer, Jürg M; High, Katherine A; Wright, J. Fraser

2008-01-01

In a gene therapy clinical trial for hemophilia B, adeno-associated virus 2 (AAV2) capsid–specific CD8+ T cells were previously implicated in the elimination of vector-transduced hepatocytes, resulting in loss of human factor IX (hFIX) transgene expression. To test the hypothesis that expression of AAV2 cap DNA impurities in the AAV2-hFIX vector was the source of epitopes presented on transduced cells, transcription of cap was assessed by quantitative reverse transcription–PCR (Q-RT-PCR) following transduction of target cells with the vector used in the clinical trial. Transcriptional profiling was also performed for residual AmpR, and adenovirus E2A and E4. Although trace amounts of DNA impurities were present in the clinical vector, transcription of these sequences was not detected after transduction of human hepatocytes, nor in mice administered a dose 26-fold above the highest dose administered in the clinical study. Two methods used to minimize encapsidated DNA impurities in the clinical vector were: (i) a vector (cis) production plasmid with a backbone exceeding the packaging limit of AAV; and (ii) a vector purification step that achieved separation of the vector from vector-related impurities (e.g., empty capsids). In conclusion, residual cap expression was undetectable following transduction with AAV2-hFIX clinical vectors. Preformed capsid protein is implicated as the source of epitopes recognized by CD8+ T cells that eliminated vector-transduced cells in the clinical study. PMID:18941440

Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira

2012-01-06

Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less

Tetrahedral DNA Nanoparticle Vector for Intracellular Delivery of Targeted Peptide Nucleic Acid Antisense Agents to Restore Antibiotic Sensitivity in Cefotaxime-Resistant Escherichia coli.

PubMed

Readman, John Benedict; Dickson, George; Coldham, Nick G

2017-06-01

The bacterial cell wall presents a barrier to the uptake of unmodified synthetic antisense oligonucleotides, such as peptide nucleic acids, and so is one of the greatest obstacles to the development of their use as therapeutic anti-bacterial agents. Cell-penetrating peptides have been covalently attached to antisense agents, to facilitate penetration of the bacterial cell wall and deliver their cargo into the cytoplasm. Although they are an effective vector for antisense oligonucleotides, they are not specific for bacterial cells and can exhibit growth inhibitory properties at higher doses. Using a bacterial cell growth assay in the presence of cefotaxime (CTX 16 mg/L), we have developed and evaluated a self-assembling non-toxic DNA tetrahedron nanoparticle vector incorporating a targeted anti-bla CTX-M-group 1 antisense peptide nucleic acid (PNA4) in its structure for penetration of the bacterial cell wall. A dose-dependent CTX potentiating effect was observed when PNA4 (0-40 μM) was incorporated into the structure of a DNA tetrahedron vector. The minimum inhibitory concentration (to CTX) of an Escherichia coli field isolate harboring a plasmid carrying bla CTX-M-3 was reduced from 35 to 16 mg/L in the presence of PNA4 carried by the DNA tetrahedron vector (40 μM), contrasting with no reduction in MIC in the presence of PNA4 alone. No growth inhibitory effects of the DNA tetrahedron vector alone were observed.

The LE1 Bacteriophage Replicates as a Plasmid within Leptospira biflexa: Construction of an L. biflexa-Escherichia coli Shuttle Vector

PubMed Central

Girons, Isabelle Saint; Bourhy, Pascale; Ottone, Catherine; Picardeau, Mathieu; Yelton, David; Hendrix, Roger W.; Glaser, Philippe; Charon, Nyles

2000-01-01

We have discovered that LE1, one of the plaque-forming phages previously described as lytic for the Leptospira biflexa saprophytic spirochete (I. Saint Girons, D. Margarita, P. Amouriaux, and G. Baranton, Res. Microbiol. 141:1131–1138, 1990), was indeed temperate. LE1 was found to be unusual, as Southern blot analysis indicated that it is one of the few phages to replicate in the prophage state as a circular plasmid. The unavailability of such small endogenous replicons has hindered genetic experimentation in Leptospira. We have developed a shuttle vector with DNA derived from LE1. Random LE1 DNA fragments were cloned into a pGEM 7Zf(+) derivative devoid of most of the bla gene but carrying a kanamycin resistance marker from the gram-positive bacterium Enterococcus (Streptococcus) faecalis. These constructs were transformed into L. biflexa strain Patoc 1 by electroporation, giving rise to kanamycin-resistant transformants. A 2.2-kb fragment from LE1 was responsible for replication of the vector in L. biflexa. However, a larger region including an intact parA gene homologue was necessary for the stability of the shuttle vector. Direct repeats and AT-rich regions characterized the LE1 origin of replication. Our data indicate that the replicon derived from the LE1 leptophage, together with the kanamycin resistance gene, is a promising tool with which to develop the genetics of Leptospira species. PMID:11004167

The use of the replication region of plasmid pRS7 from Oenococcus oeni as a putative tool to generate cloning vectors for lactic acid bacteria.

PubMed

Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M

2015-01-01

A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.

Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

PubMed Central

Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

1985-01-01

The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

Introduction of plasmid DNA into an ST398 livestock-associated methicillin-resistant Staphylococcus aureus strain

USDA-ARS?s Scientific Manuscript database

MRS926 is a livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) strain of sequence type (ST) 398. In order to facilitate in vitro and in vivo studies of this strain, we sought to tag it with a fluorescent marker. We cloned a codon-optimized gene for TurboGFP into a shuttle vector...

Hofmeister series salts enhance purification of plasmid DNA by non-ionic detergents

PubMed Central

Lezin, George; Kuehn, Michael R.; Brunelli, Luca

2011-01-01

Ion-exchange chromatography is the standard technique used for plasmid DNA purification, an essential molecular biology procedure. Non-ionic detergents (NIDs) have been used for plasmid DNA purification, but it is unclear whether Hofmeister series salts (HSS) change the solubility and phase separation properties of specific NIDs, enhancing plasmid DNA purification. After scaling-up NID-mediated plasmid DNA isolation, we established that NIDs in HSS solutions minimize plasmid DNA contamination with protein. In addition, large-scale NID/HSS solutions eliminated LPS contamination of plasmid DNA more effectively than Qiagen ion-exchange columns. Large-scale NID isolation/NID purification generated increased yields of high quality DNA compared to alkali isolation/column purification. This work characterizes how HSS enhance NID-mediated plasmid DNA purification, and demonstrates that NID phase transition is not necessary for LPS removal from plasmid DNA. Specific NIDs such as IGEPAL CA-520 can be utilized for rapid, inexpensive and efficient laboratory-based large-scale plasmid DNA purification, outperforming Qiagen-based column procedures. PMID:21351074

On the efficacy of malaria DNA vaccination with magnetic gene vectors.

PubMed

Nawwab Al-Deen, Fatin; Ma, Charles; Xiang, Sue D; Selomulya, Cordelia; Plebanski, Magdalena; Coppel, Ross L

2013-05-28

We investigated the efficacy and types of immune responses from plasmid malaria DNA vaccine encoding VR1020-PyMSP119 condensed on the surface of polyethyleneimine (PEI)-coated SPIONs. In vivo mouse studies were done firstly to determine the optimum magnetic vector composition, and then to observe immune responses elicited when magnetic vectors were introduced via different administration routes. Higher serum antibody titers against PyMSP119 were observed with intraperitoneal and intramuscular injections than subcutaneous and intradermal injections. Robust IgG2a and IgG1 responses were observed for intraperitoneal administration, which could be due to the physiology of peritoneum as a major reservoir of macrophages and dendritic cells. Heterologous DNA prime followed by single protein boost vaccination regime also enhanced IgG2a, IgG1, and IgG2b responses, indicating the induction of appropriate memory immunity that can be elicited by protein on recall. These outcomes support the possibility to design superparamagnetic nanoparticle-based DNA vaccines to optimally evoke desired antibody responses, useful for a variety of diseases including malaria. Copyright © 2013 Elsevier B.V. All rights reserved.

Secure and effective gene delivery system of plasmid DNA coated by polynucleotide.

PubMed

Kodama, Yukinobu; Ohkubo, Chikako; Kurosaki, Tomoaki; Egashira, Kanoko; Sato, Kayoko; Fumoto, Shintaro; Nishida, Koyo; Higuchi, Norihide; Kitahara, Takashi; Nakamura, Tadahiro; Sasaki, Hitoshi

2015-01-01

Polynucleotides are anionic macromolecules which are expected to transfer into the targeted cells through specific uptake mechanisms. So, we developed polynucleotides coating complexes of plasmid DNA (pDNA) and polyethylenimine (PEI) for a secure and efficient gene delivery system and evaluated their usefulness. Polyadenylic acid (polyA), polyuridylic acid (polyU), polycytidylic acid (polyC), and polyguanylic acid (polyG) were examined as the coating materials. pDNA/PEI/polyA, pDNA/PEI/polyU, and pDNA/PEI/polyC complexes formed nanoparticles with a negative surface charge although pDNA/PEI/polyG was aggregated. The pDNA/PEI/polyC complex showed high transgene efficiency in B16-F10 cells although there was little efficiency in pDNA/PEI/polyA and pDNA/PEI/polyU complexes. An inhibition study strongly indicated the specific uptake mechanism of pDNA/PEI/polyC complex. Polynucleotide coating complexes had lower cytotoxicity than pDNA/PEI complex. The pDNA/PEI/polyC complex showed high gene expression selectively in the spleen after intravenous injection into mice. The pDNA/PEI/polyC complex showed no agglutination with erythrocytes and no acute toxicity although these were observed in pDNA/PEI complex. Thus, we developed polynucleotide coating complexes as novel vectors for clinical gene therapy, and the pDNA/PEI/polyC complex as a useful candidate for a gene delivery system.

Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

PubMed

Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika

2013-01-01

Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

Event-specific plasmid standards and real-time PCR methods for transgenic Bt11, Bt176, and GA21 maize and transgenic GT73 canola.

PubMed

Taverniers, Isabel; Windels, Pieter; Vaïtilingom, Marc; Milcamps, Anne; Van Bockstaele, Erik; Van den Eede, Guy; De Loose, Marc

2005-04-20

Since the 18th of April 2004, two new regulations, EC/1829/2003 on genetically modified food and feed products and EC/1830/2003 on traceability and labeling of GMOs, are in force in the EU. This new, comprehensive regulatory framework emphasizes the need of an adequate tracing system. Unique identifiers, such as the transgene genome junction region or a specific rearrangement within the transgene DNA, should form the basis of such a tracing system. In this study, we describe the development of event-specific tracing systems for transgenic maize lines Bt11, Bt176, and GA21 and for canola event GT73. Molecular characterization of the transgene loci enabled us to clone an event-specific sequence into a plasmid vector, to be used as a marker, and to develop line-specific primers. Primer specificity was tested through qualitative PCRs and dissociation curve analysis in SYBR Green I real-time PCRs. The primers were then combined with event-specific TaqMan probes in quantitative real-time PCRs. Calibration curves were set up both with genomic DNA samples and the newly synthesized plasmid DNA markers. It is shown that cloned plasmid GMO target sequences are perfectly suitable as unique identifiers and quantitative calibrators. Together with an event-specific primer pair and a highly specific TaqMan probe, the plasmid markers form crucial components of a unique and straighforward tracing system for Bt11, Bt176, and GA21 maize and GT73 canola events.

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

PubMed

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Towards development of novel immunization strategies against leishmaniasis using PLGA nanoparticles loaded with kinetoplastid membrane protein-11.

PubMed

Santos, Diego M; Carneiro, Marcia W; de Moura, Tatiana R; Fukutani, Kiyoshi; Clarencio, Jorge; Soto, Manuel; Espuelas, Socorro; Brodskyn, Claudia; Barral, Aldina; Barral-Netto, Manoel; de Oliveira, Camila I

2012-01-01

Vaccine development has been a priority in the fight against leishmaniases, which are vector-borne diseases caused by Leishmania protozoa. Among the different immunization strategies employed to date is inoculation of plasmid DNA coding for parasite antigens, which has a demonstrated ability to induce humoral and cellular immune responses. In this sense, inoculation of plasmid DNA encoding Leishmania kinetoplasmid membrane protein-11 (KMP-11) was able to confer protection against visceral leishmaniasis. However, recently the use of antigen delivery systems such as poly(lactic-co-glycolic acid) (PLGA) nanoparticles has also proven effective for eliciting protective immune responses. In the present work, we tested two immunization strategies with the goal of obtaining protection, in terms of lesion development and parasite load, against cutaneous leishmaniasis caused by L. braziliensis. One strategy involved immunization with plasmid DNA encoding L. infantum chagasi KMP-11. Alternatively, mice were primed with PLGA nanoparticles loaded with the recombinant plasmid DNA and boosted using PLGA nanoparticles loaded with recombinant KMP-11. Both immunization strategies elicited detectable cellular immune responses with the presence of both proinflammatory and anti-inflammatory cytokines; mice receiving the recombinant PLGA nanoparticle formulations also demonstrated anti-KMP-11 IgG1 and IgG2a. Mice were then challenged with L. braziliensis, in the presence of sand fly saliva. Lesion development was not inhibited following either immunization strategy. However, immunization with PLGA nanoparticles resulted in a more prominent reduction in parasite load at the infection site when compared with immunization using plasmid DNA alone. This effect was associated with a local increase in interferon-gamma and in tumor necrosis factor-alpha. Both immunization strategies also resulted in a lower parasite load in the draining lymph nodes, albeit not significantly. Our results encourage the pursuit of immunization strategies employing nanobased delivery systems for vaccine development against cutaneous leishmaniasis caused by L. braziliensis infection.

Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

PubMed

Woods, J P; Heinecke, E L; Goldman, W E

1998-04-01

We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.

Cloning of hydrogenase genes and fine structure analysis of an operon essential for H/sub 2/ metabolism in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sankar, P.; Lee, J.H.; Shanmugam, K.T.

1985-04-01

Escherichia coli has two unlinked genes that code for hydrogenase synthesis and activity. The DNA fragments containing the two genes (hydA and hydB) were cloned into a plasmid vector, pBR322. The plasmids containing the hyd genes (pSE-290 and pSE-111 carrying the hydA and hydB genes, respectively) were used to genetically map a total of 51 mutant strains with defects in hydrogenase activity. A total of 37 mutants carried a mutation in the hydB gene, whereas the remaining 14 hyd were hydA. This complementation analysis also established the presence of two new genes, so far unidentified, one coding for formate dehydrogenase-2more » (fdv) and another producing an electron transport protein (fhl) coupling formate dehydrogenase-2 to hydrogenase. Three of the four genes, hydB, fhl, and fdv, may constitute a single operon, and all three genes are carried by a 5.6-kilobase-pair chromosomal DNA insert in plasmid pSE-128. Plasmids carrying a part of this 5.6-kilobase-pair DNA (pSE-130) or fragments derived from this DNA in different orientations (pSE-126 and pSE-129) inhibited the production of active formate hydrogenlyase. This inhibition occurred even in a prototrophic E. coli, strain K-10, but only during an early induction period. These results, based on complementation analysis with cloned DNA fragments, show that both hydA and hydB genes are essential for the production of active hydrogenase. For the expression of active formate hydrogenlyase, two other gene products, fhl and fdv are also needed. All four genes map between 58 and 59 min in the E. coli chromosome.« less

A new series of yeast shuttle vectors for the recovery and identification of multiple plasmids from Saccharomyces cerevisiae.

PubMed

Frazer, LilyAnn Novak; O'Keefe, Raymond T

2007-09-01

The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.

Multiplexing clonality: combining RGB marking and genetic barcoding

PubMed Central

Cornils, Kerstin; Thielecke, Lars; Hüser, Svenja; Forgber, Michael; Thomaschewski, Michael; Kleist, Nadja; Hussein, Kais; Riecken, Kristoffer; Volz, Tassilo; Gerdes, Sebastian; Glauche, Ingmar; Dahl, Andreas; Dandri, Maura; Roeder, Ingo; Fehse, Boris

2014-01-01

RGB marking and DNA barcoding are two cutting-edge technologies in the field of clonal cell marking. To combine the virtues of both approaches, we equipped LeGO vectors encoding red, green or blue fluorescent proteins with complex DNA barcodes carrying color-specific signatures. For these vectors, we generated highly complex plasmid libraries that were used for the production of barcoded lentiviral vector particles. In proof-of-principle experiments, we used barcoded vectors for RGB marking of cell lines and primary murine hepatocytes. We applied single-cell polymerase chain reaction to decipher barcode signatures of individual RGB-marked cells expressing defined color hues. This enabled us to prove clonal identity of cells with one and the same RGB color. Also, we made use of barcoded vectors to investigate clonal development of leukemia induced by ectopic oncogene expression in murine hematopoietic cells. In conclusion, by combining RGB marking and DNA barcoding, we have established a novel technique for the unambiguous genetic marking of individual cells in the context of normal regeneration as well as malignant outgrowth. Moreover, the introduction of color-specific signatures in barcodes will facilitate studies on the impact of different variables (e.g. vector type, transgenes, culture conditions) in the context of competitive repopulation studies. PMID:24476916

Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodyer, P.R.; Torban, E.; Dehbi, M.

1994-09-01

The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less

Is passive transmission of non-viral vectors through artificial insemination of sperm-DNA mixtures sufficient for chicken transgenesis?

PubMed Central

CHAPARIAN, Shahram; ABDULAHNEJAD, Ahad; RASHIDI, Farzad; TOGHYANI, Majid; GHEISARI, Abbasali; EGHBALSAIED, Shahin

2016-01-01

DNA uptake in the post-acrosomal region of the spermatozoa takes place exclusively in immotile spermatozoa that are naturally unable to fertilize eggs. The present study aimed to assess whether passive transmission of non-viral vectors to the surrounding areas of chicken embryos could be an alternate mechanism in chicken sperm-mediated gene transfer. First, the presence of nucleases in rooster seminal plasma was evaluated. Semen ejaculates from five roosters were centrifuged and the supernatant was incubated with pBL2 for 1 h. A robust nuclease cocktail was detected in the rooster semen. To overcome these nucleases, plasmid-TransIT combinations were incubated with semen for 1 h. Incubation of exogenous DNA in the lipoplex structure could considerably bypass the semen nuclease effect. Then, intravaginal insemination of 1 × 109 sperm mixed with lipoplexes (40 µg pBL2:40 µl TransIT) was carried out in 15 virgin hens. Neither the epithelial tissue from the inseminated female reproductive tracts nor the produced embryos following artificial insemination showed the transgene. To remove any bias in the transgene transmission possibility, the plasmid-TransIT admixture was directly injected in close vicinity of the embryos in newly laid eggs. Nonetheless, none of the produced fetuses or chicks carried the transgene. In conclusion, the results of the present study revealed a nuclease admixture in rooster seminal plasma, and passive/active transmission of the non-viral vector into close vicinity of the chicken embryo was inefficient for producing transgenic chicks. PMID:26935324

Plasmid-linked ampicillin resistance in haempohilus influenza type b.

PubMed

Elwell, L P; De Graaff, J; Seibert, D; Falkow, S

1975-08-01

Four ampicillin-resistant, beta-lactamase-producing strains of Haempohilus influenzae type b were examined for the presence of plasmid deoxyribonucleic acid (DNA). Three resistant strains contained a 30 x 10-6-dalton (30Mdal) plasmid and one resitant strain contained a 3-Mdal plasmid. The ampicillin-sensitive Haemophilus strains examined did not contain plasmid DNA. Transformation of a sensitive H. influenzae strain to ampicillin resistance with isolated plasmid DNA preparations revealed that the structural gene for beta-lactamase resided on both plasmid species. DNA-DNA hybridization studies showed that the 30-Mdal Haemophilus plasmid contained the ampicillin translocation DNA segment (TnA) found on some R-factors of enteric origin of the H. influenzae plasmids.

Nanoparticle-mediated gene delivery.

PubMed

Jin, Sha; Leach, John C; Ye, Kaiming

2009-01-01

Nonviral gene delivery has been gaining considerable attention recently. Although the efficacy of DNA transfection, which is a major concern, is low in nonviral vector-mediated gene transfer compared with viral ones, nonviral vectors are relatively easy to prepare, less immunogenic and oncogenic, and have no potential of virus recombination and no limitation on the size of a transferred gene. The ability to incorporate genetic materials such as plasmid DNA, RNA, and siRNA into functionalized nanoparticles with little toxicity demonstrates a new era in pharmacotherapy for delivering genes selectively to tissues and cells. In this chapter, we highlight the basic concepts and applications of nonviral gene delivery using super paramagnetic iron oxide nanoparticles and functionalized silica nanoparticles. The experimental protocols related to these topics are described in the chapter.

Ca(2+)-mediated anionic lipid-plasmid DNA lipoplexes. Electrochemical, structural, and biochemical studies.

PubMed

Barrán-Berdón, Ana L; Yélamos, Belén; Malfois, Marc; Aicart, Emilio; Junquera, Elena

2014-10-07

Several experimental methods, such as zeta potential, gel electrophoresis, small-angle X-ray scattering, gene transfection, fluorescence microscopy, flow cytometry, and cell viability/cytotoxicity assays, have been used to analyze the potential of anionic lipids (AL) as effective nontoxic and nonviral DNA vectors, assisted by divalent cations. The lipoplexes studied are those comprised of the green fluorescent protein-encoding plasmid DNA pEGFP-C3, an anionic lipid as 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DOPG) or 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), and a zwitterionic lipid, the 1,2-dioleoyl-sn -glycero-3-phosphatidylethanolamine (DOPE, not charged at physiological pH). The studies have been carried on at different liposome and lipoplex compositions and in the presence of a variety of [Ca2+]. Electrochemical experiments reveal that DOPG/DOPE and DOPS/DOPE anionic liposomes may compact more effectively pDNA at low molar fractions (with an excess of DOPE) and at AL/pDNA ratios ≈20. Calcium concentrations around 15-20 mM are needed to yield lipoplexes neutral or slightly positive. From a structural standpoint, DOPG/DOPE-Ca2+-pDNA lipoplexes are self-assembled into a HIIc phase (inverted cylindrical micelles in hexagonal ordering with plasmid supercoils inside the cylinders), while DOPS/DOPE-Ca2+-pDNA lipoplexes show two phases in coexistence: one classical HIIc phase which contains pDNA supercoils and one Lα phase without pDNA among the lamellae, i.e., a lamellar stack of lipidic bilayers held together by Ca2+ bridges. Transfection and cell viability studies were done with HEK293T and HeLa cells in the presence of serum. Lipoplexes herein studied show moderate-to-low transfection levels combined with moderate-to-high cell viability, comparable to those yield by Lipofectamine2000*, which is a cationic lipid (CL) standard formulation, but none of them improve the output of typical CL gen vectors, mostly if they are gemini or dendritic. This fact would be indicating that, nowadays, lipofection via anionic lipids and divalent cations as mediators still needs to enhance transfection levels in order to be considered as a real and plausible alternative to lipofection through improved CLs-based lipoplexes.

Characterization of Halomonas sp. ZM3 isolated from the Zelazny Most post-flotation waste reservoir, with a special focus on its mobile DNA

PubMed Central

2013-01-01

Background Halomonas sp. ZM3 was isolated from Zelazny Most post-flotation mineral waste repository (Poland), which is highly contaminated with heavy metals and various organic compounds. Mobile DNA of the strain (i.e. plasmids and transposons) were analyzed in order to identify genetic information enabling adaptation of the bacterium to the harsh environmental conditions. Results The analysis revealed that ZM3 carries plasmid pZM3H1 (31,370 bp), whose replication system may be considered as an archetype of a novel subgroup of IncU-like replicons. pZM3H1 is a narrow host range, mobilizable plasmid (encodes a relaxase of the MOBV family) containing mercury resistance operon (mer) and czcD genes (mediate resistance to zinc and cobalt), which are part of a large truncated Tn3 family transposon. Further analysis demonstrated that the phenotypes determined by the pZM3H1 resistance cassette are highly dependent on the host strain. In another strand of the study, the trap plasmid pMAT1 was employed to identify functional transposable elements of Halomonas sp. ZM3. Using the sacB positive selection strategy two insertion sequences were identified: ISHsp1 - representing IS5 group of IS5 family and ISHsp2 - a distinct member of the IS630 family. Conclusions This study provides the first detailed description of mobile DNA in a member of the family Halomonadaceae. The identified IncU plasmid pZM3H1 confers resistance phenotypes enabling adaptation of the host strain to the Zelazny Most environment. The extended comparative analysis has shed light on the distribution of related IncU plasmids among bacteria, which, in many cases, reflects the frequency and direction of horizontal gene transfer events. Our results also identify plasmid-encoded modules, which may form the basis of novel shuttle vectors, specific for this group of halophilic bacteria. PMID:23497212

In vivo transcription of R-plasmid deoxyribonucleic acid in Escherichia coli strains with altered antibiotic resistance levels and/or conjugal proficiency.

PubMed Central

Davis, R; Vapnek, D

1976-01-01

The amounts of plasmid deoxyribonucleic acid (DNA) and the levels of the in vivo transcription of the Escherichia coli plasmids R538-1 (repressed for conjugal transfer) and R538-1drd (derepressed for transfer) were determined by DNA-DNA hybridization and DNA-ribonucleic acid hybridization, respectively. The results demonstrate that the level of plasmid transcription is increased by two-fold in the strain carrying the derepressed plasmid, compared to an isogenic strain carrying the repressed plasmid, whereas the amount of plasmid DNA is approximately the same, suggesting that the transfer genes are under transcriptional control. Levels of plasmid DNA, plasmid DNA transcription, and chloramphenicol acetyltransferase activity were also compared in a mutant strain that carried the R538-1drd plasmid and was resistant to high levels of antibiotics. This strain produces about 13 copies of plasmid DNA per chromosome compared to five copies for the parent strain. The level of transcription of plasmid DNA was found to be twofold higher in the high-level resistant strain, whereas the level of chloramphenition, acetyltransferase activity was increased by 10-fold. In addition the levels of plasmid DNA transcription and chloramphenicol acetyltransferase activity in the high-level resistant strain were found to be further increased by the presence of high levels of chloramphenicol in the growth medium. The amount of plasmid DNA remained constant under these conditions, indicating that high levels of chloramphenicol can stimulate the expression of plasmid genes at the level of transcription in this strain. PMID:767321

Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.

PubMed

Dad, A-B K; Ramakrishna, S; Song, M; Kim, H

2014-11-01

Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.

Utilization of RNA polymerase I promoter and terminator sequences to develop a DNA transfection system for the study of hepatitis C virus internal ribosomal entry site-dependent translation.

PubMed

Oem, Jae-Ku; Xiang, Zhonghua; Zhou, Yan; Babiuk, Lorne A; Liu, Qiang

2007-09-01

Hepatitis C virus (HCV) causes severe liver diseases in a large population worldwide. HCV protein translation is controlled by an internal ribosomal entry site (IRES) within the 5'-untranslated region (UTR). HCV IRES-dependent translation is critical for HCV-associated pathogenesis. To develop a plasmid DNA transfection system by using RNA polymerase I promoter and terminator sequences for studying HCV IRES-dependent translation. A gene cassette containing HCV 5'-UTR, Renilla luciferase reporter gene, and HCV 3'-UTR was inserted between RNA polymerase I promoter and terminator sequences. HCV IRES-directed translation was determined by luciferase assay after transfection. Transfection of the RNA polymerase I-HCV IRES plasmid into human hepatoma Huh-7 and HepG2 cells resulted in luciferase gene expression. Deletion of the IIIf domain in HCV IRES dramatically reduced luciferase activity. Our results indicated that the plasmid vector system-based on RNA polymerase I promoter and terminator sequences represents an effective approach for the study of HCV IRES-dependent translation.

Functional characterization of replication and stability factors of an incompatibility group P-1 plasmid from Xylella fastidiosa.

PubMed

Lee, Min Woo; Rogers, Elizabeth E; Stenger, Drake C

2010-12-01

Xylella fastidiosa strain riv11 harbors a 25-kbp plasmid (pXF-RIV11) belonging to the IncP-1 incompatibility group. Replication and stability factors of pXF-RIV11 were identified and used to construct plasmids able to replicate in X. fastidiosa and Escherichia coli. Replication in X. fastidiosa required a 1.4-kbp region from pXF-RIV11 containing a replication initiation gene (trfA) and the adjacent origin of DNA replication (oriV). Constructs containing trfA and oriV from pVEIS01, a related IncP-1 plasmid of the earthworm symbiont Verminephrobacter eiseniae, also were competent for replication in X. fastidiosa. Constructs derived from pXF-RIV11 but not pVEIS01 replicated in Agrobacterium tumefaciens, Xanthomonas campestris, and Pseudomonas syringae. Although plasmids bearing replication elements from pXF-RIV11 or pVEIS01 could be maintained in X. fastidiosa under antibiotic selection, removal of selection resulted in plasmid extinction after 3 weekly passages. Addition of a toxin-antitoxin addiction system (pemI/pemK) from pXF-RIV11 improved plasmid stability such that >80 to 90% of X. fastidiosa cells retained plasmid after 5 weekly passages in the absence of antibiotic selection. Expression of PemK in E. coli was toxic for cell growth, but toxicity was nullified by coexpression of PemI antitoxin. Deletion of N-terminal sequences of PemK containing the conserved motif RGD abolished toxicity. In vitro assays revealed a direct interaction of PemI with PemK, suggesting that antitoxin activity of PemI is mediated by toxin sequestration. IncP-1 plasmid replication and stability factors were added to an E. coli cloning vector to constitute a stable 6.0-kbp shuttle vector (pXF20-PEMIK) suitable for use in X. fastidiosa.

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Genetic modification of bone-marrow mesenchymal stem cells and hematopoietic cells with human coagulation factor IX-expressing plasmids.

PubMed

Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram

2016-05-01

Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Ultrasound enhances in vivo tumor expression of plasmid DNA by PEG-introduced cationized dextran.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2005-11-28

This study is an investigation to experimentally confirm whether or not ultrasound (US) irradiation is effective in enhancing the in vivo gene expression of plasmid DNA in tumor. Dextran was cationized by introducing spermine to the hydroxyl groups to allow to polyionically complex with a plasmid DNA. The cationized dextran prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have an active ester and methoxy groups at each terminal, to obtain cationized dextran with different percentages of PEG introduced. Various cationized dextrans with or without PEG introduction were mixed with a plasmid DNA of LacZ to form cationized dextran-plasmid DNA complexes. Electrophoretical examination revealed that the plasmid DNA was complexed both with the cationized dextran and PEG-introduced cationized dextran, irrespective of the PEG introduction percentage, although the higher N/P ratio was needed for plasmid DNA complexation with the latter. By complexation with the cationized dextran, the zeta potential of plasmid DNA was changed to be positive. The charge of PEG-introduced cationized dextran-plasmid DNA complexes became close to 0 mV as their percentage of PEG introduced increased, although the molecular size was about 250 nm, irrespective of the PEG introduction. When cationized dextran-plasmid DNA complexes with or without PEG introduction were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass and the subsequent US irradiation to the tumor mass percutaneously, the PEG-introduced cationized dextran-plasmid DNA complex plus US irradiation enhanced the tumor level of gene expression to a significantly high extent compared with the cationized dextran-plasmid DNA complex and free plasmid DNA with or without US irradiation. The enhanced level depended on the time period and timing of US irradiation. Fluorescent microscopic studies revealed that the localization of plasmid DNA and the gene expression were observed in the tumor tissue injected with the PEG-introduced cationized dextran-plasmid DNA complex plus the subsequent US irradiation. We conclude that complexation with the PEG-introduced cationized dextran combined with US irradiation is a promising way to target the plasmid DNA to the tumor for gene expression.

Agroinfection as an alternative to insects for infecting plants with beet western yellows luteovirus.

PubMed Central

Leiser, R M; Ziegler-Graff, V; Reutenauer, A; Herrbach, E; Lemaire, O; Guilley, H; Richards, K; Jonard, G

1992-01-01

Beet western yellows luteovirus, like other luteoviruses, cannot be transmitted to host plants by mechanical inoculation but requires an aphid vector, a feature that has heretofore presented a serious obstacle to the study of such viruses. In this paper we describe use of agroinfection to infect hosts with beet western yellows virus without recourse to aphids. Agroinfection is a procedure for introducing a plant virus into a host via Agrobacterium tumefaciens harboring a Ti plasmid, which can efficiently transfer a portion of the plasmid (T-DNA) to plant cells near a wound. The viral genome must be inserted into the T-DNA in such a way that it can escape and begin autonomous replication, a requirement that has, so far, limited agroinfection to pathogens with a circular genome. We have cloned cDNA corresponding to the complete beet western yellows virus RNA genome between the cauliflower mosaic virus 35S promoter and the nopaline synthase transcription termination signal. In one construct, a self-cleaving (ribozyme) sequence was included so as to produce a transcript in planta with a 3' extremity almost identical to natural viral RNA. When inoculated mechanically to host plants, the naked plasmid DNA was not infectious but, when introduced into T-DNA and agroinfected to plants, both the construct with and without the ribozyme produced an infection. This approach should be applicable to virtually any plant virus with a linear plus-strand RNA genome. Images PMID:1409615

Engineering nanoparticle-coated bacteria as oral DNA vaccines for cancer immunotherapy.

PubMed

Hu, Qinglian; Wu, Min; Fang, Chun; Cheng, Changyong; Zhao, Mengmeng; Fang, Weihuan; Chu, Paul K; Ping, Yuan; Tang, Guping

2015-04-08

Live attenuated bacteria are of increasing importance in biotechnology and medicine in the emerging field of cancer immunotherapy. Oral DNA vaccination mediated by live attenuated bacteria often suffers from low infection efficiency due to various biological barriers during the infection process. To this end, we herein report, for the first time, a new strategy to engineer cationic nanoparticle-coated bacterial vectors that can efficiently deliver oral DNA vaccine for efficacious cancer immunotherapy. By coating live attenuated bacteria with synthetic nanoparticles self-assembled from cationic polymers and plasmid DNA, the protective nanoparticle coating layer is able to facilitate bacteria to effectively escape phagosomes, significantly enhance the acid tolerance of bacteria in stomach and intestines, and greatly promote dissemination of bacteria into blood circulation after oral administration. Most importantly, oral delivery of DNA vaccines encoding autologous vascular endothelial growth factor receptor 2 (VEGFR2) by this hybrid vector showed remarkable T cell activation and cytokine production. Successful inhibition of tumor growth was also achieved by efficient oral delivery of VEGFR2 with nanoparticle-coated bacterial vectors due to angiogenesis suppression in the tumor vasculature and tumor necrosis. This proof-of-concept work demonstrates that coating live bacterial cells with synthetic nanoparticles represents a promising strategy to engineer efficient and versatile DNA vaccines for the era of immunotherapy.

DNA transformations of Candida tropicalis with replicating and integrative vectors.

PubMed

Sanglard, D; Fiechter, A

1992-12-01

The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.

Synthesis and characterization of PEG-conjugated quaternized chitosan and its application as a gene vector.

PubMed

Zhang, Xi; Yao, Juan; Zhang, Lihong; Fang, Jianguo; Bian, Fengling

2014-03-15

Poly(ethylene glycol)-conjugated N-(2-hydroxy) propyl-3-trimethyl ammonium chitosan chloride (PHTAC) derivatives were prepared by incorporating PEG molecules onto quaternized chitosan backbone. The copolymers were characterized by FTIR, (1)H NMR and XRD. Agarose gel retardation assay indicated that PHTAC had good plasmid DNA (pDNA) binding capability and the particle sizes of PHTAC/pDNA complexes determined by DLS were about 200 nm. Cytotoxicity assays in HeLa and 293T cells showed that PHTAC had low cytotoxicity. In vitro luciferase assay showed that PHTAC with PEGylation degree of 9% (PHTAC-1) had good transfection efficiency about 5.3-fold higher than quaternized chitosan, which was comparable with PEI (25 kDa). These results suggest that PHTAC-1 is a promising candidate as an efficient nonviral gene vector. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Experimental study on human periodontal ligament cells transfected with human amelogenin gene].

PubMed

Yu, Guang; Shu, Rong; Sun, Ying; Cheng, Lan; Song, Zhong-Chen; Zhang, Xiu-Li

2008-02-01

To construct the recombinant lentiviral vector of human amelogenin gene, infect human periodontal ligament cells with the recombinant lentivirus, and evaluate the feasibility of applying modified PDLCs as seeds for a further periodontal reconstruction. The mature peptide of hAm cDNA was cloned and linked into the vector plasmid, the recombinant plasmid FUAmW was confirmed by double enzyme digestion and sequence analysis. Recombinant lentivirus was prepared from 293T cells by polytheylenimine (PEI)-mediated transient cotransfection. The hPDLCs and 293T cells were infected with the generated lentivirus. The infection efficiency was analysed by detection of green fluorescence protein (GFP) with fluorescent microscope and flow cytometer 72 hours later. The expression of hAm gene was detected by reverse transcription polymerase chain reaction (RT-PCR). The sequence of inserted fragment in recombinant plasmid was identical to the hAm sequence reported in Genebank. Green fluorescence was visible under fluorescent microscope, FCM assay showed that positive percentage was 69.46% and 33.99% in 293T and hPDLCs, respectively. The targeted gene was obtained in the experimental groups by RT-PCR. The recombinan lentiviral vector of hAm gene is constructed successfully and it could be transfected into cultured hPDLCs. hAm gene and seed cells may be used for further study in the fields periodontal tissue engineering. Supported by National Natural Science Foundation of China (Grant No. 30672315).

Tumor targeting of gene expression through metal-coordinated conjugation with dextran.

PubMed

Hosseinkhani, Hossein; Aoyama, Teruyoshi; Ogawa, Osamu; Tabata, Yasuhiko

2003-03-07

Tumor targeting of plasmid DNA was achieved through the conjugation of dextran derivatives with chelate residues based on metal coordination. Diethylenetriamine pentaacetic acid (DTPA), spermidine (Sd), and spermine (Sm) were chemically introduced to the hydroxyl groups of dextran to obtain dextran-DTPA, dextran-Sd and dextran-Sm derivatives. Conjugation of the dextran derivative by Zn(2+) coordination decreased the apparent size of the plasmid DNA, depending on the derivative type. The negative zeta potential of plasmid DNA became almost 0 mV after Zn(2+)-coordinated conjugation with dextran-Sm. When the dextran derivative-plasmid DNA conjugates with Zn(2+) coordination were intravenously injected subcutaneously into mice bearing Meth-AR-1 fibrosarcoma, the dextran-Sm-plasmid DNA conjugate significantly enhanced the level of gene expression in the tumor, in contrast to the conjugate of other dextran derivatives and free plasmid DNA. The enhanced gene expression produced by the Zn(2+)-coordinated dextran-Sm-plasmid DNA conjugate was specific to the tumor, whereas a simple mixture of dextran-Sm and plasmid DNA was not effective. The level of gene expression depended on the percentage of chelate residues introduced, the mixing weight ratio of the plasmid DNA/Sm residue used for conjugate preparation, and the plasmid DNA dose. A fluorescent microscopic study revealed that localization of plasmid DNA in the tumor tissue was observed only after injection of the dextran-Sm-plasmid DNA conjugate with Zn(2+) coordination. In addition, the gene expression induced by the conjugate lasted for more than 10 days after the injection. We conclude that Zn(2+)-coordinated dextran-Sm conjugation is a promising way to enable plasmid DNA to target the tumor in gene expression as well as to prolong the duration of gene expression.

Cloning and Expression of Major Surface Antigen 1 Gene of Toxoplasma gondii RH Strain Using the Expression Vector pVAX1 in Chinese Hamster Ovary Cells

PubMed Central

Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh

2015-01-01

Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441

A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.

PubMed

Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya

2014-03-01

Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.

Improvement and Optimization of Two Engineered Phage Resistance Mechanisms in Lactococcus lactis

PubMed Central

McGrath, Stephen; Fitzgerald, Gerald F.; van Sinderen, Douwe

2001-01-01

Homologous replication module genes were identified for four P335 type phages. DNA sequence analysis revealed that all four phages exhibited more than 90% DNA homology for at least two genes, designated rep2009 and orf17. One of these genes, rep2009, codes for a putative replisome organizer protein and contains an assumed origin of phage DNA replication (ori2009), which was identical for all four phages. DNA fragments representing the ori2009 sequence confer a phage-encoded resistance (Per) phenotype on lactococcal hosts when they are supplied on a high-copy-number vector. Furthermore, cloning multiple copies of the ori2009 sequence was found to increase the effectiveness of the Per phenotype conferred. A number of antisense plasmids targeting specific genes of the replication module were constructed. Two separate plasmids targeting rep2009 and orf17 were found to efficiently inhibit proliferation of all four phages by interfering with intracellular phage DNA replication. These results represent two highly effective strategies for inhibiting bacteriophage proliferation, and they also identify a novel gene, orf17, which appears to be important for phage DNA replication. Furthermore, these results indicate that although the actual mechanisms of DNA replication are very similar, if not identical, for all four phages, expression of the replication genes is significantly different in each case. PMID:11157223

Oxidative damage in DNA bases revealed by UV resonant Raman spectroscopy.

PubMed

D'Amico, Francesco; Cammisuli, Francesca; Addobbati, Riccardo; Rizzardi, Clara; Gessini, Alessandro; Masciovecchio, Claudio; Rossi, Barbara; Pascolo, Lorella

2015-03-07

We report on the use of the UV Raman technique to monitor the oxidative damage of deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) and DNA (plasmid vector) solutions. Nucleotide and DNA aqueous solutions were exposed to hydrogen peroxide (H2O2) and iron containing carbon nanotubes (CNTs) to produce Fenton's reaction and induce oxidative damage. UV Raman spectroscopy is shown to be maximally efficient to reveal changes in the nitrogenous bases during the oxidative mechanisms occurring on these molecules. The analysis of Raman spectra, supported by numerical computations, revealed that the Fenton's reaction causes an oxidation of the nitrogenous bases in dATP, dGTP and dCTP solutions leading to the production of 2-hydroxyadenine, 8-hydroxyguanine and 5-hydroxycytosine. No thymine change was revealed in the dTTP solution under the same conditions. Compared to single nucleotide solutions, plasmid DNA oxidation has resulted in more radical damage that causes the breaking of the adenine and guanine aromatic rings. Our study demonstrates the advantage of using UV Raman spectroscopy for rapidly monitoring the oxidation changes in DNA aqueous solutions that can be assigned to specific nitrogenous bases.

Microneedle-mediated transcutaneous immunization with plasmid DNA coated on cationic PLGA nanoparticles

PubMed Central

Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A.; Li, Xinran; Zhu, Saijie; Cui, Zhengrong

2012-01-01

Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged anoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. PMID:22921518

Generation, Analysis and Functional Annotation of Expressed Sequence Tags from the Sheepshead Minnow (Cyprinodon variegatus)

DTIC Science & Technology

2010-01-01

any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it does not display a...CA) were cloned using the pGEM-T Easy Vector System (Promega, Madison, WI) and Electromax DH10B T1 Phage Resistant Cells (Invitrogen, Carlsbad, CA...reactions were performed using 75ng of plasmid DNA template and a M13 (-40) forward primer according to the manufac- turer’s protocol for DNA sequencing of

Quantification Bias Caused by Plasmid DNA Conformation in Quantitative Real-Time PCR Assay

PubMed Central

Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming

2011-01-01

Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification. PMID:22194997

Large-scale preparation of plasmid DNA.

PubMed

Heilig, J S; Elbing, K L; Brent, R

2001-05-01

Although the need for large quantities of plasmid DNA has diminished as techniques for manipulating small quantities of DNA have improved, occasionally large amounts of high-quality plasmid DNA are desired. This unit describes the preparation of milligram quantities of highly purified plasmid DNA. The first part of the unit describes three methods for preparing crude lysates enriched in plasmid DNA from bacterial cells grown in liquid culture: alkaline lysis, boiling, and Triton lysis. The second part describes four methods for purifying plasmid DNA in such lysates away from contaminating RNA and protein: CsCl/ethidium bromide density gradient centrifugation, polyethylene glycol (PEG) precipitation, anion-exchange chromatography, and size-exclusion chromatography.

Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells.

PubMed Central

Reeves, R; Gorman, C M; Howard, B

1985-01-01

The nucleoprotein structures formed on various plasmid expression vectors transfected into mammalian cells by both the calcium phosphate and DEAE-dextran methods have been studied. We demonstrate by a variety of means that mammalian cells are capable of rapidly assembling non-integrated circular plasmids (both replicating and non-replicating) into typical "minichromosomes" containing nucleosomes with a 190 bp repetitive spacing. Treatment of recipient cells with sodium butyrate for a short period of time (12-16 h) immediately following transfection markedly increased the DNase I digestion sensitivity of the newly assembled plasmid chromatin. Furthermore, minichromosomes isolated from such butyrate-treated cells are depleted in histone H1 and contain highly acetylated forms of histone H4. These findings are entirely consistent with our earlier speculation (Gorman et al., Nucleic Acids Res. 11, 1044; 1983) that appropriate butyrate treatment might stimulate transient expression of newly transfected genes by facilitating their assembly into an "active" type of chromatin structure. Images PMID:3859838

Increased B and T Cell Responses in M. bovis Bacille Calmette-Guérin Vaccinated Pigs Co-Immunized with Plasmid DNA Encoding a Prototype Tuberculosis Antigen

PubMed Central

Bruffaerts, Nicolas; Pedersen, Lasse E.; Vandermeulen, Gaëlle; Préat, Véronique; Stockhofe-Zurwieden, Norbert; Huygen, Kris; Romano, Marta

2015-01-01

The only tuberculosis vaccine currently available, bacille Calmette-Guérin (BCG) is a poor inducer of CD8+ T cells, which are particularly important for the control of latent tuberculosis and protection against reactivation. As the induction of strong CD8+ T cell responses is a hallmark of DNA vaccines, a combination of BCG with plasmid DNA encoding a prototype TB antigen (Ag85A) was tested. As an alternative animal model, pigs were primed with BCG mixed with empty vector or codon-optimized pAg85A by the intradermal route and boosted with plasmid delivered by intramuscular electroporation. Control pigs received unformulated BCG. The BCG-pAg85A combination stimulated robust and sustained Ag85A specific antibody, lymphoproliferative, IL-6, IL-10 and IFN-γ responses. IgG1/IgG2 antibody isotype ratio reflected the Th1 helper type biased response. T lymphocyte responses against purified protein derivative of tuberculin (PPD) were induced in all (BCG) vaccinated animals, but responses were much stronger in BCG-pAg85A vaccinated pigs. Finally, Ag85A-specific IFN-γ producing CD8+ T cells were detected by intracellular cytokine staining and a synthetic peptide, spanning Ag85A131-150 and encompassing two regions with strong predicted SLA-1*0401/SLA-1*0801 binding affinity, was promiscuously recognized by 6/6 animals vaccinated with the BCG-pAg85A combination. Our study provides a proof of concept in a large mammalian species, for a new Th1 and CD8+ targeting tuberculosis vaccine, based on BCG-plasmid DNA co-administration. PMID:26172261

Retroviral mutation rates and A-to-G hypermutations during different stages of retroviral replication.

PubMed Central

Kim, T; Mudry, R A; Rexrode, C A; Pathak, V K

1996-01-01

Retroviruses mutate at a high rate in vivo during viral replication. Mutations may occur during proviral transcription by RNA polymerase II, during minus-strand DNA synthesis (RNA template) by viral reverse transcriptase, or during plus-strand DNA synthesis (DNA template) by reverse transcriptase. To determine the contributions of different stages of replication to the retroviral mutation rates, we developed a spleen necrosis virus-based in vivo system to selectively identify mutations occurring during the early stage (RNA transcription plus minus-strand synthesis) and the late stage (plus-strand synthesis plus DNA repair). A lacZalpha reporter gene was inserted into the long terminal repeat (LTR) of a spleen necrosis virus shuttle vector, and proviruses were recovered from infected cells as plasmids containing either one or both LTRs. Plasmids containing both LTRs generated a mutant phenotype only if the lacZalpha genes in both LTRs were mutated, which is most likely to occur during the early stage. Mutant phenotypes were identified from plasmids containing one LTR regardless of the stage at which the mutations occurred. Thus, mutant frequencies obtained after recovery of plasmids containing both LTRs or one LTR provided early-stage and total mutation rates, respectively. Analysis of 56,409 proviruses suggested that the retroviral mutation rates during the early and late stages of replication were equal or within twofold of each other. In addition, two mutants with A-to-G hypermutations were discovered, suggesting a role for mammalian double-stranded RNA adenosine deaminase enzyme in retroviral mutations. These experiments provide a system to selectively identify mutations in the early stage of retroviral replication and to provide upper and lower limits to the in vivo mutation rates during minus-strand and plus-strand synthesis, respectively. PMID:8892879

Solid-phase-assisted synthesis of targeting peptide-PEG-oligo(ethane amino)amides for receptor-mediated gene delivery.

PubMed

Martin, Irene; Dohmen, Christian; Mas-Moruno, Carlos; Troiber, Christina; Kos, Petra; Schaffert, David; Lächelt, Ulrich; Teixidó, Meritxell; Günther, Michael; Kessler, Horst; Giralt, Ernest; Wagner, Ernst

2012-04-28

In the forthcoming era of cancer gene therapy, efforts will be devoted to the development of new efficient and non-toxic gene delivery vectors. In this regard, the use of Fmoc/Boc-protected oligo(ethane amino)acids as building blocks for solid-phase-supported assembly represents a novel promising approach towards fully controlled syntheses of effective gene vectors. Here we report on the synthesis of defined polymers containing the following: (i) a plasmid DNA (pDNA) binding domain of eight succinoyl-tetraethylenpentamine (Stp) units and two terminal cysteine residues; (ii) a central polyethylene glycol (PEG) chain (with twenty-four oxyethylene units) for shielding; and (iii) specific peptides for targeting towards cancer cells. Peptides B6 and c(RGDfK), which bind transferrin receptor and α(v)β(3) integrin, respectively, were chosen because of the high expression of these receptors in many tumoral cells. This study shows the feasibility of designing these kinds of fully controlled vectors and their success for targeted pDNA-based gene transfer. This journal is © The Royal Society of Chemistry 2012

Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

PubMed Central

Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2016-01-01

The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

Metatranscriptomics of Soil Eukaryotic Communities.

PubMed

Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2016-01-01

Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

Broad-spectrum anti-tumor and anti-metastatic DNA vaccine based on p62-encoding vector

PubMed Central

Sherman, Michael Y.; Gabai, Vladimir; Kiselev, Oleg; Komissarov, Andrey; Grudinin, Mikhail; Shartukova, Maria; Romanovskaya-Romanko, Ekaterina A.; Kudryavets, Yuri; Bezdenezhnykh, Natalya; Lykhova, Oleksandra; Semesyuk, Nadiia; Concetti, Antonio; Tsyb, Anatoly; Filimonova, Marina; Makarchuk, Victoria; Yakubovsky, Raisa; Chursov, Andrey; Shcherbinina, Vita; Shneider, Alexander

2013-01-01

Autophagy plays an important role in neoplastic transformation of cells and in resistance of cancer cells to radio- and chemotherapy. p62 (SQSTM1) is a key component of autophagic machinery which is also involved in signal transduction. Although recent empirical observations demonstrated that p62 is overexpressed in variety of human tumors, a mechanism of p62 overexpression is not known. Here we report that the transformation of normal human mammary epithelial cells with diverse oncogenes (RAS, PIK3CA and Her2) causes marked accumulation of p62. Based on this result, we hypothesized that p62 may be a feasible candidate to be an anti-cancer DNA vaccine. Here we performed a preclinical study of a novel DNA vaccine encoding p62. Intramuscularly administered p62-encoding plasmid induced anti-p62 antibodies and exhibited strong antitumor activity in four models of allogeneic mouse tumors – B16 melanoma, Lewis lung carcinoma (LLC), S37 sarcoma, and Ca755 breast carcinoma. In mice challenged with Ca755 cells, p62 treatment had dual effect: inhibited tumor growth in some mice and prolonged life in those mice which developed tumor size similar to control. P62-encoding plasmid has demonstrated its potency both as a preventive and therapeutic vaccine. Importantly, p62 vaccination drastically suppressed metastasis formation: in B16 melanoma where tumor cells where injected intravenously, and in LLC and S37 sarcoma with spontaneous metastasis. Overall, we conclude that a p62-encoding vector(s) constitute(s) a novel, effective broad-spectrum antitumor and anti-metastatic vaccine feasible for further development and clinical trials. PMID:24121124

Microneedle-mediated transcutaneous immunization with plasmid DNA coated on cationic PLGA nanoparticles.

PubMed

Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A; Li, Xinran; Zhu, Saijie; Cui, Zhengrong

2012-10-28

Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. Copyright © 2012 Elsevier B.V. All rights reserved.

Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

PubMed Central

Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza

2015-01-01

Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938

Asymmetry and Extent of In Vivo Transcripition of R-Plasmid Deoxyribonucleic Acid in Escherichia coli

PubMed Central

Vapnek, Daniel; Spingler, Elizabeth

1974-01-01

Deoxyribonucleic acid-ribonucleic acid (DNA-RNA) hybridization studies have been performed with R-plasmid DNA (R538-1drd) and in vivo-synthesized RNA. R-plasmid DNA was isolated from Escherichia coli K-12, and the complementary strands were separated in cesium chloride-polyuridylic acid-polyguanylic acid gradients. DNA-RNA hybridization was performed with the separated DNA strands and RNA purified from R-plasmid-carrying cells. The results demonstrated that an asymmetric transcription of the R-plasmid DNA occurs in vivo. Hybridization was only detected with the H strand (denser strand in cesium chloride-polyuridylic acid-polyguanylic acid). By determining the density of the RNA-DNA hybrid in CsCl gradients, it was estimated that greater than 60% of the nucleotide sequences in the R-plasmid DNA are transcribed in logarithmically growing E. coli cells. No R-plasmid-specific RNA was detected in E. coli cells that did not carry the plasmid. PMID:4612013

Design and characterization of plasmids encoding antigenic peptides of Aha1 from Aeromonas hydrophila as prospective fish vaccines.

PubMed

Rauta, Pradipta R; Nayak, Bismita; Monteiro, Gabriel A; Mateus, Marília

2017-01-10

The current investigation aimed at designing DNA vaccines against Aeromonas hydrophila infections. The DNA vaccine candidates were designed to express two antigenic outer membrane protein (Aha1) peptides and to be delivered by a nanoparticle-based delivery system. Gene sequences of conserved regions of antigenic Aha1 [aha1(211-381), aha1(211-381)opt, aha1(703-999) and aha1(703-999)opt] were cloned into pVAX-GFP expression vector. The selected DNA vaccine candidates were purified from E. coli DH5α and transfected into Chinese hamster ovary cells. The expression of the antigenic peptides was measured in cells along post-transfection time, through the fluorescence intensity of the reporter GFP. The lipofection efficiency of aha-pVAX-GFP was highest after 24h incubation. Formulated PLGA-chitosan nanoparticle/plasmid DNA complexes were characterized in terms of size, size distribution and zeta potential. Nanocomplexes with average diameters in the range of 150-170nm transfected in a similar fashion into CHO cells confirmed transfection efficiency comparable to that of lipofection. DNA entrapment and further DNase digestion assays demonstrated ability for pDNA protection by the nanoparticles against enzymatic digestion. Copyright © 2016 Elsevier B.V. All rights reserved.

[Overexpression of liver kinase B1 inhibits the proliferation of lung cancer cells].

PubMed

Li, Yang; Zhang, Libin; Wang, Ping

2017-01-01

Objective To explore the effect of overexpressed liver kinase B1(LKB1) on the proliferation of lung cancer cell lines. Methods The expression levels of LKB1 and PTEN in A549, NCI-H23, NCI-H157, XWLC-05, NCI-H446 lung cancer cells were detected by immunocytochemistry (ICC) and Western blotting. Plasmid pcDNA3.1 + -LKB1 and empty vector pcDNA3.1 + -null were separately transfected into the above five cell lines, and then the expression of LKB1 mRNA and protein were determined by quantitative real-time PCR and Western blotting, respectively. Finally, CCK-8 assay was used to analyze the proliferation ability of the transfected cells. Results LKB1 and PTEN were positive in NCI-H23 cells; LKB1 was negative while PTEN was positive in A549 and NCI-H446 cells; both LKB1 and PTEN were negative in NCI-H157 and XWLC-05 cells. Quantitative real-time PCR and Western blotting showed that the expression level of LKB1 significantly increased in the above cell lines transfected with plasmid pcDNA3.1 + -LKB1 compared with the ones with empty vector pcDNA3.1 + -null. Besides, CCK-8 assay showed that the overexpression of LKB1 in the lung cancer cells transfected with pcDNA3.1 + -LKB1 had an obvious inhibitory effect on cell proliferation. Conclusion The expression of LKB1 is down-regulated in most of the lung cell lines to different extent and the over-expression of LKB1 can remarkably inhibit the proliferation ability of lung cancer cell lines.

Immunogenicity and efficacy of a bivalent DNA vaccine containing LeIF and TSA genes against murine cutaneous leishmaniasis.

PubMed

Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

2017-03-01

There is no effective vaccine for the prevention and elimination of leishmaniasis. For this reason, we assessed the protective effects of DNA vaccines containing LeIF, TSA genes alone, or LeIF-TSA fusion against cutaneous leishmaniasis pEGFP-N1 plasmid (empty vector) and phosphate buffer saline (PBS) were used as control groups. Therefore, cellular and humoral immune responses were evaluated before and after the challenge with Leishmania major. Lesion diameter was also measured 3-12 weeks after challenge. All immunized mice with plasmid DNA encoding Leishmania antigens induced the partial immunity characterized by increased IFN-γ and IgG2a levels compared with control groups (p < 0.001). Furthermore, the immunized mice showed significant reduction in mean lesion sizes compared with mice in empty vector and PBS groups (p < 0.05). The reduction in lesion diameter was 29.3%, 34.1%, and 46.2% less in groups vaccinated with LeIF, TSA, and LeIF-TSA, respectively, than in PBS group at 12th week post infection. IFN/IL-4 and IgG2a/IgG1 ratios indicated that group receiving LeIF-TSA fusion had the highest IFN-γ and IgG2a levels. In this study, DNA immunization promoted Th1 immune response characterized by higher IFN-γ and IgG2a levels and also reduction in lesion size. These results showed that a bivalent vaccine containing two distinct antigens may induce more potent immune responses against leishmaniasis. © 2017 APMIS. Published by John Wiley & Sons Ltd.

Optimized Pan-species and Speciation Duplex Real-time PCR Assays for Plasmodium Parasites Detection in Malaria Vectors

PubMed Central

Sandeu, Maurice Marcel; Moussiliou, Azizath; Moiroux, Nicolas; Padonou, Gilles G.; Massougbodji, Achille; Corbel, Vincent; Tuikue Ndam, Nicaise

2012-01-01

Background An accurate method for detecting malaria parasites in the mosquito’s vector remains an essential component in the vector control. The Enzyme linked immunosorbent assay specific for circumsporozoite protein (ELISA-CSP) is the gold standard method for the detection of malaria parasites in the vector even if it presents some limitations. Here, we optimized multiplex real-time PCR assays to accurately detect minor populations in mixed infection with multiple Plasmodium species in the African malaria vectors Anopheles gambiae and Anopheles funestus. Methods Complementary TaqMan-based real-time PCR assays that detect Plasmodium species using specific primers and probes were first evaluated on artificial mixtures of different targets inserted in plasmid constructs. The assays were further validated in comparison with the ELISA-CSP on 200 field caught Anopheles gambiae and Anopheles funestus mosquitoes collected in two localities in southern Benin. Results The validation of the duplex real-time PCR assays on the plasmid mixtures demonstrated robust specificity and sensitivity for detecting distinct targets. Using a panel of mosquito specimen, the real-time PCR showed a relatively high sensitivity (88.6%) and specificity (98%), compared to ELISA-CSP as the referent standard. The agreement between both methods was “excellent” (κ = 0.8, P<0.05). The relative quantification of Plasmodium DNA between the two Anopheles species analyzed showed no significant difference (P = 0, 2). All infected mosquito samples contained Plasmodium falciparum DNA and mixed infections with P. malariae and/or P. ovale were observed in 18.6% and 13.6% of An. gambiae and An. funestus respectively. Plasmodium vivax was found in none of the mosquito samples analyzed. Conclusion This study presents an optimized method for detecting the four Plasmodium species in the African malaria vectors. The study highlights substantial discordance with traditional ELISA-CSP pointing out the utility of employing an accurate molecular diagnostic tool for detecting malaria parasites in field mosquito populations. PMID:23285168

Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

PubMed

Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

2003-08-01

Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its effective induction of apoptosis and tumor growth inhibition.

Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

PubMed

Kline, E L; Chiang, S J; Lattora, D; Chaung, W

1992-02-01

We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

[Cloning and sequence analysis of recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit and Actinobacillus actinomycetemcomitans fimbria associative protein].

PubMed

Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang

2005-02-01

To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.

Water-soluble N-[(2-hydroxy-3-trimethylammonium)propyl]chitosan chloride as a nucleic acids vector for cell transfection.

PubMed

Faizuloev, Evgeny; Marova, Anna; Nikonova, Alexandra; Volkova, Irina; Gorshkova, Marina; Izumrudov, Vladimir

2012-08-01

To endow the cationic polysaccharides with solubility in the whole pH-range without loss of functionality of the amino groups, different chitosan samples were treated with glycidyltrimethylammonium chloride. Each modified unit of the exhaustively alkylated quaternized chitosan (QCht) contained both quaternary and secondary amino groups. The intercalated dye displacement assay and ζ-potential measurements implied stability of QCht polyplexes at physiological conditions and protonation of the secondary amino groups in slightly acidic media which is favorable for transfection according to proton sponge mechanism. The cytotoxicity and transfection efficacy increased with the chain lengthening. Nevertheless, the longest chains of QCht, 250 kDa were less toxic than PEI for COS-1 cells and revealed comparable and even significantly higher transfection activity of siRNA and plasmid DNA, respectively. Thus, highly polymerized QCht (250 kDa) provided the highest level of the plasmid DNA transfection being 5 and 80 times more active than QCht (100 kDa) and QCht (50 kDa), respectively, and 4-fold more effective than PEI, 25 kDa. The established influence of QCht molecular weight on toxicity and transfection efficacy allows elaborating polysaccharide vectors that possess rational balance of these characteristics. Copyright © 2012 Elsevier Ltd. All rights reserved.

Role of the Adenovirus DNA-Binding Protein in In Vitro Adeno-Associated Virus DNA Replication

PubMed Central

Ward, Peter; Dean, Frank B.; O’Donnell, Michael E.; Berns, Kenneth I.

1998-01-01

A basic question in adeno-associated virus (AAV) biology has been whether adenovirus (Ad) infection provided any function which directly promoted replication of AAV DNA. Previously in vitro assays for AAV DNA replication, using linear duplex AAV DNA as the template, uninfected or Ad-infected HeLa cell extracts, and exogenous AAV Rep protein, demonstrated that Ad infection provides a direct helper effect for AAV DNA replication. It was shown that the nature of this helper effect was to increase the processivity of AAV DNA replication. Left unanswered was the question of whether this effect was the result of cellular factors whose activity was enhanced by Ad infection or was the result of direct participation of Ad proteins in AAV DNA replication. In this report, we show that in the in vitro assay, enhancement of processivity occurs with the addition of either the Ad DNA-binding protein (Ad-DBP) or the human single-stranded DNA-binding protein (replication protein A [RPA]). Clearly Ad-DBP is present after Ad infection but not before, whereas the cellular level of RPA is not apparently affected by Ad infection. However, we have not measured possible modifications of RPA which might occur after Ad infection and affect AAV DNA replication. When the substrate for replication was an AAV genome inserted into a plasmid vector, RPA was not an effective substitute for Ad-DBP. Extracts supplemented with Ad-DBP preferentially replicated AAV sequences rather than adjacent vector sequences; in contrast, extracts supplemented with RPA preferentially replicated vector sequences. PMID:9420241

Vector Development for the Expression of Foreign Proteins in the Vaccine Strain Brucella abortus S19

PubMed Central

Comerci, Diego J.; Pollevick, Guido D.; Vigliocco, Ana M.; Frasch, Alberto C. C.; Ugalde, Rodolfo A.

1998-01-01

A vector for the expression of foreign antigens in the vaccine strain Brucella abortus S19 was developed by using a DNA fragment containing the regulatory sequences and the signal peptide of the Brucella bcsp31 gene. This fragment was cloned in broad-host-range plasmid pBBR4MCS, resulting in plasmid pBEV. As a reporter protein, a repetitive antigen of Trypanosoma cruzi was used. The recombinant fusion protein is stably expressed and secreted into the Brucella periplasmic space, inducing a good antibody response against the T. cruzi antigen. The expression of the repetitive antigen in Brucella neither altered its growth pattern nor generated a toxic or lethal effect during experimental infection. The application of this strategy for the generation of live recombinant vaccines and the tagging of B. abortus S19 vaccine is discussed. This is the first time that a recombinant protein has been expressed in the periplasm of brucellae. PMID:9673273

Cationized pullulan 3D matrices as new materials for gene transfer.

PubMed

San Juan, Aurélie; Hlawaty, Hanna; Chaubet, Frédéric; Letourneur, Didier; Feldman, Laurent J

2007-08-01

This study deals with the development of a novel biocompatible cationized pullulan three-dimensional matrix for gene delivery. A water-soluble cationic polysaccharide, diethylaminoethyl-pullulan (DEAE-pullulan), was first synthesized and characterized. Fluorescence quenching and gel retardation assays evidenced the complexation in solution of DNA with DEAE-pullulan, but not with neutral pullulan. On cultured smooth muscle cells (SMCs) incubated with DEAE-pullulan and a plasmid vector expressing a secreted form of alkaline phosphatase (pSEAP), SEAP activity was 150-fold higher than with pSEAP alone or pSEAP with neutral pullulan. DEAE-pullulan was then chemically crosslinked using phosphorus oxychloride. The resulting matrices were obtained in less than a minute and molded as discs of 12 mm diameter and 2 mm thickness. Such DEAE-pullulan 3D matrices were loaded with up to 50 microg of plasmid DNA, with a homogeneous plasmid loading observed with YOYO-1 fluorescence staining. Moreover, the DEAE-pullulan matrix was shown to protect pSEAP from DNase I degradation. Incubation of cultured SMCs with pSEAP-loaded DEAE-pullulan matrices resulted in significant gene transfer without cell toxicity. This study suggests that these cationized pullulan 3D matrices could be useful biomaterials for local gene transfer.

Evaluation of protective effect of multiantigenic DNA vaccine encoding MIC3 and ROP18 antigen segments of Toxoplasma gondii in mice.

PubMed

Qu, Daofeng; Han, Jianzhong; Du, Aifang

2013-07-01

The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.

GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules

PubMed Central

Sarrion-Perdigones, Alejandro; Falconi, Erica Elvira; Zandalinas, Sara I.; Juárez, Paloma; Fernández-del-Carmen, Asun; Granell, Antonio; Orzaez, Diego

2011-01-01

Synthetic Biology requires efficient and versatile DNA assembly systems to facilitate the building of new genetic modules/pathways from basic DNA parts in a standardized way. Here we present GoldenBraid (GB), a standardized assembly system based on type IIS restriction enzymes that allows the indefinite growth of reusable gene modules made of standardized DNA pieces. The GB system consists of a set of four destination plasmids (pDGBs) designed to incorporate multipartite assemblies made of standard DNA parts and to combine them binarily to build increasingly complex multigene constructs. The relative position of type IIS restriction sites inside pDGB vectors introduces a double loop (“braid”) topology in the cloning strategy that allows the indefinite growth of composite parts through the succession of iterative assembling steps, while the overall simplicity of the system is maintained. We propose the use of GoldenBraid as an assembly standard for Plant Synthetic Biology. For this purpose we have GB-adapted a set of binary plasmids for A. tumefaciens-mediated plant transformation. Fast GB-engineering of several multigene T-DNAs, including two alternative modules made of five reusable devices each, and comprising a total of 19 basic parts are also described. PMID:21750718

GoldenBraid: an iterative cloning system for standardized assembly of reusable genetic modules.

PubMed

Sarrion-Perdigones, Alejandro; Falconi, Erica Elvira; Zandalinas, Sara I; Juárez, Paloma; Fernández-del-Carmen, Asun; Granell, Antonio; Orzaez, Diego

2011-01-01

Synthetic Biology requires efficient and versatile DNA assembly systems to facilitate the building of new genetic modules/pathways from basic DNA parts in a standardized way. Here we present GoldenBraid (GB), a standardized assembly system based on type IIS restriction enzymes that allows the indefinite growth of reusable gene modules made of standardized DNA pieces. The GB system consists of a set of four destination plasmids (pDGBs) designed to incorporate multipartite assemblies made of standard DNA parts and to combine them binarily to build increasingly complex multigene constructs. The relative position of type IIS restriction sites inside pDGB vectors introduces a double loop ("braid") topology in the cloning strategy that allows the indefinite growth of composite parts through the succession of iterative assembling steps, while the overall simplicity of the system is maintained. We propose the use of GoldenBraid as an assembly standard for Plant Synthetic Biology. For this purpose we have GB-adapted a set of binary plasmids for A. tumefaciens-mediated plant transformation. Fast GB-engineering of several multigene T-DNAs, including two alternative modules made of five reusable devices each, and comprising a total of 19 basic parts are also described.

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Enhanced Gene and siRNA Delivery by Polycation-Modified Mesoporous Silica Nanoparticles Loaded with Chloroquine

PubMed Central

Bhattarai, Shanta Raj; Muthuswamy, Elayaraja; Wani, Amit; Brichacek, Michal; Castañeda, Antonio L.; Brock, Stephanie L.

2014-01-01

Purpose To prepare mesoporous silica-based delivery systems capable of simultaneous delivery of drugs and nucleic acids. Methods The surface of mesoporous silica nanoparticles (MSN) was modified with poly(ethylene glycol) (PEG) and poly(2-(dimethylamino)ethylmethacrylate) (PDMAEMA) or poly (2-(diethylamino)ethylmethacrylate) (PDEAEMA). The particles were then loaded with a lysosomotropic agent chloroquine (CQ) and complexed with plasmid DNA or siRNA. The ability of the synthesized particles to deliver combinations of CQ and nucleic acids was evaluated using luciferase plasmid DNA and siRNA targeting luciferase and GAPDH. Results The results show a slow partial MSN dissolution to form hollow silica nanoparticles in aqueous solution. The biological studies show that polycation-modified MSN are able to simultaneously deliver CQ with DNA and siRNA. The co-delivery of CQ and the nucleic acids leads to a significantly increased transfection and silencing activity of the complexes compared with MSN not loaded with CQ. Conclusion PEGylated MSN modified with polycations are promising delivery vectors for combination drug/nucleic acid therapies. PMID:20730557

Bacteriophage-based vectors for site-specific insertion of DNA in the chromosome of Corynebacteria.

PubMed

Oram, Mark; Woolston, Joelle E; Jacobson, Andrew D; Holmes, Randall K; Oram, Diana M

2007-04-15

In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as beta. beta-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally encoded genes, is regulated by the DtxR protein in response to Fe(2+) levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the beta-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae DeltadtxR strain. Additionally, strains of beta-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for beta, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species.

[Construction of Plasmodium falciparum signal peptide peptidase-GFP mutant and its expression analysis in the malaria parasite].

PubMed

Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti

2014-08-01

To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

PubMed

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Y.; Dunn, J.; Gao, S.

2008-10-31

Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing asmore » little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.« less

Vaccines against Botulism.

PubMed

Sundeen, Grace; Barbieri, Joseph T

2017-09-02

Botulinum neurotoxins (BoNT) cause the flaccid paralysis of botulism by inhibiting the release of acetylcholine from motor neurons. There are seven serotypes of BoNT (A-G), with limited therapies, and no FDA approved vaccine for botulism. An investigational formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was used to vaccinate people who are at high risk of contracting botulism. However, this formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was losing potency and was discontinued. This article reviews the different vaccines being developed to replace the discontinued toxoid vaccine. These vaccines include DNA-based, viral vector-based, and recombinant protein-based vaccines. DNA-based vaccines include plasmids or viral vectors containing the gene encoding one of the BoNT heavy chain receptor binding domains (HC). Viral vectors reviewed are adenovirus, influenza virus, rabies virus, Semliki Forest virus, and Venezuelan Equine Encephalitis virus. Among the potential recombinant protein vaccines reviewed are HC, light chain-heavy chain translocation domain, and chemically or genetically inactivated holotoxin.

Vaccines against Botulism

PubMed Central

Sundeen, Grace; Barbieri, Joseph T.

2017-01-01

Botulinum neurotoxins (BoNT) cause the flaccid paralysis of botulism by inhibiting the release of acetylcholine from motor neurons. There are seven serotypes of BoNT (A-G), with limited therapies, and no FDA approved vaccine for botulism. An investigational formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was used to vaccinate people who are at high risk of contracting botulism. However, this formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was losing potency and was discontinued. This article reviews the different vaccines being developed to replace the discontinued toxoid vaccine. These vaccines include DNA-based, viral vector-based, and recombinant protein-based vaccines. DNA-based vaccines include plasmids or viral vectors containing the gene encoding one of the BoNT heavy chain receptor binding domains (HC). Viral vectors reviewed are adenovirus, influenza virus, rabies virus, Semliki Forest virus, and Venezuelan Equine Encephalitis virus. Among the potential recombinant protein vaccines reviewed are HC, light chain-heavy chain translocation domain, and chemically or genetically inactivated holotoxin. PMID:28869493

Efficient production of recombinant adeno-associated viral vector, serotype DJ/8, carrying the GFP gene.

PubMed

Hashimoto, Haruo; Mizushima, Tomoko; Chijiwa, Tsuyoshi; Nakamura, Masato; Suemizu, Hiroshi

2017-06-15

The purpose of this study was to establish an efficient method for the preparation of an adeno-associated viral (AAV), serotype DJ/8, carrying the GFP gene (AAV-DJ/8-GFP). We compared the yields of AAV-DJ/8 vector, which were produced by three different combination methods, consisting of two plasmid DNA transfection methods (lipofectamine and calcium phosphate co-precipitation; CaPi) and two virus DNA purification methods (iodixanol and cesium chloride; CsCl). The results showed that the highest yield of AAV-DJ/8-GFP vector was accomplished with the combination method of lipofectamine transfection and iodixanol purification. The viral protein expression levels and the transduction efficacy in HEK293 and CHO cells were not different among four different combination methods for AAV-DJ/8-GFP vectors. We confirmed that the AAV-DJ/8-GFP vector could transduce to human and murine hepatocyte-derived cell lines. These results show that AAV-DJ/8-GFP, purified by the combination of lipofectamine and iodixanol, produces an efficient yield without altering the characteristics of protein expression and AAV gene transduction. Copyright © 2017 Elsevier B.V. All rights reserved.

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

PEGylation enhances tumor targeting of plasmid DNA by an artificial cationized protein with repeated RGD sequences, Pronectin.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2004-05-31

The objective of this study is to investigate feasibility of a non-viral gene carrier with repeated RGD sequences (Pronectin F+) in tumor targeting for gene expression. The Pronectin F+ was cationized by introducing spermine (Sm) to the hydroxyl groups to allow to polyionically complex with plasmid DNA. The cationized Pronectin F+ prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have active ester and methoxy groups at the terminal, to form various PEG-introduced cationized Pronectin F+. The cationized Pronectin F+ with or without PEGylation at different extents was mixed with a plasmid DNA of LacZ to form respective cationized Pronectin F+-plasmid DNA complexes. The plasmid DNA was electrophoretically complexed with cationized Pronectin F+ and PEG-introduced cationized Pronectin F+, irrespective of the PEGylation extent, although the higher N/P ratio of complexes was needed for complexation with the latter Pronectin F+. The molecular size and zeta potential measurements revealed that the plasmid DNA was reduced in size to about 250 nm and the charge was changed to be positive by the complexation with cationized Pronectin F+. For the complexation with PEG-introduced cationized Pronectin F+, the charge of complex became neutral being almost 0 mV with the increasing PEGylation extents, while the molecular size was similar to that of cationized Pronectin F+. When cationized Pronectin F+-plasmid DNA complexes with or without PEGylation were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass, the PEG-introduced cationized Pronectin F+-plasmid DNA complex specifically enhanced the level of gene expression in the tumor, to a significantly high extent compared with the cationized Pronectin F+-plasmid DNA complexes and free plasmid DNA. The enhanced level of gene expression depended on the percentage of PEG introduced, the N/P ratio, and the plasmid DNA dose. A fluorescent microscopic study revealed that the localization of plasmid DNA in the tumor tissue was observed only for the PEG-introduced cationized Pronectin F+-plasmid DNA complex injected. We conclude that the PEGylation of cationized Pronectin F+ is a promising way to enable the plasmid DNA to target to the tumor for gene expression. Coyright 2004 Elsevier B.V.

Easy preparation of a large-size random gene mutagenesis library in Escherichia coli.

PubMed

You, Chun; Percival Zhang, Y-H

2012-09-01

A simple and fast protocol for the preparation of a large-size mutant library for directed evolution in Escherichia coli was developed based on the DNA multimers generated by prolonged overlap extension polymerase chain reaction (POE-PCR). This protocol comprised the following: (i) a linear DNA mutant library was generated by error-prone PCR or shuffling, and a linear vector backbone was prepared by regular PCR; (ii) the DNA multimers were generated based on these two DNA templates by POE-PCR; and (iii) the one restriction enzyme-digested DNA multimers were ligated to circular plasmids, followed by transformation to E. coli. Because the ligation efficiency of one DNA fragment was several orders of magnitude higher than that of two DNA fragments for typical mutant library construction, it was very easy to generate a mutant library with a size of more than 10(7) protein mutants per 50 μl of the POE-PCR product. Via this method, four new fluorescent protein mutants were obtained based on monomeric cherry fluorescent protein. This new protocol was simple and fast because it did not require labor-intensive optimizations in restriction enzyme digestion and ligation, did not involve special plasmid design, and enabled constructing a large-size mutant library for directed enzyme evolution within 1 day. Copyright © 2012 Elsevier Inc. All rights reserved.

Novel “Superspreader” Bacteriophages Promote Horizontal Gene Transfer by Transformation

PubMed Central

Bliskovsky, Valery V.; Malagon, Francisco; Baker, James D.; Prince, Jeffrey S.; Klaus, James S.; Adhya, Sankar L.

2017-01-01

ABSTRACT Bacteriophages infect an estimated 1023 to 1025 bacterial cells each second, many of which carry physiologically relevant plasmids (e.g., those encoding antibiotic resistance). However, even though phage-plasmid interactions occur on a massive scale and have potentially significant evolutionary, ecological, and biomedical implications, plasmid fate upon phage infection and lysis has not been investigated to date. Here we show that a subset of the natural lytic phage population, which we dub “superspreaders,” releases substantial amounts of intact, transformable plasmid DNA upon lysis, thereby promoting horizontal gene transfer by transformation. Two novel Escherichia coli phage superspreaders, SUSP1 and SUSP2, liberated four evolutionarily distinct plasmids with equal efficiency, including two close relatives of prominent antibiotic resistance vectors in natural environments. SUSP2 also mediated the extensive lateral transfer of antibiotic resistance in unbiased communities of soil bacteria from Maryland and Wyoming. Furthermore, the addition of SUSP2 to cocultures of kanamycin-resistant E. coli and kanamycin-sensitive Bacillus sp. bacteria resulted in roughly 1,000-fold more kanamycin-resistant Bacillus sp. bacteria than arose in phage-free controls. Unlike many other lytic phages, neither SUSP1 nor SUSP2 encodes homologs to known hydrolytic endonucleases, suggesting a simple potential mechanism underlying the superspreading phenotype. Consistent with this model, the deletion of endonuclease IV and the nucleoid-disrupting protein ndd from coliphage T4, a phage known to extensively degrade chromosomal DNA, significantly increased its ability to promote plasmid transformation. Taken together, our results suggest that phage superspreaders may play key roles in microbial evolution and ecology but should be avoided in phage therapy and other medical applications. PMID:28096488

One pyrimidine dimer inactivates expression of a transfected gene in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Protic-Sabljic, M.; Kraemer, K.H.

1985-10-01

The authors have developed a host cell reactivation assay of DNA repair utilizing UV-treated plasmid vectors. The assay primarily reflects cellular repair of transcriptional activity of damaged DNA measured indirectly as enzyme activity of the transfected genes. They studied three plasmids (pSV2cat, 5020 base pairs; pSV2catSVgpt, 7268 base pairs; and pRSVcat, 5027 base pairs) with different sizes and promoters carrying the bacterial cat gene (CAT, chloramphenicol acetyltransferase) in a construction that permits cat expression in human cells. All human simian virus 40-transformed cells studied expressed high levels of the transfected cat gene. UV treatment of the plasmids prior to transfectionmore » resulted in differential decrease in CAT activity in different cell lines. With pSV2catSVgpt, UV inactivation of CAT expression was greater in the xeroderma pigmentosum group A and D lines than in the other human cell lines tested. The D0 of the CAT inactivation curve was 50 J X m-2 for pSV2cat and for pRSVcat in the xeroderma pigmentosum group A cells. The similarity of the D0 data in the xeroderma pigmentosum group A cells for three plasmids of different size and promoters implies they all have similar UV-inactivation target size. UV-induced pyrimidine dimer formation in the plasmids was quantified by assay of the number of UV-induced T4 endonuclease V-sensitive sites. In the most sensitive xeroderma pigmentosum cells, with all three plasmids, one UV-induced pyrimidine dimer inactivates a target of about 2 kilobases, close to the size of the putative CAT mRNA.« less

Mobilome and genetic modification of bifidobacteria.

PubMed

Guglielmetti, S; Mayo, B; Álvarez-Martín, P

2013-06-01

Until recently, proper development of molecular studies in Bifidobacterium species has been hampered by growth difficulties, because of their exigent nutritive requirements, oxygen sensitivity and lack of efficient genetic tools. These studies, however, are critical to uncover the cross-talk between bifidobacteria and their hosts' cells and to prove unequivocally the supposed beneficial effects provided through the endogenous bifidobacterial populations or after ingestion as probiotics. The genome sequencing projects of different bifidobacterial strains have provided a wealth of genetic data that will be of much help in deciphering the molecular basis of the physiological properties of bifidobacteria. To this end, the purposeful development of stable cloning and expression vectors based on robust replicons - either from temperate phages or resident plasmids - is still needed. This review addresses the current knowledge on the mobile genetic elements of bifidobacteria (prophages, plasmids and transposons) and summarises the different types of vectors already available, together with the transformation procedures for introducing DNA into the cells. It also covers recent molecular studies performed with such vectors and incipient results on the genetic modification of these organisms, establishing the basis that would allow the use of bifidobacteria for future biotechnological applications.

System and method for introduction and stabilization of genes in Thermus sp.

DOEpatents

Kayser, Kevin J.; Park, Ho-Shin; Kilbane, II, John J.

2005-03-01

A method for introducing and stabilizing heterologous and recombinant genes in a thermophilic host in which a characteristic gene defining a detectable host characteristic is inactivated or deleted from the thermophilic host, resulting in a modified thermophilic host expressing an absence of the detectable host characteristic. A DNA fragment of interest is inserted into the modified thermophilic host together with an intact characteristic gene, whereby the detectable host characteristic is restored to the thermophilic host, thereby enabling detection and confirmation of successful transformation using plasmid vectors and integration of the DNA fragment into the chromosome of the thermophilic host.

Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.

PubMed

Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming

2014-12-01

In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

Cutaneous gene expression of plasmid DNA in excised human skin following delivery via microchannels created by radio frequency ablation.

PubMed

Birchall, James; Coulman, Sion; Anstey, Alexander; Gateley, Chris; Sweetland, Helen; Gershonowitz, Amikam; Neville, Lewis; Levin, Galit

2006-04-07

The skin is a valuable organ for the development and exploitation of gene medicines. Delivering genes to skin is restricted however by the physico-chemical properties of DNA and the stratum corneum (SC) barrier. In this study, we demonstrate the utility of an innovative technology that creates transient microconduits in human skin, allowing DNA delivery and resultant gene expression within the epidermis and dermis layers. The radio frequency (RF)-generated microchannels were of sufficient morphology and depth to permit the epidermal delivery of 100 nm diameter nanoparticles. Model fluorescent nanoparticles were used to confirm the capacity of the channels for augmenting diffusion of macromolecules through the SC. An ex vivo human organ culture model was used to establish the gene expression efficiency of a beta-galactosidase reporter plasmid DNA applied to ViaDerm treated skin. Skin treated with ViaDerm using 50 microm electrode arrays promoted intense levels of gene expression in the viable epidermis. The intensity and extent of gene expression was superior when ViaDerm was used following a prior surface application of the DNA formulation. In conclusion, the RF-microchannel generator (ViaDerm) creates microchannels amenable for delivery of nanoparticles and gene therapy vectors to the viable region of skin.

Evaluation of the immune response induced by DNA vaccines expressing MIF and MCD-1 genes of Trichinella spiralis in BALB/c mice.

PubMed

Tang, F; Xu, L; Yan, R; Song, X; Li, X

2012-12-01

Plasmids expressing macrophage migration inhibitory factor (MIF) of Trichinella spiralis (TsMIF), multi-cystatin-like domain protein (MCD-1) of T. spiralis (TsMCD-1), or co-expressing TsMIF and TsMCD-1 were constructed with a pVAX1 vector. Their ability to generate a protective immune response against T. spiralis infection was evaluated in BALB/c mice. Groups of mice were immunized twice at 2-week intervals with 100 μg of recombinant plasmids pVAX1-Tsmif, pVAX1-Tsmcd-1 or pVAX1-Tsmif-Tsmcd-1. Control animals were immunized with phosphate-buffered saline (PBS) or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17) and CD4+/CD8+ T cells were monitored. Challenge infection was performed 2 weeks following the second immunization and worm burden was assayed at 35 days post-challenge. Vaccination with pVAX1-Tsmif induced moderate serum IFN-γ and increases of CD4+ and CD8+ T cells, but no specific immunoglobulin antibody response. Vaccination with pVAX1-Tsmcd-1 induced a predominant Th1 antibody (IgG2a and IgG2b) response and strong levels of serum IFN-γ, and increases of CD4+ T cells. Importantly, co-expression of TsMIF and TsMCD-1 in DNA immunization produced more serum IFN-γ and markedly enhanced CD4+ and CD8+ T cells than the single DNA vaccine of the two genes. Challenge infection demonstrated that immunization with pVAX1-Tsmif-Tsmcd-1 reduced worm burdens (by 23.17%; P < 0.05).

The Web-Based DNA Vaccine Database DNAVaxDB and Its Usage for Rational DNA Vaccine Design.

PubMed

Racz, Rebecca; He, Yongqun

2016-01-01

A DNA vaccine is a vaccine that uses a mammalian expression vector to express one or more protein antigens and is administered in vivo to induce an adaptive immune response. Since the 1990s, a significant amount of research has been performed on DNA vaccines and the mechanisms behind them. To meet the needs of the DNA vaccine research community, we created DNAVaxDB ( http://www.violinet.org/dnavaxdb ), the first Web-based database and analysis resource of experimentally verified DNA vaccines. All the data in DNAVaxDB, which includes plasmids, antigens, vaccines, and sources, is manually curated and experimentally verified. This chapter goes over the detail of DNAVaxDB system and shows how the DNA vaccine database, combined with the Vaxign vaccine design tool, can be used for rational design of a DNA vaccine against a pathogen, such as Mycobacterium bovis.

Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

PubMed

Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

2015-11-25

DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.

Comparison of the Deoxyribonucleic Acid Molecular Weights and Homologies of Plasmids Conferring Linked Resistance to Streptomycin and Sulfonamides

PubMed Central

Barth, Peter T.; Grinter, Nigel J.

1974-01-01

Bacterial strains showing linked resistance to streptomycin (Sm) and sulfonamides (Su) were chosen representing a wide taxonomic and geographical range. Their SmSu resistances were transferred to Escherichia coli K-12 and then plasmid deoxyribonucleic acid (DNA) was isolated by ethidium bromide CsCl centrifugation. The plasmid DNA was examined by electron microscopy and analyzed by sedimentation through 5 to 20% neutral sucrose gradients. Plasmid DNA from strains having transmissible SmSu resistance consisted of two or three molecular species, one of which had a molecular mass of about 5.7 Mdal (106 daltons), the others varying between 20 to 60 Mdal. By using transformation or F′ mobilization, we isolated the SmSu-resistance determinant from any fellow resident plasmids in each strain and again isolated the plasmid DNA. Cosedimentation of each of these with a differently labeled reference plasmid DNA (R300B) showed 9 out of 12 of the plasmids to have a molecular mass not significantly different from the reference (5.7 Mdal); two others were 6.3 and 9.2 Mdal, but PB165 consisted of three plasmids of 7.4, 14.7, and 21.4 Mdal. Three separate isolations of the SmSu determinant from PB165 gave the same three plasmids, which we conclude may be monomer, dimer, and trimer, respectively. DNA-DNA hybridizations at 75 C demonstrated 80 to 93% homology between reference R300B DNA and each isolated SmSu plasmid DNA, except for the 9.2-Mdal plasmid which had 45% homology and PB165 which had 35%. All the SmSu plasmids were present as multiple copies (about 10) per chromosome. The conjugative plasmid of R300 (present as 1.3 copies per chromosome) has been shown to have negligible effect on the number of copies of its accompanying SmSu plasmid R300B. We conclude that the SmSu plasmids are closely related and probably have a common evolutionary origin. Images PMID:4616941

Hyperbranched PEGmethacrylate linear pDMAEMA block copolymer as an efficient non-viral gene delivery vector.

PubMed

Mathew, Asha; Cao, Hongliang; Collin, Estelle; Wang, Wenxin; Pandit, Abhay

2012-09-15

A unique hyperbranched polymeric system with a linear poly-2-dimethylaminoethyl methacrylate (pDMAEMA) block and a hyperbranched polyethylene glycol methyl ether methacrylate (PEGMEMA) and ethylene dimethacrylate (EGDMA) block was designed and synthesized via deactivation enhanced atom transfer radical polymerisation (DE-ATRP) for efficient gene delivery. Using this unique structure, with a linear pDMAEMA block, which efficiently binds to plasmid DNA (pDNA) and hyperbranched polyethylene glycol (PEG) based block as a protective shell, we were able to maintain high transfection levels without sacrificing cellular viability even at high doses. The transfection capability and cytotoxicity of the polymers over a range of pDNA concentration were analysed and the results were compared to commercially available transfection vectors such as polyethylene imine (branched PEI, 25 kDa), partially degraded poly(amido amine)dendrimer (dPAMAM; commercial name: SuperFect(®)) in fibroblasts and adipose tissue derived stem cells (ADSCs). Copyright © 2012 Elsevier B.V. All rights reserved.

Polyglycerol-functionalized nanodiamond as a platform for gene delivery: Derivatization, characterization, and hybridization with DNA

PubMed Central

Zhao, Li; Nakae, Yuki; Qin, Hongmei; Ito, Tadamasa; Kimura, Takahide; Kojima, Hideto; Chan, Lawrence

2014-01-01

Summary A gene vector consisting of nanodiamond, polyglycerol, and basic polypeptide (ND-PG-BPP) has been designed, synthesized, and characterized. The ND-PG-BPP was synthesized by PG functionalization of ND through ring-opening polymerization of glycidol on the ND surface, multistep organic transformations (–OH → –OTs (tosylate) → –N3) in the PG layer, and click conjugation of the basic polypeptides (Arg8, Lys8 or His8) terminated with propargyl glycine. The ND-PG-BPP exhibited good dispersibility in water (>1.0 mg/mL) and positive zeta potential ranging from +14.2 mV to +44.1 mV at neutral pH in Milli-Q water. It was confirmed by gel retardation assay that ND-PG-Arg8 and ND-PG-Lys8 with higher zeta potential hybridized with plasmid DNA (pDNA) through electrostatic attraction, making them promising as nonviral vectors for gene delivery. PMID:24778723

Gemini-Type Tetraphenylethylene Amphiphiles Containing [12]aneN3 and Long Hydrocarbon Chains as Nonviral Gene Vectors and Gene Delivery Monitors.

PubMed

Ding, Ai-Xiang; Tan, Zheng-Li; Shi, You-Di; Song, Lin; Gong, Bing; Lu, Zhong-Lin

2017-04-05

Four gemini amphiphiles decorated with triazole-[12]aneN 3 as the hydrophilic moiety and various long hydrocarbons as hydrophobic moieties, 1-4, were designed to form micelles possessing the aggregation-induced emission (AIE) property for gene delivery and tracing. All four amphiphiles give ultralow critical micelle concentrations, are pH-/photostable and biocompatible, and completely retard the migration of plasmid DNAs at low concentrations. The DNA-binding abilities of the micelles were fully assessed. The coaggregated nanoparticles of 1-4 with DNAs could convert back into AIE micelles. In vitro transfections indicated that lipids 1 and 2 and their originated liposomes bearing decent delivering abilities have great potentials as nonviral vectors. Finally, on the basis of the transfection and the transitions between condensates and micelles, lipid 2 was singled out as the first example for real-time tracing of the intracellular deliveries of nonlabeled DNA, which provides spatiotemporal messages about the processes of condensate uptake and DNA release.

Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

PubMed Central

Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

2018-01-01

Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

Characterization of two new plasmid DNAs found in mitochondria of wild-type Neurospora intermedia strains.

PubMed Central

Stohl, L L; Collins, R A; Cole, M D; Lambowitz, A M

1982-01-01

Mitochondria from two Neurospora intermedia strains (P4O5-Labelle and Fiji N6-6) were found to contain plasmid DNAs in addition to the standard mitochondrial DNA species. The plasmid DNAs consist of monomeric circles (4.1-4.3 kbp and 5.2-5.3 kbp for Labelle and Fiji, respectively) and oligomers in which monomers are organized as head-to-tail repeats. DNA-DNA hybridization experiments showed that the plasmids have no substantial sequence homology to mtDNA, to each other, or to a previously characterized mitochondrial plasmid from N. crassa strain Mauriceville-lc (Collins et al. Cell 24, 443-452, 1981). The intramitochondrial location of the plasmids was established by cell fractionation and nuclease protection experiments. In sexual crosses, the plasmids showed strict maternal inheritance, the same as Neurospora mitochondrial DNA. The plasmids may represent a novel class of mitochondrial genetic elements. Images PMID:6280144

[Cloning and gene expression in lactic acid bacteria].

PubMed

Bondarenko, V M; Beliavskaia, V A

2000-01-01

The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.

Polycation-induced Cell Membrane Permeability Does Not Enhance Cellular Uptake or Expression Efficiency of Delivered DNA

PubMed Central

Prevette, Lisa E.; Mullen, Douglas G.; Banaszak Holl, Mark M.

2010-01-01

Polycationic materials commonly used to delivery DNA to cells are known to induce cell membrane porosity in a charge-density dependent manner. It has been suggested that these pores may provide a mode of entry of the polymer-DNA complexes (polyplexes) into cells. To examine the correlation between membrane permeability and biological activity, we used two-color flow cytometry on two mammalian cell lines to simultaneously measure gene expression of a plasmid DNA delivered with four common nonviral vectors and cellular uptake of normally excluded fluorescent dye molecules of two different sizes, 668 Da and 2 MDa. We also followed gene expression in cells sorted based on the retention of endogenous fluorescein. We have found that cell membrane porosity caused by polycationic vectors does not enhance internalization or gene expression. Based on this single-cell study, membrane permeability is found to be an unwanted side effect that limits transfection efficiency, possibly through leakage of the delivered nucleic acid through the pores prior to transcription and translation and/or activation of cell defense mechanisms that restrict transgene expression. PMID:20349965

Chitosan-based DNA delivery vector targeted to gonadotropin-releasing hormone (GnRH) receptor.

PubMed

Boonthum, Chatwalee; Namdee, Katawut; Boonrungsiman, Suwimon; Chatdarong, Kaywalee; Saengkrit, Nattika; Sajomsang, Warayuth; Ponglowhapan, Suppawiwat; Yata, Teerapong

2017-02-10

The main purpose of this study was to investigate the application of modified chitosan as a potential vector for gene delivery to gonadotropin-releasing hormone receptor (GnRHR)-expressing cells. Such design of gene carrier could be useful in particular for gene therapy for cancers related to the reproductive system, gene disorders of sexual development, and contraception and fertility control. In this study, a decapeptide GnRH was successfully conjugated to chitosan (CS) as confirmed by proton nuclear magnetic resonance spectroscopy ( 1 H NMR) and Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR). The synthesized GnRH-conjugated chitosan (GnRH-CS) was able to condense DNA to form positively charged nanoparticles and specifically deliver plasmid DNA to targeted cells in both two-dimensional (2D) and three-dimensional (3D) cell cultures systems. Importantly, GnRH-CS exhibited higher transfection activity compared to unmodified CS. In conclusion, GnRH-conjugated chitosan can be a promising carrier for targeted DNA delivery to GnRHR-expressing cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lambda Red Mediated Gap Repair Utilizes a Novel Replicative Intermediate in Escherichia coli

PubMed Central

Reddy, Thimma R.; Fevat, Léna M. S.; Munson, Sarah E.; Stewart, A. Francis; Cowley, Shaun M.

2015-01-01

The lambda phage Red recombination system can mediate efficient homologous recombination in Escherichia coli, which is the basis of the DNA engineering technique termed recombineering. Red mediated insertion of DNA requires DNA replication, involves a single-stranded DNA intermediate and is more efficient on the lagging strand of the replication fork. Lagging strand recombination has also been postulated to explain the Red mediated repair of gapped plasmids by an Okazaki fragment gap filling model. Here, we demonstrate that gap repair involves a different strand independent mechanism. Gap repair assays examining the strand asymmetry of recombination did not show a lagging strand bias. Directly testing an ssDNA plasmid showed lagging strand recombination is possible but dsDNA plasmids did not employ this mechanism. Insertional recombination combined with gap repair also did not demonstrate preferential lagging strand bias, supporting a different gap repair mechanism. The predominant recombination route involved concerted insertion and subcloning though other routes also operated at lower frequencies. Simultaneous insertion of DNA resulted in modification of both strands and was unaffected by mutations to DNA polymerase I, responsible for Okazaki fragment maturation. The lower efficiency of an alternate Red mediated ends-in recombination pathway and the apparent lack of a Holliday junction intermediate suggested that gap repair does not involve a different Red recombination pathway. Our results may be explained by a novel replicative intermediate in gap repair that does not involve a replication fork. We exploited these observations by developing a new recombineering application based on concerted insertion and gap repair, termed SPI (subcloning plus insertion). SPI selected against empty vector background and selected for correct gap repair recombinants. We used SPI to simultaneously insert up to four different gene cassettes in a single recombineering reaction. Consequently, our findings have important implications for the understanding of E. coli replication and Red recombination. PMID:25803509

Plasmids of Carotenoid-Producing Paracoccus spp. (Alphaproteobacteria) - Structure, Diversity and Evolution

PubMed Central

Maj, Anna; Dziewit, Lukasz; Czarnecki, Jakub; Wlodarczyk, Miroslawa; Baj, Jadwiga; Skrzypczyk, Grazyna; Giersz, Dorota; Bartosik, Dariusz

2013-01-01

Plasmids are components of many bacterial genomes. They enable the spread of a large pool of genetic information via lateral gene transfer. Many bacterial strains contain mega-sized replicons and these are particularly common in Alphaproteobacteria. Considerably less is known about smaller alphaproteobacterial plasmids. We analyzed the genomes of 14 such plasmids residing in 4 multireplicon carotenoid-producing strains of the genus Paracoccus (Alphaproteobacteria): P. aestuarii DSM 19484, P. haeundaensis LG P-21903, P. marcusii DSM 11574 and P. marcusii OS22. Comparative analyses revealed mosaic structures of the plasmids and recombinational shuffling of diverse genetic modules involved in (i) plasmid replication, (ii) stabilization (including toxin-antitoxin systems of the relBE/parDE, tad-ata, higBA, mazEF and toxBA families) and (iii) mobilization for conjugal transfer (encoding relaxases of the MobQ, MobP or MobV families). A common feature of the majority of the plasmids is the presence of AT-rich sequence islets (located downstream of exc1-like genes) containing genes, whose homologs are conserved in the chromosomes of many bacteria (encoding e.g. RelA/SpoT, SMC-like proteins and a retron-type reverse transcriptase). The results of this study have provided insight into the diversity and plasticity of plasmids of Paracoccus spp., and of the entire Alphaproteobacteria. Some of the identified plasmids contain replication systems not described previously in this class of bacteria. The composition of the plasmid genomes revealed frequent transfer of chromosomal genes into plasmids, which significantly enriches the pool of mobile DNA that can participate in lateral transfer. Many strains of Paracoccus spp. have great biotechnological potential, and the plasmid vectors constructed in this study will facilitate genetic studies of these bacteria. PMID:24260361

Limiting an Insect Infestation of Nitrogen-Fixing Root Nodules of the Pigeon Pea (Cajanus cajan) by Engineering the Expression of an Entomocidal Gene in Its Root Nodules

PubMed Central

Nambiar, P. T. C.; Ma, S.-W.; Iyer, V. N.

1990-01-01

A region of DNA which determined the production of the insecticidal toxin of Bacillus thuringiensis subsp. israelensis was cloned into a derivative of a broad-host-range group IncQ plasmid vector of gram-negative bacteria. The plasmid which we constructed was transferred by conjugative mobilization into a Bradyrhizobium species that nodulates pigeon peas. In this species the construction was maintained stably in the absence of selection and expressed the gene that was installed. Experiments in a greenhouse with the strain which we constructed indicated that this organism provides protection against root nodule damage by the larvae of the insect Rivellia angulata (Diptera). Images PMID:16348294

A BAYESIAN METHOD FOR CALCULATING REAL-TIME QUANTITATIVE PCR CALIBRATION CURVES USING ABSOLUTE PLASMID DNA STANDARDS

EPA Science Inventory

In real-time quantitative PCR studies using absolute plasmid DNA standards, a calibration curve is developed to estimate an unknown DNA concentration. However, potential differences in the amplification performance of plasmid DNA compared to genomic DNA standards are often ignore...

Construction of a star-shaped copolymer as a vector for FGF receptor-mediated gene delivery in vitro and in vivo.

PubMed

Li, Da; Ping, Yuan; Xu, Fujian; Yu, Hai; Pan, Hongming; Huang, Hongliang; Wang, Qingqing; Tang, Guping; Li, Jun

2010-09-13

The success of cancer gene therapy highly relies on the gene delivery vector with high transfection activity and low toxicity. In the present study, eight-armed polyethylene glycol (EAP) and low molecular weight (LMW) polyethylenimine (PEI) were used as basic units to construct the architecture of a new star-shaped EAP-PEI copolymer (EAPP). MC11, a peptide capable of selectively binding fibroblast growth factor receptor (FGFR) on tumor cell membranes, was further conjugated to EAPP to produce the vector EAPP-MC11 (EAPPM) to enhance tumor targetability. This tumor-targeting vector EAPPM was observed to retard the plasmids mobility at a nitrogen/phosphorus (N/P) ratio of 3. The vector could efficiently condense plasmids within 300 nm nanoparticles with a positive zeta potential at the N/P ratio of 20 or above. While the cytotoxicity of EAPPM polyplexes was similar to that of LMW PEI, it was significantly lower than that of PEI (25 kDa) in HepG2 and PC3 cell lines. In vitro gene transfection with pDNA mediated by EAPPM showed that the transfection efficiency increased 15 times in HepG2 cells but remained at a similar level in PC3 cells in comparison with that of EAPP. By systemic injection of EAPPM/pDNA complexes into a HepG2-bearing mice model, luciferase expression detected in lung, liver, and tumor tissues demonstrated EAPPM could deliver in a targeted manner a reporter gene into tumor tissues, where the luciferase expression of EAPPM was 4 times higher than that of EAPP and even 23 times higher than that of PEI (25 kDa). Furthermore, it was found that the systemic delivery of EAPPM/pCSK-α-interferon complexes in vivo were much more effective in inhibiting tumor growth than EAPP or PEI (25 kDa). These results clearly show that EAPPM is an efficient and safe vector for FGFR-mediated targeted gene delivery both in vitro and in vivo. With low cytotoxicity and high targetability, EAPPM may have great potential as a delivery vector for future cancer gene therapy applications.

A simple Gateway-assisted construction system of TALEN genes for plant genome editing.

PubMed

Kusano, Hiroaki; Onodera, Hitomi; Kihira, Miho; Aoki, Hiromi; Matsuzaki, Hikaru; Shimada, Hiroaki

2016-07-25

TALEN is an artificial nuclease being applied for sequence-specific genome editing. For the plant genome editing, a pair of TALEN genes is expressed in the cells, and a binary plasmid for Agrobacterium-mediated transformation should be assembled. We developed a novel procedure using the Gateway-assisted plasmids, named Emerald-Gateway TALEN system. We constructed entry vectors, pPlat plasmids, for construction of a desired TALEN gene using Platinum Gate TALEN kit. We also created destination plasmid, pDual35SGw1301, which allowed two TALEN genes to both DNA strands to recruit using Gateway technology. Resultant TALEN genes were evaluated by the single-strand annealing (SSA) assay in E. coli cells. By this assay, the TALENs recognized the corresponding targets in the divided luciferase gene, and induced a specific recombination to generate an active luciferase gene. Using the TALEN genes constructed, we created a transformant potato cells in which a site-specific mutation occurred at the target site of the GBSS gene. This suggested that our system worked effectively and was applicable as a convenient tool for the plant genome editing.

Supercoiled plasmid DNA purification by integrating membrane technology with a monolithic chromatography.

PubMed

Nunes, Catherine; Sousa, Angela; Nunes, José C; Morão, António M; Sousa, Fani; Queiroz, João A

2014-06-01

The present study describes the integration of membrane technology with monolithic chromatography to obtain plasmid DNA with high quality. Isolation and clarification of plasmid DNA lysate were first conducted by a microfiltration step, by using a hydrophilic nylon microfiltration membrane, avoiding the need of centrifugation. For the total elimination of the remaining impurities, a suitable purification step is required. Monolithic stationary phases have been successfully applied as an alternative to conventional supports. Thus, the sample recovered from the membrane process was applied into a nongrafted CarbonylDiImidazole disk. Throughout the global procedure, a reduced level of impurities such as proteins and RNA was obtained, and no genomic DNA was detectable in the plasmid DNA sample. The chromatographic process demonstrated an efficient performance on supercoiled plasmid DNA purity and recovery (100 and 84.44%, respectively). Thereby, combining the membrane technology to eliminate some impurities from lysate sample with an efficient chromatographic strategy to purify the supercoiled plasmid DNA arises as a powerful approach for industrial-scale systems aiming at plasmid DNA purification. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].

PubMed

Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V

2010-01-01

The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.

Ultrasound-targeted hepatic delivery of factor IX in hemophiliac mice.

PubMed

Anderson, C D; Moisyadi, S; Avelar, A; Walton, C B; Shohet, R V

2016-06-01

Ultrasound-targeted microbubble destruction (UTMD) was used to direct the delivery of plasmid and transposase-based vectors encoding human factor IX (hFIX) to the livers of hemophilia B (FIX-/-) mice. The DNA vectors were incorporated into cationic lipid microbubbles, injected intravenously, and transfected into hepatocytes by acoustic cavitation of the bubbles as they transited the liver. Ultrasound parameters were identified that produced transfection of hepatocytes in vivo without substantial damage or bleeding in the livers of the FIX-deficient mice. These mice were treated with a conventional expression plasmid, or one containing a piggyBac transposon construct, and hFIX levels in the plasma and liver were evaluated at multiple time points after UTMD. We detected hFIX in the plasma by western blotting from mice treated with either plasmid during the 12 days after UTMD, and in the hepatocytes of treated livers by immunofluorescence. Reductions in clotting time and improvements in the percentage of FIX activity were observed for both plasmids, conventional (4.15±1.98%), and transposon based (2.70±.75%), 4 to 5 days after UTMD compared with untreated FIX (-/-) control mice (0.92±0.78%) (P=0.001 and P=0.012, respectively). Reduced clotting times persisted for both plasmids 12 days after treatment (reflecting percentage FIX activity of 3.12±1.56%, P=0.02 and 3.08±0.10%, P=0.001, respectively). Clotting times from an additional set of mice treated with pmGENIE3-hFIX were evaluated for long-term effects and demonstrated a persistent reduction in average clotting time 160 days after a single treatment. These data suggest that UTMD could be a minimally invasive, nonviral approach to enhance hepatic FIX expression in patients with hemophilia.

Biodegradable polymers as non-viral carriers for plasmid DNA delivery.

PubMed

Luten, Jordy; van Nostrum, Cornelus F; De Smedt, Stefaan C; Hennink, Wim E

2008-03-03

Gene therapy holds a great promise for the treatment of acquired and inherited diseases with a genetic origin that are currently incurable. Non-viral gene delivery systems are gaining recognition as an alternative to viral gene vectors for their potential in avoiding immunogenicity and toxicity problems inherently associated with the use of viral systems. Many cationic polymers have been studied both in vitro and in vivo for gene delivery purposes. However, in recent years there has been a focus on biodegradable carrier systems. The potential advantage of biodegradable carriers as compared to their non-degradable counterparts is their reduced toxicity and the avoidance of accumulation of the polymer in the cells after repeated administration. Also, the degradation of the polymer can be used as a tool to release the plasmid DNA into the cytosol. In this article the recent results obtained with two classes of degradable gene delivery systems, namely those based on water-soluble cationic polymers and on micro- and nanoparticles will be summarized and discussed.

Water soluble cationic dextran derivatives containing poly(amidoamine) dendrons for efficient gene delivery.

PubMed

Mai, Kaijin; Zhang, Shanshan; Liang, Bing; Gao, Cong; Du, Wenjun; Zhang, Li-Ming

2015-06-05

To develop new dextran derivatives for efficient gene delivery, the conjugation of poly(amidoamine) dendrons onto biocompatible dextran was carried out by a Cu(I)-catalyzed azide-alkyne cycloaddition, as confirmed by FTIR and (1)H NMR analyses. For resultant dextran conjugates with various generations of poly(amidoamine) dendrons, their buffering capacity and in vitro cytotoxicity were evaluated by acid-base titration and MTT tests, respectively. In particular, their physicochemical characteristics for the complexation with plasmid DNA were investigated by the combined analyses from agarose gel electrophoresis, zeta potential, particle size, transmission electron microscopy and fluorescence emission spectra. Moreover, their complexes with plasmid DNA were studied with respect to their transfection efficiency in human embryonic kidney (HEK293) cell lines. In the case of a higher generation of poly(amidoamine) dendrons, such a dextran conjugate was found to have much lower cytotoxicity and better gene delivery capability when compared to branched polyethylenimine (bPEI, 25kDa), a commonly used gene vector. Copyright © 2015 Elsevier Ltd. All rights reserved.

Complexes containing cationic and anionic pH-sensitive liposomes: comparative study of factors influencing plasmid DNA gene delivery to tumors.

PubMed

Chen, Yan; Sun, Ji; Lu, Ying; Tao, Chun; Huang, Jingbin; Zhang, He; Yu, Yuan; Zou, Hao; Gao, Jing; Zhong, Yanqiang

2013-01-01

pH-sensitive liposomes represent an effective gene vector in cancer therapy. However, their use is greatly hampered by their relatively low transfection efficiency. To improve the transfection efficiency of pH-sensitive liposomes, we prepared complexes containing 3β-[N-(N',N'-dimethylaminoethane) carbamoyl] cholesterol (DC-Chol) and dioleoylphosphatidyl ethanolamine (DOPE) liposomes and pH-sensitive liposomes composed of cholesteryl hemisuccinate (CHEMS) and DOPE, and evaluated the influence of various factors on plasmid DNA (pDNA) transfection efficiency. All DC-Chol/DOPE liposome/pDNA and pH-sensitive liposome complexes showed similarly potent pH sensitivity. In the presence of serum-containing medium, two optimized complexes of DC-Chol/DOPE liposomes/pDNA and pH-sensitive PEGylated liposomes showed high transfection efficiency of 22.94% and 20.07%, respectively. Notably, DC-Chol/DOPE (2:3) liposomes/pH-sensitive PEGylated (1%) liposome complexes with a charge ratio of 1:1 (m/m [+/-]) showed enhanced accumulation in tumors in vivo. Our results show the influence of various factors on pDNA transfection efficiency in complexes of DC-Chol/DOPE liposomes and pH-sensitive PEGylated liposomes. Understanding of such mechanisms will lead to better design of complexes of DC-Chol/DOPE liposomes and pH-sensitive liposomes for gene therapy.

Complexes containing cationic and anionic pH-sensitive liposomes: comparative study of factors influencing plasmid DNA gene delivery to tumors

PubMed Central

Chen, Yan; Sun, Ji; Lu, Ying; Tao, Chun; Huang, Jingbin; Zhang, He; Yu, Yuan; Zou, Hao; Gao, Jing; Zhong, Yanqiang

2013-01-01

pH-sensitive liposomes represent an effective gene vector in cancer therapy. However, their use is greatly hampered by their relatively low transfection efficiency. To improve the transfection efficiency of pH-sensitive liposomes, we prepared complexes containing 3β-[N-(N′,N′-dimethylaminoethane) carbamoyl] cholesterol (DC-Chol) and dioleoylphosphatidyl ethanolamine (DOPE) liposomes and pH-sensitive liposomes composed of cholesteryl hemisuccinate (CHEMS) and DOPE, and evaluated the influence of various factors on plasmid DNA (pDNA) transfection efficiency. All DC-Chol/DOPE liposome/pDNA and pH-sensitive liposome complexes showed similarly potent pH sensitivity. In the presence of serum-containing medium, two optimized complexes of DC-Chol/DOPE liposomes/pDNA and pH-sensitive PEGylated liposomes showed high transfection efficiency of 22.94% and 20.07%, respectively. Notably, DC-Chol/DOPE (2:3) liposomes/pH-sensitive PEGylated (1%) liposome complexes with a charge ratio of 1:1 (m/m [+/−]) showed enhanced accumulation in tumors in vivo. Our results show the influence of various factors on pDNA transfection efficiency in complexes of DC-Chol/DOPE liposomes and pH-sensitive PEGylated liposomes. Understanding of such mechanisms will lead to better design of complexes of DC-Chol/DOPE liposomes and pH-sensitive liposomes for gene therapy. PMID:23637529

Strategies to optimize capsid protein expression and single-stranded DNA formation of adeno-associated virus in Saccharomyces cerevisiae.

PubMed

Galli, A; Della Latta, V; Bologna, C; Pucciarelli, D; Cipriani, F; Backovic, A; Cervelli, T

2017-08-01

Adeno-associated virus type 2 (AAV) is a nonpathogenic parvovirus that is a promising tool for gene therapy. We aimed to construct plasmids for optimal expression and assembly of capsid proteins and evaluate adenovirus (Ad) protein effect on AAV single-stranded DNA (ssDNA) formation in Saccharomyces cerevisiae. Yeast expression plasmids have been developed in which the transcription of AAV capsid proteins (VP1,2,3) is driven by the constitutive ADH1 promoter or galactose-inducible promoters. Optimal VP1,2,3 expression was obtained from GAL1/10 bidirectional promoter. Moreover, we demonstrated that AAP is expressed in yeast and virus-like particles (VLPs) assembled inside the cell. Finally, the expression of two Ad proteins, E4orf6 and E1b55k, had no effect on AAV ssDNA formation. This study confirms that yeast is able to form AAV VLPs; however, capsid assembly and ssDNA formation are less efficient in yeast than in human cells. Moreover, the expression of Ad proteins did not affect AAV ssDNA formation. New manufacturing strategies for AAV-based gene therapy vectors (rAAV) are needed to reduce costs and time of production. Our study explores the feasibility of yeast as alternative system for rAAV production. © 2017 The Society for Applied Microbiology.

Plasmid vectors for Xylella fastidiosa utilizing a toxin-antitoxin system for plasmid stability in the absence of antibiotic selection

USDA-ARS?s Scientific Manuscript database

The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacte...

Increased proliferation of endothelial cells with overexpression of soluble TNF-alpha receptor I gene.

PubMed

Sugano, Masahiro; Tsuchida, Keiko; Tomita, Hideharu; Makino, Naoki

2002-05-01

Vascular endothelial growth factor (VEGF) can overcome a potential anti-angiogenic effect of TNF-alpha by inhibiting endothelial apoptosis induced by this cytokine. Soluble TNF-alpha receptor I (sTNFRI) is an extracellular domain of TNFRI and antagonizes the activity of TNF-alpha. Here we report that sTNFRI is able to stimulate the growth of endothelial cells not by antagonizing TNF-alpha. Exogenously added recombinant human sTNFRI stimulated significantly more cell growth of human umbilical venous endothelial cells (HUVEC) with a low dose (50-200 pg/ml) compared with smooth muscle cells. In contrast, monoclonal antibody against TNF-alpha did not stimulate growth of human HUVEC. The sTNFRI expression plasmid (pcDNA3.1 plasmid) was introduced into the cell culture using OPTI-MEM, lipofectin and transferrin. Growth of HUVEC transfected with sTNFRI vector also increased significantly compared with those transfected with control vector. HUVEC transfected with sTNFRI vector increased the extracellular domain of TNFRI mRNA levels, but did not affect the intracellular domain of TNFRI mRNA levels. Accumulation of sTNFRI significantly increased in conditioned medium from HUVEC transfected with sTNFRI vector compared with those transfected with control vector. HUVEC transfected with sTNFRI vector not only increased sTNFRI but also prevented shedding of sTNFRI from TNFRI. The TNF-alpha -induced internucleosomic fragmentation was also significantly prevented in HUVEC transfected with sTNFRI vector compared with those transfected with control vector. These results suggest that instead of growth factors such as VEGF, local transfection of the sTNFRI gene may have potential therapeutic value in vascular diseases in which TNF-alpha is also usually highly expressed.

[BLG gene knockout and hLF gene knock-in at BLG locus in goat by TALENs].

PubMed

Song, Shaozheng; Zhu, Mengmin; Yuan, Yuguo; Rong, Yao; Xu, Sheng; Chen, Si; Mei, Junyan; Cheng, Yong

2016-03-01

To knock out β-lactoglobulin (BLG) gene and insert human lactoferrin (hLF) coding sequence at BLG locus of goat, the transcription activator-like effector nucleases (TALEN) mediated recombination was used to edit the BLG gene of goat fetal fibroblast, then as donor cells for somatic cell nuclear transfer. We designed a pair of specific plasmid TALEN-3-L/R for goat BLG exon III recognition sites, and BLC14-TK vector containing a negative selection gene HSV-TK, was used for the knock in of hLF gene. TALENs plasmids were transfected into the goat fetal fibroblast cells, and the cells were screened three days by 2 μg/mL puromycin. DNA cleavage activities of cells were verified by PCR amplification and DNA production sequencing. Then, targeting vector BLC14-TK and plasmids TALEN-3-L/R were co-transfected into goat fetal fibroblasts, both 700 μg/mL G418 and 2 μg/mL GCV were simultaneously used to screen G418-resistant cells. Detections of integration and recombination were implemented to obtain cells with hLF gene site-specific integration. We chose targeting cells as donor cells for somatic cell nuclear transfer. The mutagenicity of TALEN-3-L/R was between 25% and 30%. A total of 335 reconstructed embryos with 6 BLG-/hLF+ targeting cell lines were transferred into 16 recipient goats. There were 9 pregnancies confirmed by ultrasound on day 30 to 35 (pregnancy rate of 39.1%), and one of 50-day-old fetus with BLG-/hLF+ was achieved. These results provide the basis for hLF gene knock-in at BLG locus of goat and cultivating transgenic goat of low allergens and rich hLF in the milk.

Folic acid conjugated mPEG-PEI600 as an efficient non-viral vector for targeted nucleic acid delivery.

PubMed

Xu, Zhenhua; Jin, Jiefu; Siu, Leo K S; Yao, Hong; Sze, Johnny; Sun, Hongzhe; Kung, Hsiang-Fu; Poon, Wai Sang; Ng, Samuel S M; Lin, Marie C

2012-04-15

In this study we describe a novel polymer, mPPS-FA, synthesized as a potential gene transfer vector. To complete mPPS-FA, folic acid was conjugated to a backbone (named mPPS) consisting of a copolymer of methyl PEG-2000, PEI-600, and sebacoyl chloride. (1)H NMR, FT-IR, and UV spectroscopy were used to characterize the structure of mPPS-FA. It was revealed that mPPS-FA holds the ability to bind plasmid DNA yielding positively charged particles (polyplexes). Dynamic light scattering (DLS) and TEM techniques were used to study the size and morphology of the formed mPPS-FA/DNA nanocomplexes. The mPPS-FA/DNA nanoparticles exhibited low cytotoxicity as transfection of B16-F0, U87MG, CHO-1, and Ho-8910 cells produced >80% viability indicating low cytotoxicity of the polymer. The ability of mPPS-FA to deliver EGFP plasmid to melanoma B16-F0, U87, CHO-1, Ho-8910, and A549 cells was investigated in vitro as compared to the lipid-based transfection agent Lipofectamine2000 and Linear PEI 22 kDa (L-PEI 22 kDa). We found that mPPS-FA/DNA complexes yielded the highest GFP transfection efficiency in B16-F0, U87, CHO-1, and Ho-8910 cells, which all highly express folate receptors (FR), at an mPPS-FA/DNA ratio (w/w) of 15. Furthermore, the transfection of mPPS-FA/DNA complexes in CHO-1 cells could be competitively blocked by free folic acid molecules. In contrast, in low FR expressing A549 cells, mPPS-FA showed similar low transfection efficiency as mPPS. Taken together, mPPS-FA showed the highest efficiency in vitro and the potential to be developed as a nonviral gene carrier. Copyright © 2012 Elsevier B.V. All rights reserved.

Construction of Biologically Functional Bacterial Plasmids In Vitro

PubMed Central

Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

1973-01-01

The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

Identification of an amino acid residue on influenza C virus M1 protein responsible for formation of the cord-like structures of the virus.

PubMed

Muraki, Yasushi; Washioka, Hiroshi; Sugawara, Kanetsu; Matsuzaki, Yoko; Takashita, Emi; Hongo, Seiji

2004-07-01

Influenza C virus-like particles (VLPs) have been generated from cloned cDNAs. A cDNA of the green fluorescent protein (GFP) gene in antisense orientation was flanked by the 5' and 3' non-coding regions of RNA segment 5 of the influenza C virus. The cDNA cassette was inserted between an RNA polymerase I promoter and terminator of the Pol I vector. This plasmid DNA was transfected into 293T cells together with plasmids encoding virus proteins of C/Ann Arbor/1/50 or C/Yamagata/1/88. Transfer of the supernatants of the transfected 293T cells to HMV-II cells resulted in GFP expression in the HMV-II cells. The quantification of the GFP-positive HMV-II cells indicated the presence of approximately 10(6) VLPs (ml supernatant)(-1). Cords 50-300 microm in length were observed on transfected 293T cells, although the cords were not observed when the plasmid for M1 protein of C/Ann Arbor/1/50 was replaced with that of C/Taylor/1233/47. A series of transfection experiments with plasmids encoding M1 mutants of C/Ann Arbor/1/50 or C/Taylor/1233/47 showed that an amino acid at residue 24 of the M1 protein is responsible for cord formation. This finding provides direct evidence for a previous hypothesis that M1 protein is involved in the formation of cord-like structures protruding from the C/Yamagata/1/88-infected cells. Evidence was obtained by electron microscopy that transfected cells bearing cords produced filamentous VLPs, suggesting the potential role of the M1 protein in determining the filamentous/spherical morphology of influenza C virus.

An in silico DNA cloning experiment for the biochemistry laboratory.

PubMed

Elkins, Kelly M

2011-01-01

This laboratory exercise introduces students to concepts in recombinant DNA technology while accommodating a major semester project in protein purification, structure, and function in a biochemistry laboratory for junior- and senior-level undergraduate students. It is also suitable for forensic science courses focused in DNA biology and advanced high school biology classes. Students begin by examining a plasmid map with the goal of identifying which restriction enzymes may be used to clone a piece of foreign DNA containing a gene of interest into the vector. From the National Center for Biotechnology Initiative website, students are instructed to retrieve a protein sequence and use Expasy's Reverse Translate program to reverse translate the protein to cDNA. Students then use Integrated DNA Technologies' OligoAnalyzer to predict the complementary DNA strand and obtain DNA recognition sequences for the desired restriction enzymes from New England Biolabs' website. Students add the appropriate DNA restriction sequences to the double-stranded foreign DNA for cloning into the plasmid and infecting Escherichia coli cells. Students are introduced to computational biology tools, molecular biology terminology and the process of DNA cloning in this valuable single session, in silico experiment. This project develops students' understanding of the cloning process as a whole and contrasts with other laboratory and internship experiences in which the students may be involved in only a piece of the cloning process/techniques. Students interested in pursuing postgraduate study and research or employment in an academic biochemistry or molecular biology laboratory or industry will benefit most from this experience. Copyright © 2010 Wiley Periodicals, Inc.

Explanatory chapter: how plasmid preparation kits work.

PubMed

Koontz, Laura

2013-01-01

To isolate plasmid DNA from bacteria using a commercial plasmid miniprep kit (if interested, compare this protocol with Isolation of plasmid DNA from bacteria). Copyright © 2013 Elsevier Inc. All rights reserved.

Enhancing Malaria Vaccine Development by the Naval Medical Research Center

DTIC Science & Technology

2003-03-01

optimized in Milestone 1 of this Phase II project. Reduction in particle size of the biopolymeric carrier was sufficient for intramuscular administration of...glycolide) (PLGA) with incorporated DNA plasmid were developed for systemic administration of DNA plasmids for use as a malaria vaccine. Objectives in...with incorporated DNA plasmid were developed for systemic administration of DNA plasmids for use as a malaria vaccine. Objectives in Milestone 1

The influence of novel gemini surfactants containing cycloalkyl side-chains on the structural phases of DNA in solution.

PubMed

Pietralik, Zuzanna; Kumita, Janet R; Dobson, Christopher M; Kozak, Maciej

2015-07-01

Very important to gene therapy is the delivery system of the nucleic acids (called a vector), which will enhance the efficiency of the transport of new DNA into cells whilst protecting against damage. A promising alternative to the currently used viral vectors are the systems based on amphiphilic compounds - lipoplexes. Among them, gemini surfactants, which consist of two hydrophobic chains and two cationic heads connected by a linker - spacer group, appear to be promising candidates. The subject of this study involves two gemini surfactants, alkoxy derivatives of bis-imidazolium quaternary salts, differing in the length of their spacer groups and how they interact with two types of salmon sperm DNA (low and high molecular weight (MW)) or plasmid DNA (pDNA). The mixtures of gemini surfactants with nucleic acids of differing p/n ratios (positive-to-negative charge ratio) were characterised by small angle X-ray scattering (SAXS) of synchrotron radiation, dynamic light scattering (DLS), circular dichroism (CD) spectroscopy, atomic force microscopy (AFM), transmission electron microscopy (TEM) and gel electrophoresis techniques. This analysis allows for the selection of the most suitable and promising candidates for non-viral vectors in gene therapy, determination of the conditions needed to form stable complexes, identification of conformational changes in the DNA molecules upon interactions with gemini surfactants and in some cases, determination of the structures formed in these lipoplexes. Copyright © 2015 Elsevier B.V. All rights reserved.

Plasmid fermentation process for DNA immunization applications.

PubMed

Carnes, Aaron E; Williams, James A

2014-01-01

Plasmid DNA for immunization applications must be of the highest purity and quality. The ability of downstream purification to efficiently produce a pure final product is directly influenced by the performance of the upstream fermentation process. While several clinical manufacturing facilities already have validated fermentation processes in place to manufacture plasmid DNA for use in humans, a simple and inexpensive laboratory-scale fermentation process can be valuable for in-house production of plasmid DNA for use in animal efficacy studies. This chapter describes a simple fed-batch fermentation process for producing bacterial cell paste enriched with high-quality plasmid DNA. A constant feeding strategy results in a medium cell density culture with continuously increasing plasmid amplification towards the end of the process. Cell banking and seed culture preparation protocols, which can dramatically influence final product yield and quality, are also described. These protocols are suitable for production of research-grade plasmid DNA at the 100 mg-to-1.5 g scale from a typical 10 L laboratory benchtop fermentor.

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

Comparison of Current Regulatory Status for Gene-Based Vaccines in the U.S., Europe and Japan

PubMed Central

Nakayama, Yoshikazu; Aruga, Atsushi

2015-01-01

Gene-based vaccines as typified by plasmid DNA vaccines and recombinant viral-vectored vaccines are expected as promising solutions against infectious diseases for which no effective prophylactic vaccines exist such as HIV, dengue virus, Ebola virus and malaria, and for which more improved vaccines are needed such as tuberculosis and influenza virus. Although many preclinical and clinical trials have been conducted to date, no DNA vaccines or recombinant viral-vectored vaccines expressing heterologous antigens for human use have yet been licensed in the U.S., Europe or Japan. In this research, we describe the current regulatory context for gene-based prophylactic vaccines against infectious disease in the U.S., Europe, and Japan. We identify the important considerations, in particular, on the preclinical assessments that would allow these vaccines to proceed to clinical trials, and the differences on the regulatory pathway for the marketing authorization in each region. PMID:26344953

PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids

PubMed Central

Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua

2011-01-01

The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

Bacteriophage-based Vectors for Site-specific Insertion of DNA in the Chromosome of Corynebacteria

PubMed Central

Oram, Mark; Woolston, Joelle E.; Jacobson, Andrew D.; Holmes, Randall K.; Oram, Diana M.

2007-01-01

In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as β. β-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally-encoded genes, is regulated by the DtxR protein in response to Fe2+ levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the β-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae ΔdtxR strain. Additionally, strains of β-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for β, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species. PMID:17275217

Role of the Neddylation Enzyme Uba3, A New Estrogen Receptor Corepressor in Breast Cancer

DTIC Science & Technology

2006-09-01

cells acquire ICI 182,780 resistance while retaining expres- sion of ER. MATERIALS AND METHODS Materials The following antibodies and reagents were used...protein assay kit; FBS and csFBS (Hy- Clone Laboratories, Inc., Logan, UT); LipofectAMINE Plus Reagent , geneticin, and other cell culture reagents were...plasmid DNA (adjusted by corresponding empty vectors) by using LipofectAMINE Plus Reagent according to the manufacturer’s guidelines. Five hours later

Lipoic acid functionalized amino acids cationic lipids as gene vectors.

PubMed

Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zheng, Li-Ting; Zhao, Zhi-Gang

2016-10-01

A series of reducible cationic lipids 4a-4f with different amino acid polar-head groups were prepared. The novel lipid contains a hydrophobic lipoic acid (LA) moiety, which can be reduced under reductive conditions to release of the encapsulated plasmid DNA. The particle size, zeta potential and cellular uptake of lipoplexes formed with DNA, as well as the transfection efficacy (TE) were characterized. The TE of the cationic lipid based on arginine was especially high, and was 2.5times higher than that of a branched polyethylenimine in the presence of 10% serum. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vaccination of Mice Using the West Nile Virus E-Protein in a DNA Prime-Protein Boost Strategy Stimulates Cell-Mediated Immunity and Protects Mice against a Lethal Challenge

PubMed Central

De Filette, Marina; Soehle, Silke; Ulbert, Sebastian; Richner, Justin; Diamond, Michael S.; Sinigaglia, Alessandro; Barzon, Luisa; Roels, Stefan; Lisziewicz, Julianna; Lorincz, Orsolya; Sanders, Niek N.

2014-01-01

West Nile virus (WNV) is a mosquito-borne flavivirus that is endemic in Africa, the Middle East, Europe and the United States. There is currently no antiviral treatment or human vaccine available to treat or prevent WNV infection. DNA plasmid-based vaccines represent a new approach for controlling infectious diseases. In rodents, DNA vaccines have been shown to induce B cell and cytotoxic T cell responses and protect against a wide range of infections. In this study, we formulated a plasmid DNA vector expressing the ectodomain of the E-protein of WNV into nanoparticles by using linear polyethyleneimine (lPEI) covalently bound to mannose and examined the potential of this vaccine to protect against lethal WNV infection in mice. Mice were immunized twice (prime – boost regime) with the WNV DNA vaccine formulated with lPEI-mannose using different administration routes (intramuscular, intradermal and topical). In parallel a heterologous boost with purified recombinant WNV envelope (E) protein was evaluated. While no significant E-protein specific humoral response was generated after DNA immunization, protein boosting of DNA-primed mice resulted in a marked increase in total neutralizing antibody titer. In addition, E-specific IL-4 T-cell immune responses were detected by ELISPOT after protein boost and CD8+ specific IFN-γ expression was observed by flow cytometry. Challenge experiments using the heterologous immunization regime revealed protective immunity to homologous and virulent WNV infection. PMID:24503579

Cholera toxin B-subunit gene enhances mucosal immunoglobulin A, Th1-type, and CD8+ cytotoxic responses when coadministered intradermally with a DNA vaccine.

PubMed

Sanchez, Alba E; Aquino, Guillermo; Ostoa-Saloma, Pedro; Laclette, Juan P; Rocha-Zavaleta, Leticia

2004-07-01

A plasmid vector encoding the cholera toxin B subunit (pCtB) was evaluated as an intradermal genetic adjuvant for a model DNA vaccine expressing the human papillomavirus type 16 L1 capsid gene (p16L1) in mice. p16L1 was coadministered with plasmid pCtB or commercial polypeptide CtB as a positive control. Coadministration of pCtB induced a significant increment of specific anti-L1 immunoglobulin A (IgA) antibodies in cervical secretions (P < 0.05) and fecal extracts (P < 0.005). Additionally, coadministration of pCtB enhanced the production of interleukin-2 and gamma interferon by spleen cells but did not affect the production of interleukin-4, suggesting a Th1-type helper response. Furthermore, improved CD8+ T-cell-mediated cytotoxic activity was observed in mice vaccinated with the DNA vaccine with pCtB as an adjuvant. This adjuvant effect was comparable to that induced by the CtB polypeptide. These results indicate that intradermal coadministration of pCtB is an adequate means to enhance the mucosa-, Th1-, and CD8(+)-mediated cytotoxic responses induced by a DNA vaccine.

Synthesis of O-serogroup specific positive controls and real-time PCR standards for nine clinically relevant non-O157 STECs.

PubMed

Conrad, Cheyenne C; Gilroyed, Brandon H; McAllister, Tim A; Reuter, Tim

2012-10-01

Non-O157 Shiga toxin producing Escherichia coli (STEC) are gaining recognition as human pathogens, but no standardized method exists to identify them. Sequence analysis revealed that STEC can be classified on the base of variable O antigen regions into different O serotypes. Polymerase chain reaction is a powerful technique for thorough screening and complex diagnosis for these pathogens, but requires a positive control to verify qualitative and/or quantitative DNA-fragment amplification. Due to the pathogenic nature of STEC, controls are not readily available and cell culturing of STEC reference strains requires biosafety conditions of level 2 or higher. In order to bypass this limitation, controls of stacked O-type specific DNA-fragments coding for primer recognition sites were designed to screen for nine STEC serotypes frequently associated with human infection. The synthetic controls were amplified by PCR, cloned into a plasmid vector and transferred into bacteria host cells. Plasmids amplified by bacterial expression were purified, serially diluted and tested as standards for real-time PCR using SYBR Green and TaqMan assays. Utility of synthetic DNA controls was demonstrated in conventional and real-time PCR assays and validated with DNA from natural STEC strains. Copyright © 2012 Elsevier B.V. All rights reserved.

pHg/pSILBAγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihpRNA – triggering in the mycorrhizal fungus Laccaria bicolor

PubMed Central

Kemppainen, Minna J.; Pardo, Alejandro G.

2010-01-01

Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319

Biodegradable brain-penetrating DNA nanocomplexes and their use to treat malignant brain tumors

PubMed Central

Mastorakos, Panagiotis; Zhang, Clark; Song, Eric; Kim, Young Eun; Park, Hee Won; Berry, Sneha; Choi, Won Kyu; Hanes, Justin; Suk, Jung Soo

2018-01-01

The discovery of powerful genetic targets has spurred clinical development of gene therapy approaches to treat patients with malignant brain tumors. However, lack of success in the clinic has been attributed to the inability of conventional gene vectors to achieve gene transfer throughout highly disseminated primary brain tumors. Here, we demonstrate ex vivo that small nanocomplexes composed of DNA condensed by a blend of biodegradable polymer, poly(β-amino ester) (PBAE), with PBAE conjugated with 5 kDa polyethylene glycol (PEG) molecules (PBAE-PEG) rapidly penetrate healthy brain parenchyma and orthotopic brain tumor tissues in rats. Rapid diffusion of these DNA-loaded nanocomplexes observed in fresh tissues ex vivo demonstrated that they avoided adhesive trapping in the brain owing to their dense PEG coating, which was critical to achieving widespread transgene expression throughout orthotopic rat brain tumors in vivo following administration by convection enhanced delivery. Transgene expression with the PBAE/PBAE-PEG blended nanocomplexes (DNA-loaded brain-penetrating nanocomplexes, or DNA-BPN) was uniform throughout the tumor core compared to nanocomplexes composed of DNA with PBAE only (DNA-loaded conventional nanocomplexes, or DNA-CN), and transgene expression reached beyond the tumor edge, where infiltrative cancer cells are found, only for the DNA-BPN formulation. Finally, DNA-BPN loaded with anti-cancer plasmid DNA provided significantly enhanced survival compared to the same plasmid DNA loaded in DNA-CN in two aggressive orthotopic brain tumor models in rats. These findings underscore the importance of achieving widespread delivery of therapeutic nucleic acids within brain tumors and provide a promising new delivery platform for localized gene therapy in the brain. PMID:28694032

Evaluation of the effect of non-B DNA structures on plasmid integrity via accelerated stability studies.

PubMed

Ribeiro, S C; Monteiro, G A; Prazeres, D M F

2009-04-01

Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

Nonradioactive Screening Method for Isolation of Disease-Specific Probes To Diagnose Plant Diseases Caused by Mycoplasmalike Organisms

PubMed Central

Lee, Ing-Ming; Davis, Robert E.; DeWitt, Natalie D.

1990-01-01

DNA fragments of tomato big bud (BB) mycoplasmalike organism (MLO) in diseased periwinkle plants (Catharanthus roseus L.) were cloned to pSP6 plasmid vectors and amplified in Escherichia coli JM83. A nonradioactive method was developed and used to screen for MLO-specific recombinants. Cloned DNA probes were prepared by nick translation of the MLO recombinant plasmids by using biotinylated nucleotides. The probes all hybridized with nucleic acid from BB MLO-infected, but not healthy, plants. Results from dot hybridization analyses indicated that several MLOs, e.g., those of Italian tomato big bud, periwinkle little leaf, and clover phyllody, are closely related to BB MLO. The Maryland strain of aster yellows and maize bushy stunt MLOs are also related to BB MLO. Among the remaining MLOs used in this study, Vinca virescence and elm yellows MLOs may be very distantly related, if at all, to BB MLO. Potato witches' broom, clover proliferation, ash yellows, western X, and Canada X MLOs are distantly related to BB MLO. Southern hybridization analyses revealed that BB MLO contains extrachromosomal DNA that shares sequence homologies with extrachromosomal DNAs from aster yellows and periwinkle little leaf MLOs. Images PMID:16348195

Single inverted terminal repeats of the Junonia coenia Densovirus promotes somatic chromosomal integration of vector plasmids in insect cells and supports high efficiency expression

USDA-ARS?s Scientific Manuscript database

Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

Induction of homologous recombination in Saccharomyces cerevisiae.

PubMed

Simon, J R; Moore, P D

1988-09-01

We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.

Long-term and stable correction of uremic anemia by intramuscular injection of plasmids containing hypoxia-regulated system of erythropoietin expression

PubMed Central

Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang

2012-01-01

Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115

The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

PubMed Central

Craig, R K; Hall, L; Parker, D; Campbell, P N

1981-01-01

A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

Properties of internalization factors contributing to the uptake of extracellular DNA into tumor-initiating stem cells of mouse Krebs-2 cell line.

PubMed

Dolgova, Evgeniya V; Potter, Ekaterina A; Proskurina, Anastasiya S; Minkevich, Alexandra M; Chernych, Elena R; Ostanin, Alexandr A; Efremov, Yaroslav R; Bayborodin, Sergey I; Nikolin, Valeriy P; Popova, Nelly A; Kolchanov, Nikolay A; Bogachev, Sergey S

2016-05-25

Previously, we demonstrated that poorly differentiated cells of various origins, including tumor-initiating stem cells present in the ascites form of mouse cancer cell line Krebs-2, are capable of naturally internalizing both linear double-stranded DNA and circular plasmid DNA. The method of co-incubating Krebs-2 cells with extracellular plasmid DNA (pUC19) or TAMRA-5'-dUTP-labeled polymerase chain reaction (PCR) product was used. It was found that internalized plasmid DNA isolated from Krebs-2 can be transformed into competent Escherichia coli cells. Thus, the internalization processes taking place in the Krebs-2 cell subpopulation have been analyzed and compared, as assayed by E. coli colony formation assay (plasmid DNA) and cytofluorescence (TAMRA-DNA). We showed that extracellular DNA both in the form of plasmid DNA and a PCR product is internalized by the same subpopulation of Krebs-2 cells. We found that the saturation threshold for Krebs-2 ascites cells is 0.5 μg DNA/10(6) cells. Supercoiled plasmid DNA, human high-molecular weight DNA, and 500 bp PCR fragments are internalized into the Krebs-2 tumor-initiating stem cells via distinct, non-competing internalization pathways. Under our experimental conditions, each cell may harbor 340-2600 copies of intact plasmid material, or up to 3.097 ± 0.044×10(6) plasmid copies (intact or not), as detected by quantitative PCR. The internalization dynamics of extracellular DNA, copy number of the plasmids taken up by the cells, and competition between different types of double-stranded DNA upon internalization into tumor-initiating stem cells of mouse ascites Krebs-2 have been comprehensively analyzed. Investigation of the extracellular DNA internalization into tumor-initiating stem cells is an important part of understanding their properties and possible destruction mechanisms. For example, a TAMRA-labeled DNA probe may serve as an instrument to develop a target for the therapy of cancer, aiming at elimination of tumor stem cells, as well as developing a straightforward test system for the quantification of poorly differentiated cells, including tumor-initiating stem cells, in the bulk tumor sample (biopsy or surgery specimen).

Complete genetic analysis of plasmids carrying mcr-1 and other resistance genes in an Escherichia coli isolate of animal origin.

PubMed

Li, Ruichao; Xie, Miaomiao; Lv, Jingzhang; Wai-Chi Chan, Edward; Chen, Sheng

2017-03-01

To investigate the genetic features of three plasmids recovered from an MCR-1 and ESBL-producing Escherichia coli strain, HYEC7, and characterize the transmission mechanism of mcr-1 . The genetic profiles of three plasmids were determined by PCR, S1-PFGE, Southern hybridization and WGS analysis. The ability of the mcr-1 -bearing plasmid to undergo conjugation was also assessed. The mcr-1 -bearing transposon Tn 6330 was characterized by PCR and DNA sequencing. Complete sequences of three plasmids were obtained. A non-conjugative phage P7-like plasmid, pHYEC7- mcr1 , was found to harbour the mcr-1 -bearing transposon Tn 6330 , which could be excised from the plasmid by generating a circular intermediate harbouring mcr-1 and the IS Apl1 element. The insertion of the circular intermediate into another plasmid, pHYEC7-IncHI2, could form pHNSHP45-2, the original IncHI2-type mcr-1 -carrying plasmid that was reported. The third plasmid, pHYEC7-110, harboured two replicons, IncX1 and IncFIB, and comprised multiple antimicrobial resistance mobile elements, some of which were shared by pHYEC7-IncHI2. The Tn 6330 element located in the phage-like plasmid pHYEC7- mcr1 could be excised from the plasmid and formed a circular intermediate that could be integrated into plasmids containing the IS Apl1 element. This phenomenon indicated that Tn 6330 is a key element responsible for widespread dissemination of mcr-1 among various types of plasmids and bacterial chromosomes. The dissemination rate of such an element may be further enhanced upon translocation into phage-like vectors, which may also be transmitted via transduction events. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Gene therapy approaches for spinal cord injury

NASA Astrophysics Data System (ADS)

Bright, Corinne

As the biomedical engineering field expands, combination technologies are demonstrating enormous potential for treating human disease. In particular, intersections between the rapidly developing fields of gene therapy and tissue engineering hold promise to achieve tissue regeneration. Nonviral gene therapy uses plasmid DNA to deliver therapeutic proteins in vivo for extended periods of time. Tissue engineering employs biomedical materials, such as polymers, to support the regrowth of injured tissue. In this thesis, a combination strategy to deliver genes and drugs in a polymeric scaffold was applied to a spinal cord injury model. In order to develop a platform technology to treat spinal cord injury, several nonviral gene delivery systems and polymeric scaffolds were evaluated in vitro and in vivo. Nonviral vector trafficking was evaluated in primary neuronal culture to develop an understanding of the barriers to gene transfer in neurons and their supporting glia. Although the most efficient gene carrier in vitro differed from the optimal gene carrier in vivo, confocal and electron microscopy of these nonviral vectors provided insights into the interaction of these vectors with the nucleus. A novel pathway for delivering nanoparticles into the nuclei of neurons and Schwann cells via vesicle trafficking was observed in this study. Reporter gene expression levels were evaluated after direct and remote delivery to the spinal cord, and the optimal nonviral vector, dose, and delivery strategy were applied to deliver the gene encoding the basic fibroblast growth factor (bFGF) to the spinal cord. An injectable and biocompatible gel, composed of the amphiphillic polymer poly(ethylene glycol)-poly(epsilon-caprolactone)-poly(ethylene glycol) (PEG-PCL-PEG) was evaluated as a drug and gene delivery system in vitro, and combined with the optimized nonviral gene delivery system to treat spinal cord injury. Plasmid DNA encoding the bFGF gene and the therapeutic NEP1--40 peptide were incorporated in the PEG-PCL-PEG gel and injected into a lesion transecting the main dorsomedial and minor ventral medial corticospinal tract (CST). The degree of collateralization of the transected CST was quantified as an indicator of the regenerative potential of these treatments. At one month post-injury, we observed the robust rostral collateralization of the CST tract in response to the bFGF plasmid-loaded gel. In conclusion, we hope that this platform technology can be applied to the sustained local delivery of other proteins for the treatment of spinal cord injury.

Evidence for autonomous replication and stabilization of recombinant plasmids in the transformants of yeast Hansenula polymorpha.

PubMed

Tikhomirova, L P; Ikonomova, R N; Kuznetsova, E N

1986-01-01

For the transformation of the yeast Hansenula polymorpha we have constructed a set of hybrid plasmids carrying the LEU2 gene of Saccharomyces cerevisiae as a selective marker and fragments of mitochondrial DNA of Candida utilis and H. polymorpha or chromosomal DNA fragments of H. polymorpha as replicator sequences. The replication properties of chimeric plasmids in the yeast H. polymorpha were investigated. We showed that for plasmids propagated autonomously in this yeast the plasmid monomers could be detected in the transformants only during the immediate time after the transformation event. Further growth under selective conditions led to the selection of polymeric forms of plasmid DNA as it was clearly shown for transformants carrying cosmid pL2 with mtDNA fragment of C. utilis. Such transformants carrying polymerized plasmids showed a remarkably increased stability of the transformed phenotype. Cosmid pL2 was able to shuttle between Escherichia coli, S. cerevisiae and H. polymorpha, whereas plasmids with DNA fragments from H. polymorpha did not transform S. cerevisiae effectively.

Rapid screening for plasmid DNA.

PubMed

Hughes, C; Meynell, G G

1977-03-07

A procedure is described for demonstrating plasmid DNA and its molecular weight, based on rate zonal centrifugation of unlabelled DNA in neutral sucrose gradients containing a low concentration of ethidium bromide. Each DNA species is then visualized as a discrete fluorescent band when the centrifuge tube is illuminated with ultra-violet light. Plasmids exist as closed circular and as relaxed circular molecules, which sediment separately, but during preparation of lysates, closed circular molecules are nicked so that each plasmid forms only a single band of relaxed circles within the gradient.

Hyaluronic acid synthase-2 gene transfer into the joints of Beagles by use of recombinant adeno-associated viral vectors.

PubMed

Kyostio-Moore, Sirkka; Berthelette, Patricia; Cornell, Cathleen Sookdeo; Nambiar, Bindu; Figueiredo, Monica Dias

2018-05-01

OBJECTIVE To evaluate gene transfer of recombinant adeno-associated viral (rAAV) vectors with AAV2 or AAV5 capsid and encoding hyaluronic acid (HA) synthase-2 (HAS2) into joints of healthy dogs. ANIMALS 22 purpose-bred Beagles. PROCEDURES Plasmid expression cassettes encoding canine HAS2 (cHAS2) were assessed in vitro for concentration and molecular size of secreted HA. Thereafter, rAAV2-cHAS2 vectors at 3 concentrations and rAAV5-cHAS2 vectors at 1 concentration were each administered intra-articularly into the left stifle joint of 5 dogs; 2 dogs received PBS solution instead. Synovial fluid HA concentration and serum and synovial fluid titers of neutralizing antibodies against AAV capsids were measured at various points. Dogs were euthanized 28 days after treatment, and cartilage and synovium samples were collected for vector DNA and mRNA quantification and histologic examination. RESULTS Cell transfection with plasmids encoding cHAS2 resulted in an increase in production and secretion of HA in vitro. In vivo, the rAAV5-cHAS2 vector yielded uniform genome transfer and cHAS2 expression in collected synovium and cartilage samples. In contrast, rAAV2-cHAS2 vectors were detected inconsistently in synovium and cartilage samples and failed to produce clear dose-related responses. Histologic examination revealed minimal synovial inflammation in joints injected with rAAV vectors. Neutralizing antibodies against AAV capsids were detected in serum and synovial fluid samples from all vector-treated dogs. CONCLUSIONS AND CLINICAL RELEVANCE rAAV5-mediated transfer of the gene for cHAS2 into healthy joints of dogs by intra-articular injection appeared safe and resulted in vector-derived cHAS2 production by synoviocytes and chondrocytes. Whether this treatment may increase HA production by synoviocytes and chondrocytes in osteoarthritic joints remains to be determined.

[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].

PubMed

Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua

2013-02-01

To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.

Partial complementation of the UV sensitivity of E. coli and yeast excision repair mutants by the cloned denV gene of bacteriophage T4.

PubMed

Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C

1986-04-01

The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.

Poly(amidoamine) Dendrimers Modified with 1,2-Epoxyhexane or 1,2-Epoxydodecane for Enhanced Gene Delivery Applications.

PubMed

Xiao, Tongyu; Cao, Xueyan; Hou, Wenxiu; Peng, Chen; Qiu, Jieru; Shi, Xiangyang

2015-12-01

We report a new non-viral gene delivery system based on hydrophobically modified poly(amidoamine) (PAMAM) dendrimers. In this study, the periphery of amine-terminated generation 5 (G5) PAMAM dendrimers was partially reacted with 1,2-epoxyhexane and 1,2-epoxydodecane, respectively. The formed hydrophobically modified G5 dendrimers (denoted as G5.NH2-C6 or G5.NH2-C12) were used to complex two different plasmid DNAs (pDNAs) encoding luciferase (Luc) and enhanced green fluorescent protein (EGFP), respectively for gene transfection studies. The polyplexes formed between vectors and pDNA were characterized by gel retardation assay, dynamic light scattering, and zeta potential measurements. We show that the G5.NH2-C6 and G5.NH2-C12 vectors are able to effectively compact the pDNA, allowing for highly efficient gene transfection into a model cell line (HeLa cells) as demonstrated by both Luc assay and confocal microscopic imaging of the EGFP expression. Under the studied N/P ratios (the molar ratio of primary amines of the dendrimers to phosphates in the pDNA backbone) at 2.5 or 5, the transfection efficiency of the dendrimer-based vectors followed the order of G5.NH2-C12 > G5.NH2-C6 > G5.NH2. This enhanced gene transfection capacity is believed to be associated with the enhanced hydrophobic interaction between the vector/pDNA complexes and the relatively hydrophobic cell membranes. The developed hydrophobically modified dendrimers may be used as a promising non-viral vector for enhanced gene delivery applications.

Improvement of a yeast self-excising integrative vector by prevention of expression leakage of the intronated Cre recombinase gene during plasmid maintenance in Escherichia coli.

PubMed

Agaphonov, Michael O

2017-12-01

The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Generation of Infectious Poliovirus with Altered Genetic Information from Cloned cDNA.

PubMed

Bujaki, Erika

2016-01-01

The effect of specific genetic alterations on virus biology and phenotype can be studied by a great number of available assays. The following method describes the basic protocol to generate infectious poliovirus with altered genetic information from cloned cDNA in cultured cells.The example explained here involves generation of a recombinant poliovirus genome by simply replacing a portion of the 5' noncoding region with a synthetic gene by restriction cloning. The vector containing the full length poliovirus genome and the insert DNA with the known mutation(s) are cleaved for directional cloning, then ligated and transformed into competent bacteria. The recombinant plasmid DNA is then propagated in bacteria and transcribed to RNA in vitro before RNA transfection of cultured cells is performed. Finally, viral particles are recovered from the cell culture.

Parvoviral Left-End Hairpin Ears Are Essential during Infection for Establishing a Functional Intranuclear Transcription Template and for Efficient Progeny Genome Encapsidation

PubMed Central

Li, Lei; Cotmore, Susan F.

2013-01-01

The 121-nucleotide left-end telomere of Minute Virus of Mice (MVM) can be folded into a Y-shaped hairpin with short axial ears that are highly conserved within genus Parvovirus. To explore their potential role(s) during infection, we constructed infectious plasmid clones that lacked one or other ear. Although these were nonviable when transfected into A9 cells, excision of the viral genome and DNA amplification appeared normal, and viral transcripts and proteins were expressed, but progeny virion production was minimal, supporting the idea of a potential role for the ears in genome packaging. To circumvent the absence of progeny that confounded further analysis of these mutants, plasmids were transfected into 293T cells both with and without an adenovirus helper construct, generating single bursts of progeny. These virions bound to A9 cells and were internalized but failed to initiate viral transcription, protein expression, or DNA replication. No defects in mutant virion stability or function could be detected in vitro. Significantly, mutant capsid gene expression and DNA replication could be rescued by coinfection with wild-type virions carrying a replication-competent, capsid-gene-replacement vector. To pinpoint where such complementation occurred, prior transfection of plasmids expressing only MVM nonstructural proteins was explored. NS1 alone, but not NS2, rescued transcription and protein expression from both P4 and P38 promoters, whereas NS1 molecules deleted for their C-terminal transactivation domain did not. These results suggest that the mutant virions reach the nucleus, uncoat, and are converted to duplex DNA but require an intact left-end hairpin structure to form the initiating transcription complex. PMID:23903839

Ultrasound-Mediated DNA Transformation in Thermophilic Gram-Positive Anaerobes

PubMed Central

Ji, Yuetong; He, Zhili; Pu, Yunting; Zhou, Jizhong; Xu, Jian

2010-01-01

Background Thermophilic, Gram-positive, anaerobic bacteria (TGPAs) are generally recalcitrant to chemical and electrotransformation due to their special cell-wall structure and the low intrinsic permeability of plasma membranes. Methodology/Principal Findings Here we established for any Gram-positive or thermophiles an ultrasound-based sonoporation as a simple, rapid, and minimally invasive method to genetically transform TGPAs. We showed that by applying a 40 kHz ultrasound frequency over a 20-second exposure, Texas red-conjugated dextran was delivered with 27% efficiency into Thermoanaerobacter sp. X514, a TGPA that can utilize both pentose and hexose for ethanol production. Experiments that delivered plasmids showed that host-cell viability and plasmid DNA integrity were not compromised. Via sonoporation, shuttle vectors pHL015 harboring a jellyfish gfp gene and pIKM2 encoding a Clostridium thermocellum β-1,4-glucanase gene were delivered into X514 with an efficiency of 6×102 transformants/µg of methylated DNA. Delivery into X514 cells was confirmed via detecting the kanamycin-resistance gene for pIKM2, while confirmation of pHL015 was detected by visualization of fluorescence signals of secondary host-cells following a plasmid-rescue experiment. Furthermore, the foreign β-1,4-glucanase gene was functionally expressed in X514, converting the host into a prototypic thermophilic consolidated bioprocessing organism that is not only ethanologenic but cellulolytic. Conclusions/Significance In this study, we developed an ultrasound-based sonoporation method in TGPAs. This new DNA-delivery method could significantly improve the throughput in developing genetic systems for TGPAs, many of which are of industrial interest yet remain difficult to manipulate genetically. PMID:20838444

Incision of trivalent chromium [Cr(III)]-induced DNA damage by Bacillus caldotenax UvrABC endonuclease.

PubMed

O'Brien, Travis J; Jiang, Guohui; Chun, Gina; Mandel, H George; Westphal, Craig S; Kahen, Kaveh; Montaser, Akbar; States, J Christopher; Patierno, Steven R

2006-11-07

Some hexavalent chromium [Cr(VI)]-containing compounds are lung carcinogens. Once within cells, Cr(VI) is reduced to trivalent chromium [Cr(III)] which displays an affinity for both DNA bases and the phosphate backbone. A diverse array of genetic lesions is produced by Cr including Cr-DNA monoadducts, DNA interstrand crosslinks (ICLs), DNA-Cr-protein crosslinks (DPCs), abasic sites, DNA strand breaks and oxidized bases. Despite the large amount of information available on the genotoxicity of Cr, little is known regarding the molecular mechanisms involved in the removal of these lesions from damaged DNA. Recent work indicates that nucleotide excision repair (NER) is involved in the processing of Cr-DNA adducts in human and rodent cells. In order to better understand this process at the molecular level and begin to identify the Cr-DNA adducts processed by NER, the incision of CrCl(3) [Cr(III)]-damaged plasmid DNA was studied using a thermal-resistant UvrABC NER endonuclease from Bacillus caldotenax (Bca). Treatment of plasmid DNA with Cr(III) (as CrCl(3)) increased DNA binding as a function of dose. For example, at a Cr(III) concentration of 1 microM we observed approximately 2 Cr(III)-DNA adducts per plasmid. At this same concentration of Cr(III) we found that approximately 17% of the plasmid DNA contained ICLs ( approximately 0.2 ICLs/plasmid). When plasmid DNA treated with Cr(III) (1 microM) was incubated with Bca UvrABC we observed approximately 0.8 incisions/plasmid. The formation of endonuclease IV-sensitive abasic lesions or Fpg-sensitive oxidized DNA bases was not detected suggesting that the incision of Cr(III)-damaged plasmid DNA by UvrABC was not related to the generation of oxidized DNA damage. Taken together, our data suggest that a sub-fraction of Cr(III)-DNA adducts is recognized and processed by the prokaryotic NER machinery and that ICLs are not necessarily the sole lesions generated by Cr(III) that are substrates for NER.

Nebulisation of receptor-targeted nanocomplexes for gene delivery to the airway epithelium.

PubMed

Manunta, Maria D I; McAnulty, Robin J; Tagalakis, Aristides D; Bottoms, Stephen E; Campbell, Frederick; Hailes, Helen C; Tabor, Alethea B; Laurent, Geoffrey J; O'Callaghan, Christopher; Hart, Stephen L

2011-01-01

Gene therapy mediated by synthetic vectors may provide opportunities for new treatments for cystic fibrosis (CF) via aerosolisation. Vectors for CF must transfect the airway epithelium efficiently and not cause inflammation so they are suitable for repeated dosing. The inhaled aerosol should be deposited in the airways since the cystic fibrosis transmembrane conductance regulator gene (CFTR) is expressed predominantly in the epithelium of the submucosal glands and in the surface airway epithelium. The aim of this project was to develop an optimised aerosol delivery approach applicable to treatment of CF lung disease by gene therapy. The vector suspension investigated in this study comprises receptor-targeting peptides, cationic liposomes and plasmid DNA that self-assemble by electrostatic interactions to form a receptor-targeted nanocomplex (RTN) of approximately 150 nm with a cationic surface charge of +50 mV. The aerodynamic properties of aerosolised nanocomplexes produced with three different nebulisers were compared by determining aerosol deposition in the different stages of a Next Generation Pharmaceutical Impactor (NGI). We also investigated the yield of intact plasmid DNA by agarose gel electrophoresis and densitometry, and transfection efficacies in vitro and in vivo. RTNs nebulised with the AeroEclipse II BAN were the most effective, compared to other nebulisers tested, for gene delivery both in vitro and in vivo. The biophysical properties of the nanocomplexes were unchanged after nebulisation while the deposition of RTNs suggested a range of aerosol aerodynamic sizes between 5.5 µm-1.4 µm cut off (NGI stages 3-6) compatible with deposition in the central and lower airways. RTNs showed their ability at delivering genes via nebulisation, thus suggesting their potential applications for therapeutic interventions of cystic fibrosis and other respiratory disorders.

Ultrasound -Assisted Gene Transfer to Adipose Tissue-Derived Stem/Progenitor Cells (ASCs)

NASA Astrophysics Data System (ADS)

Miyamoto, Yoshitaka; Ueno, Hitomi; Hokari, Rei; Yuan, Wenji; Kuno, Shuichi; Kakimoto, Takashi; Enosawa, Shin; Negishi, Yoichi; Yoshinaka, Kiyoshi; Matsumoto, Yoichiro; Chiba, Toshio; Hayashi, Shuji

2011-09-01

In recent years, multilineage adipose tissue-derived stem cells (ASCs) have become increasingly attractive as a promising source for cell transplantation and regenerative medicine. Particular interest has been expressed in the potential to make tissue stem cells, such as ASCs and marrow stromal cells (MSCs), differentiate by gene transfection. Gene transfection using highly efficient viral vectors such as adeno- and sendai viruses have been developed for this purpose. Sonoporation, or ultrasound (US)-assisted gene transfer, is an alternative gene manipulation technique which employs the creation of a jet stream by ultrasonic microbubble cavitation. Sonoporation using non-viral vectors is expected to be a much safer, although less efficient, tool for prospective clinical gene therapy. In this report, we assessed the efficacy of the sonoporation technique for gene transfer to ASCs. We isolated and cultured adipocyets from mouse adipose tissue. ASCs that have the potential to differentiate with transformation into adipocytes or osteoblasts were obtained. Using the US-assisted system, plasmid DNA containing beta-galactosidase (beta-Gal) and green fluorescent protein (GFP) genes were transferred to the ASCs. For this purpose, a Sonopore 4000 (NEPAGENE Co.) and a Sonazoid (Daiichi Sankyo Co.) instrument were used in combination. ASCs were subjected to US (3.1 MHz, 50% duty cycle, burst rate 2.0 Hz, intensity 1.2 W/cm2, exposure time 30 sec). We observed that the gene was more efficiently transferred with increased concentrations of plasmid DNA (5-150 μg/mL). However, further optimization of the US parameters is required, as the gene transfer efficiency was still relatively low. In conclusion, we herein demonstrate that a gene can be transferred to ASCs using our US-assisted system. In regenerative medicine, this system might resolve the current issues surrounding the use of viral vectors for gene transfer.

Duck Enteritis Virus Glycoprotein D and B DNA Vaccines Induce Immune Responses and Immunoprotection in Pekin Ducks

PubMed Central

Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

2014-01-01

DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks. PMID:24736466

Duck enteritis virus glycoprotein D and B DNA vaccines induce immune responses and immunoprotection in Pekin ducks.

PubMed

Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

2014-01-01

DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.

Reconstructing the complex evolutionary history of mobile plasmids in red algal genomes

PubMed Central

Lee, JunMo; Kim, Kyeong Mi; Yang, Eun Chan; Miller, Kathy Ann; Boo, Sung Min; Bhattacharya, Debashish; Yoon, Hwan Su

2016-01-01

The integration of foreign DNA into algal and plant plastid genomes is a rare event, with only a few known examples of horizontal gene transfer (HGT). Plasmids, which are well-studied drivers of HGT in prokaryotes, have been reported previously in red algae (Rhodophyta). However, the distribution of these mobile DNA elements and their sites of integration into the plastid (ptDNA), mitochondrial (mtDNA), and nuclear genomes of Rhodophyta remain unknown. Here we reconstructed the complex evolutionary history of plasmid-derived DNAs in red algae. Comparative analysis of 21 rhodophyte ptDNAs, including new genome data for 5 species, turned up 22 plasmid-derived open reading frames (ORFs) that showed syntenic and copy number variation among species, but were conserved within different individuals in three lineages. Several plasmid-derived homologs were found not only in ptDNA but also in mtDNA and in the nuclear genome of green plants, stramenopiles, and rhizarians. Phylogenetic and plasmid-derived ORF analyses showed that the majority of plasmid DNAs originated within red algae, whereas others were derived from cyanobacteria, other bacteria, and viruses. Our results elucidate the evolution of plasmid DNAs in red algae and suggest that they spread as parasitic genetic elements. This hypothesis is consistent with their sporadic distribution within Rhodophyta. PMID:27030297

Hydrophobic and electrostatic interactions between cell penetrating peptides and plasmid DNA are important for stable non-covalent complexation and intracellular delivery.

PubMed

Upadhya, Archana; Sangave, Preeti C

2016-10-01

Cell penetrating peptides are useful tools for intracellular delivery of nucleic acids. Delivery of plasmid DNA, a large nucleic acid, poses a challenge for peptide mediated transport. The paper investigates and compares efficacy of five novel peptide designs for complexation of plasmid DNA and subsequent delivery into cells. The peptides were designed to contain reported DNA condensing agents and basic cell penetrating sequences, octa-arginine (R 8 ) and CHK 6 HC coupled to cell penetration accelerating peptides such as Bax inhibitory mutant peptide (KLPVM) and a peptide derived from the Kaposi fibroblast growth factor (kFGF) membrane translocating sequence. A tryptophan rich peptide, an analogue of Pep-3, flanked with CH 3 on either ends was also a part of the study. The peptides were analysed for plasmid DNA complexation, protection of peptide-plasmid DNA complexes against DNase I, serum components and competitive ligands by simple agarose gel electrophoresis techniques. Hemolysis of rat red blood corpuscles (RBCs) in the presence of the peptides was used as a measure of peptide cytotoxicity. Plasmid DNA delivery through the designed peptides was evaluated in two cell lines, human cervical cancer cell line (HeLa) and (NIH/3 T3) mouse embryonic fibroblasts via expression of the secreted alkaline phosphatase (SEAP) reporter gene. The importance of hydrophobic sequences in addition to cationic sequences in peptides for non-covalent plasmid DNA complexation and delivery has been illustrated. An alternative to the employment of fatty acid moieties for enhanced gene transfer has been proposed. Comparison of peptides for plasmid DNA complexation and delivery of peptide-plasmid DNA complexes to cells estimated by expression of a reporter gene, SEAP. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

Intramolecular transposition by a synthetic IS50 (Tn5) derivative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomcsanyi, T.; Phadnis, S.H.; Berg, D.E.

1990-11-01

We report the formation of deletions and inversions by intramolecular transposition of Tn5-derived mobile elements. The synthetic transposons used contained the IS50 O and I end segments and the transposase gene, a contraselectable gene encoding sucrose sensitivity (sacB), antibiotic resistance genes, and a plasmid replication origin. Both deletions and inversions were associated with loss of a 300-bp segment that is designated the vector because it is outside of the transposon. Deletions were severalfold more frequent than inversions, perhaps reflecting constraints on DNA twisting or abortive transposition. Restriction and DNA sequence analyses showed that both types of rearrangements extended from onemore » transposon end to many different sites in target DNA. In the case of inversions, transposition generated 9-bp direct repeats of target sequences.« less

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

Isolation, characterization, and evaluation of wild isolates of Lactobacillus reuteri from pig feces.

PubMed

Lee, Deog Yong; Seo, Yeon-Soo; Rayamajhi, Nabin; Kang, Mi Lan; Lee, Su In; Yoo, Han Sang

2009-12-01

Lactic acid bacteria (LAB) are a well-used probiotics for health improvements in both humans and animals. Despite of several benefits, non-host-specific LAB showed poor probiotics effects due to difficulty in colonization and competition with normal flora. Therefore, the feasibility of porcine LAB isolates was evaluated as a probiotics. Ten of 49 Lactobacillus spp. isolates harbored 2 approximately 10 kb plasmid DNA. Seven strains were selected based on the safety test, such as hemolytic activity, ammonia, indole, and phenylalanine production. After safety test, five strains were selected again by several tests, such as epithelial adherence, antimicrobial activity, tolerance against acid, bile, heat, and cold-drying, and production of acid and hydrogen peroxide. Then, enzyme profiles (ZYM test) and antibiotics resistance were analyzed for further characterization. Five Lactobacillus reuteri isolates from pig feces were selected by safety and functional tests. The plasmid DNA which was able to develop vector system was detected in the isolates. Together with these approaches, pig-specific Lactobacillus spp. originated from pigs were selected. These strains may be useful tools to develop oral delivery system.

Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

PubMed

Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P

2012-09-01

Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

Catalytic site of human protein-glucosylgalactosylhydroxylysine glucosidase: Three crucial carboxyl residues were determined by cloning and site-directed mutagenesis.

PubMed

Hamazaki, Hideaki; Hamazaki, Michiko Horikawa

2016-01-15

Protein-glucosylgalactosylhydroxylysine glucosidase (PGGHG; EC3.2.1.107) cleaves glucose from disaccharide unit (Glc-α1,2-Gal) linked to hydroxylysine residues of collagen. In the present paper we first show that PGGHG is the product of ATHL1 gene as follows. (1) PGGHG was purified from chick embryos and digested with trypsin. LC-MS/MS analysis suggested the tryptic-peptides were from the ATHL1 gene product. (2) Chick embryo ATHL1 cDNA was cloned to a cloning and expression vector and two plasmid clones with different ATHL1 CDS insert were obtained. (3) Each plasmid DNA was transformed into Escherichia coli cells for expression and two isoforms of chicken PGGHG were obtained. (4) Both isoforms effectively released glucose from type IV collagen. Next, we searched for carboxyl residues crucial for catalytic activity as follows; human ATHL1 cDNA was cloned into a cloning and expression vector and 18 mutants were obtained by site-directed mutagenesis for 15 carboxyl residues conserved in ATHL1 of jawed vertebrates. The expression analysis indicated that substitutions of Asp301, Glu430 and Glu574 with sterically conservative (D301N, E430Q, E574Q) or functionally conservative (D301E, E430D, E574D) residues led to the complete elimination of enzyme activity. These findings lead us to the conclusion that PGGHG is encoded by ATHL1 and three carboxyl residues (corresponding to Asp301, Glu430 and Glu574 of human PGGHG) might be involved in the catalytic site of PGGHG. Copyright © 2015 Elsevier Inc. All rights reserved.

Genome sequence of Ensifer adhaerens OV14 provides insights into its ability as a novel vector for the genetic transformation of plant genomes.

PubMed

Rudder, Steven; Doohan, Fiona; Creevey, Christopher J; Wendt, Toni; Mullins, Ewen

2014-04-07

Recently it has been shown that Ensifer adhaerens can be used as a plant transformation technology, transferring genes into several plant genomes when equipped with a Ti plasmid. For this study, we have sequenced the genome of Ensifer adhaerens OV14 (OV14) and compared it with those of Agrobacterium tumefaciens C58 (C58) and Sinorhizobium meliloti 1021 (1021); the latter of which has also demonstrated a capacity to genetically transform crop genomes, albeit at significantly reduced frequencies. The 7.7 Mb OV14 genome comprises two chromosomes and two plasmids. All protein coding regions in the OV14 genome were functionally grouped based on an eggNOG database. No genes homologous to the A. tumefaciens Ti plasmid vir genes appeared to be present in the OV14 genome. Unexpectedly, OV14 and 1021 were found to possess homologs to chromosomal based genes cited as essential to A. tumefaciens T-DNA transfer. Of significance, genes that are non-essential but exert a positive influence on virulence and the ability to genetically transform host genomes were identified in OV14 but were absent from the 1021 genome. This study reveals the presence of homologs to chromosomally based Agrobacterium genes that support T-DNA transfer within the genome of OV14 and other alphaproteobacteria. The sequencing and analysis of the OV14 genome increases our understanding of T-DNA transfer by non-Agrobacterium species and creates a platform for the continued improvement of Ensifer-mediated transformation (EMT).

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

Genome sequence of Ensifer adhaerens OV14 provides insights into its ability as a novel vector for the genetic transformation of plant genomes

PubMed Central

2014-01-01

Background Recently it has been shown that Ensifer adhaerens can be used as a plant transformation technology, transferring genes into several plant genomes when equipped with a Ti plasmid. For this study, we have sequenced the genome of Ensifer adhaerens OV14 (OV14) and compared it with those of Agrobacterium tumefaciens C58 (C58) and Sinorhizobium meliloti 1021 (1021); the latter of which has also demonstrated a capacity to genetically transform crop genomes, albeit at significantly reduced frequencies. Results The 7.7 Mb OV14 genome comprises two chromosomes and two plasmids. All protein coding regions in the OV14 genome were functionally grouped based on an eggNOG database. No genes homologous to the A. tumefaciens Ti plasmid vir genes appeared to be present in the OV14 genome. Unexpectedly, OV14 and 1021 were found to possess homologs to chromosomal based genes cited as essential to A. tumefaciens T-DNA transfer. Of significance, genes that are non-essential but exert a positive influence on virulence and the ability to genetically transform host genomes were identified in OV14 but were absent from the 1021 genome. Conclusions This study reveals the presence of homologs to chromosomally based Agrobacterium genes that support T-DNA transfer within the genome of OV14 and other alphaproteobacteria. The sequencing and analysis of the OV14 genome increases our understanding of T-DNA transfer by non-Agrobacterium species and creates a platform for the continued improvement of Ensifer-mediated transformation (EMT). PMID:24708309

Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery

PubMed Central

Coelho-Castelo, AAM; Trombone, AP; Rosada, RS; Santos, RR; Bonato, VLD; Sartori, A; Silva, CL

2006-01-01

In order to assess a new strategy of DNA vaccine for a more complete understanding of its action in immune response, it is important to determine the in vivo biodistribution fate and antigen expression. In previous studies, our group focused on the prophylactic and therapeutic use of a plasmid DNA encoding the Mycobacterium leprae 65-kDa heat shock protein (Hsp65) and achieved an efficient immune response induction as well as protection against virulent M. tuberculosis challenge. In the present study, we examined in vivo tissue distribution of naked DNA-Hsp65 vaccine, the Hsp65 message, genome integration and methylation status of plasmid DNA. The DNA-Hsp65 was detectable in several tissue types, indicating that DNA-Hsp65 disseminates widely throughout the body. The biodistribution was dose-dependent. In contrast, RT-PCR detected the Hsp65 message for at least 15 days in muscle or liver tissue from immunized mice. We also analyzed the methylation status and integration of the injected plasmid DNA into the host cellular genome. The bacterial methylation pattern persisted for at least 6 months, indicating that the plasmid DNA-Hsp65 does not replicate in mammalian tissue, and Southern blot analysis showed that plasmid DNA was not integrated. These results have important implications for the use of DNA-Hsp65 vaccine in a clinical setting and open new perspectives for DNA vaccines and new considerations about the inoculation site and delivery system. PMID:16445866

Transfection Studies with Colloidal Systems Containing Highly Purified Bipolar Tetraether Lipids from Sulfolobus acidocaldarius.

PubMed

Engelhardt, Konrad H; Pinnapireddy, Shashank Reddy; Baghdan, Elias; Jedelská, Jarmila; Bakowsky, Udo

2017-01-01

Lipid vectors are commonly used to facilitate the transfer of nucleic acids into mammalian cells. In this study, two fractions of tetraether lipids from the archaea Sulfolobus acidocaldarius were extracted and purified using different methods. The purified lipid fractions polar lipid fraction E (PLFE) and hydrolysed glycerol-dialkyl-nonitol tetraether (hGDNT) differ in their structures, charge, size, and miscibility from conventional lipids. Liposomes were prepared by mixing tetraether lipids with cholesterol (CH) and 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) resulting in stable vectors for gene delivery. Lipoplexes were prepared by complexation of liposomes with a luciferase expressing plasmid (pCMV-luc) at certain nitrogen-to-phosphorus (N/P) ratios and optimised for the transient transfection of ovarian adenocarcinoma cells (SK-OV-3). Complexation efficacy was investigated by gel-red fluorescence assay. Biophysical properties, like size, surface charge, and morphology, were investigated by differential light scattering (DLS), atomic force microscopy (AFM), and scanning electron microscopy (Cryo-SEM), respectively, revealing structural differences between liposomes and lipoplexes. A range of stable transfecting agents containing tetraether lipids were obtained by incorporating 5 mol% of tetraether lipids. Lipoplexes showed a decrease in free gel-red with increasing N/P ratios indicating efficient incorporation of plasmid DNA (pDNA) and remarkable stability. Transfection experiments of the lipoplexes revealed successful and superior transfection of SK-OV-3 cell line compared to the commercially available DOTAP and branched polyethyleneimine (25 kDa bPEI).

Transfection Studies with Colloidal Systems Containing Highly Purified Bipolar Tetraether Lipids from Sulfolobus acidocaldarius

PubMed Central

Pinnapireddy, Shashank Reddy; Baghdan, Elias; Jedelská, Jarmila

2017-01-01

Lipid vectors are commonly used to facilitate the transfer of nucleic acids into mammalian cells. In this study, two fractions of tetraether lipids from the archaea Sulfolobus acidocaldarius were extracted and purified using different methods. The purified lipid fractions polar lipid fraction E (PLFE) and hydrolysed glycerol-dialkyl-nonitol tetraether (hGDNT) differ in their structures, charge, size, and miscibility from conventional lipids. Liposomes were prepared by mixing tetraether lipids with cholesterol (CH) and 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) resulting in stable vectors for gene delivery. Lipoplexes were prepared by complexation of liposomes with a luciferase expressing plasmid (pCMV-luc) at certain nitrogen-to-phosphorus (N/P) ratios and optimised for the transient transfection of ovarian adenocarcinoma cells (SK-OV-3). Complexation efficacy was investigated by gel-red fluorescence assay. Biophysical properties, like size, surface charge, and morphology, were investigated by differential light scattering (DLS), atomic force microscopy (AFM), and scanning electron microscopy (Cryo-SEM), respectively, revealing structural differences between liposomes and lipoplexes. A range of stable transfecting agents containing tetraether lipids were obtained by incorporating 5 mol% of tetraether lipids. Lipoplexes showed a decrease in free gel-red with increasing N/P ratios indicating efficient incorporation of plasmid DNA (pDNA) and remarkable stability. Transfection experiments of the lipoplexes revealed successful and superior transfection of SK-OV-3 cell line compared to the commercially available DOTAP and branched polyethyleneimine (25 kDa bPEI). PMID:28239294

Cloning and expression of L-asparaginase gene in Escherichia coli.

PubMed

Wang, Y; Qian, S; Meng, G; Zhang, S

2001-08-01

The L-asparaginase (ASN) from Escherichia coli AS1.357 was cloned as a DNA fragment generated using polymerase chain reaction technology and primers derived from conserved regions of published ASN gene sequences. Recombinant plasmid pASN containing ASN gene and expression vector pBV220 was transformed in different E. coli host strains. The activity and expression level of ASN in the engineering strains could reach 228 IU/mL of culture fluid and about 50% of the total soluble cell protein respectively, more than 40-fold the enzyme activity of the wild strain. The recombinant plasmid in E. coli AS1.357 remained stable after 72 h of cultivation and 5 h of heat induction without selective pressure. The ASN gene of E. coli AS1.357 was sequenced and had high homology compared to the reported data.

A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.

PubMed

Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei

2018-05-01

Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.

Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-12-20

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-09-30

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Generation of recombinant rotaviruses expressing fluorescent proteins using an optimized reverse genetics system.

PubMed

Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki

2018-04-18

An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.

Identification and characterization of microsatellite markers in the Chagas disease vector Triatoma dimidiata

PubMed Central

Anderson, Jennifer M.; Lai, James E.; Dotson, Ellen M.; Cordon-Rosales, Celia; Ponce, Carlos; Norris, Douglas E.; Ben Beard, C.

2014-01-01

Triatoma dimidiata, one of the major vectors of Chagas disease in Central America, is found in both domestic and peri-domestic habitats. Questions concerning population boundaries, infestation rates, insecticide resistance, and geographic dispersal of triatomine bugs persist and may be resolved using genetic markers such as microsatellites. Microsatellites are short tandem repeats found dispersed throughout a genome and can be useful for genotypic identification. We developed a plasmid library from the genomic DNA isolated from a single T. dimidiata adult collected in Guatamala. Ten thousand clones were screened using a probe consisting of nine microsatellite oligonucleotides. Eight loci appear polymorphic among populations found in Guatemala, Honduras, and Mexico, and thus are potentially useful for population genetic applications. PMID:12798021

Changes in cultivar-specificity toward pea can result from transfer of plasmid RP4 and other incompatibility group P1 replicons to Pseudomonas syringae pv. pisi.

PubMed

Moulton, P J; Vivian, A; Hunter, P J; Taylor, J D

1993-12-01

Transfer of RP4 and related replicons belonging to the Escherichia coli incompatibility group P (Pseudomonas aeruginosa IncP1) to races 2 and 6 of P. syringae pv. pisi was associated with the creation of two types of transconjugant, one resembling the parental race and the other showing an altered cultivar-specificity towards pea. The latter, irrespective of the parental race, exhibited a novel pattern of interaction with pea that corresponded to race 4; consequently such transconjugants were termed race 4-like. Curing of RP4 did not affect the phenotype, except in relation to the antibiotic resistances specified by RP4. The race 4-like strains were non-fluorescent when cultured on appropriate media (in contrast to the particular isolates of races 2 and 6 from which they were derived), showed an enhanced ability to inherit RP4 subsequently (at frequencies up to 10(-1) per recipient) and differed from their parental race in their pattern of plasmid profile. The plasmid profiles were similar for all race 4-like strains irrespective of origin. There was no evidence that RP4 had recombined with DNA in the recipient and probing failed to detect the retention of any part of RP4 in cured strains. The inheritance of the related cosmid vector, pLAFR3, had similar effects in races 2 and 6. This observation is important since this vector has been widely used to clone avirulence genes in plant pathogenic bacteria. Transfer of the IncW plasmids S-a and R388 did not cause any changes in the fluorescence or cultivar-specificity of races 2 or 6.(ABSTRACT TRUNCATED AT 250 WORDS)

Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

PubMed Central

Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

1974-01-01

DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

Multiple Pathways of Plasmid DNA Transfer in Helicobacter pylori

PubMed Central

Rohrer, Stefanie; Holsten, Lea; Weiss, Evelyn; Benghezal, Mohammed; Fischer, Wolfgang; Haas, Rainer

2012-01-01

Many Helicobacter pylori (Hp) strains carry cryptic plasmids of different size and gene content, the function of which is not well understood. A subgroup of these plasmids (e.g. pHel4, pHel12), contain a mobilisation region, but no cognate type IV secretion system (T4SS) for conjugative transfer. Instead, certain H. pylori strains (e.g. strain P12 carrying plasmid pHel12) can harbour up to four T4SSs in their genome (cag-T4SS, comB, tfs3, tfs4). Here, we show that such indigenous plasmids can be efficiently transferred between H. pylori strains, even in the presence of extracellular DNaseI eliminating natural transformation. Knockout of a plasmid-encoded mobA relaxase gene significantly reduced plasmid DNA transfer in the presence of DNaseI, suggesting a DNA conjugation or mobilisation process. To identify the T4SS involved in this conjugative DNA transfer, each individual T4SS was consecutively deleted from the bacterial chromosome. Using a marker-free counterselectable gene deletion procedure (rpsL counterselection method), a P12 mutant strain was finally obtained with no single T4SS (P12ΔT4SS). Mating experiments using these mutants identified the comB T4SS in the recipient strain as the major mediator of plasmid DNA transfer between H. pylori strains, both in a DNaseI-sensitive (natural transformation) as well as a DNaseI-resistant manner (conjugative transfer). However, transfer of a pHel12::cat plasmid from a P12ΔT4SS donor strain into a P12ΔT4SS recipient strain provided evidence for the existence of a third, T4SS-independent mechanism of DNA transfer. This novel type of plasmid DNA transfer, designated as alternate DNaseI-Resistant (ADR) mechanism, is observed at a rather low frequency under in vitro conditions. Taken together, our study describes for the first time the existence of three distinct pathways of plasmid DNA transfer between H. pylori underscoring the importance of horizontal gene transfer for this species. PMID:23029142

Multiple pathways of plasmid DNA transfer in Helicobacter pylori.

PubMed

Rohrer, Stefanie; Holsten, Lea; Weiss, Evelyn; Benghezal, Mohammed; Fischer, Wolfgang; Haas, Rainer

2012-01-01

Many Helicobacter pylori (Hp) strains carry cryptic plasmids of different size and gene content, the function of which is not well understood. A subgroup of these plasmids (e.g. pHel4, pHel12), contain a mobilisation region, but no cognate type IV secretion system (T4SS) for conjugative transfer. Instead, certain H. pylori strains (e.g. strain P12 carrying plasmid pHel12) can harbour up to four T4SSs in their genome (cag-T4SS, comB, tfs3, tfs4). Here, we show that such indigenous plasmids can be efficiently transferred between H. pylori strains, even in the presence of extracellular DNaseI eliminating natural transformation. Knockout of a plasmid-encoded mobA relaxase gene significantly reduced plasmid DNA transfer in the presence of DNaseI, suggesting a DNA conjugation or mobilisation process. To identify the T4SS involved in this conjugative DNA transfer, each individual T4SS was consecutively deleted from the bacterial chromosome. Using a marker-free counterselectable gene deletion procedure (rpsL counterselection method), a P12 mutant strain was finally obtained with no single T4SS (P12ΔT4SS). Mating experiments using these mutants identified the comB T4SS in the recipient strain as the major mediator of plasmid DNA transfer between H. pylori strains, both in a DNaseI-sensitive (natural transformation) as well as a DNaseI-resistant manner (conjugative transfer). However, transfer of a pHel12::cat plasmid from a P12ΔT4SS donor strain into a P12ΔT4SS recipient strain provided evidence for the existence of a third, T4SS-independent mechanism of DNA transfer. This novel type of plasmid DNA transfer, designated as alternate DNaseI-Resistant (ADR) mechanism, is observed at a rather low frequency under in vitro conditions. Taken together, our study describes for the first time the existence of three distinct pathways of plasmid DNA transfer between H. pylori underscoring the importance of horizontal gene transfer for this species.

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

PubMed

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

Retinaldehyde dehydrogenase 2 as a molecular adjuvant for enhancement of mucosal immunity during DNA vaccination.

PubMed

Holechek, Susan A; McAfee, Megan S; Nieves, Lizbeth M; Guzman, Vanessa P; Manhas, Kavita; Fouts, Timothy; Bagley, Kenneth; Blattman, Joseph N

2016-11-04

In order for vaccines to induce efficacious immune responses against mucosally transmitted pathogens, such as HIV-1, activated lymphocytes must efficiently migrate to and enter targeted mucosal sites. We have previously shown that all-trans retinoic acid (ATRA) can be used as a vaccine adjuvant to enhance mucosal CD8 + T cell responses during vaccination and improve protection against mucosal viral challenge. However, the ATRA formulation is incompatible with most recombinant vaccines, and the teratogenic potential of ATRA at high doses limits its usage in many clinical settings. We hypothesized that increasing in vivo production of retinoic acid (RA) during vaccination with a DNA vector expressing retinaldehyde dehydrogenase 2 (RALDH2), the rate-limiting enzyme in RA biosynthesis, could similarly provide enhanced programming of mucosal homing to T cell responses while avoiding teratogenic effects. Administration of a RALDH2- expressing plasmid during immunization with a HIVgag DNA vaccine resulted in increased systemic and mucosal CD8 + T cell numbers with an increase in both effector and central memory T cells. Moreover, mice that received RALDH2 plasmid during DNA vaccination were more resistant to intravaginal challenge with a recombinant vaccinia virus expressing the same HIVgag antigen (VACVgag). Thus, RALDH2 can be used as an alternative adjuvant to ATRA during DNA vaccination leading to an increase in both systemic and mucosal T cell immunity and better protection from viral infection at mucosal sites. Copyright © 2016 Elsevier Ltd. All rights reserved.

Zn(II)-dipicolylamine-based metallo-lipids as novel non-viral gene vectors.

PubMed

Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zhao, Zhi-Gang

2017-08-01

In this study, a series of Zn(II)-dipicolylamine (Zn-DPA) based cationic lipids bearing different hydrophobic tails (long chains, α-tocopherol, cholesterol or diosgenin) were synthesized. Structure-activity relationship (SAR) of these lipids was studied in detail by investigating the effects of several structural aspects including the type of hydrophobic tails, the chain length and saturation degree. In addition, several assays were used to study their interactions with plasmid DNA, and results reveal that these lipids could condense DNA into nanosized particles with appropriate size and zeta-potentials. MTT-based cell viability assays showed that lipoplexes 5 had low cytotoxicity. The in vitro gene transfection studies showed the hydrophobic tails clearly affected the TE, and hexadecanol-containing lipid 5b gives the best TE, which was 2.2 times higher than bPEI 25k in the presence of 10% serum. The results not only demonstrate that these lipids might be promising non-viral gene vectors, but also afford us clues for further optimization of lipidic gene delivery materials.

Low incidence of DNA sequence variation in human induced pluripotent stem cells generated by non-integrating plasmid expression

PubMed Central

Cheng, Linzhao; Hansen, Nancy F.; Zhao, Ling; Du, Yutao; Zou, Chunlin; Donovan, Frank X.; Chou, Bin-Kuan; Zhou, Guangyu; Li, Shijie; Dowey, Sarah N.; Ye, Zhaohui; Chandrasekharappa, Settara C.; Yang, Huanming; Mullikin, James C.; Liu, P. Paul

2012-01-01

Summary The utility of induced pluripotent stem cells (iPSCs) as models to study diseases and as sources for cell therapy depends on the integrity of their genomes. Despite recent publications of DNA sequence variations in the iPSCs, the true scope of such changes for the entire genome is not clear. Here we report the whole-genome sequencing of three human iPSC lines derived from two cell types of an adult donor by episomal vectors. The vector sequence was undetectable in the deeply sequenced iPSC lines. We identified 1058–1808 heterozygous single nucleotide variants (SNVs), but no copy number variants, in each iPSC line. Six to twelve of these SNVs were within coding regions in each iPSC line, but ~50% of them are synonymous changes and the remaining are not selectively enriched for known genes associated with cancers. Our data thus suggest that episome-mediated reprogramming is not inherently mutagenic during integration-free iPSC induction. PMID:22385660

Antheraea pernyi silk fibroin for targeted gene delivery of VEGF165-Ang-1 with PEI.

PubMed

Ma, Caili; Lv, Linlin; Liu, Yu; Yu, Yanni; You, Renchuan; Yang, Jicheng; Li, Mingzhong

2014-06-01

Vascularization is a crucial challenge in tissue engineering. One solution for this problem is to implant scaffolds that contain functional genes that promote vascularization by providing angiogenic growth factors via a gene delivery carrier. Poly(ethylenimine) (PEI) is a gene delivery carrier with high transfection efficiency but with cytotoxicity. To solve this problem, we utilized Antheraea pernyi silk fibroin (ASF), which has favorable cytocompatibility and biodegradability, RGD sequences and a negative charge, in conjunction with PEI, as the delivery vector for vascular endothelial growth factor (VEGF) 165-angiopoietin-1 (Ang-1) dual gene simultaneous expression plasmid, creating an ASF/PEI/pDNA complex. The results suggested that the zeta potential of the ASF/PEI/pDNA complex was significantly lower than that of the PEI/pDNA complex. Decreased nitrogen and increased oxygen on the surface of the complex demonstrated that the ASF had successfully combined with the surface of the PEI/pDNA. Furthermore, the complexes resisted digestion by nucleic acid enzymes and degradation by serum. L929 cells were cultured and transfected in vitro and improved cytotoxicity was found when the cells were transfected with ASF/PEI/pDNA compared with PEI/pDNA. In addition, the transfection efficiency and VEGF secretion increased. In general, this study provides a novel method for decreasing the cytotoxicity of PEI gene delivery vectors and increasing transfection efficiency of angiogenesis-related genes.

Optical tracking of organically modified silica nanoparticles as DNA carriers: A nonviral, nanomedicine approach for gene delivery

NASA Astrophysics Data System (ADS)

Roy, Indrajit; Ohulchanskyy, Tymish Y.; Bharali, Dhruba J.; Pudavar, Haridas E.; Mistretta, Ruth A.; Kaur, Navjot; Prasad, Paras N.

2005-01-01

This article reports a multidisciplinary approach to produce fluorescently labeled organically modified silica nanoparticles as a nonviral vector for gene delivery and biophotonics methods to optically monitor intracellular trafficking and gene transfection. Highly monodispersed, stable aqueous suspensions of organically modified silica nanoparticles, encapsulating fluorescent dyes and surface functionalized by cationic-amino groups, are produced by micellar nanochemistry. Gel-electrophoresis studies reveal that the particles efficiently complex with DNA and protect it from enzymatic digestion of DNase 1. The electrostatic binding of DNA onto the surface of the nanoparticles, due to positively charged amino groups, is also shown by intercalating an appropriate dye into the DNA and observing the Förster (fluorescence) resonance energy transfer between the dye (energy donor) intercalated in DNA on the surface of nanoparticles and a second dye (energy acceptor) inside the nanoparticles. Imaging by fluorescence confocal microscopy shows that cells efficiently take up the nanoparticles in vitro in the cytoplasm, and the nanoparticles deliver DNA to the nucleus. The use of plasmid encoding enhanced GFP allowed us to demonstrate the process of gene transfection in cultured cells. Our work shows that the nanomedicine approach, with nanoparticles acting as a drug-delivery platform combining multiple optical and other types of probes, provides a promising direction for targeted therapy with enhanced efficacy as well as for real-time monitoring of drug action. nonviral vector | ORMOSIL nanoparticles | confocal microscopy

Attenuation of corneal myofibroblast development through nanoparticle-mediated soluble transforming growth factor-β type II receptor (sTGFβRII) gene transfer.

PubMed

Sharma, Ajay; Rodier, Jason T; Tandon, Ashish; Klibanov, Alexander M; Mohan, Rajiv R

2012-01-01

To explore (i) the potential of polyethylenimine (PEI)-DNA nanoparticles as a vector for delivering genes into human corneal fibroblasts, and (ii) whether the nanoparticle-mediated soluble extracellular domain of the transforming growth factor-β type II receptor (sTGFβRII) gene therapy could be used to reduce myofibroblasts and fibrosis in the cornea using an in vitro model. PEI-DNA nanoparticles were prepared at a nitrogen-to-phosphate ratio of 30 by mixing linear PEI and a plasmid encoding sTGFβRII conjugated to the fragment crystallizable (Fc) portion of human immunoglobulin. The PEI-DNA polyplex formation was confirmed through gel retardation assay. Human corneal fibroblasts (HCFs) were generated from donor corneas; myofibroblasts and fibrosis were induced with TGFβ1 (1 ng/ml) stimulation employing serum-free conditions. The sTGFβRII conjugated to the Fc portion of human immunoglobulin gene was introduced into HCF using either PEI-DNA nanoparticles or Lipofectamine. Suitable negative and positive controls to compare selected nanoparticle and therapeutic gene efficiency were included. Delivered gene copies and mRNA (mRNA) expression were quantified with real-time quantitative PCR (qPCR) and protein with enzyme-linked immunosorbent assay (ELISA). The changes in fibrosis parameters were quantified by measuring fibrosis marker α-smooth muscle actin (SMA) mRNA and protein levels with qPCR, immunostaining, and immunoblotting. Cytotoxicity was determined using cellular viability, proliferation, and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. PEI readily bound to plasmids to form nanoparticular polyplexes and exhibited much greater transfection efficiency (p<0.01) than the commercial reagent Lipofectamine. The PEI-DNA-treated cultures showed 4.5×10(4) plasmid copies/µg DNA in real-time qPCR and 7,030±87 pg/ml sTGFβRII protein in ELISA analyses, whereas Lipofectamine-transfected cultures demonstrated 1.9×10(3) gene copies/µg DNA and 1,640±100 pg/ml sTGFβRII protein during these assays. The PEI-mediated sTGFβRII delivery remarkably attenuated TGFβ1-induced transdifferentiation of corneal fibroblasts to myofibroblasts in cultures, as indicated by threefold lower levels of SMA mRNA (p<0.01) and significant inhibition of SMA protein (up to 96±3%; p<0.001 compared to no-gene-delivered cultures) in immunocytochemical staining and immunoblotting. The nanoparticle-mediated delivery of sTGFβRII showed significantly better antifibrotic effects than the Lipofectamine under similar experimental conditions. However, the inhibition of myofibroblast in HCF cultures by sTGFβRII overexpression by either method was significantly higher than the naked vector transfection. Furthermore, PEI- or Lipofectamine-mediated sTGFβRII delivery into HCF did not alter cellular proliferation or phenotype at 12 and 24 h post-treatment. Nanoparticles treated with HCF showed more than 90% cellular viability and very low cell death (2-6 TUNEL+ cells), suggesting that the tested doses of PEI-nanoparticles do not induce significant cell death. This study demonstrated that PEI-DNA nanoparticles are an attractive vector for the development of nonviral corneal gene therapy approaches and that the sTGFβRII gene delivery into keratocytes could be used to control corneal fibrosis in vivo.

Practical Integration-Free Episomal Methods for Generating Human Induced Pluripotent Stem Cells.

PubMed

Kime, Cody; Rand, Tim A; Ivey, Kathryn N; Srivastava, Deepak; Yamanaka, Shinya; Tomoda, Kiichiro

2015-10-06

The advent of induced pluripotent stem (iPS) cell technology has revolutionized biomedicine and basic research by yielding cells with embryonic stem (ES) cell-like properties. The use of iPS-derived cells for cell-based therapies and modeling of human disease holds great potential. While the initial description of iPS cells involved overexpression of four transcription factors via viral vectors that integrated within genomic DNA, advances in recent years by our group and others have led to safer and higher quality iPS cells with greater efficiency. Here, we describe commonly practiced methods for non-integrating induced pluripotent stem cell generation using nucleofection of episomal reprogramming plasmids. These methods are adapted from recent studies that demonstrate increased hiPS cell reprogramming efficacy with the application of three powerful episomal hiPS cell reprogramming factor vectors and the inclusion of an accessory vector expressing EBNA1. Copyright © 2015 John Wiley & Sons, Inc.

Pullulan-protamine as efficient haemocompatible gene delivery vector: synthesis and in vitro characterization.

PubMed

Priya, S S; Rekha, M R; Sharma, Chandra P

2014-02-15

Biodegradable non-viral vectors with good transfection efficiency is essential for successful gene delivery. The purpose of this study was to design a non-viral vector by conjugating protamine to pullulan and elucidate the potential use of pullulan protamine conjugate (PPA) as an effective, non toxic and haemocompatible gene delivery system. The particle size and surface charge were measured using Nanosizer. Derivatization was confirmed by NMR, FTIR and DSC analyses. Acid base titration revealed the buffering behaviour of the conjugate. The protection of DNA from nuclease enzyme and interaction of plasma components on the stability of nanoplexes were also analysed. The uptake studies confirmed the plasmid delivery into the nucleus and the inhibitor studies determined the uptake mechanism. Transfection experiments revealed the capability of PPA to cellular uptake in C6 cells and facilitate high gene expression. Thus, PPA proves to be a promising non-viral vector. Copyright © 2013 Elsevier Ltd. All rights reserved.

Neutralizing antibodies respond to a bivalent dengue DNA vaccine or/and a recombinant bivalent antigen.

PubMed

Zhang, Zhi-Shan; Weng, Yu-Wei; Huang, Hai-Long; Zhang, Jian-Ming; Yan, Yan-Sheng

2015-02-01

There is currently no effective vaccine to prevent dengue infection, despite the existence of multiple studies on potential methods of immunization. The aim of the present study was to explore the effect of DNA and/or recombinant protein on levels of neutralizing antibodies. For this purpose, envelope domain IIIs of dengue serotypes 1 and 2 (DEN-1/2)were spliced by a linker (Gly‑Gly‑Ser‑Gly‑Ser)3 and cloned into the prokaryotic expression plasmid pET30a (+) and eukaryotic vector pcDNA3.1 (+). The chimeric bivalent protein was expressed in Escherichia coli, and one‑step purification by high‑performance liquid chromatography was conducted. Protein expression levels of the DNA plasmid were tested in BHK‑21 cells by indirect immunofluorescent assay. In order to explore a more effective immunization strategy and to develop neutralizing antibodies against the two serotypes, mice were inoculated with recombinant bivalent protein, the DNA vaccine, or the two given simultaneously. Presence of the specific antibodies was tested by ELISA and the presence of the neutralizing antibodies was determined by plaque reduction neutralization test. Results of the analysis indicated that the use of a combination of DNA and protein induced significantly higher titers of neutralizing antibodies against either DEN‑1 or DEN‑2 (1:64.0 and 1:76.1, respectively) compared with the DNA (1:24.7 and 1:26.9, DEN‑1 and DEN‑2, respectively) or the recombinant protein (1:34.9 and 1:45.3 in DEN‑1 and DEN‑2, respectively). The present study demonstrated that the combination of recombinant protein and DNA as an immunization strategy may be an effective method for the development of a vaccine to prevent dengue virus infection.

Transformation in fungi.

PubMed Central

Fincham, J R

1989-01-01

Transformation with exogenous deoxyribonucleic acid (DNA) now appears to be possible with all fungal species, or at least all that can be grown in culture. This field of research is at present dominated by Saccharomyces cerevisiae and two filamentous members of the class Ascomycetes, Aspergillus nidulans and Neurospora crassa, with substantial contributions also from fission yeast (Schizosaccharomyces pombe) and another filamentous member of the class Ascomycetes, Podospora anserina. However, transformation has been demonstrated, and will no doubt be extensively used, in representatives of most of the main fungal classes, including Phycomycetes, Basidiomycetes (the order Agaricales and Ustilago species), and a number of the Fungi Imperfecti. The list includes a number of plant pathogens, and transformation is likely to become important in the analysis of the molecular basis of pathogenicity. Transformation may be maintained either by using an autonomously replicating plasmid as a vehicle for the transforming DNA or through integration of the DNA into the chromosomes. In S. cerevisiae and other yeasts, a variety of autonomously replicating plasmids have been used successfully, some of them designed for use as shuttle vectors for Escherichia coli as well as for yeast transformation. Suitable plasmids are not yet available for use in filamentous fungi, in which stable transformation is dependent on chromosomal integration. In Saccharomyces cerevisiae, integration of transforming DNA is virtually always by homology; in filamentous fungi, in contrast, it occurs just as frequently at nonhomologous (ectopic) chromosomal sites. The main importance of transformation in fungi at present is in connection with gene cloning and the analysis of gene function. The most advanced work is being done with S. cerevisiae, in which the virtual restriction of stable DNA integration to homologous chromosome loci enables gene disruption and gene replacement to be carried out with greater precision and efficiency than is possible in other species that show a high proportion of DNA integration events at nonhomologous (ectopic) sites. With a little more trouble, however, the methodology pioneered for S. cerevisiae can be applied to other fungi too. Transformation of fungi with DNA constructs designed for high gene expression and efficient secretion of gene products appears to have great commercial potential. PMID:2651864

Dual‑sensitive HRE/Egr1 promoter regulates Smac overexpression and enhances radiation‑induced A549 human lung adenocarcinoma cell death under hypoxia.

PubMed

Li, Chang-Feng; Chen, Li-Bo; Li, Dan-Dan; Yang, Lei; Zhang, Bao-Gang; Jin, Jing-Peng; Zhang, Ying; Zhang, Bin

2014-08-01

The aim of this study was to construct an expression vector carrying the hypoxia/radiation dual‑sensitive chimeric hypoxia response element (HRE)/early growth response 1 (Egr‑1) promoter in order to overexpress the therapeutic second mitochondria‑derived activator of caspases (Smac). Using this expression vector, the present study aimed to explore the molecular mechanism underlying radiotherapy‑induced A549 human lung adenocarcinoma cell death and apoptosis under hypoxia. The plasmids, pcDNA3.1‑Egr1‑Smac (pE‑Smac) and pcDNA3.1‑HRE/Egr-1‑Smac (pH/E‑Smac), were constructed and transfected into A549 human lung adenocarcinoma cells using the liposome method. CoCl2 was used to chemically simulate hypoxia, followed by the administration of 2 Gy X‑ray irradiation. An MTT assay was performed to detect cell proliferation and an Annexin V‑fluorescein isothiocyanate apoptosis detection kit was used to detect apoptosis. Quantitative polymerase chain reaction and western blot analyses were used for the detection of mRNA and protein expression, respectively. Infection with the pE‑Smac and pH/E‑Smac plasmids in combination with radiation and/or hypoxia was observed to enhance the expression of Smac. Furthermore, Smac overexpression was found to enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis. The cytochrome c/caspase‑9/caspase‑3 pathway was identified to be involved in this regulation of apoptosis. Plasmid infection in combination with X‑ray irradiation was found to markedly induce cell death under hypoxia. In conclusion, the hypoxia/radiation dual‑sensitive chimeric HRE/Egr‑1 promoter was observed to enhance the expression of the therapeutic Smac, as well as enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis under hypoxia. This apoptosis was found to involve the mitochondrial pathway.

New multifunctional Escherichia coli-Streptomyces shuttle vectors allowing blue-white screening on XGal plates.

PubMed

Wehmeier, U F

1995-11-07

Four new shuttle vectors for Escherichia coli (Ec) and Streptomyces, pUWL218, pUWL219, pUWL-SK and pUWL-KS, which permit recognition of recombinant (re-) plasmids on XGal plates in Ec, were constructed. These vectors contain the replication functions of the Streptomyces wide-host-range multicopy plasmid pIJ101, the tsr gene conferring resistance to thiostrepton in Streptomyces, the ColEI origin of replication from the pUC plasmids for replication in Ec and the bla gene conferring resistance to ampicillin in Ec. They possess multiple cloning sites with a number of unique restriction sites and allow direct sequencing of re-derivatives using the pUC sequencing primers.

Enhancement of Gag-specific but reduction of Env- and Pol-specific CD8+ T cell responses by simian immunodeficiency virus nonstructural proteins in mice.

PubMed

Zhang, Yinfeng; Sun, Caijun; Feng, Liqiang; Xiao, Lijun; Chen, Ling

2012-04-01

Accessory and regulatory proteins (nonstructural proteins) have received increasing attention as components in novel HIV/SIV vaccine design. However, the complicated interactions between nonstructural proteins and structural proteins remain poorly understood, especially their effects on immunogenicity. In this study, the immunogenicity of structural proteins in the presence and absence of nonstructural proteins was compared. First, a series of recombinant plasmids and adenoviral vectors carrying various SIVmac239 nonstructural and structural genes was constructed. Then mice were primed with DNA plasmids and boosted with corresponding Ad5 vectors of different combinations, and the resulting immune responses were measured. Our results demonstrated that when the individual Gag, Pol, or Env gene products were coimmunized with the whole repertoire of nonstructural proteins, the Gag-specific CD8(+) T response was greatly enhanced, while the Env- and Pol-specific CD8(+) T responses were significantly reduced. The same pattern was not observed in CD4(+) T cell responses. Antibody responses against both the Gag and Env proteins were elicited more effectively when these structural antigens were immunized together with nonstructural antigens. These findings may provide helpful insights into the development of novel HIV/SIV vaccines.

Synthesis and characterization of N-(2-hydroxy)propyl-3-trimethyl ammonium chitosan chloride for potential application in gene delivery.

PubMed

Xiao, Bo; Wan, Ying; Wang, Xiaoyu; Zha, Qichen; Liu, Haoming; Qiu, Zhiye; Zhang, Shengmin

2012-03-01

A series of N-(2-hydroxy)propyl-3-trimethyl ammonium chitosan chloride (HTCC) samples with various degrees of quaternization ranging from 12.4 to 43.7% was synthesized. The structures and properties of HTCC were investigated by FT-IR, (1)H NMR, conductometric titration and XRD analysis. It was found that HTCC had a more amorphous structure than chitosan. HTCC samples showed significantly lower cytotoxicity than polyethyleneimine in HepG2 and HeLa cell lines. The samples spontaneously formed complexes with pGL3 luciferase plasmid. These complexes had desirable particle sizes (160-300 nm) and zeta potentials (10.8-18.7 mV) when the weight ratios of HTCC to plasmid altered in the range of 3:1-20:1. In vitro gene transfection results indicated that HTCC had significantly high transfection efficiency compared with chitosan for delivering pGL3 luciferase plasmid to HeLa cells. The results suggest that HTCC could be a promising non-viral vector for safe and efficient DNA delivery. Copyright © 2011 Elsevier B.V. All rights reserved.

Cloning and study of the pectate lyase gene of Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bukanov, N.O.; Fonshtein, M.Yu.; Evtushenkov, A.N.

1986-04-01

The cloning of the gene of a secretable protein of Erwinia carotovora, pectate lyase, in Escherichia coli was described. Primary cloning was conducted using the phage vector lambda 47.1. In the gene library of E. carotovora obtained, eight phages carrying the gene sought were identified according to the appearance of enzymatic activity of the gene product, pectate lyase, in situ. The BamHI fragment of DNA, common to all these phages, was recloned on the plasmid pUC19. It was shown that the cloned pectate lyase gene is represented on the E. carotovora chromosome in one copy. Methods of production of representativemore » gene libraries on phage vectors from no less than 1 ..mu..g of cloned DNA even for the genomes of eukaryotes have now been developed. Vectors have been created, for example, lambda 47.1, permitting the selection only of hybrid molecules. A number of methods have been developed for the search for a required gene in the library, depending on whether the cloned gene can be expressed or not, and if it can, what properties it will impart to the hybrid clone containing it.« less

Enhancement of VP6 immunogenicity and protective efficacy against rotavirus by VP2 in a genetic immunization.

PubMed

Lopez-Guerrero, D V; Arias, N; Gutierrez-Xicotencatl, L; Chihu-Amparan, L; González, A; Pedroza-Saavedra, A; Rosas-Salgado, G; Villegas-Garcia, J C; Badillo-Godinez, O; Fernandez, G; Lopez, S; Esquivel-Guadarrama, F

2018-05-24

VP2/VP6 virus like particles (VLPs) are very effective in inducing protection against the rotavirus infection in animal models. Individually, VP6 can also induce protection. However, there is no information about the immunogenicity of VP2. The aim of this work was to evaluate the efficacy of DNA vaccines codifying for VP2 or VP6, alone or combined, to induce protection against the rotavirus infection. Murine rotavirus VP2 and VP6 genes were cloned into the pcDNA3 vector. Adult BALB/c mice were inoculated three times by intramuscular (i.m.) injections with 100 or 200µg of pcDNA3-VP2 or pcDNA3-VP6 alone or co-administered with 100µg of pcDNA3-VP2/100µg of pcDNA3-VP6. Two weeks after the last inoculation, mice were challenged with the wild type murine rotavirus strain epizootic diarrhea of infant mice (EDIM wt ). We found that both plasmids, pcDNA3-VP2 and pcDNA3-VP6, were able to induce rotavirus-specific serum antibodies, but not intestinal rotavirus-specific IgA; only 200µg of pcDNA3-VP6 induced 35% protection against the infection. A similar level of protection was found when mice were co-administered with 100µg of pcDNA3-VP2/100µg of pcDNA3-VP6 (1:1 ratio). However, the best protection (up to 58%) occurred when mice were inoculated with 10µg of pcDNA3-VP2/100µg of pcDNA3-VP6 (1:10 ratio). These results indicate that the DNA plasmid expressing VP6 is a better vaccine candidate that the one expressing VP2. However, when co-expressed, VP2 potentiates the immunogenicity and protective efficacy of VP6. Copyright © 2017. Published by Elsevier Ltd.

Continuous Production of Discrete Plasmid DNA-Polycation Nanoparticles Using Flash Nanocomplexation.

PubMed

Santos, Jose Luis; Ren, Yong; Vandermark, John; Archang, Maani M; Williford, John-Michael; Liu, Heng-Wen; Lee, Jason; Wang, Tza-Huei; Mao, Hai-Quan

2016-12-01

Despite successful demonstration of linear polyethyleneimine (lPEI) as an effective carrier for a wide range of gene medicine, including DNA plasmids, small interfering RNAs, mRNAs, etc., and continuous improvement of the physical properties and biological performance of the polyelectrolyte complex nanoparticles prepared from lPEI and nucleic acids, there still exist major challenges to produce these nanocomplexes in a scalable manner, particularly for lPEI/DNA nanoparticles. This has significantly hindered the progress toward clinical translation of these nanoparticle-based gene medicine. Here the authors report a flash nanocomplexation (FNC) method that achieves continuous production of lPEI/plasmid DNA nanoparticles with narrow size distribution using a confined impinging jet device. The method involves the complex coacervation of negatively charged DNA plasmid and positive charged lPEI under rapid, highly dynamic, and homogeneous mixing conditions, producing polyelectrolyte complex nanoparticles with narrow distribution of particle size and shape. The average number of plasmid DNA packaged per nanoparticles and its distribution are similar between the FNC method and the small-scale batch mixing method. In addition, the nanoparticles prepared by these two methods exhibit similar cell transfection efficiency. These results confirm that FNC is an effective and scalable method that can produce well-controlled lPEI/plasmid DNA nanoparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Continuous Production of Discrete Plasmid DNA-Polycation Nanoparticles Using Flash Nanocomplexation

PubMed Central

Santos, Jose Luis; Ren, Yong; Vandermark, John; Archang, Maani M.; Williford, John-Michael; Liu, Heng-wen; Lee, Jason; Wang, Tza-Huei; Mao, Hai-Quan

2016-01-01

Despite successful demonstration of linear polyethyleneimine (lPEI) as an effective carrier for a wide range of gene medicine, including DNA plasmids, small interfering RNAs, mRNAs, etc., and continuous improvement of the physical properties and biological performance of the polyelectrolyte complex nanoparticles prepared from lPEI and nucleic acids, there still exist major challenges to produce these nanocomplexes in a scalable manner, particularly for lPEI/DNA nanoparticles. This has significantly hindered the progress towards clinical translation of these nanoparticle-based gene medicine. Here we report a flash nanocomplexation (FNC) method that achieves continuous production of lPEI/plasmid DNA nanoparticles with narrow size distribution using a confined impinging jet device. The method involves the complex coacervation of negatively charged DNA plasmid and positive charged lPEI under rapid, highly dynamic, and homogeneous mixing conditions, producing polyelectrolyte complex nanoparticles with narrow distribution of particle size and shape. The average number of plasmid DNA packaged per nanoparticles and its distribution are similar between the FNC method and the small-scale batch mixing method. In addition, the nanoparticles prepared by these two methods exhibit similar cell transfection efficiency. These results confirm that FNC is an effective and scalable method that can produce well-controlled lPEI/plasmid DNA nanoparticles. PMID:27717227

Engineered Saccharomyces cerevisiae strain for improved xylose utilization with a three-plasmid SUMO yeast expression system

USDA-ARS?s Scientific Manuscript database

A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...

A Potential Food-Grade Cloning Vector for Streptococcus thermophilus That Uses Cadmium Resistance as the Selectable Marker

PubMed Central

Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.

2003-01-01

A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cdr phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus. PMID:14532023

A potential food-grade cloning vector for Streptococcus thermophilus that uses cadmium resistance as the selectable marker.

PubMed

Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W

2003-10-01

A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.

SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.

PubMed

Schwartz, Matthew L; Jorgensen, Erik M

2016-04-01

In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.

In vitro transfection of plasmid DNA by amine derivatives of gelatin accompanied with ultrasound irradiation.

PubMed

Hosseinkhani, Hossein; Aoyama, Ternyoshi; Yamamoto, Shingo; Ogawa, Osamu; Tabata, Yasuhiko

2002-10-01

The purpose of this study is to examine the ultrasound (US)-enhanced gene expression by the complexes of a plasmid DNA with gelatin derivatives of aminization. Gelatin derivatives with different introduced extents of ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) were prepared with a water-soluble carbodiimide. The molecular size and zeta potential of the gelatin derivatives before and after complexation with the plasmid DNA were examined. After incubation with the complexes with or without US exposure, the DNA expression of rat gastric mucosal cells was measured to evaluate the effect of the type of gelatin derivatives on their gene expression. The cell uptake of the complexes, the cell viability, and the buffering effect of gelatin derivatives were examined. The apparent molecular size and zeta potential of gelatin derivatives became larger as their aminization extent increased although the Sm gelatin derivative of higher aminization showed a larger value than other corresponding derivatives. Irrespective of the type of gelatin derivatives, the apparent molecular size of plasmid DNA was reduced by increasing the gelatin-DNA mixing ratio to attain a saturated value of about 150 nm. The condensed gelatin-DNA complexes showed the zeta potential of 10-15 mV. The cells incubated with the complex exhibited significantly stronger luciferase activities than free plasmid DNA, and the activity was further enhanced by US irradiation. The enhancement was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. The amount of plasmid DNA internalized into the cells was significantly increased by the complexation with every gelatin derivative, whereas US irradiation did not significantly increase the DNA internalization. US irradiation had no effect on the viability of cells incubated with every gelatin derivative-plasmid DNA complex, although the viability was decreased by the complex incubation. The buffering capacity of Sm derivative was higher than that of Ed and Sd derivatives and comparable with that of polyethylene amine. Among amine derivatives of gelatin, the Sm derivative enabled the plasmid DNA to induce the US-enhanced gene expression of cells in vitro most effectively because of the superior buffering effect.

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

The pPSU Plasmids for Generating DNA Molecular Weight Markers.

PubMed

Henrici, Ryan C; Pecen, Turner J; Johnston, James L; Tan, Song

2017-05-26

Visualizing nucleic acids by gel electrophoresis is one of the most common techniques in molecular biology, and reference molecular weight markers or ladders are commonly used for size estimation. We have created the pPSU1 & pPSU2 pair of molecular weight marker plasmids which produce both 100 bp and 1 kb DNA ladders when digested with two common restriction enzymes. The 100 bp ladder fragments have been optimized to migrate appropriately on both agarose and native polyacrylamide, unlike many currently available DNA ladders. Sufficient plasmid DNA can be isolated from 100 ml E. coli cultures for the two plasmids to produce 100 bp or 1 kb ladders for 1000 gels. As such, the pPSU1 and pPSU2 plasmids provide reference fragments from 50 to 10000 bp at a fraction of the cost of commercial DNA ladders. The pPSU1 and pPSU2 plasmids are available without licensing restrictions to nonprofit academic users, affording freely available high-quality, low-cost molecular weight standards for molecular biology applications.

Non-viral gene delivery strategies for cancer therapy, tissue engineering and regenerative medicine

NASA Astrophysics Data System (ADS)

Bhise, Nupura S.

Gene therapy involves the delivery of deoxyribonucleic acid (DNA) into cells to override or replace a malfunctioning gene for treating debilitating genetic diseases, including cancer and neurodegenerative diseases. In addition to its use as a therapeutic, it can also serve as a technology to enable regenerative medicine strategies. The central challenge of the gene therapy research arena is developing a safe and effective delivery agent. Since viral vectors have critical immunogenic and tumorogenic safety issues that limit their clinical use, recent efforts have focused on developing non-viral biomaterial based delivery vectors. Cationic polymers are an attractive class of gene delivery vectors due to their structural versatility, ease of synthesis, biodegradability, ability to self-complex into nanoparticles with negatively charged DNA, capacity to carry large cargo, cellular uptake and endosomal escape capacity. In this thesis, we hypothesized that developing a biomaterial library of poly(betaamino esters) (PBAE), a newer class of cationic polymers consisting of biodegradable ester groups, would allow investigating vector design parameters and formulating effective non-viral gene delivery strategies for cancer drug delivery, tissue engineering and stem cell engineering. Consequently, a high-throughput transfection assay was developed to screen the PBAE-based nanoparticles in hard to transfect fibroblast cell lines. To gain mechanistic insights into the nanoparticle formulation process, biophysical properties of the vectors were characterized in terms of molecular weight (MW), nanoparticle size, zeta potential and plasmid per particle count. We report a novel assay developed for quantifying the plasmid per nanoparticle count and studying its implications for co-delivery of multiple genes. The MW of the polymers ranged from 10 kDa to 100 kDa, nanoparticle size was about 150 run, zeta potential was about 30 mV in sodium acetate buffer (25 mM, pH 5) and 30 to 100 plasmids were associated with a single polymeric nanoparticle. To develop PBAE vectors for application in cancer drug delivery and 3-D tissue engineered cultures, the gene delivery efficacy of PBAE nanoparticles was evaluated in mammary epithelial cells used as a model for studying normal development of mammary gland as well as the events that lead to development of breast cancer. We investigated how small molecular changes to the end-capping terminal group of the polymer and changes to the polymer MW affect gene delivery in 2-D mammary cell culture compared to 3-D primary organotypic cultured mouse mammary tissue. We reported that the polymers synthesized here are more effective for gene delivery than FuGENERTM HD, one of the leading commercially available reagents for non-viral gene delivery. We also highlighted that transfection of the 3-D organotypic cultures is more difficult than transfection of 2-D cultures, but likely models some of the key challenges for in vivo gene therapy more closely than 2-D cultures. Finally, we evaluated the use of PBAE nanotechnology for genetic manipulation of stem cell fate for regenerative medicine applications. We developed a PBAE nanoparticle based non-viral protocol and compared it with an electroporation based approach to deliver episomal plasmids encoding reprogramming factors for derivation of human induced pluripotent stem cells (hiPSC). The hiPSCs generated using these approaches can be differentiated into specific cell types for in vitro disease modeling and drug screening, specifically to study retinal degeneration.

Preclinical development of BCG.HIVA2auxo.int, harboring an integrative expression vector, for a HIV-TB Pediatric vaccine. Enhancement of stability and specific HIV-1 T-cell immunity.

PubMed

Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan

2017-08-03

One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.

Peroxynitrite modified DNA presents better epitopes for anti-DNA autoantibodies in diabetes type 1 patients.

PubMed

Tripathi, Prashant; Moinuddin; Dixit, Kiran; Mir, Abdul Rouf; Habib, Safia; Alam, Khursheed; Ali, Asif

2014-07-01

Peroxynitrite (ONOO(-)), formed by the reaction between nitric oxide (NO) and superoxide (O2(-)), has been implicated in the etiology of numerous disease processes. Peroxynitrite interacts with DNA via direct oxidative reactions or via indirect radical-mediated mechanism. It can inflict both oxidative and nitrosative damages on DNA bases, generating abasic sites, resulting in the single strand breaks. Plasmid pUC 18 isolated from Escherichiacoli was modified with peroxynitrite, generated by quenched flow process. Modifications incurred in plasmid DNA were characterized by ultraviolet and fluorescence spectroscopy, circular dichroism, HPLC and melting temperature studies. Binding characteristics and specificity of antibodies from diabetes patients were analyzed by direct binding and inhibition ELISA. Peroxynitrite modification of pUC 18 plasmid resulted in the formation of strand breaks and base modification. The major compound formed when peroxynitrite reacted with DNA was 8-nitroguanine, a specific marker for peroxynitrite induced DNA damage in inflamed tissues. The concentration of 8-nitroguanine was found to be 3.8 μM. Sera from diabetes type 1 patients from different age groups were studied for their binding to native and peroxynitrite modified plasmid. Direct binding and competitive-inhibition ELISA results showed higher recognition of peroxynitrite modified plasmid, as compared to the native form, by auto-antibodies present in diabetes patients. The preferential recognition of modified plasmid by diabetes autoantibodies was further reiterated by gel shift assay. Experimentally induced anti-peroxynitrite-modified plasmid IgG was used as a probe to detect nitrosative lesions in the DNA isolated from diabetes patients. Copyright © 2014 Elsevier Inc. All rights reserved.

Development of a chromosome-plasmid balanced lethal system for Lactobacillus acidophilus with thyA gene as selective marker.

PubMed

Fu, X; Xu, J G

2000-01-01

A chromosome-plasmid balanced lethal gene delivery system for Lactobacillus acidophilus based on the thyA gene was developed. The selected L. acidophilus DOM La strain carries a mutated thyA gene and has an obligate requirement for thymidine. This strain can be used as a host for the constructed shuttle vector pFXL03, lacking antibiotic-resistant markers but having the wild-type thyA gene from L. casei which complements the thyA chromosomal mutation. The vector also contains the replicon region from plasmid pUC19 and that of the Lactococcus plasmid pWV01, which allows the transfer between Escherichia coli, L. casei and L. acidophilus. Eight unique restriction sites (i.e., PstI, HindIII, SphI, SalI, AccI, XbaI, KpnI and SacI) are available for cloning. After 40-time transfers in modified MRS medium, no plasmid loss was observed. The vector pFXL03 is potentially useful as a food-grade vaccine delivery system for L. acidophilus.

Production of lentiviral vectors

PubMed Central

Merten, Otto-Wilhelm; Hebben, Matthias; Bovolenta, Chiara

2016-01-01

Lentiviral vectors (LV) have seen considerably increase in use as gene therapy vectors for the treatment of acquired and inherited diseases. This review presents the state of the art of the production of these vectors with particular emphasis on their large-scale production for clinical purposes. In contrast to oncoretroviral vectors, which are produced using stable producer cell lines, clinical-grade LV are in most of the cases produced by transient transfection of 293 or 293T cells grown in cell factories. However, more recent developments, also, tend to use hollow fiber reactor, suspension culture processes, and the implementation of stable producer cell lines. As is customary for the biotech industry, rather sophisticated downstream processing protocols have been established to remove any undesirable process-derived contaminant, such as plasmid or host cell DNA or host cell proteins. This review compares published large-scale production and purification processes of LV and presents their process performances. Furthermore, developments in the domain of stable cell lines and their way to the use of production vehicles of clinical material will be presented. PMID:27110581

Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

PubMed Central

Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

2000-01-01

A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

Inhibition of hepatitis B virus replication via HBV DNA cleavage by Cas9 from Staphylococcus aureus.

PubMed

Liu, Yu; Zhao, Miaoxian; Gong, Mingxing; Xu, Ying; Xie, Cantao; Deng, Haohui; Li, Xueying; Wu, Hongkai; Wang, Zhanhui

2018-04-01

Chronic hepatitis B virus (HBV) infection is difficult to cure due to the presence of covalently closed circular DNA (cccDNA). Accumulating evidence indicates that the CRISPR/Cas9 system effectively disrupts HBV genome, including cccDNA, in vitro and in vivo. However, efficient delivery of CRISPR/Cas9 system to the liver or hepatocytes using an adeno-associated virus (AAV) vector remains challenging due to the large size of Cas9 from Streptococcus pyogenes (Sp). The recently identified Cas9 protein from Staphylococcus aureus (Sa) is smaller than SpCas9 and thus is able to be packaged into the AAV vector. To examine the efficacy of SaCas9 system on HBV genome destruction, we designed 5 guide RNAs (gRNAs) that targeted different HBV genotypes, 3 of which were shown to be effective. The SaCas9 system significantly reduced HBV antigen expression, as well as pgRNA and cccDNA levels, in Huh7, HepG2.2.15 and HepAD38 cells. The dual expression of gRNAs/SaCas9 in these cell lines resulted in more efficient HBV genome cleavage. In the mouse model, hydrodynamic injection of gRNA/SaCas9 plasmids resulted in significantly lower levels of HBV protein expression. We also delivered the SaCas9 system into mice with persistent HBV replication using an AAV vector. Both the AAV vector and the mRNA of Cas9 could be detected in the C3H mouse liver cells. Decreased hepatitis B surface antigen (HBsAg), HBV DNA and pgRNA levels were observed when a higher titer of AAV was injected, although this decrease was not significantly different from the control. In summary, the SaCas9 system accurately and efficiently targeted the HBV genome and inhibited HBV replication both in vitro and in vivo. The system was delivered by an AAV vector and maybe used as a novel therapeutic strategy against chronic HBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

[Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

PubMed

Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

2007-07-01

To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

PlasmoGEM, a database supporting a community resource for large-scale experimental genetics in malaria parasites.

PubMed

Schwach, Frank; Bushell, Ellen; Gomes, Ana Rita; Anar, Burcu; Girling, Gareth; Herd, Colin; Rayner, Julian C; Billker, Oliver

2015-01-01

The Plasmodium Genetic Modification (PlasmoGEM) database (http://plasmogem.sanger.ac.uk) provides access to a resource of modular, versatile and adaptable vectors for genome modification of Plasmodium spp. parasites. PlasmoGEM currently consists of >2000 plasmids designed to modify the genome of Plasmodium berghei, a malaria parasite of rodents, which can be requested by non-profit research organisations free of charge. PlasmoGEM vectors are designed with long homology arms for efficient genome integration and carry gene specific barcodes to identify individual mutants. They can be used for a wide array of applications, including protein localisation, gene interaction studies and high-throughput genetic screens. The vector production pipeline is supported by a custom software suite that automates both the vector design process and quality control by full-length sequencing of the finished vectors. The PlasmoGEM web interface allows users to search a database of finished knock-out and gene tagging vectors, view details of their designs, download vector sequence in different formats and view available quality control data as well as suggested genotyping strategies. We also make gDNA library clones and intermediate vectors available for researchers to produce vectors for themselves. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Back to basics: pBR322 and protein expression systems in E. coli.

PubMed

Balbás, Paulina; Bolívar, Francisco

2004-01-01

The extensive variety of plasmid-based expression systems in E. coli resulted from the fact that there is no single strategy for achieving maximal expression of every cloned gene. Although a number of strategies have been implemented to deal with problems associated to gene transcription and translation, protein folding, secretion, location, posttranslational modifications, particularities of different strains, and the like and more integrated processes have been developed, the basic plasmid-borne elements and their interaction with the particular host strain will influence the overall expression system and final productivity. Plasmid vector pBR322 is a well-established multipurpose cloning vector in laboratories worldwide, and a large number of derivatives have been created for specific applications and research purposes, including gene expression in its natural host, E. coli, and few other bacteria. The early characterization of the molecule, including its nucleotide sequence, replication and maintenance mechanisms, and determination of its coding regions, accounted for its success, not only as a universal cloning vector, but also as a provider of genes and an origin of replication for other intraspecies vectors. Since the publication of the aforementioned reviews, novel discoveries pertaining to these issues have appeared in the literature that deepen the understanding of the plasmid's features, behavior, and impact in gene expression systems, as well as some important strain characteristics that affect plasmid replication and stability. The objectives of this review include updating and discussing the new information about (1) the replication and maintenance of pBR322; (2) the host-related modulation mechanisms of plasmid replication; (3) the effects of growth rate on replication control, stability, and recombinant gene expression; (4) ways for plasmid amplification and elimination. Finally, (5) a summary of novel ancillary studies about pBR322 is presented.

DNA-based random number generation in security circuitry.

PubMed

Gearheart, Christy M; Arazi, Benjamin; Rouchka, Eric C

2010-06-01

DNA-based circuit design is an area of research in which traditional silicon-based technologies are replaced by naturally occurring phenomena taken from biochemistry and molecular biology. This research focuses on further developing DNA-based methodologies to mimic digital data manipulation. While exhibiting fundamental principles, this work was done in conjunction with the vision that DNA-based circuitry, when the technology matures, will form the basis for a tamper-proof security module, revolutionizing the meaning and concept of tamper-proofing and possibly preventing it altogether based on accurate scientific observations. A paramount part of such a solution would be self-generation of random numbers. A novel prototype schema employs solid phase synthesis of oligonucleotides for random construction of DNA sequences; temporary storage and retrieval is achieved through plasmid vectors. A discussion of how to evaluate sequence randomness is included, as well as how these techniques are applied to a simulation of the random number generation circuitry. Simulation results show generated sequences successfully pass three selected NIST random number generation tests specified for security applications.

In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56.

PubMed

Chen, Qiang; Fischer, Joshua R; Benoit, Vivian M; Dufour, Nicholas P; Youderian, Philip; Leong, John M

2008-12-01

Borrelia burgdorferi is the causative agent of Lyme disease, the most common vector-borne illness in the Northern hemisphere. Low-passage-number infectious strains of B. burgdorferi exhibit extremely low transformation efficiencies-so low, in fact, as to hinder the genetic study of putative virulence factors. Two putative restriction-modification (R-M) systems, BBE02 contained on linear plasmid 25 (lp25) and BBQ67 contained on lp56, have been postulated to contribute to this poor transformability. Restriction barriers posed by other bacteria have been overcome by the in vitro methylation of DNA prior to transformation. To test whether a methylation-sensitive restriction system contributes to poor B. burgdorferi transformability, shuttle plasmids were treated with the CpG methylase M.SssI prior to the electroporation of a variety of strains harboring different putative R-M systems. We found that for B. burgdorferi strains that harbor lp56, in vitro methylation increased transformation by at least 1 order of magnitude. These results suggest that in vitro CpG methylation protects exogenous DNA from degradation by an lp56-contained R-M system, presumably BBQ67. The utility of in vitro methylation for the genetic manipulation of B. burgdorferi was exemplified by the ease of plasmid complementation of a B. burgdorferi B31 A3 BBK32 kanamycin-resistant (B31 A3 BBK32::Kan(r)) mutant, deficient in the expression of the fibronectin- and glycosaminoglycan (GAG)-binding adhesin BBK32. Consistent with the observation that several surface proteins may promote GAG binding, the B. burgdorferi B31 A3 BBK32::Kan(r) mutant demonstrated no defect in the ability to bind purified GAGs or GAGs expressed on the surfaces of cultured cells.

Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum.

PubMed

Alvarez, B; Secades, P; McBride, M J; Guijarro, J A

2004-01-01

Flavobacterium psychrophilum, a member of the Cytophaga-Flavobacterium-Bacteroides group, is an important pathogen of salmonid fish. Previous attempts to develop genetic techniques for this fastidious, psychrotrophic bacterium have met with failure. Here we describe the development of techniques for the genetic manipulation of F. psychrophilum and the identification of plasmids, selectable markers, a reporter system, and a transposon that function in several isolates of this fish pathogen. The antibiotic resistance genes ermF, cfxA, and tetQ function in F. psychrophilum. Cloning vectors based on the F. psychrophilum cryptic plasmid pCP1 which carried these selectable markers were introduced by conjugation from E. coli, resulting in antibiotic-resistant colonies of F. psychrophilum. Conjugative transfer of DNA into F. psychrophilum was strain dependent. Efficient transfer was observed for two of the seven strains tested (THC02-90 and THC04-90). E. coli lacZY functioned in F. psychrophilum when expressed from a pCP1 promoter, allowing its development as a reporter for studies of gene expression. Plasmids isolated from F. psychrophilum were efficiently introduced into F. psychrophilum by electroporation, but plasmids isolated from E. coli were not suitable for transfer by this route, suggesting the presence of a restriction barrier. DNA isolated from F. psychrophilum was resistant to digestion by Sau3AI and BamHI, indicating that a Sau3AI-like restriction modification system may constitute part of this barrier. Tn4351 was introduced into F. psychrophilum from E. coli and transposed with apparent randomness, resulting in erythromycin-resistant colonies. The techniques developed in this study allow for genetic manipulation and analysis of this important fish pathogen.

Dendritic cell targeted chitosan nanoparticles for nasal DNA immunization against SARS CoV nucleocapsid protein.

PubMed

Raghuwanshi, Dharmendra; Mishra, Vivek; Das, Dipankar; Kaur, Kamaljit; Suresh, Mavanur R

2012-04-02

This work investigates the formulation and in vivo efficacy of dendritic cell (DC) targeted plasmid DNA loaded biotinylated chitosan nanoparticles for nasal immunization against nucleocapsid (N) protein of severe acute respiratory syndrome coronavirus (SARS-CoV) as antigen. The induction of antigen-specific mucosal and systemic immune response at the site of virus entry is a major challenge for vaccine design. Here, we designed a strategy for noninvasive receptor mediated gene delivery to nasal resident DCs. The pDNA loaded biotinylated chitosan nanoparticles were prepared using a complex coacervation process and characterized for size, shape, surface charge, plasmid DNA loading and protection against nuclease digestion. The pDNA loaded biotinylated chitosan nanoparticles were targeted with bifunctional fusion protein (bfFp) vector for achieving DC selective targeting. The bfFp is a recombinant fusion protein consisting of truncated core-streptavidin fused with anti-DEC-205 single chain antibody (scFv). The core-streptavidin arm of fusion protein binds with biotinylated nanoparticles, while anti-DEC-205 scFv imparts targeting specificity to DC DEC-205 receptor. We demonstrate that intranasal administration of bfFp targeted formulations along with anti-CD40 DC maturation stimuli enhanced magnitude of mucosal IgA as well as systemic IgG against N protein. The strategy led to the detection of augmented levels of N protein specific systemic IgG and nasal IgA antibodies. However, following intranasal delivery of naked pDNA no mucosal and systemic immune responses were detected. A parallel comparison of targeted formulations using intramuscular and intranasal routes showed that the intramuscular route is superior for induction of systemic IgG responses compared with the intranasal route. Our results suggest that targeted pDNA delivery through a noninvasive intranasal route can be a strategy for designing low-dose vaccines.

Replication and Transcription of Eukaryotic DNA in Esherichia coli

PubMed Central

Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

1974-01-01

Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

Enhanced animal growth via ligand-regulated GHRH myogenic-injectable vectors

NASA Technical Reports Server (NTRS)

Draghia-Akli, Ruxandra; Malone, P. Brandon; Hill, Leigh Anne; Ellis, Kenneth M.; Schwartz, Robert J.; Nordstrom, Jeffrey L.

2002-01-01

Regulated animal growth occurred following a single electroporated injection of a mixture of two plasmids (10 microg of DNA), one expressing the GeneSwitch regulator protein, the other an inducible growth hormone releasing hormone (GHRH) gene, into the tibialis anterior muscles of adult SCID mice. Administration of the ligand mifepristone (MFP) up-regulated GHRH expression, as shown by elevations of IGF-I levels, and when MFP dosing was withdrawn, IGF-I returned to baseline levels. Five cycles of IGF-I induction were observed during a five-month period. Chronic MFP dosing for 25 days increased lean body mass, weight gain, and bone mineral density significantly compared with non-MFP treated controls. In summary, long-term drug-regulated GHRH expression was achieved following plasmid-based gene therapy, and chronic induction of GHRH expression in adult animals led to improvements in weight gain and body composition.

Enhanced animal growth via ligand-regulated GHRH myogenic-injectable vectors.

PubMed

Draghia-Akli, Ruxandra; Malone, P Brandon; Hill, Leigh Anne; Ellis, Kenneth M; Schwartz, Robert J; Nordstrom, Jeffrey L

2002-03-01

Regulated animal growth occurred following a single electroporated injection of a mixture of two plasmids (10 microg of DNA), one expressing the GeneSwitch regulator protein, the other an inducible growth hormone releasing hormone (GHRH) gene, into the tibialis anterior muscles of adult SCID mice. Administration of the ligand mifepristone (MFP) up-regulated GHRH expression, as shown by elevations of IGF-I levels, and when MFP dosing was withdrawn, IGF-I returned to baseline levels. Five cycles of IGF-I induction were observed during a five-month period. Chronic MFP dosing for 25 days increased lean body mass, weight gain, and bone mineral density significantly compared with non-MFP treated controls. In summary, long-term drug-regulated GHRH expression was achieved following plasmid-based gene therapy, and chronic induction of GHRH expression in adult animals led to improvements in weight gain and body composition.

Factors affecting the efficient transformation of Colletotrichum species

USGS Publications Warehouse

Redman, Regina S.; Rodriguez, Rusty J.

1994-01-01

Factors affecting the efficient transformation of Colletotrichum species. Experimental Mycology, 18, 230-246. Twelve isolates representing four species of Colletotrichum were transformed either by enhanced protoplast, restriction enzyme-mediated integration (REMI), or electroporation-mediated protocols. The enhanced protoplast transformation protocol resulted in 100- and 50-fold increases in the transformation efficiencies of Colletotrichum lindemuthianum and C. magna , respectively. REMI transformation involved the use of Hin dIII and vector DNA linearized with HindIII to increase the number of integration events and potential gene disruptions in the fungal genome. Combining the enhanced protoplast and the REMI protocols resulted in a 22-fold increase in the number of hygromycin/nystatin-resistant mutants in C. lindemuthianum . Electroporation-mediated transformation was performed on mycelial fragments and spores of four Colletotrichum species, resulting in efficiencies of up to 1000 transformants/μg DNA. The pHA1.3 vector which confers hygromycin resistance contains telomeric sequences from Fusarium oxysporum , transforms by autonomous replication and genomic integration, and was essential for elevated transformation efficiencies of 100 to 10,000 transformants/μg DNA. Modifications of pHA1.3 occurred during bacterial amplification and post fungal transformation resulting in plasmids capable of significantly elevated transformation efficiencies in C. lindemuthianum.

Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

PubMed

Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

2010-05-15

DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells. Copyright 2010 Elsevier Inc. All rights reserved.

Construction of shuttle vectors capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous cyanobacteria.

PubMed Central

Wolk, C P; Vonshak, A; Kehoe, P; Elhai, J

1984-01-01

Wild-type cyanobacteria of the genus Anabaena are capable of oxygenic photosynthesis, differentiation of cells called heterocysts at semiregular intervals along the cyanobacterial filaments, and aerobic nitrogen fixation by the heterocysts. To foster analysis of the physiological processes characteristic of these cyanobacteria, we have constructed a family of shuttle vectors capable of replication and selection in Escherichia coli and, in unaltered form, in several strains of Anabaena. Highly efficient conjugative transfer of these vectors from E. coli to Anabaena is dependent upon the presence of broad host-range plasmid RP-4 and of helper plasmids. The shuttle vectors contain portions of plasmid pBR322 required for replication and mobilization, with sites for Anabaena restriction enzymes deleted; cyanobacterial replicon pDU1, which lacks such sites; and determinants for resistance to chloramphenicol, streptomycin, neomycin, and erythromycin. Images PMID:6324204

A self-initiating eukaryotic transient gene expression system based on contransfection of bacteriophage T7 RNA polymerase and DNA vectors containing a T7 autogene.

PubMed Central

Chen, X; Li, Y; Xiong, K; Wagner, T E

1994-01-01

A novel cytoplasmic gene expression system has been developed. This system differs from other expression systems in that it relies on the co-delivery of plasmid DNA and T7 RNA polymerase (RNAP) during transfection. The plasmid contains a T7 RNAP gene driven by the T7 promoter (T7 autogene) and a functional/reporter gene driven by another T7 promoter (T7T7/T7-gene construct). Once this DNA-enzyme complex is introduced into eukaryotic cells, the transcription of the T7 RNAP and the functional/reporter genes is initiated by the co-delivered T7 RNAP. The T7 RNAP, which is responsible for the initiation and maintenance of expression of both T7 and functional/reporter genes, is replenished by translation of newly synthesized T7 mRNA. This T7 system was designed in such a manner that the expression of the functional/reporter genes can occur in the cytoplasm and does not require any nuclear involvement. When transfected by either a pT7T7/T7Luc or a pT7T7/T7hGH plasmids with the cointroduced T7 RNAP, mouse L cells were found to express high levels of luciferase immediately after transfection, apparently due to the cytoplasmic gene expression; the expression of human growth hormone (hGH) could be sustained for at least 6 days. Both T7 and hGH mRNA were expressed by the cells transfected with pT7T7/T7hGH. These results suggest that this cytoplasmic expression system may be used for certain targets of somatic gene therapy. Images PMID:8029020

Low molecular weight polyethylenimine cross-linked by 2-hydroxypropyl-gamma-cyclodextrin coupled to peptide targeting HER2 as a gene delivery vector.

PubMed

Huang, Hongliang; Yu, Hai; Tang, Guping; Wang, Qingqing; Li, Jun

2010-03-01

Gene delivery is one of the critical steps for gene therapy. Non-viral vectors have many advantages but suffered from low gene transfection efficiency. Here, in order to develop new polymeric gene vectors with low cytotoxicity and high gene transfection efficiency, we synthesized a cationic polymer composed of low molecular weight polyethylenimine (PEI) of molecular weight of 600 Da cross-linked by 2-hydroxypropyl-gamma-cyclodextrin (HP gamma-CD) and then coupled to MC-10 oligopeptide containing a sequence of Met-Ala-Arg-Ala-Lys-Glu. The oligopeptide can target to HER2, the human epidermal growth factor receptor 2, which is often over expressed in many breast and ovary cancers. The new gene vector was expected to be able to target delivery of genes to HER2 positive cancer cells for gene therapy. The new gene vector was composed of chemically bonded HP gamma-CD, PEI (600 Da), and MC-10 peptide at a molar ratio of 1:3.3:1.2. The gene vector could condense plasmid DNA at an N/P ratio of 6 or above. The particle size of HP gamma-CD-PEI-P/DNA complexes at N/P ratios 40 was around 170-200 nm, with zeta potential of about 20 mV. The gene vector showed very low cytotoxicity, strong targeting specificity to HER2 receptor, and high efficiency of delivering DNA to target cells in vitro and in vivo with the reporter genes. The delivery of therapeutic IFN-alpha gene mediated by the new gene vector and the therapeutic efficiency were also studied in mice animal model. The animal study results showed that the new gene vector HP gamma-CD-PEI-P significantly enhanced the anti-tumor effect on tumor-bearing nude mice as compared to PEI (25 kDa), HP gamma-CD-PEI, and other controls, indicating that this new polymeric gene vector is a potential candidate for cancer gene therapy. (c) 2009 Elsevier Ltd. All rights reserved.

HIV vaccines: new frontiers in vaccine development.

PubMed

Duerr, Ann; Wasserheit, Judith N; Corey, Lawrence

2006-08-15

A human immunodeficiency virus (HIV) vaccine is the most promising and feasible strategy to prevent the events during acute infection that simultaneously set the course of the epidemic in the community and the course of the disease for the individual. Because safety concerns limit the use of live, attenuated HIV and inactivated HIV, a variety of alternate approaches is being investigated. Traditional antibody-mediated approaches using recombinant HIV envelope proteins have shown no efficacy in 2 phase III trials. Current HIV vaccine trials are focusing primarily on cytotoxic T lymphocyte-mediated products that use viral vectors, either alone or as boosts to DNA plasmids that contain viral genes. The most immunogenic of these products appear to be the recombinant adenovirus vector vaccines, 2 of which are now in advanced clinical development.

Plasmid DNA production combining antibiotic-free selection, inducible high yield fermentation, and novel autolytic purification.

PubMed

Carnes, Aaron E; Hodgson, Clague P; Luke, Jeremy M; Vincent, Justin M; Williams, James A

2009-10-15

DNA vaccines and gene medicines, derived from bacterial plasmids, are emerging as an important new class of pharmaceuticals. However, the challenges of performing cell lysis processes for plasmid DNA purification at an industrial scale are well known. To address downstream purification challenges, we have developed autolytic Escherichia coli host strains that express endolysin (phage lambdaR) in the cytoplasm. Expression of the endolysin is induced during fermentation by a heat inducible promoter. The endolysin remains in the cytoplasm, where it is separated from its peptidoglycan substrate in the cell wall; hence the cells remain alive and intact and can be harvested by the usual methods. The plasmid DNA is then recovered by autolytic extraction under slightly acidic, low salt buffer conditions and treatment with a low concentration of non-ionic detergent. Under these conditions the E. coli genomic DNA remains associated with the insoluble cell debris and is removed by a solid-liquid separation. Here, we report fermentation, lysis methods, and plasmid purification using autolytic hosts.

Evaluation of droplet digital PCR for characterizing plasmid reference material used for quantifying ammonia oxidizers and denitrifiers.

PubMed

Dong, Lianhua; Meng, Ying; Wang, Jing; Liu, Yingying

2014-02-01

DNA reference materials of certified value have a critical function in many analytical processes of DNA measurement. Quantification of amoA genes in ammonia oxidizing bacteria (AOB) and archaea (AOA), and of nirS and nosZ genes in the denitrifiers is very important for determining their distribution and abundance in the natural environment. A plasmid reference material containing nirS, nosZ, amoA-AOB, and amoA-AOA is developed to provide a DNA standard with copy number concentration for ensuring comparability and reliability of quantification of these genes. Droplet digital PCR (ddPCR) was evaluated for characterization of the plasmid reference material. The result revealed that restriction endonuclease digestion of plasmids can improve amplification efficiency and minimize the measurement bias of ddPCR. Compared with the conformation of the plasmid, the size of the DNA fragment containing the target sequence and the location of the restriction site relative to the target sequence are not significant factors affecting plasmid quantification by ddPCR. Liquid chromatography-isotope dilution mass spectrometry (LC-IDMS) was used to provide independent data for quantifying the plasmid reference material. The copy number concentration of the digested plasmid determined by ddPCR agreed well with that determined by LC-IDMS, improving both the accuracy and reliability of the plasmid reference material. The reference value, with its expanded uncertainty (k = 2), of the plasmid reference material was determined to be (5.19 ± 0.41) × 10(9) copies μL(-1) by averaging the results of two independent measurements. Consideration of the factors revealed in this study can improve the reliability and accuracy of ddPCR; thus, this method has the potential to accurately quantify DNA reference materials.

Chemotherapeutic Drug-Conjugated Microbeads Demonstrate Preferential Binding to Methylated Plasmid DNA.

PubMed

Lin, Kevin N; Grandhi, Taraka Sai Pavan; Goklany, Sheba; Rege, Kaushal

2018-04-10

Plasmid DNA (pDNA) is an attractive therapeutic biomolecule in several diseases including cancer, AIDS, cystic fibrosis, Parkinson's disease, and Alzheimer's disease. Increasing demand for plasmid DNA as a therapeutic biomolecule for transgene expression or vaccine applications necessitate novel approaches to bioprocessing. The synthesis, characterization and evaluation of aminoglycoside-derived hydrogel microbeads (Amikabeads) for pDNA binding is described previously. Here, the generation and evaluation of novel chemotherapeutic drug-conjugated microbeads for application in pDNA binding and recovery is described. Chemotherapeutic drug-conjugated Amikabeads demonstrate higher binding of methylated pDNA compared to unmethylated pDNA in presence of high salt concentrations. Desorption of plasmids from drug-conjugated microbeads is facilitated by the use of organic modifiers. The observed differences in binding methylated versus unmethylated DNA can make drug-conjugated microbeads useful in diagnostic as well as therapeutic applications. These results demonstrate that anti-cancer drugs represent a diverse set of ligands that may be exploited for molecular engineering of novel DNA binding materials for applications in delivery, diagnostics, and biomanufacturing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA packaging by the Bacillus subtilis defective bacteriophage PBSX.

PubMed Central

Anderson, L M; Bott, K F

1985-01-01

Defective bacteriophage PBSX, a resident of all Bacillus subtilis 168 chromosomes, packages fragments of DNA from all portions of the host chromosome when induced by mitomycin C. In this study, the physical process for DNA packaging of both chromosomal and plasmid DNAs was examined. Discrete 13-kilobase (kb) lengths of DNA were packaged by wild-type phage, and the process was DNase I resistant and probably occurred by a head-filling mechanism. Genetically engineered isogenic host strains having a chloramphenicol resistance determinant integrated as a genetic flag at two different regions of the chromosome were used to monitor the packaging of specific chromosomal regions. No dramatic selectivity for these regions could be documented. If the wild-type strain 168 contains autonomously replicating plasmids, especially pC194, the mitomycin C induces an increase in size of resident plasmid DNA, which is then packaged as 13-kb pieces into phage heads. In strain RB1144, which lacks substantial portions of the PBSX resident phage region, mitomycin C treatment did not affect the structure of resident plasmids. Induction of PBSX started rolling circle replication on plasmids, which then became packaged as 13-kb fragments. This alteration or cannibalization of plasmid replication resulting from mitomycin C treatment requires for its function some DNA within the prophage deletion of strain RB1144. Images PMID:3923209

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

Study of the Efficiency of the Hydroporation for Delivery of Plasmid DNA to the Cells on the Model of Toxic Neuropathy.

PubMed

Yudin, M A; Bykov, V N; Nikiforov, A S; Al-Shekhadat, R I; Ivanov, I M; Ustinova, T M

2018-04-01

We compared the efficiency of delivery of plasmid DNA (active ingredient concentration 1 mg/kg) that provides production of nerve growth factor (NGF) after intravenous administration to rats and after administration by hydroporation. The method of hydroporation ensured plasmid penetration into the liver tissue and lengthened the time of its detection in the organ. DNA concentration in 1 h after its introduction by hydroporation or intravenous route was 0.7 and 0.05 ng/mg tissue, respectively. The use of this transfection method ensured preservation of NGF DNA in the liver tissue at a level of 0.24 ng/mg of tissue 1 day after administration of the plasmid construct, while after intravenous administration, expression of the analyzed DNA was not detected in blood and liver samples. After hydroporation, the maximum of relative normalized expression of cDNA (270 rel. units) was observed after 4 h, and after 1 day, this parameter decreased to 35 rel. units. Introduction of plasmid DNA of NGF by hydroporation prevented the development of disorders of neuromuscular conduction in a rats model of toxic neuropathy induced by subacute administration of malathion in a dose of 0.5 LD 50 .

DETECTION OF DNA DAMAGE USING MELTING ANALYSIS TECHNIQUES

EPA Science Inventory

A rapid and simple fluorescence screening assay for UV radiation-, chemical-, and enzyme-induced DNA damage is reported. This assay is based on a melting/annealing analysis technique and has been used with both calf thymus DNA and plasmid DNA (puc 19 plasmid from E. coli). DN...

Reporter gene expression in dendritic cells after gene gun administration of plasmid DNA.

PubMed

Watkins, Craig; Hopkins, John; Harkiss, Gordon

2005-07-21

Dendritic cells (DC) play an integral role in plasmid DNA vaccination. However, the interaction between plasmid DNA and DC in vivo is incompletely understood. In this report, we utilise the sheep pseudoafferent cannulation model to examine the interaction between plasmid DNA encoding enhanced green fluorescent protein (pEGFP) and afferent lymph DC (ALDC) following gene gun administration. The results show that peaks of fluorescent ALDC tended to appear around days 1-4 and 9-13, then erratically thereafter for up to 2 months. Phenotypic analysis showed that EGFP+ ALDC expressed MHC class II, WC6, CD1b, and SIRPalpha markers. Plasmid, detected by PCR, was found in lymph cells and cell-free plasma on a daily basis, and was present variably for up to 2 months. Plasmid was also detected in purified CD1b+ ALDC, but the presence of plasmid did not correlate with EGFP expression by ALDC. Free EGFP in afferent lymph plasma was detectable by luminometry only after three administrations of the plasmid. The results show that gene gun administered pEGFP persisted for extended periods after a single administration, leeching out of skin on a daily basis. The plasmid was associated with both the cellular and fluid components of afferent lymph. EGFP protein appeared in afferent lymph in a pulsatile manner, but associated only with ALDC.

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

Anti-tumor function of double-promoter regulated adenovirus carrying SEA gene, in the treatment of bladder cancer.

PubMed

Hu, Jianpeng; Xuan, Xujun; Han, Conghui; Hao, Lin; Zhang, Peiying; Chen, Meng; He, Houguang; Fan, Tao; Dong, Binzheng

2012-03-01

To construct an adenovirus carrying SEA gene and regulated by telomerase reverse transcriptase (hTERT) and hypoxia-inducible factor (HIF) promoters and investigate its anti-tumor function in vitro, as well as its role in lymphocyte production. hTERT and HIF genes were cloned into adenovirus E1A and E1B shuttle plasmids. The control vector for SEA gene expression is under the regulation of CMV and SV40 promoters. Double regulation was obtained through homologous recombination. The positive clones of replicable adenovirus H2-SEA-Ad were selected by plaque assay. The adenovirus was purified, titrated, and DNA was verified by PCR. The obtained virus was used to infect EJ bladder tumor cells and the SEA Mrna, and protein expression was measured by RT-PCR, western blot, and immunofluorescence microscopy, respectively. Co-culture of lymphocytes and tumor cells was observed dynamically under microscope. The construction of shuttle plasmid p315-CSS-SEA was confirmed by PCR and DNA sequencing. Insertion of superantigen SEA gene in adenovirus (H2-SEA-Ad.SEA) was obtained by homologous recombination. In lymphocytes and tumor cell co-culture, the number of viable tumor cells in test groups was significantly lower than that in control group after 12, 24, and 48 h of treatment. Production of interleukin-2, interleukin-4, and tumor necrosis factor were higher in test groups than in control group. Expression of SEA gene in bladder tumor cells by adenoviral vector caused reduced tumor cell proliferation, as well as stimulation of inflammatory cytokine productions in co-cultures with lymphocytes.

[Construction of BAD Lentivirus Vector and Its Effect on Proliferation in A549 Cell Lines].

PubMed

Huang, Na; He, Yan-qi; Zhu, Jing; Li, Wei-min

2015-05-01

To construct the recombinant lentivirus expressing vector BAD (Bcl-2-associated death protein) gene and to study its effect on A549 cell proliferation. The BAD gene was amplified from plasmid pAV-MCMV-BAD-GFP by PCR. The purified BAD gene fragment was inserted into a lentivirus vector (pLVX-IRES-ZsGreen 1), and the insertion was identified by PCR, restriction endonuclease analysis and DNA sequencing. A549 cells were then transfected with the packaged recombinant lentivirus, and resistant cell clones were selected with flow cytometry. The expression of BAD in A549 cell lines stably transduction with a lentivirus was examined using Western blot. The effect of BAD overexpression on proliferation of A549 cells was evaluated by using CCK-8 kit. Restriction enzyme digestion and DNA sequencing showed that the full-length BAD gene (507 bp) had been successfully subcloned into the lentiviral vector to result in the recombinant vector pLVX-IRES-ZsGreen 1. Monoclonal cell lines BAD-A549 was produced after transfection with the recombinant lentivirus and selected with flow cytometry. Stable expression of BAD protein was verified by Western blot. In vitro, the OD value in BAD group was significantly lower than that of control groups from 120-144 h (P<0. 05). A549 cell lines stably transduced with a lentivirus expressing the BAD gene had been successfully generated. In vitro, BAD overexpression significantly inhibited A549 cells proliferation.

Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

PubMed

Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

2004-07-01

The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.

PubMed

Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei

2018-01-01

Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.

Cloning and characterization of an autonomous replication sequence from Coxiella burnetii.

PubMed Central

Suhan, M; Chen, S Y; Thompson, H A; Hoover, T A; Hill, A; Williams, J C

1994-01-01

A Coxiella burnetii chromosomal fragment capable of functioning as an origin for the replication of a kanamycin resistance (Kanr) plasmid was isolated by use of origin search methods utilizing an Escherichia coli host. The 5.8-kb fragment was subcloned into phagemid vectors and was deleted progressively by an exonuclease III-S1 technique. Plasmids containing progressively shorter DNA fragments were then tested for their capability to support replication by transformation of an E. coli polA strain. A minimal autonomous replication sequence (ARS) was delimited to 403 bp. Sequencing of the entire 5.8-kb region revealed that the minimal ARS contained two consensus DnaA boxes, three A + T-rich 21-mers, a transcriptional promoter leading rightwards, and potential integration host factor and factor of inversion stimulation binding sites. Database comparisons of deduced amino acid sequences revealed that open reading frames located around the ARS were homologous to genes often, but not always, found near bacterial chromosomal origins; these included identities with rpmH and rnpA in E. coli and identities with the 9K protein and 60K membrane protein in E. coli and Pseudomonas species. These and direct hybridization data suggested that the ARS was chromosomal and not associated with the resident plasmid QpH1. Two-dimensional agarose gel electrophoresis did not reveal the presence of initiating intermediates, indicating that the ARS did not initiate chromosome replication during laboratory growth of C. burnetii. Images PMID:8071197

Construction of a standard reference plasmid containing seven target genes for the detection of transgenic cotton.

PubMed

Wang, Xujing; Tang, Qiaoling; Dong, Lei; Dong, Yufeng; Su, Yueyan; Jia, Shirong; Wang, Zhixing

2014-07-01

Insect resistance and herbicide tolerance are the dominant traits of commercialized transgenic cotton. In this study, we constructed a general standard reference plasmid for transgenic cotton detection. Target genes, including the cowpea trypsin gene cptI, the insect resistance gene cry1Ab/1Ac, the herbicide tolerance gene cp4-epsps, the Agrobacterium tumefaciens nopaline synthase (Nos) terminator that exists in transgenic cotton and part of the endogenous cotton SadI gene were amplified from plasmids pCPT1, pBT, pCP4 and pBI121 and from DNA of the nontransgenic cotton line K312, respectively. The genes cry1Ab/1Ac and cptI, as well as cp4-epsps and the Nos terminator gene, were ligated together to form the fusion genes cptI-Bt and cp4-Nos, respectively, by overlapping PCR. We checked the validity of genes Sad1, cptI-Bt and cp4-Nos by DNA sequencing. Then, positive clones of cptI-Bt, cp4-Nos and Sad1 were digested with the corresponding restriction enzymes and ligated sequentially into vector pCamBIA2300, which contains the CAMV 35S promoter and nptII gene, to form the reference plasmid pMCS. Qualitative detection showed that pMCS is a good positive control for transgenic cotton detection. Real-time PCR detection efficiencies with pMCS as a calibrator ranged from 94.35% to 98.67% for the standard curves of the target genes (R(2)⩾0.998). The relative standard deviation of the mean value for the known sample was 11.95%. These results indicate that the strategy of using the pMCS plasmid as a reference material is feasible and reliable for the detection of transgenic cotton. Therefore, this plasmid can serve as a useful reference tool for qualitative and quantitative detection of single or stacked trait transgenic cotton, thus paving the way for the identification of various products containing components of transgenic cotton. Copyright © 2014 Elsevier Inc. All rights reserved.

A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.

PubMed

Brandenburger, A; Russell, S

1996-10-01

MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.

Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.

PubMed

Kuwahara, S

1978-09-01

Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid.

Plasmid pVAX1-NH36 purification by membrane and bead perfusion chromatography.

PubMed

Franco-Medrano, Diana Ivonne; Guerrero-Germán, Patricia; Montesinos-Cisneros, Rosa María; Ortega-López, Jaime; Tejeda-Mansir, Armando

2017-03-01

The demand for plasmid DNA (pDNA) has increased in response to the rapid advances in vaccines applications to prevent and treat infectious diseases caused by virus, bacteria or parasites, such as Leishmania species. The immunization protocols require large amounts of supercoiled plasmid DNA (sc-pDNA) challenging the development of efficient and profitable processes for capturing and purified pDNA molecules from large volumes of lysates. A typical bioprocess involves four steps: fermentation, primary recovery, intermediate recovery and final purification. Ion-exchange chromatography is one of the key operations in the purification schemes of pDNA owing the chemical structure of these macromolecules. The goal of this research was to compare the performance of the final purification step of pDNA using ion-exchange chromatography on columns packed with Mustang Q membranes or perfusive beads POROS 50 HQ. The experimental results showed that both matrixes could separate the plasmid pVAX1-NH36 (3936 bp) from impurities in clarified Escherichia coli lysates with an adequate resolution. In addition, a 24- and 21-fold global purification factor was obtained. An 88 and 63% plasmid recuperation was achieved with ion-exchange membranes and perfusion beads, respectively. A better understanding of perfusion-based matrices for the purification of pDNA was developed in this research.

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

EPA Science Inventory

A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

EPA Science Inventory

A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

Persistence of transferable extended-spectrum-β-lactamase resistance in the absence of antibiotic pressure.

PubMed

Cottell, Jennifer L; Webber, Mark A; Piddock, Laura J V

2012-09-01

The treatment of infections caused by antibiotic-resistant bacteria is one of the great challenges faced by clinicians in the 21st century. Antibiotic resistance genes are often transferred between bacteria by mobile genetic vectors called plasmids. It is commonly believed that removal of antibiotic pressure will reduce the numbers of antibiotic-resistant bacteria due to the perception that carriage of resistance imposes a fitness cost on the bacterium. This study investigated the ability of the plasmid pCT, a globally distributed plasmid that carries an extended-spectrum-β-lactamase (ESBL) resistance gene (bla(CTX-M-14)), to persist and disseminate in the absence of antibiotic pressure. We investigated key attributes in plasmid success, including conjugation frequencies, bacterial-host growth rates, ability to cause infection, and impact on the fitness of host strains. We also determined the contribution of the bla(CTX-M-14) gene itself to the biology of the plasmid and host bacterium. Carriage of pCT was found to impose no detectable fitness cost on various bacterial hosts. An absence of antibiotic pressure and inactivation of the antibiotic resistance gene also had no effect on plasmid persistence, conjugation frequency, or bacterial-host biology. In conclusion, plasmids such as pCT have evolved to impose little impact on host strains. Therefore, the persistence of antibiotic resistance genes and their vectors is to be expected in the absence of antibiotic selective pressure regardless of antibiotic stewardship. Other means to reduce plasmid stability are needed to prevent the persistence of these vectors and the antibiotic resistance genes they carry.

Turning self-destructing Salmonella into a universal DNA vaccine delivery platform.

PubMed

Kong, Wei; Brovold, Matthew; Koeneman, Brian A; Clark-Curtiss, Josephine; Curtiss, Roy

2012-11-20

We previously developed a biological containment system using recombinant Salmonella Typhimurium strains that are attenuated yet capable of synthesizing protective antigens. The regulated delayed attenuation and programmed self-destructing features designed into these S. Typhimurium strains enable them to efficiently colonize host tissues and allow release of the bacterial cell contents after lysis. To turn such a recombinant attenuated Salmonella vaccine (RASV) strain into a universal DNA vaccine-delivery vehicle, our approach was to genetically modify RASV strains to display a hyperinvasive phenotype to maximize Salmonella host entry and host cell internalization, to enable Salmonella endosomal escape to release a DNA vaccine into the cytosol, and to decrease Salmonella-induced pyroptosis/apoptosis that allows the DNA vaccine time to traffic to the nucleus for efficient synthesis of encoded protective antigens. A DNA vaccine vector that encodes a domain that contributes to the arabinose-regulated lysis phenotype but has a eukaryotic promoter was constructed. The vector was then improved by insertion of multiple DNA nuclear-targeting sequences for efficient nuclear trafficking and gene expression, and by increasing nuclease resistance to protect the plasmid from host degradation. A DNA vaccine encoding influenza WSN virus HA antigen delivered by the RASV strain with the best genetic attributes induced complete protection to mice against a lethal influenza virus challenge. Adoption of these technological improvements will revolutionize means for effective delivery of DNA vaccines to stimulate mucosal, systemic, and cellular protective immunities, and lead to a paradigm shift in cost-effective control and prevention of a diversity of diseases.

Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein.

PubMed Central

Scanlon, K J; Jiao, L; Funato, T; Wang, W; Tone, T; Rossi, J J; Kashani-Sabet, M

1991-01-01

The c-fos gene product Fos has been implicated in many cellular processes, including signal transduction, DNA synthesis, and resistance to antineoplastic agents. A fos ribozyme (catalytic RNA) was designed to evaluate the effects of suppressing Fos protein synthesis on expression of enzymes involved in DNA synthesis, DNA repair, and drug resistance. DNA encoding the fos ribozyme (fosRb) was cloned into the pMAMneo expression plasmid, and the resultant vector was transfected into A2780DDP cells resistant to the chemotherapeutic agent cisplatin. The parental drug-sensitive A2780S cells were transfected with the pMMV vector containing the c-fos gene. Morphological alterations were accompanied by significant changes in pharmacological sensitivity in both c-fos- and fosRb-transfected cells. pMAMneo fosRb transfectants revealed decreased c-fos gene expression, concomitant with reduced thymidylate (dTMP) synthase, DNA polymerase beta, topoisomerase I, and metallothionein IIA mRNAs. In contrast, c-myc expression was elevated after fos ribozyme action. Insertion of a mutant ribozyme, mainly capable of antisense activity, into A2780DDP cells resulted in smaller reductions in c-fos gene expression and in cisplatin resistance than the active ribozyme. These studies establish a role for c-fos in drug resistance and in mediating DNA synthesis and repair processes by modulating expression of genes such as dTMP synthase, DNA polymerase beta, and topoisomerase I. These studies also suggest the utility of ribozymes in the analysis of cellular gene expression. Images PMID:1660142

Turning self-destructing Salmonella into a universal DNA vaccine delivery platform

PubMed Central

Kong, Wei; Brovold, Matthew; Koeneman, Brian A.; Clark-Curtiss, Josephine; Curtiss, Roy

2012-01-01

We previously developed a biological containment system using recombinant Salmonella Typhimurium strains that are attenuated yet capable of synthesizing protective antigens. The regulated delayed attenuation and programmed self-destructing features designed into these S. Typhimurium strains enable them to efficiently colonize host tissues and allow release of the bacterial cell contents after lysis. To turn such a recombinant attenuated Salmonella vaccine (RASV) strain into a universal DNA vaccine-delivery vehicle, our approach was to genetically modify RASV strains to display a hyperinvasive phenotype to maximize Salmonella host entry and host cell internalization, to enable Salmonella endosomal escape to release a DNA vaccine into the cytosol, and to decrease Salmonella-induced pyroptosis/apoptosis that allows the DNA vaccine time to traffic to the nucleus for efficient synthesis of encoded protective antigens. A DNA vaccine vector that encodes a domain that contributes to the arabinose-regulated lysis phenotype but has a eukaryotic promoter was constructed. The vector was then improved by insertion of multiple DNA nuclear-targeting sequences for efficient nuclear trafficking and gene expression, and by increasing nuclease resistance to protect the plasmid from host degradation. A DNA vaccine encoding influenza WSN virus HA antigen delivered by the RASV strain with the best genetic attributes induced complete protection to mice against a lethal influenza virus challenge. Adoption of these technological improvements will revolutionize means for effective delivery of DNA vaccines to stimulate mucosal, systemic, and cellular protective immunities, and lead to a paradigm shift in cost-effective control and prevention of a diversity of diseases. PMID:23129620

Identification of facultatively heterotrophic, N/sub 2/-fixing cyanobacteria able to receive plasmid vectors from Escherichia coli by conjugation. [Anabaena spp; Nostoc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, E.; Wolk, C.P.

1985-06-01

Plasmid vectors transferable by conjugation from Escherichia coli to obligately photoautotrophic strains of Anabaena spp. are also transferred to and maintained in heterotrophic, filamentous cyanobacteria of the genus Nostoc. These organisms can be used for the genetic analysis of oxygenic photosynthesis, chromatic adaptation, nitrogen fixation, and heterocyst development.

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat

Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficientmore » in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.« less

Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.

PubMed

Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel

2018-06-16

ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.

PEGylated PEI-based biodegradable polymers as non-viral gene vectors.

PubMed

Huang, Fu-Wei; Wang, Hui-Yuan; Li, Cao; Wang, Hua-Fen; Sun, Yun-Xia; Feng, Jun; Zhang, Xian-Zheng; Zhuo, Ren-Xi

2010-11-01

Novel functional biodegradable gene vectors, poly(L-succinimide)-g-polyethylenimines-g-poly(ethylene glycol) (PSI-g-PEI-g-PEGs) were synthesized by conjugating methoxy poly(ethylene glycol) (mPEG, M(w)=750 Da) to PEI segments (M(w)=800 Da) of PSI-g-PEI. The physicochemical properties of PSI-g-PEI-g-PEGs, including buffering capability, pDNA binding ability, cytotoxicity, zeta potential and the particle size of polymer/pDNA complexes, were explored. The influence of PEGylation was discussed based on a comparative study of PSI-g-PEI-g-PEGs, PSI-g-PEI and PEI25k (M(w)=25 kDa). SEM images revealed that PSI-g-PEI-g-PEG/pDNA particles have a regular shape with the diameter ranging from 70 to 170 nm. PEGylation could suppress the aggregation occurrence between complexes, resulting in a reduction of the polymer/pDNA complex size. PSI-g-PEI-g-PEGs exhibited remarkably lower cytotoxicity compared to PSI-g-PEI and PEI25k. In 293T and HeLa cells, the obtained PSI-g-PEI-g-PEGs showed very high transfection efficiency compared to PEI25k. Fluorescent confocal microscopy demonstrated that PSI-g-PEI-g-PEGs could effectively transport pGL-3 plasmids into the nuclei of HeLa cells. Taking into account the continued high transfection efficacy and decreased toxicity after PEG modification, PSI-g-PEI-g-PEGs show great potential as the non-viral vectors for gene transfection. Copyright © 2010 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Uncoupling of sgRNAs from their associated barcodes during PCR amplification of combinatorial CRISPR screens

PubMed Central

2018-01-01

Many implementations of pooled screens in mammalian cells rely on linking an element of interest to a barcode, with the latter subsequently quantitated by next generation sequencing. However, substantial uncoupling between these paired elements during lentiviral production has been reported, especially as the distance between elements increases. We detail that PCR amplification is another major source of uncoupling, and becomes more pronounced with increased amounts of DNA template molecules and PCR cycles. To lessen uncoupling in systems that use paired elements for detection, we recommend minimizing the distance between elements, using low and equal template DNA inputs for plasmid and genomic DNA during PCR, and minimizing the number of PCR cycles. We also present a vector design for conducting combinatorial CRISPR screens that enables accurate barcode-based detection with a single short sequencing read and minimal uncoupling. PMID:29799876

Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.

PubMed

Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.

Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

PubMed Central

Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

Infrared laser effects at fluences used for treatment of dentin hypersensitivity on DNA repair in Escherichia coli and plasmids

NASA Astrophysics Data System (ADS)

Rocha Teixeira, Gleica; da Silva Marciano, Roberta; da Silva Sergio, Luiz Philippe; Castanheira Polignano, Giovanni Augusto; Roberto Guimarães, Oscar; Geller, Mauro; de Paoli, Flavia; de Souza da Fonseca, Adenilson

2014-12-01

Low-intensity infrared lasers are proposed in clinical protocols based on biostimulative effects, yet dosimetry is inaccurate and their effects on DNA at therapeutic doses are controversial. The aim of this work was to evaluate the effects of low-intensity infrared laser on survival and induction of filamentation of Escherichia coli cells, and induction of DNA lesions in bacterial plasmids. E. coli cultures were exposed to laser (808 nm, 100 mW, 40 and 60 J/cm2) to study bacterial survival and filamentation. Also, bacterial plasmids were exposed to laser to study DNA lesions by electrophoretic profile and action of DNA repair enzymes. Data indicate low-intensity infrared laser has no effect on survival of E. coli wild type and exonuclease III, but decreases the survival of formamidopyrimidine DNA glycosylase/MutM protein and endonuclease III deficient cells in stationary growth phase, induces bacterial filamentation, does not alter the electrophoretic profile of plasmids in agarose gels and does not alter the electrophoretic profile of plasmids incubated with endonuclease III, formamidopyrimidine DNA glycosylase/MutM protein and exonuclease III. Our findings show that low-intensity laser exposure causes DNA lesions at sub-lethal level and induces cellular mechanisms involved in repair of oxidative lesions in DNA. Studies about laser dosimetry and safety strategies are necessary for professionals and patients exposed to low-intensity lasers at therapeutic doses.

An automated microplate-based method for monitoring DNA strand breaks in plasmids and bacterial artificial chromosomes

PubMed Central

Rock, Cassandra; Shamlou, Parviz Ayazi; Levy, M. Susana

2003-01-01

A method is described for high-throughput monitoring of DNA backbone integrity in plasmids and artificial chromosomes in solution. The method is based on the denaturation properties of double-stranded DNA in alkaline conditions and uses PicoGreen fluorochrome to monitor denaturation. In the present method, fluorescence enhancement of PicoGreen at pH 12.4 is normalised by its value at pH 8 to give a ratio that is proportional to the average backbone integrity of the DNA molecules in the sample. A good regression fit (r2 > 0.98) was obtained when results derived from the present method and those derived from agarose gel electrophoresis were compared. Spiking experiments indicated that the method is sensitive enough to detect a proportion of 6% (v/v) molecules with an average of less than two breaks per molecule. Under manual operation, validation parameters such as inter-assay and intra-assay variation gave values of <5% coefficient of variation. Automation of the method showed equivalence to the manual procedure with high reproducibility and low variability within wells. The method described requires as little as 0.5 ng of DNA per well and a 96-well microplate can be analysed in 12 min providing an attractive option for analysis of high molecular weight vectors. A preparation of a 116 kb bacterial artificial chromosome was subjected to chemical and shear degradation and DNA integrity was tested using the method. Good correlation was obtained between time of chemical degradation and shear rate with fluorescence response. Results obtained from pulsed- field electrophoresis of sheared samples were in agreement with those obtained using the microplate-based method. PMID:12771229

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

[Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

PubMed

Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

2011-01-01

To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P < 0.01). For antibody isotype analysis, the IgG1 isotype antibody titers in all test groups were significantly higher than of IgG2a (P < 0.01). The high-level spleen lymphocyte stimulation index was observed in the three test groups under the stimulation with Con A, higher than that in control groups (P < 0.01). LTB gene could enhance the humoral immune response of CPV VP2 gene vaccine in mice.

Immune Responses Induced by Gene Gun or Intramuscular Injection of DNA Vaccines That Express Immunogenic Regions of the Serine Repeat Antigen from Plasmodium falciparum

PubMed Central

Belperron, Alexia A.; Feltquate, David; Fox, Barbara A.; Horii, Toshihiro; Bzik, David J.

1999-01-01

The liver- and blood-stage-expressed serine repeat antigen (SERA) of Plasmodium falciparum is a candidate protein for a human malaria vaccine. We compared the immune responses induced in mice immunized with SERA-expressing plasmid DNA vaccines delivered by intramuscular (i.m.) injection or delivered intradermally by Gene Gun immunization. Mice were immunized with a pcdna3 plasmid encoding the entire 47-kDa domain of SERA (amino acids 17 to 382) or the N-terminal domain (amino acids 17 to 110) of SERA. Minimal antibody responses were detected following DNA vaccination with the N-terminal domain of SERA, suggesting that the N-terminal domain alone is not highly immunogenic by this route of vaccine delivery. Immunization of mice by Gene Gun delivery of the 47-kDa domain of SERA elicited a significantly higher serum antibody titer to the antigen than immunization of mice by i.m. injection with the same plasmid did. The predominant isotype subclass of the antibodies elicited to the SERA protein following i.m. and Gene Gun immunizations with SERA plasmid DNA was immunoglobulin G1. Coimmunization of mice with SERA plasmid DNA and a plasmid expressing the hepatitis B surface antigen (pCMV-s) by the i.m. route resulted in higher anti-SERA titers than those generated in mice immunized with the SERA DNA plasmid alone. Vaccination with DNA may provide a viable alternative or may be used in conjunction with protein-based subunit vaccines to maximize the efficacy of a human malaria vaccine that includes immunogenic regions of the SERA protein. PMID:10496891

The effect of conjugation to gold nanoparticles on the ability of low molecular weight chitosan to transfer DNA vaccine.

PubMed

Zhou, Xianfeng; Zhang, Xizhen; Yu, Xianghui; Zha, Xiao; Fu, Qiuan; Liu, Bin; Wang, Xueyun; Chen, Yan; Chen, Yue; Shan, Yaming; Jin, Yinghua; Wu, Yongge; Liu, Junqiu; Kong, Wei; Shen, Jiacong

2008-01-01

Nonviral gene delivery systems based on conventional high molecular weight chitosans are efficient as DNA vaccine delivery system, but have poor physical properties such as aggregated shapes, low solubility at neutral pH, high viscosity at concentrations used for in vivo delivery and a slow onset of action. Furthermore, Chitosan oligomers shorter than 14 monomers units were recently found to form only weak complexes with DNA, resulting in physically unstable polyplexes in vitro and in vivo. Here, low molecular weight chitosans with an average molecular mass of 6kDa (Chito6) have been covalently attached to gold nanoparticles (GNPs), and the potency of the resulting Chito6-GNPs conjugates as vectors for the delivery of plasmid DNA has been investigated in vitro and in vivo. After delivery by intramuscular immunization in BALB/c mice, the Chito6-GNPs conjugates induced an enhanced serum antibody response 10 times more potent than naked DNA vaccine. Additionally, in contrast to naked DNA, the Chito6-GNPs conjugates induced potent cytotoxic T lymphocyte responses at a low dose.

Molecular transformation, gene cloning, and gene expression systems for filamentous fungi

USGS Publications Warehouse

Gold, Scott E.; Duick, John W.; Redman, Regina S.; Rodriguez, Rusty J.

2001-01-01

This chapter discusses the molecular transformation, gene cloning, and gene expression systems for filamentous fungi. Molecular transformation involves the movement of discrete amounts of DNA into cells, the expression of genes on the transported DNA, and the sustainable replication of the transforming DNA. The ability to transform fungi is dependent on the stable replication and expression of genes located on the transforming DNA. Three phenomena observed in bacteria, that is, competence, plasmids, and restriction enzymes to facilitate cloning, were responsible for the development of molecular transformation in fungi. Initial transformation success with filamentous fungi, involving the complementation of auxotrophic mutants by exposure to sheared genomic DNA or RNA from wt isolates, occurred with low transformation efficiencies. In addition, it was difficult to retrieve complementing DNA fragments and isolate genes of interest. This prompted the development of transformation vectors and methods to increase efficiencies. The physiological studies performed with fungi indicated that the cell wall could be removed to generate protoplasts. It was evident that protoplasts could be transformed with significantly greater efficiencies than walled cells.

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice.

PubMed

Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter

2014-11-01

Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.

Systemically administered gp100 encoding DNA vaccine for melanoma using water-in-oil-in-water multiple emulsion delivery systems.

PubMed

Kalariya, Mayurkumar; Amiji, Mansoor M

2013-09-10

The purpose of this study was to develop a water-in-oil-in-water (W/O/W) multiple emulsions-based vaccine delivery system for plasmid DNA encoding the gp100 peptide antigen for melanoma immunotherapy. The gp100 encoding plasmid DNA was encapsulated in the inner-most aqueous phase of squalane oil containing W/O/W multiple emulsions using a two-step emulsification method. In vitro transfection ability of the encapsulated plasmid DNA was investigated in murine dendritic cells by transgene expression analysis using fluorescence microscopy and ELISA methods. Prophylactic immunization using the W/O/W multiple emulsions encapsulated the gp100 encoding plasmid DNA vaccine significantly reduced tumor volume in C57BL/6 mice during subsequent B16-F10 tumor challenge. In addition, serum Th1 cytokine levels and immuno-histochemistry of excised tumor tissues indicated activation of cytotoxic T-lymphocytes mediated anti-tumor immunity causing tumor growth suppression. The W/O/W multiple emulsions-based vaccine delivery system efficiently delivers the gp100 plasmid DNA to induce cell-mediated anti-tumor immunity. Copyright © 2013 Elsevier B.V. All rights reserved.

New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.

PubMed

Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel

2016-03-01

Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.

The mechanism and control of DNA transfer by the conjugative relaxase of resistance plasmid pCU1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nash, Rebekah Potts; Habibi, Sohrab; Cheng, Yuan

2010-11-15

Bacteria expand their genetic diversity, spread antibiotic resistance genes, and obtain virulence factors through the highly coordinated process of conjugative plasmid transfer (CPT). A plasmid-encoded relaxase enzyme initiates and terminates CPT by nicking and religating the transferred plasmid in a sequence-specific manner. We solved the 2.3 {angstrom} crystal structure of the relaxase responsible for the spread of the resistance plasmid pCU1 and determined its DNA binding and nicking capabilities. The overall fold of the pCU1 relaxase is similar to that of the F plasmid and plasmid R388 relaxases. However, in the pCU1 structure, the conserved tyrosine residues (Y18,19,26,27) that aremore » required for DNA nicking and religation were displaced up to 14 {angstrom} out of the relaxase active site, revealing a high degree of mobility in this region of the enzyme. In spite of this flexibility, the tyrosines still cleaved the nic site of the plasmid's origin of transfer, and did so in a sequence-specific, metal-dependent manner. Unexpectedly, the pCU1 relaxase lacked the sequence-specific DNA binding previously reported for the homologous F and R388 relaxase enzymes, despite its high sequence and structural similarity with both proteins. In summary, our work outlines novel structural and functional aspects of the relaxase-mediated conjugative transfer of plasmid pCU1.« less

Unique Helicase Determinants in the Essential Conjugative TraI Factor from Salmonella enterica Serovar Typhimurium Plasmid pCU1

DOE Office of Scientific and Technical Information (OSTI.GOV)

McLaughlin, K. J.; Nash, R. P.; Redinbo, M. R.

The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. Inmore » this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.« less

Degradable polymeric carrier for the delivery of IL-10 plasmid DNA to prevent autoimmune insulitis of NOD mice.

PubMed

Koh, J J; Ko, K S; Lee, M; Han, S; Park, J S; Kim, S W

2000-12-01

Recently, we have reported that biodegradable poly [alpha-(4-aminobutyl)-L-glycolic acid] (PAGA) can condense and protect plasmid DNA from DNase I. In this study, we investigated whether the systemic administration of pCAGGS mouse IL-10 (mIL-10) expression plasmid complexed with PAGA can reduce the development of insulitis in non-obese diabetic (NOD) mice. PAGA/mIL-10 plasmid complexes were stable for more than 60 min, but the naked DNA was destroyed within 10 min by DNase I. The PAGA/DNA complexes were injected into the tail vein of 3-week-old NOD mice. Serum mIL-10 level peaked at 5 days after injection, and could be detected for more than 9 weeks. The prevalence of severe insulitis on 12-week-old NOD mice was markedly reduced by the intravenous injection of PAGA/DNA complex (15.7%) compared with that of naked DNA injection (34.5%) and non-treated controls (90.9%). In conclusion, systemic administration of pCAGGS mIL-10 plasmid/PAGA complexes can reduce the severity of insulitis in NOD mice. This study shows that the PAGA/DNA complex has the potential for the prevention of autoimmune diabetes mellitus. Gene Therapy (2000) 7, 2099-2104.

Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

PubMed

Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

2012-07-01

The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein

PubMed Central

Sepulveda, Edgardo; Vogelmann, Jutta

2011-01-01

Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692

Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †

PubMed Central

Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.

2008-01-01

The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685

Degradable polyethylenimine derivate coupled to a bifunctional peptide R13 as a new gene-delivery vector

PubMed Central

Liu, Kehai; Wang, Xiaoyu; Fan, Wei; Zhu, Qing; Yang, Jingya; Gao, Jing; Gao, Shen

2012-01-01

Background To solve the efficiency versus cytotoxicity and tumor-targeting problems of polyethylenimine (PEI) used as a nonviral gene delivery vector, a degradable PEI derivate coupled to a bifunctional peptide R13 was developed. Methods First, we synthesized a degradable PEI derivate by crosslinking low-molecular-weight PEI with pluronic P123, then used tumor-targeting peptide arginine-glycine-aspartate-cysteine (RGDC), in conjunction with the cell-penetrating peptide Tat (49–57), to yield a bifunctional peptide RGDC-Tat (49–57) named R13, which can improve cell selection and increase cellular uptake, and, lastly, adopted R13 to modify the PEI derivates so as to prepare a new polymeric gene vector (P123-PEI-R13). The new gene vector was characterized in terms of its chemical structure and biophysical parameters. We also investigated the specificity, cytotoxicity, and gene transfection efficiency of this vector in αvβ3-positive human cervical carcinoma Hela cells and murine melanoma B16 cells in vitro. Results The vector showed controlled degradation, strong targeting specificity to αvβ3 receptor, and noncytotoxicity in Hela cells and B16 cells at higher doses, in contrast to PEI 25 KDa. The particle size of P123-PEI-R13/DNA complexes was around 100–250 nm, with proper zeta potential. The nanoparticles can protect plasmid DNA from being digested by DNase I at a concentration of 6 U DNase I/μg DNA. The nanoparticles were resistant to dissociation induced by 50% fetal bovine serum and 600 μg/mL sodium heparin. P123-PEI-R13 also revealed higher transfection efficiency in two cell lines as compared with PEI 25 KDa. Conclusion P123-PEI-R13 is a potential candidate as a safe and efficient gene-delivery carrier for gene therapy. PMID:22412301

Cell-surface glycosaminoglycans inhibit intranuclear uptake but promote post-nuclear processes of polyamidoamine dendrimer-pDNA transfection.

PubMed

Ziraksaz, Zarrintaj; Nomani, Alireza; Ruponen, Marika; Soleimani, Masoud; Tabbakhian, Majid; Haririan, Ismaeil

2013-01-23

Interaction of cell-surface glycosaminoglycans (GAGs) with non-viral vectors seems to be an important factor which modifies the intracellular destination of the gene complexes. Intracellular kinetics of polyamidoamine (PAMAM) dendrimer as a non-viral vector in cellular uptake, intranuclear delivery and transgene expression of plasmid DNA with regard to the cell-surface GAGs has not been investigated until now. The physicochemical properties of the PAMAM-pDNA complexes were characterized by photon correlation spectroscopy, atomic force microscopy, zeta measurement and agarose gel electrophoresis. The transfection efficiency and toxicity of the complexes at different nitrogen to phosphate (N:P) ratios were determined using various in vitro cell models such as human embryonic kidney cells, chinese hamster ovary cells and its mutants lacking cell-surface GAGs or heparan sulphate proteoglycans (HSPGs). Cellular uptake, nuclear uptake and transfection efficiency of the complexes were determined using flow cytometry and optimized cell-nuclei isolation with quantitative real-time PCR and luciferase assay. Physicochemical studies showed that PAMAM dendrimer binds pDNA efficiently, forms small complexes with high positive zeta potential and transfects cells properly at N:P ratios around 5 and higher. The cytotoxicity could be a problem at N:Ps higher than 10. GAGs elimination caused nearly one order of magnitude higher pDNA nuclear uptake and more than 2.6-fold higher transfection efficiency than CHO parent cells. However, neither AUC of nuclear uptake, nor AUC of transfection affected significantly by only cell-surface HSPGs elimination and interesting data related to the effect of GAGs on intranuclear pDNA using PAMAM as delivery vector have been reported in this study. Presented data shows that the rate-limiting step of PAMAM-pDNA complexes transfection is located after delivery to the cell nucleus and GAGs are regarded as an inhibitor of the intranuclear delivery step, while slightly promotes transgene expression. Copyright © 2012 Elsevier B.V. All rights reserved.

High Efficiency Transformation of Cultured Tobacco Cells 1

PubMed Central

An, Gynheung

1985-01-01

Tobacco calli were transformed at levels up to 50% by cocultivation of tobacco cultured cells with Agrobacterium tumefaciens harboring the binary transfer-DNA vector, pGA472, containing a kanamycin resistance marker. Transformation frequency was dependent on the physiological state of the tobacco cells, the nature of Agrobacterium strain and, less so, on the expression of the vir genes of the tumor-inducing plasmid. Maximum transformation frequency was obtained with exponentially growing plant cells, suggesting that rapid growth of plant cells is an essental factor for efficient transformation of higher plants. Images Fig. 1 PMID:16664453

Novel RepA-MCM proteins encoded in plasmids pTAU4, pORA1 and pTIK4 from Sulfolobus neozealandicus

PubMed Central

Greve, Bo; Jensen, Susanne; Phan, Hoa; Brügger, Kim; Zillig, Wolfram; She, Qunxin; Garrett, Roger A.

2005-01-01

Three plasmids isolated from the crenarchaeal thermoacidophile Sulfolobus neozealandicus were characterized. Plasmids pTAU4 (7,192 bp), pORA1 (9,689 bp) and pTIK4 (13,638 bp) show unusual properties that distinguish them from previously characterized cryptic plasmids of the genus Sulfolobus. Plasmids pORA1 and pTIK4 encode RepA proteins, only the former of which carries the novel polymerase–primase domain of other known Sulfolobus plasmids. Plasmid pTAU4 encodes a mini-chromosome maintenance protein homolog and no RepA protein; the implications for DNA replication are considered. Plasmid pORA1 is the first Sulfolobus plasmid to be characterized that does not encode the otherwise highly conserved DNA-binding PlrA protein. Another encoded protein appears to be specific for the New Zealand plasmids. The three plasmids should provide useful model systems for functional studies of these important crenarchaeal proteins. PMID:15876565

Fate of plasmids containing Mu DNA: chromosome association and mobilization.

PubMed

Bialy, H; Waggoner, B T; Pato, M L

1980-01-01

The fluorescent dye, diamidinophenylindole-dihydrochloride (DAPI) can be added to CsCl gradients to enhance the density resolution of DNA species, independent of their topological configurations. When Proteus mirabilis and Escherichia coli strains carrying an RP4::Mucts plasmid were examined with the use of such a technique, it was found that after thermal induction of the prophage essentially al of the plasmid DNA became associated with the chromosome. This quantitative association is detergent-RNase- and pronase-resistant and dependent on the expression of Mu genes. The association is temporally, and probably functionally, correlated with the onset of Mu DNA replication. Genetic studies with F'::mini Mu plasmids indicate that some of the association results in stable Hfr formation, and does not require the product of Mu gene B.

Transfection efficiency of chitosan and thiolated chitosan in retinal pigment epithelium cells: A comparative study

PubMed Central

Oliveira, Ana V.; Silva, Andreia P.; Bitoque, Diogo B.; Silva, Gabriela A.; Rosa da Costa, Ana M.

2013-01-01

OBJECTIVE: Gene therapy relies on efficient vector for a therapeutic effect. Efficient non-viral vectors are sought as an alternative to viral vectors. Chitosan, a cationic polymer, has been studied for its gene delivery potential. In this work, disulfide bond containing groups were covalently added to chitosan to improve the transfection efficiency. These bonds can be cleaved by cytoplasmic glutathione, thus, releasing the DNA load more efficiently. MATERIALS AND METHODS: Chitosan and thiolated chitosan nanoparticles (NPs) were prepared in order to obtain a NH3+:PO4− ratio of 5:1 and characterized for plasmid DNA complexation and release efficiency. Cytotoxicity and gene delivery studies were carried out on retinal pigment epithelial cells. RESULTS: In this work, we show that chitosan was effectively modified to incorporate a disulfide bond. The transfection efficiency of chitosan and thiolated chitosan varied according to the cell line used, however, thiolation did not seem to significantly improve transfection efficiency. CONCLUSION: The apparent lack of improvement in transfection efficiency of the thiolated chitosan NPs is most likely due to its size increase and charge inversion relatively to chitosan. Therefore, for retinal cells, thiolated chitosan does not seem to constitute an efficient strategy for gene delivery. PMID:23833516

Brownian Ratchet Mechanism for Faithful Segregation of Low-Copy-Number Plasmids.

PubMed

Hu, Longhua; Vecchiarelli, Anthony G; Mizuuchi, Kiyoshi; Neuman, Keir C; Liu, Jian

2017-04-11

Bacterial plasmids are extrachromosomal DNA that provides selective advantages for bacterial survival. Plasmid partitioning can be remarkably robust. For high-copy-number plasmids, diffusion ensures that both daughter cells inherit plasmids after cell division. In contrast, most low-copy-number plasmids need to be actively partitioned by a conserved tripartite ParA-type system. ParA is an ATPase that binds to chromosomal DNA; ParB is the stimulator of the ParA ATPase and specifically binds to the plasmid at a centromere-like site, parS. ParB stimulation of the ParA ATPase releases ParA from the bacterial chromosome, after which it takes a long time to reset its DNA-binding affinity. We previously demonstrated in vitro that the ParA system can exploit this biochemical asymmetry for directed cargo transport. Multiple ParA-ParB bonds can bridge a parS-coated cargo to a DNA carpet, and they can work collectively as a Brownian ratchet that directs persistent cargo movement with a ParA-depletion zone trailing behind. By extending this model, we suggest that a similar Brownian ratchet mechanism recapitulates the full range of actively segregated plasmid motilities observed in vivo. We demonstrate that plasmid motility is tuned as the replenishment rate of the ParA-depletion zone progressively increases relative to the cargo speed, evolving from diffusion to pole-to-pole oscillation, local excursions, and, finally, immobility. When the plasmid replicates, the daughters largely display motilities similar to that of their mother, except that when the single-focus progenitor is locally excursive, the daughter foci undergo directed segregation. We show that directed segregation maximizes the fidelity of plasmid partition. Given that local excursion and directed segregation are the most commonly observed modes of plasmid motility in vivo, we suggest that the operation of the ParA-type partition system has been shaped by evolution for high fidelity of plasmid segregation. Published by Elsevier Inc.