Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

[Construction and expression analysis of the zebrafish heart-specific transgenetic vector based on Tol2 transposable element].

PubMed

Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun

2010-02-01

In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.

Plasmid Vectors for Xylella fastidiosa Utilizing a Toxin-Antitoxin System for Stability in the Absence of Antibiotic Selection.

PubMed

Burbank, Lindsey P; Stenger, Drake C

2016-08-01

The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacterial genetics but there are only a limited number of plasmid vectors available that replicate in X. fastidiosa, and even fewer that are retained without antibiotic selection. Two plasmids are described here that show stable replication in X. fastidiosa and are effective for gene complementation both in vitro and in planta. Plasmid maintenance is facilitated by incorporation of the PemI/PemK plasmid addiction system, consisting of PemK, an endoribonuclease toxin, and its cognate antitoxin, PemI. Vector pXf20pemIK utilizes a native X. fastidiosa replication origin as well as a high-copy-number pUC origin for propagation in Escherichia coli cloning strains. Broad-host-range vector pBBR5pemIK is a medium- to low-copy-number plasmid based on the pBBR1 backbone. Both plasmids are maintained for extended periods of time in the absence of antibiotic selection, as well as up to 14 weeks in grapevine, without affecting bacterial fitness. These plasmids present an alternative to traditional complementation and expression vectors which rely on antibiotic selection for plasmid retention.

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Single inverted terminal repeats of the Junonia coenia Densovirus promotes somatic chromosomal integration of vector plasmids in insect cells and supports high efficiency expression

USDA-ARS?s Scientific Manuscript database

Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...

Identification of Essential Genetic Baculoviral Elements for Recombinant Protein Expression by Transactivation in Sf21 Insect Cells.

PubMed

Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop

2016-01-01

The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.

Improvement of a yeast self-excising integrative vector by prevention of expression leakage of the intronated Cre recombinase gene during plasmid maintenance in Escherichia coli.

PubMed

Agaphonov, Michael O

2017-12-01

The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Plasmids of corynebacteria.

PubMed

Deb, J K; Nath, N

1999-06-01

Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.

PubMed

Brandenburger, A; Russell, S

1996-10-01

MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression

PubMed Central

Camps, Manel

2010-01-01

ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961

Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

PubMed

Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

2011-12-01

The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

PubMed

Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

2017-07-21

Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

[Construction of the superantigen SEA transfected laryngocarcinoma cells].

PubMed

Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua

2013-04-01

To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.

PubMed

Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A

2008-01-01

Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

[Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

PubMed

Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

2013-04-01

This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

Tightly-wound miniknot vectors for gene therapy: a potential improvement over supercoiled minicircle DNA.

PubMed

Tolmachov, Oleg E

2010-04-01

Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.

Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

USDA-ARS?s Scientific Manuscript database

A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

[Construction and expression of a eukaryotic expression vector containing human CR2-Fc fusion protein].

PubMed

Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong

2014-01-01

To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.

[Experimental study of human umbilical cord blood derived stromal cells transfected with recombinant adenoviral vector co-expressing VCAM-1 and GFP].

PubMed

Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu

2008-06-01

This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

PubMed

Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

2011-07-01

Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

Expression Plasmids for Use in Candida glabrata

PubMed Central

Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

2013-01-01

We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

Enhanced Eradication of Lymphoma by Tumor-Specific Cytotoxic T Cells Secreting an Engineered Tumor-Specific Immunotoxin

DTIC Science & Technology

2008-06-01

verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus

Electrotransfer of Plasmid Vector DNA into Muscle

NASA Astrophysics Data System (ADS)

Miyazaki, Satsuki; Miyazaki, Jun-Ichi

Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

NASA Technical Reports Server (NTRS)

Ludwig, D. L.; Bruschi, C. V.

1991-01-01

The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis.

PubMed

Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo

2015-01-01

To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.

Novel Minicircle Vector for Gene Therapy in Murine Myocardial Infarction

PubMed Central

Huang, Mei; Chen, ZhiYing; Hu, Shijun; Jia, Fangjun; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Kay, Mark A.; Wu, Joseph C.

2011-01-01

Background Conventional plasmids for gene therapy produce low-level and short-term gene expression. In this study, we develop a novel non-viral vector which robustly and persistently expresses the hypoxia inducible factor-1 alpha (HIF-1α) therapeutic gene in the heart, leading to functional benefits following myocardial infarction (MI). Methods and Results We first created minicircles carrying double fusion (MC-DF) reporter gene consisting of firefly luciferase and enhanced green fluorescent protein (Fluc-eGFP) for noninvasive measurement of transfection efficiency. Mouse C2C12 myoblasts and normal FVB mice were used for in vitro and in vivo confirmation, respectively. Bioluminescence imaging (BLI) showed stable minicircle gene expression in the heart for >12 weeks and the activity level was 5.6±1.2 fold stronger than regular plasmid at day 4 (P<0.01). Next, we created minicircles carrying hypoxia inducible factor-1 alpha (MC-HIF-1α) therapeutic gene for treatment of MI. Adult FVB mice underwent LAD ligation and were injected intramyocardially with (1) MC-HIF-1α, (2) regular plasmid carrying HIF-1α (PL-HIF-1α) as positive control, and (3) PBS as negative control (n=10/group). Echocardiographic study showed a significantly greater improvement of left ventricular ejection fraction (LVEF) in the minicircle group (51.3%±3.6%) compared to regular plasmid group (42.3%±4.1%) and saline group (30.5%±2.8%) at week 4 (P<0.05 for both). Histology demonstrated increased neoangiogenesis in both treatment groups. Finally, Western blot showed minicircles express >50% higher HIF-1α level than regular plasmid. Conclusion Taken together, this is the first study to demonstrate that minicircles can significantly improve transfection efficiency, duration of transgene expression, and cardiac contractility. Given the serious drawbacks associated with most viral vectors, we believe this novel non-viral vector can be of great value for cardiac gene therapy protocols. PMID:19752373

Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

PubMed Central

Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

2012-01-01

We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

Engineering new mycobacterial vaccine design for HIV–TB pediatric vaccine vectored by lysine auxotroph of BCG

PubMed Central

Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan

2014-01-01

In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961

Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †

PubMed Central

Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.

2008-01-01

The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685

Characterization of a minimal pKW2124 replicon from Weissella cibaria KLC140 and its application for the construction of the Weissella expression vector pKUCm1

PubMed Central

Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon

2015-01-01

A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882

[Cloning and gene expression in lactic acid bacteria].

PubMed

Bondarenko, V M; Beliavskaia, V A

2000-01-01

The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

PubMed

Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

2009-11-20

In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.

Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

PubMed Central

Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

2010-01-01

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

Construction of novel shuttle expression vectors for gene expression in Bacillus subtilis and Bacillus pumilus.

PubMed

Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong

2015-01-01

A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.

Design of a Retrovirus-Derived Vector for Expression and Transduction of Exogenous Genes in Mammalian Cells

PubMed Central

Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard

1983-01-01

We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426

Methods for Gene Transfer to the Central Nervous System

PubMed Central

Kantor, Boris; Bailey, Rachel M.; Wimberly, Keon; Kalburgi, Sahana N.; Gray, Steven J.

2015-01-01

Gene transfer is an increasingly utilized approach for research and clinical applications involving the central nervous system (CNS). Vectors for gene transfer can be as simple as an unmodified plasmid, but more commonly involve complex modifications to viruses to make them suitable gene delivery vehicles. This chapter will explain how tools for CNS gene transfer have been derived from naturally occurring viruses. The current capabilities of plasmid, retroviral, adeno-associated virus, adenovirus, and herpes simplex virus vectors for CNS gene delivery will be described. These include both focal and global CNS gene transfer strategies, with short- or long-term gene expression. As is described in this chapter, an important aspect of any vector is the cis-acting regulatory elements incorporated into the vector genome that control when, where, and how the transgene is expressed. PMID:25311922

Gene Amplification by PCR and Subcloning into a GFP-Fusion Plasmid Expression Vector as a Molecular Biology Laboratory Course

ERIC Educational Resources Information Center

Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.

2004-01-01

A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Liposomal lipid and plasmid DNA delivery to B16/BL6 tumors after intraperitoneal administration of cationic liposome DNA aggregates.

PubMed

Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B

1999-05-01

The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.

Generation of HIV-1 based bi-cistronic lentiviral vectors for stable gene expression and live cell imaging.

PubMed

Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N

2012-10-01

The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.

A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

PubMed Central

Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

2013-01-01

Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

A human parvovirus, adeno-associated virus, as a eucaryotic vector: Transient expression and encapsidation of the procaryotic gene for chloramphenicol acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tratschin, J.D.; West, M.H.P.; Sandbank, T.

1984-10-01

The authors have used the defective human parvovirus adeno-associated virus (AAV) as a novel eurocaryotic vector (parvector) for the expression of a foreign gene in human cells. The recombinant, pAV2, contains the AAV genome in a pBR322-derived bacterial plasmid. When pAV2 is transfected into human cells together with helper adenovirus particles, the AAV genome is rescued from the recombinant plasmid and replicated to produce infectious AAV particles at high efficiency. To create a vector, we inserted a procaryotic sequence coding for chloramphenicol acetyltransferase (CAT) into derivatives of pAV2 following either of the AAV promoters p/sub 40/ (pAVHiCAT) and p/sub 19/more » (pAVBcCAT). When transfected into human 293 cells or HeLa cells, pAVHiCAT expressed CAT activity in the absence of adenovirus. In the presence of adenovirus, this vector produced increased amounts of CAT activity and the recombinant AAV-CAT genome was replicated. In 293 cells, pAVBcCAT expressed a similar amount of CAT activity in the absence or presence of adenovirus and the recombinant AAV-CAT genome was not replicated. In HeLa cells, pAVBcCAT expressed low levels of CAT activity, but this level was elevated by coinfection with adenovirus particles or by cotransfection with a plasmid which expressed the adenovirus early region 1A (E1A) product. The E1A product is a transcriptional activator and is expressed in 293 cells. Thus, expression from two AAV promoters is differentially regulated: expression from p/sub 19/ is increased by E1A, whereas p/sub 40/ yields high levels of constitutive expression in the absence of E1A. Both AAV vectors were packaged into AAV particles by complementation with wild-type AAV and yielded CAT activity when subsequently infected into cells in the presence of adenovirus.« less

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

PubMed Central

Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

2013-01-01

IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.

PubMed

Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng

2007-01-01

Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.

Molecular cloning and production of caprine recombinant Oct4 protein for generation induced pluripotent stem cells.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Singh, Surender; Kumar, Sudarshan; Kaushik, Jai K; Mohanty, Ashok K; Malakar, Dhruba

2015-12-01

Oct4, pluripotency marker and transcription factor, expresses in embryonic stem cells. It plays a pivotal role in determination of stem cells fate. Up and down regulation of Oct4 causes differentiation of embryonic stem cells. It is one of the main transcription factors which remained concerned in every study related to induced pluripotent stem cell. Here, we report the production of goat Oct4 protein using plasmid and lentiviral based vectors. Firstly, Oct4 ORF was cloned in pAcGFP1-N1 plasmid vector and positive clones were screened with colony PCR. Oct4 was over-expressed in CHO-K1 cell line and expression was confirmed by observing green florescent protein expression in CHO-K1 cells. Secondly, Oct4 lentiviral expression construct has been prepared using pLenti-gw vector. Oct4 ORF was cloned into pLenti4/V5-DEST vector and viral particles were produced in 293FT cells. Oct4 viral particles were used to infect goat fibroblast cells. Oct4 expression was observed and confirmed in transfected goat fibroblast cells using RT-PCR. Detection of Oct4 protein in western blotting assay affirmed the capacity of over-expression of our Oct4 lentiviral vector. The lentiviral expression construct and recombinant Oct4 protein may be used for reprogramming of somatic cell into induced pluripotent stem cell.

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1991-03-26

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.

Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes.

PubMed

Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan

2008-04-01

The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.

Structural and physiological studies of the Escherichia coli histidine operon inserted into plasmid vectors.

PubMed Central

Bruni, C B; Musti, A M; Frunzio, R; Blasi, F

1980-01-01

A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1987-08-28

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE PAGES

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...

2018-02-01

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae

PubMed Central

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137

Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.

PubMed

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.

Genetic modification of bone-marrow mesenchymal stem cells and hematopoietic cells with human coagulation factor IX-expressing plasmids.

PubMed

Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram

2016-05-01

Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

“Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete”

PubMed Central

2012-01-01

Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256

Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae.

PubMed

Gritz, L; Davies, J

1983-11-01

The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.

Efficient and sustained IGF-1 expression in the adipose tissue-derived stem cells mediated via a lentiviral vector.

PubMed

Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao

2015-02-01

The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

PubMed

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

[The induction of neovascularization in chorioallantoic membrane of chicken embryos transfected by a recombinant plasmid containing human angiogenin gene].

PubMed

Avdeeva, S V; Khaĭdarova, N V; Logunov, D Iu; Neugodova, G L; Sevast'ianova, G A; Tarantul, V Z; Naroditskiĭ, B S

2003-01-01

A method was elaborated to evaluate the biological activity of expression products of gene in the plasmid vectors, which are crucial for the synthesis of growth factor of blood vessels. It was proven as possible that the chrioallantonic membrane (CAM) of chicken's embryos could be transfected by recombinant plasmids containing both the reporter and target genes. The efficiency of CAM transfection was assessed by a plasmid carrying the reporter gene of green fluorescent protein (GFP). Finally, it was demonstrated that, at an infiltration of the recombinant plasmid containing the human angiogenine gene, its expression products induce the neovascularization in the CAM cells of chicken's embryos and stimulate an accretion in vessels of the 1st, 2nd and 3d orders.

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

PubMed

Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

2010-06-01

Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

Copy number variability of expression plasmids determined by cell sorting and Droplet Digital PCR.

PubMed

Jahn, Michael; Vorpahl, Carsten; Hübschmann, Thomas; Harms, Hauke; Müller, Susann

2016-12-19

Plasmids are widely used for molecular cloning or production of proteins in laboratory and industrial settings. Constant modification has brought forth countless plasmid vectors whose characteristics in terms of average plasmid copy number (PCN) and stability are rarely known. The crucial factor determining the PCN is the replication system; most replication systems in use today belong to a small number of different classes and are available through repositories like the Standard European Vector Architecture (SEVA). In this study, the PCN was determined in a set of seven SEVA-based expression plasmids only differing in the replication system. The average PCN for all constructs was determined by Droplet Digital PCR and ranged between 2 and 40 per chromosome in the host organism Escherichia coli. Furthermore, a plasmid-encoded EGFP reporter protein served as a means to assess variability in reporter gene expression on the single cell level. Only cells with one type of plasmid (RSF1010 replication system) showed a high degree of heterogeneity with a clear bimodal distribution of EGFP intensity while the others showed a normal distribution. The heterogeneous RSF1010-carrying cell population and one normally distributed population (ColE1 replication system) were further analyzed by sorting cells of sub-populations selected according to EGFP intensity. For both plasmids, low and highly fluorescent sub-populations showed a remarkable difference in PCN, ranging from 9.2 to 123.4 for ColE1 and from 0.5 to 11.8 for RSF1010, respectively. The average PCN determined here for a set of standardized plasmids was generally at the lower end of previously reported ranges and not related to the degree of heterogeneity. Further characterization of a heterogeneous and a homogeneous population demonstrated considerable differences in the PCN of sub-populations. We therefore present direct molecular evidence that the average PCN does not represent the true number of plasmid molecules in individual cells.

Production and purification of non replicative canine adenovirus type 2 derived vectors.

PubMed

Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard

2013-12-03

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

PubMed Central

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

PubMed

Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

2013-08-20

Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.

Live, attenuated Salmonella typhimurium vectoring Campylobacter antigens.

PubMed

Sizemore, Donata R; Warner, Beth; Lawrence, Julie; Jones, Amy; Killeen, Kevin P

2006-05-01

We describe the evaluation of three live, attenuated deltaphoP/Q Salmonella enteric serovar Typhimurium strains expressing PEB1 minus its signal sequence (PEB1-ss) from three different plasmids: a pBR-based asd plasmid, an arabinose-based runaway plasmid, which each expressed PEB1-ss in the bacterial cytosol, and a PEB1::HlyA fusion plasmid that directs secretion of PEB1-ss into the extracellular milieu. Serum IgG responses specific for PEB1-ss were induced by pBR-derived and runaway plasmids, with 100 and 90% seroconversion, respectively, at a 1:500 dilution of anti-sera as measured by Western blot analysis, while the PEB1-ss::HlyA fusion plasmid induced serum IgG in only 20% of the mice. Although significant levels of anti-PEB serum IgG were induced, no protection against oral Campylobacter jejuni challenge was observed.

Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

PubMed

Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika

2013-01-01

Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

PubMed

Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

2017-01-01

Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.

Development of a Novel Escherichia coli-Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide.

PubMed

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.

Therapeutic Benefits and Adverse Effects of Combined Proangiogenic Gene Therapy in Mouse Critical Leg Ischemia.

PubMed

Lebas, Benoît; Galley, Julien; Renaud-Gabardos, Edith; Pujol, Françoise; Lenfant, Françoise; Garmy-Susini, Barbara; Chaufour, Xavier; Prats, Anne-Catherine

2017-04-01

Critical leg ischemia (CLI) represents the ultimate stage of peripheral arterial disease. Despite current surgery advances, patients with CLI have limited therapeutic options. Therapeutic angiogenesis thus appears as a powerful approach, aiming to stimulate vessel formation by angiogenic molecules administration. In this context, combined gene therapy has been proved to be the most efficient. The present study aims to compare, in a preclinical mouse model, the therapeutic benefit of a combination of 2 angiogenic factors fibroblast growth factor 2 (FGF2) and Cyr61 using plasmid and viral vectors, able to generate short- or long-term transgene expression in the leg, respectively. Two therapeutic genes, FGF2 and Cyr61, were introduced into internal ribosome entry site-based expression vectors (FGFiCyr) allowing co-expression of the 2 transgenes. The proangiogenic plasmid pC-FGFiCyr was assessed by intramuscular administration followed by electrotransfer into ischemic legs. To generate long-term transgene expression, the FGFiCyr bicistronic cassette was introduced into an adenoassociated virus-derived vector (rAAV). The rAAV treatment was performed either before or immediately after surgery. Therapeutic effects were analyzed by laser Doppler imaging, clinical score, and angiography. The plasmid pC-FGFiCyr improved revascularization, reperfusion, and clinical score. Surprisingly, when AAV-FGFiCyr was injected 21 or 28 days before surgery, the proangiogenic rAAV was drastically deleterious on all measured parameters. In contrast, when administrated shortly after surgery, AAV-FGFiCyr generated therapeutic benefits, with a significantly better clinical score than after treatment with the plasmid. Therapeutic effects of the angiogenic combination FGF2-Cyr61 is observed with short-term transgene expression, but the treatment is significantly more efficient when a long-term expression viral vector is used. However, the rAAV-FGFiCyr generated therapeutic benefit only when injected in an ischemic leg, whereas the same dose of rAAV exhibited deleterious effects when administrated to healthy animals. These data may contribute to the understanding of the moderate success of proangiogenic treatments in CLI gene therapy clinical assays. Copyright © 2016 Elsevier Inc. All rights reserved.

SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.

PubMed

Schwartz, Matthew L; Jorgensen, Erik M

2016-04-01

In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.

Long-term and stable correction of uremic anemia by intramuscular injection of plasmids containing hypoxia-regulated system of erythropoietin expression

PubMed Central

Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang

2012-01-01

Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115

Deletion of the Clostridium thermocellum recA gene reveals that it is required for thermophilic plasmid replication but not plasmid integration at homologous DNA sequences.

PubMed

Groom, Joseph; Chung, Daehwan; Kim, Sun-Ki; Guss, Adam; Westpheling, Janet

2018-05-28

A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (≥ 60 °C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a result also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ∆recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.

Deletion of the Clostridium thermocellum recA Gene Reveals that it is Required for Thermophilic Plasmid Replication but not Plasmid Integration at Homologous DNA Sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chung, Daehwan; Groom, Joseph; Kim, Sun-Ki

A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (>/= 60 degrees C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a resultmore » also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ..delta..recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.« less

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus

PubMed Central

Rodriguez, Michelle D.; Paul, Zubin; Wood, Charles E.; Rice, Kelly C.; Triplett, Eric W.

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus. These three reporter plasmids are available through BEI Resources. PMID:29312199

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus.

PubMed

Rodriguez, Michelle D; Paul, Zubin; Wood, Charles E; Rice, Kelly C; Triplett, Eric W

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus . These three reporter plasmids are available through BEI Resources.

Folic acid-decorated polyamidoamine dendrimer mediates selective uptake and high expression of genes in head and neck cancer cells.

PubMed

Xu, Leyuan; Kittrell, Shannon; Yeudall, W Andrew; Yang, Hu

2016-11-01

Folic acid (FA)-decorated polyamidoamine dendrimer G4 (G4-FA) was synthesized and studied for targeted delivery of genes to head and neck cancer cells expressing high levels of folate receptors (FRs). Cellular uptake, targeting specificity, cytocompatibility and transfection efficiency were evaluated. G4-FA competes with free FA for the same binding site. G4-FA facilitates the cellular uptake of DNA plasmids in a FR-dependent manner and selectively delivers plasmids to FR-high cells, leading to enhanced gene expression. G4-FA is a suitable vector to deliver genes selectively to head and neck cancer cells. The fundamental understandings of G4-FA as a vector and its encouraging transfection results for head and neck cancer cells provided support for its further testing in vivo.

Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

PubMed Central

2014-01-01

Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

A novel bicistronic sensor vector for detecting caspase-3 activation.

PubMed

Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah

2015-01-01

Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.

The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model.

PubMed

Suarez, D L; Schultz-Cherry, S

2000-01-01

Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.

A plasmid-based reverse genetics system for influenza A virus.

PubMed Central

Pleschka, S; Jaskunas, R; Engelhardt, O G; Zürcher, T; Palese, P; García-Sastre, A

1996-01-01

A reverse genetics system for negative-strand RNA viruses was first successfully developed for influenza viruses. This technology involved the transfection of in vitro-reconstituted ribonucleoprotein (RNP) complexes into influenza virus-infected cells. We have now developed a method that allows intracellular reconstitution of RNP complexes from plasmid-based expression vectors. Expression of a viral RNA-like transcript is achieved from a plasmid containing a truncated human polymerase I (polI) promoter and a ribozyme sequence that generates the desired 3' end by autocatalytic cleavage. The polI-driven plasmid is cotransfected into human 293 cells with polII-responsive plasmids that express the viral PB1, PB2, PA, and NP proteins. This exclusively plasmid-driven system results in the efficient transcription and replication of the viral RNA-like reporter and allows the study of cis- and trans-acting signals involved in the transcription and replication of influenza virus RNAs. Using this system, we have also been able to rescue a synthetic neuraminidase gene into a recombinant influenza virus. This method represents a convenient alternative to the previously established RNP transfection system. PMID:8648766

[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].

PubMed

Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua

2013-02-01

To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.

GeneGuard: A modular plasmid system designed for biosafety.

PubMed

Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom

2015-03-20

Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.

A novel dual vector coexpressing PhiX174 lysis E gene and staphylococcal nuclease A gene on the basis of lambda promoter pR and pL, respectively.

PubMed

Fu, Lixia; Lu, Chengping

2013-06-01

Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).

A stable shuttle vector system for efficient genetic complementation of Helicobacter pylori strains by transformation and conjugation.

PubMed

Heuermann, D; Haas, R

1998-03-01

A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.

Gene transfer with a vector expressing Maxi-K from a smooth muscle-specific promoter restores erectile function in the aging rat.

PubMed

Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J

2008-03-01

Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.

[Construction and expression of recombinant human serum albumin-EPO fusion protein].

PubMed

Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing

2011-05-01

OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production.

PubMed

Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

PubMed Central

Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731

Vector Development for the Expression of Foreign Proteins in the Vaccine Strain Brucella abortus S19

PubMed Central

Comerci, Diego J.; Pollevick, Guido D.; Vigliocco, Ana M.; Frasch, Alberto C. C.; Ugalde, Rodolfo A.

1998-01-01

A vector for the expression of foreign antigens in the vaccine strain Brucella abortus S19 was developed by using a DNA fragment containing the regulatory sequences and the signal peptide of the Brucella bcsp31 gene. This fragment was cloned in broad-host-range plasmid pBBR4MCS, resulting in plasmid pBEV. As a reporter protein, a repetitive antigen of Trypanosoma cruzi was used. The recombinant fusion protein is stably expressed and secreted into the Brucella periplasmic space, inducing a good antibody response against the T. cruzi antigen. The expression of the repetitive antigen in Brucella neither altered its growth pattern nor generated a toxic or lethal effect during experimental infection. The application of this strategy for the generation of live recombinant vaccines and the tagging of B. abortus S19 vaccine is discussed. This is the first time that a recombinant protein has been expressed in the periplasm of brucellae. PMID:9673273

Versatile plasmid-based expression systems for Gram-negative bacteria--General essentials exemplified with the bacterium Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Schwab, Helmut; Koefinger, Petra

2015-12-25

The Gram-negative bacterium Escherichia coli is currently the most efficient and widely used prokaryotic host for recombinant protein and metabolite production. However, due to some limitations and to various interesting features of other Gram-negative bacteria efficient vector systems applicable to a broad range are desired. Basic building blocks for plasmid-based vectors include besides the need for a suitable selection marker in the first line a proper replication and maintenance system. In addition to these basic requirements, further elements are needed for Gram-negative bacteria beyond E. coli, such as Pseudomonas pudita, Ralstonia eutropha, Burkholderia glumae or Acinetobacter sp.. Established building blocks have to be adapted and new building blocks providing the desired functions need to be identified and exploited. This minireview addresses so far described and used genetic elements for broad host range replication, efficient plasmid maintenance, and conjugative plasmid transfer as well as expression elements and protein secretion signals. The industrially important bacterium R. eutropha H16 was chosen as a model organism to provide specific data on the effectivity and utility of building blocks based on such genetic elements. Copyright © 2015 Elsevier B.V. All rights reserved.

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp.

PubMed

Zhou, Jingxiang; Xue, Jiangdong; Wang, Qiuju; Zhu, Xia; Li, Xingwei; Lv, Wenliang; Zhang, Dongming

2014-06-01

In order to construct the recombinant plasmid of pIRES-ORF81, the nucleic acid isolated from Koi herpes virus-CJ (KHV-CJ) strains was used as a template to insert the ORF81 gene fragments amplified by PCR into the pIRES-neo, a kind of eukaryotic expression vector. Using Western blotting analysis, it was verified that ORF81 gene protein can be expressed correctly by pIRES-ORF81, after MFC cells were transfected. The recombinant plasmid pIRES-ORF81 was set into three immunization dose gradients: 1, 10, and 50 μg/carp. Empty plasmid group, PBS group, and blank control group were set simultaneously. Giving intramuscular injections to healthy carps with an average body mass of 246 ± 20 g, indirect ELISA was used to regularly determine antibody levels after three times immunization injection. Neutralizing antibodies were detected by neutralization assay. The results of inoculation tests showed that the pIRES-ORF81 recombinant plasmid can induce the production of carp-specific antibodies. The differences of immune effect between the three different doses of immune gradients were not significant (P > 0.05), but they can induce the production of neutralizing antibodies. After 25 d of inoculation, carp mortality of pIRES-neo empty vector treatment groups was 85%, while the carp mortality of eukaryotic expression recombinant plasmid pIRES-ORF81 injected with three different doses of immune gradients was 20, 17.5, and 12.5%, respectively. Differences in comparison to the control group were highly significant (P < 0.01). However, histopathological section of immunohistochemistry organization revealed no significant changes. It demonstrated that the DNA vaccine pIRES-ORF81 constructed in the experiment displayed a good protective effect against KHV, which had the potential to industrial applications.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

PubMed

Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

2010-06-01

To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

Genetic transformation of a clinical (genital tract), plasmid-free isolate of Chlamydia trachomatis: engineering the plasmid as a cloning vector.

PubMed

Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N

2013-01-01

Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.

Adeno-associated virus vectors can be efficiently produced without helper virus.

PubMed

Matsushita, T; Elliger, S; Elliger, C; Podsakoff, G; Villarreal, L; Kurtzman, G J; Iwaki, Y; Colosi, P

1998-07-01

The purpose of this work was to develop an efficient method for the production of adeno-associated virus (AAV) vectors in the absence of helper virus. The adenovirus regions that mediate AAV vector replication were identified and assembled into a helper plasmid. These included the VA, E2A and E4 regions. When this helper plasmid was cotransfected into 293 cells, along with plasmids encoding the AAV vector, and rep and cap genes, AAV vector was produced as efficiently as when using adenovirus infection as a source of help. CMV-driven constructs expressing the E4orf6 and the 72-M(r), E2A proteins were able to functionally replace the E4 and E2A regions, respectively. Therefore the minimum set of genes required to produce AAV helper activity equivalent to that provided by adenovirus infection consists of, or is a subset of, the following genes: the E4orf6 gene, the 72-M(r), E2A protein gene, the VA RNA genes and the E1 region. AAV vector preparations made with adenovirus and by the helper virus-free method were essentially indistinguishable with respect to particle density, particle to infectivity ratio, capsimer ratio and efficiency of muscle transduction in vivo. Only AAV vector preparations made by the helper virus-free method were not reactive with anti-adenovirus sera.

Development of a Novel Escherichia coli–Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide

PubMed Central

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli–Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 (rhsmo) and alcohol dehydrogenase gene from Leifsonia sp. S749 (lsadh), in K. rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase (gapdh) promotor. The RhSMO–LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent–water biphasic reaction system to efficiently convert styrene into (S)-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells. PMID:29230202

A Generic Protocol for Intracellular Expression of Recombinant Proteins in Bacillus subtilis.

PubMed

Phan, Trang; Huynh, Phuong; Truong, Tuom; Nguyen, Hoang

2017-01-01

Bacillus subtilis (B. subtilis) is a potential and attractive host for the production of recombinant proteins. Different expression systems for B. subtilis have been developed recently, and various target proteins have been recombinantly synthesized and purified using this host. In this chapter, we introduce a generic protocol to express a recombinant protein in B. subtilis. It includes protocols for (1) using our typical expression vector (plasmid pHT254) to introduce a target gene, (2) transformation of the target vector into B. subtilis, and (3) evaluation of the actual expression of a recombinant protein.

A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.

PubMed

Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu

2015-05-01

Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A Bivalent Typhoid Live Vector Vaccine Expressing both Chromosome- and Plasmid-Encoded Yersinia pestis Antigens Fully Protects against Murine Lethal Pulmonary Plague Infection

PubMed Central

Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.

2014-01-01

Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120

[Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

PubMed

Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

2016-01-01

Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

PubMed

Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

2010-01-01

Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community

PubMed Central

Cormier, Catherine Y.; Mohr, Stephanie E.; Zuo, Dongmei; Hu, Yanhui; Rolfs, Andreas; Kramer, Jason; Taycher, Elena; Kelley, Fontina; Fiacco, Michael; Turnbull, Greggory; LaBaer, Joshua

2010-01-01

The Protein Structure Initiative Material Repository (PSI-MR; http://psimr.asu.edu) provides centralized storage and distribution for the protein expression plasmids created by PSI researchers. These plasmids are a resource that allows the research community to dissect the biological function of proteins whose structures have been identified by the PSI. The plasmid annotation, which includes the full length sequence, vector information and associated publications, is stored in a freely available, searchable database called DNASU (http://dnasu.asu.edu). Each PSI plasmid is also linked to a variety of additional resources, which facilitates cross-referencing of a particular plasmid to protein annotations and experimental data. Plasmid samples can be requested directly through the website. We have also developed a novel strategy to avoid the most common concern encountered when distributing plasmids namely, the complexity of material transfer agreement (MTA) processing and the resulting delays this causes. The Expedited Process MTA, in which we created a network of institutions that agree to the terms of transfer in advance of a material request, eliminates these delays. Our hope is that by creating a repository of expression-ready plasmids and expediting the process for receiving these plasmids, we will help accelerate the accessibility and pace of scientific discovery. PMID:19906724

Cloning of cellulase genes from acidothermus cellulolyticus

DOEpatents

Lastick, deceased, Stanley M.; Tucker, Melvin P.; Grohmann, Karel

1996-01-01

A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase acitivty in E. coli.

Promiscuous plasmid replication in thermophiles: Use of a novel hyperthermophilic replicon for genetic manipulation of Clostridium thermocellum at its optimum growth temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Groom, Joseph; Chung, Daehwan; Olson, Daniel G.

2016-01-29

Clostridium thermocellum is a leading candidate for the consolidated bioprocessing of lignocellulosic biomass for the production of fuels and chemicals. A limitation to the engineering of this strain is the availability of stable replicating plasmid vectors for homologous and heterologous expression of genes that provide improved and/or novel pathways for fuel production. Current vectors relay on replicons from mesophilic bacteria and are not stable at the optimum growth temperature of C. thermocellum. To develop more thermostable genetic tools for C. thermocellum, we constructed vectors based on the hyperthermophilic Caldicellulosiruptor bescii replicon pBAS2. Autonomously replicating shuttle vectors based on pBAS2 reproduciblymore » transformed C. thermocellum at 60 °C and were maintained in multiple copy. Promoters, selectable markers and plasmid replication proteins from C. bescii were functional in C. thermocellum. Phylogenetic analyses of the proteins contained on pBAS2 revealed that the replication initiation protein RepL is unique among thermophiles. Lastly, these results suggest that pBAS2 may be a broadly useful replicon for other thermophilic Firmicutes.« less

Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

PubMed

Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

2015-10-01

A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Cloning of cellulase genes from Acidothermus cellulolyticus

DOEpatents

Lastick, S.M.; Tucker, M.P.; Grohmann, K.

1996-05-07

A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase activity in E. coli. 5 figs.

Construction and Characterization of an in-vivo Linear Covalently Closed DNA Vector Production System

PubMed Central

2012-01-01

Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697

Construction and characterization of an in-vivo linear covalently closed DNA vector production system.

PubMed

Nafissi, Nafiseh; Slavcev, Roderick

2012-12-06

While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.

Intranasal Delivery of pGDNF Nanoparticles for Parkinson's Disease

NASA Astrophysics Data System (ADS)

Harmon, Brendan Trevor

Parkinson's disease (PD) is a progressive neurodegenerative disorder that primarily affects the dopaminergic A9 nigrostriatal tract. For dopamine neurons specifically, glial cell-derived neurotrophic factor (GDNF) has been shown to promote their survival and proliferation both in culture and in vivo. GDNF has also proven to be neuroprotective and restorative in various animal models of PD and some human clinical trials. However, its delivery to the brain has required invasive surgical routes which are not clinically practical for many patients. The main objective of this project was to test intranasal delivery to the brain of a nanoparticle vector incorporating an expression plasmid for GDNF (pGDNF). The intranasal route circumvents the blood-brain barrier, allowing larger sized vectors into the central nervous system while avoiding peripheral distribution. This approach would provide a renewable source of GDNF within the target areas of the brain, the striatum and the substantia nigra (SN) without the need for surgical injections or frequent re-dosing. A PEGylated polylysine compacted plasmid nanoparticle vector (PEG-CK30), developed by Copernicus Therapeutics, Inc., has been shown to transfect neurons and glial cells in vivo while lacking the safety issues present with other vectors. The first goal of this work was to determine if these PEG-CK30 compacted plasmid nanoparticles can successfully transfect cells and express the reporter protein, enhanced green fluorescent protein (eGFP) in the rat brain after intranasal administration. Initial in vivo experiments utilized the expression plasmid pCG, expressing eGFP under the fast-acting cytomegalovirus (CMV) promoter. Intranasal administration of pCG nanoparticles resulted in evidence of transfection of brain cells, as shown both qualitatively, by GFP-immunohistochemistry, and quantitatively, by GFP-ELISA. Expression was detected throughout the rat brain two days post-administration. Following the proof-of-principle study with pCG, a new plasmid was created by Copernicus Therapeutics, Inc. to better mimic their long-lasting pGDNF plasmid while providing both GDNF as well as the reporter function of eGFP. This eGFP-GDNF plasmid was used to monitor expression and cell-types transfected. This expression plasmid, called pUGG, was first characterized in vitro to verify protein expression. Transfection experiments in SHEP-1 neuroblastoma cells, ventral midbrain cultures, and N27 dopaminergic cells all demonstrated that pUGG expressed bioactive eGFP and GDNF. However, cleavage of the two proteins did not occur and the expressed protein emerged as a fusion construct which was not detectable by GDNF-ELISA, although it was detected by GFP-ELISA. The next goal was to determine if pUGG was able to transfect cells in vivo in rat brain. Direct striatal injection of pUGG nanoparticles showed significant eGFP expression at the site of injection both 7 and 14 days post-administration with no difference in eGFP expression between the two time-points. GFP-immunohistochemistry at the striatal injection site revealed expression of eGFP-positive cells as well as evidence of GDNF's bioactivity as indicated by neurite outgrowth. Moving forward, we administered pUGG nanoparticles intranasally to rats and found significant expression seven days later throughout the brain, with highest levels in the forebrain areas (olfactory bulb and frontal cortex). Significant expression was also seen along the rostral-caudal axis of the brain compared with naked pUGG plasmid. The final goal of this work was to examine whether intranasal pGDNF pre-treatment could generate sufficient GDNF to protect SN dopamine neurons after a unilateral 6-hydroxydopmaine (6-OHDA) lesion, a common animal model for PD. Copernicus' pGDNF plasmid was utilized for the neuroprotection experiments to avoid possible confounds due to the GFP fusion produced by pUGG. Tyrosine hydroxylase-immunostaining density was used as a marker for dopamine neurons in the SN and their nerve terminals in the striatum. Dopamine cell counts were also performed in the SN. Intranasal delivery of pGDNF significantly protected dopamine neurons in the rat 6-OHDA model of PD. This was revealed in three ways. First, pGDNF treatments reduced amphetamine-induced circling behavior, suggesting a prevention of dopamine loss on the 6-OHDA-lesioned side. Second, pGDNF increased TH staining density and dopamine cell counts in the SN on the 6-OHDA-lesioned side. This result was direct evidence of neuroprotection of dopamine cell bodies. Third, pGDNF increased TH staining density in the striatum on the 6-OHDA-lesioned side. This result was direct evidence of protection of dopaminergic nerve terminals. Intranasal pGDNF nanoparticles provided greater neuroprotection than naked pGDNF for all measures. This result was consistent with our previous findings that pGDNF nanoparticles produce more GDNF in brain than the naked plasmid. Collectively, these results demonstrate that intranasal delivery of Copernicus' pGDNF nanoparticles has great clinical potential as a new, non-invasive and non-viral gene therapy approach for early stage Parkinson's disease. By promoting recovery of damaged neurons and preventing further cell loss, symptoms may be reversed and disease progression may be stopped.

Sequence and immunogenicity of a clinically approved novel measles virus vaccine vector

PubMed Central

Zuniga, Amando; Liniger, Mathias; Morin, Teldja Neige Azzouz; Marty, René R.; Wiegand, Marian; Ilter, Orhan; Weibel, Sara; Billeter, Martin A.; Knuchel, Marlyse C.; Naim, Hussein Y.

2013-01-01

The measles virus vaccine (MVbv) is a clinically certified and well-tolerated vaccine strain that has been given both parenterally and mucosally. It has been extensively used in children and has proven to be safe and effective in eliciting protective immunity. This specific strain was therefore chosen to generate a measles viral vector. The genome of the commercial MVbv vaccine strain was isolated, sequenced and a plasmid, p(+)MVb, enabling transcription of the viral antigenome and rescue of MVb, was constructed. Phylogenic and phenotypic analysis revealed that MVbv and the rescued MVb constitute another evolutionary branch within the hitherto classified measles vaccines. Plasmid p(+)MVb was modified by insertion of artificial MV-type transcription units (ATUs) for the generation of recombinant viruses (rMVb) expressing additional proteins. Replication characteristics and immunogenicity of rMVb vectors were similar to the parental MVbv and to other vaccine strains. The expression of the additional proteins was stable over 10 serial virus transfers, which corresponds to an amplification greater than 1020. The excellent safety record and its efficient application as aerosol may add to the usefulness of the derived vectors. PMID:23324616

[Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

2009-04-01

This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

[Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

PubMed

Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

2007-07-01

To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

An improved ternary vector system for Agrobacterium-mediated rapid maize transformation.

PubMed

Anand, Ajith; Bass, Steven H; Wu, Emily; Wang, Ning; McBride, Kevin E; Annaluru, Narayana; Miller, Michael; Hua, Mo; Jones, Todd J

2018-05-01

A simple and versatile ternary vector system that utilizes improved accessory plasmids for rapid maize transformation is described. This system facilitates high-throughput vector construction and plant transformation. The super binary plasmid pSB1 is a mainstay of maize transformation. However, the large size of the base vector makes it challenging to clone, the process of co-integration is cumbersome and inefficient, and some Agrobacterium strains are known to give rise to spontaneous mutants resistant to tetracycline. These limitations present substantial barriers to high throughput vector construction. Here we describe a smaller, simpler and versatile ternary vector system for maize transformation that utilizes improved accessory plasmids requiring no co-integration step. In addition, the newly described accessory plasmids have restored virulence genes found to be defective in pSB1, as well as added virulence genes. Testing of different configurations of the accessory plasmids in combination with T-DNA binary vector as ternary vectors nearly doubles both the raw transformation frequency and the number of transformation events of usable quality in difficult-to-transform maize inbreds. The newly described ternary vectors enabled the development of a rapid maize transformation method for elite inbreds. This vector system facilitated screening different origins of replication on the accessory plasmid and T-DNA vector, and four combinations were identified that have high (86-103%) raw transformation frequency in an elite maize inbred.

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Hybrid Adeno-Associated Viral Vectors Utilizing Transposase-Mediated Somatic Integration for Stable Transgene Expression in Human Cells

PubMed Central

Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja

2013-01-01

Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154

A new series of yeast shuttle vectors for the recovery and identification of multiple plasmids from Saccharomyces cerevisiae.

PubMed

Frazer, LilyAnn Novak; O'Keefe, Raymond T

2007-09-01

The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.

Cloning-independent plasmid construction for genetic studies in streptococci

PubMed Central

Xie, Zhoujie; Qi, Fengxia; Merritt, Justin

2013-01-01

Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in E. coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5×103 – 2×105 CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli – Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. PMID:23673081

Cloning-independent plasmid construction for genetic studies in streptococci.

PubMed

Xie, Zhoujie; Qi, Fengxia; Merritt, Justin

2013-08-01

Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in Escherichia coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5 × 10³ to 2 × 10⁵ CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli-Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. Copyright © 2013 Elsevier B.V. All rights reserved.

Dextran and protamine-based solid lipid nanoparticles as potential vectors for the treatment of X-linked juvenile retinoschisis.

PubMed

Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R

2012-04-01

The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.

The Tol2 transposon system mediates the genetic engineering of T-cells with CD19-specific chimeric antigen receptors for B-cell malignancies.

PubMed

Tsukahara, T; Iwase, N; Kawakami, K; Iwasaki, M; Yamamoto, C; Ohmine, K; Uchibori, R; Teruya, T; Ido, H; Saga, Y; Urabe, M; Mizukami, H; Kume, A; Nakamura, M; Brentjens, R; Ozawa, K

2015-02-01

Engineered T-cell therapy using a CD19-specific chimeric antigen receptor (CD19-CAR) is a promising strategy for the treatment of advanced B-cell malignancies. Gene transfer of CARs to T-cells has widely relied on retroviral vectors, but transposon-based gene transfer has recently emerged as a suitable nonviral method to mediate stable transgene expression. The advantages of transposon vectors compared with viral vectors include their simplicity and cost-effectiveness. We used the Tol2 transposon system to stably transfer CD19-CAR into human T-cells. Normal human peripheral blood lymphocytes were co-nucleofected with the Tol2 transposon donor plasmid carrying CD19-CAR and the transposase expression plasmid and were selectively propagated on NIH3T3 cells expressing human CD19. Expanded CD3(+) T-cells with stable and high-level transgene expression (~95%) produced interferon-γ upon stimulation with CD19 and specifically lysed Raji cells, a CD19(+) human B-cell lymphoma cell line. Adoptive transfer of these T-cells suppressed tumor progression in Raji tumor-bearing Rag2(-/-)γc(-/-) immunodeficient mice compared with control mice. These results demonstrate that the Tol2 transposon system could be used to express CD19-CAR in genetically engineered T-cells for the treatment of refractory B-cell malignancies.

Rule-Based Design of Plant Expression Vectors Using GenoCAD.

PubMed

Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean

2015-01-01

Plant synthetic biology requires software tools to assist on the design of complex multi-genic expression plasmids. Here a vector design strategy to express genes in plants is formalized and implemented as a grammar in GenoCAD, a Computer-Aided Design software for synthetic biology. It includes a library of plant biological parts organized in structural categories and a set of rules describing how to assemble these parts into large constructs. Rules developed here are organized and divided into three main subsections according to the aim of the final construct: protein localization studies, promoter analysis and protein-protein interaction experiments. The GenoCAD plant grammar guides the user through the design while allowing users to customize vectors according to their needs. Therefore the plant grammar implemented in GenoCAD will help plant biologists take advantage of methods from synthetic biology to design expression vectors supporting their research projects.

Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.

PubMed

Dad, A-B K; Ramakrishna, S; Song, M; Kim, H

2014-11-01

Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.

Optimization of a one-step heat-inducible in vivo mini DNA vector production system.

PubMed

Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.

Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System

PubMed Central

Wettig, Shawn; Slavcev, Roderick A.

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704

Immune Efficacy of a Genetically Engineered Vaccine against Lymphocystis Disease Virus: Analysis of Different Immunization Strategies

PubMed Central

Zheng, Fengrong; Sun, Xiuqin; Wu, Xing'an; Liu, Hongzhan; Li, Jiye; Wu, Suqi; Zhang, Jinxing

2011-01-01

Here, we report the construction of a vaccine against lymphocystis disease virus (LCDV) using nucleic acid vaccination technology. A fragment of the major capsid protein encoding gene from an LCDV isolated from China (LCDV-cn) was cloned into an eukaryotic expression vector pEGFP-N2, yielding a recombinant plasmid pEGFP-N2-LCDV-cn0.6 kb. This plasmid was immediately expressed after liposomal transfer into the Japanese flounder embryo cell line. The recombinant plasmid was inoculated into Japanese flounder via two routes (intramuscular injection and hypodermic injection) at three doses (0.1, 5, and 15 μg), and then T-lymphopoiesis in different tissues and antibodies raised against LCDV were evaluated. The results indicated that this recombinant plasmid induced unique humoral or cell-mediated immune responses depending on the inoculation route and conferred immune protection. Furthermore, the humoral immune responses and protective effects were significantly increased at higher vaccine doses via the two injection routes. Plasmid pEGFP-N2-LCDV0.6 kb is therefore a promising vaccine candidate against LCDV in Japanese flounder. PMID:21789044

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

PubMed

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Blocking of SMAD4 expression by shRNA effectively inhibits fibrogenesis of human hepatic stellate cells.

PubMed

Khanizadeh, Sayyad; Ravanshad, Mehrdad; Hosseini, SeyedYounes; Davoodian, Parivash; Nejati Zadeh, Azim; Sarvari, Jamal

2015-01-01

In this study, to clarify the SMAD4 blocking impact on fibrosis process, we investigated its down-regulation by shRNA on activated human LX-2 cell, in vitro. Liver fibrosis is a critical consequence of chronic damage to the liver that can progress toward advanced diseases, liver cirrhosis and hepatocellular carcinoma (HCC). Different SMAD proteins play as major mediators in the fibrogenesis activity of hepatic stellate cells through TGF-β pathways, but the extent of SMAD4 as a co-SMAD protein remained less clear. vector expressing verified shRNA targeting human SMAD4 gene was transfected into LX-2 cells. The GFP expressing plasmid was transfected in the same manner as a control group while leptin treated cells were employed as positive controls. Subsequently, total RNA was extracted and real-time PCR was performed to measure the mRNA levels of SMAD4, COL-1A1, α-SMA, TGF-β and TIMP-1. Furthermore, trypan blue exclusion was performed to test the effect of plasmid transfection and SMAD4 shutting-down on cellular viability. The results indicated that the expression of SMAD4was down-regulated following shRNA transfection intoLX-2 cells (P<0.001). The gene expression analysis of fibrotic genes in LX-2 cells showed that SMAD4 blocking by shRNA significantly reduced the expression level of fibrotic genes when compared to control plasmids (P<0.001). Vector expressing SMAD4-shRNA induced no significant cytotoxic or proliferative effects on LX-2 cells as determined by viability assay (P<0.05). The results of this study suggested that knockdown of SMAD4 expression in stellate cell can control the progression of fibrogenesis through TGF-β pathway blocking.

The Aspartate-Semialdehyde Dehydrogenase of Edwardsiella ictaluri and Its Use as Balanced-Lethal System in Fish Vaccinology

PubMed Central

Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy

2010-01-01

asdA mutants of Gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd+ plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd+ plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric Gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd+ expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd+ vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd+ plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry. PMID:21209920

The aspartate-semialdehyde dehydrogenase of Edwardsiella ictaluri and its use as balanced-lethal system in fish vaccinology.

PubMed

Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy

2010-12-29

asdA mutants of gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd(+) plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd(+) plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd(+) expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd(+) vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd(+) plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry.

Molecular cloning and expression in Saccharomyces cerevisiae and Neurospora crassa of the invertase gene from Neurospora crassa.

PubMed

Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A

1989-10-01

A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.

Saccharomyces cerevisiae Shuttle vectors.

PubMed

Gnügge, Robert; Rudolf, Fabian

2017-05-01

Yeast shuttle vectors are indispensable tools in yeast research. They enable cloning of defined DNA sequences in Escherichia coli and their direct transfer into Saccharomyces cerevisiae cells. There are three types of commonly used yeast shuttle vectors: centromeric plasmids, episomal plasmids and integrating plasmids. In this review, we discuss the different plasmid systems and their characteristic features. We focus on their segregational stability and copy number and indicate how to modify these properties. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

[Use of a novel baculovirus vector to express nucleoprotein gene of Crimean-Congo hemorrhagic fever virus in both insect and mammalian cells].

PubMed

Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang

2002-09-01

To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.

Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells.

PubMed Central

Reeves, R; Gorman, C M; Howard, B

1985-01-01

The nucleoprotein structures formed on various plasmid expression vectors transfected into mammalian cells by both the calcium phosphate and DEAE-dextran methods have been studied. We demonstrate by a variety of means that mammalian cells are capable of rapidly assembling non-integrated circular plasmids (both replicating and non-replicating) into typical "minichromosomes" containing nucleosomes with a 190 bp repetitive spacing. Treatment of recipient cells with sodium butyrate for a short period of time (12-16 h) immediately following transfection markedly increased the DNase I digestion sensitivity of the newly assembled plasmid chromatin. Furthermore, minichromosomes isolated from such butyrate-treated cells are depleted in histone H1 and contain highly acetylated forms of histone H4. These findings are entirely consistent with our earlier speculation (Gorman et al., Nucleic Acids Res. 11, 1044; 1983) that appropriate butyrate treatment might stimulate transient expression of newly transfected genes by facilitating their assembly into an "active" type of chromatin structure. Images PMID:3859838

Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli

NASA Astrophysics Data System (ADS)

Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz

1981-02-01

Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

Production of Enterocin P, an Antilisterial Pediocin-Like Bacteriocin from Enterococcus faecium P13, in Pichia pastoris

PubMed Central

Gutiérrez, Jorge; Criado, Raquel; Martín, María; Herranz, Carmen; Cintas, Luis M.; Hernández, Pablo E.

2005-01-01

The gene encoding mature enterocin P (EntP), an antimicrobial peptide from Enterococcus faecium P13, was cloned into the pPICZαA expression vector to generate plasmid pJC31. This plasmid was integrated into the genome of P. pastoris X-33, and EntP was heterologously secreted from the recombinant P. pastoris X-33t1 derivative at a higher production and antagonistic activity than from E. faecium P13. PMID:15980385

A novel immunization method to induce cytotoxic T-lymphocyte responses (CTL) against plasmid-encoded herpes simplex virus type-1 glycoprotein D.

PubMed

Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J

1999-03-05

DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.

Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

PubMed Central

Sharma, Nynne; Cai, Yujia; Bak, Rasmus O; Jakobsen, Martin R; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2013-01-01

DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB) DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs) devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system. PMID:23443502

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

Construction and production of oncotropic vectors, derived from MVM(p), that share reduced sequence homology with helper plasmids.

PubMed

Clément, Nathalie; Velu, Thierry; Brandenburger, Annick

2002-09-01

The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

Method: low-cost delivery of the cotton leaf crumple virus-induced gene silencing system

PubMed Central

2012-01-01

Background We previously developed a virus-induced gene silencing (VIGS) vector for cotton from the bipartite geminivirusCotton leaf crumple virus (CLCrV). The original CLCrV VIGS vector was designed for biolistic delivery by a gene gun. This prerequisite limited the use of the system to labs with access to biolistic equipment. Here we describe the adaptation of this system for delivery by Agrobacterium (Agrobacterium tumefaciens). We also describe the construction of two low-cost particle inflow guns. Results The biolistic CLCrV vector was transferred into two Agrobacterium binary plasmids. Agroinoculation of the binary plasmids into cotton resulted in silencing and GFP expression comparable to the biolistic vector. Two homemade low-cost gene guns were used to successfully inoculate cotton (G. hirsutum) and N. benthamiana with either the CLCrV VIGS vector or the Tomato golden mosaic virus (TGMV) VIGS vector respectively. Conclusions These innovations extend the versatility of CLCrV-based VIGS for analyzing gene function in cotton. The two low-cost gene guns make VIGS experiments affordable for both research and teaching labs by providing a working alternative to expensive commercial gene guns. PMID:22853641

Plasmid Vectors and Molecular Building Blocks for the Development of Genetic Manipulation Tools for Trypanosoma cruzi

PubMed Central

Bouvier, León A.; Cámara, María de los Milagros; Canepa, Gaspar E.; Miranda, Mariana R.; Pereira, Claudio A.

2013-01-01

The post genomic era revealed the need for developing better performing, easier to use and more sophisticated genetic manipulation tools for the study of Trypanosoma cruzi, the etiological agent of Chagas disease. In this work a series of plasmids that allow genetic manipulation of this protozoan parasite were developed. First of all we focused on useful tools to establish selection strategies for different strains and which can be employed as expression vectors. On the other hand molecular building blocks in the form of diverse selectable markers, modifiable fluorescent protein and epitope-tag coding sequences were produced. Both types of modules were harboured in backbone molecules conceived to offer multiple construction and sub-cloning strategies. These can be used to confer new properties to already available genetic manipulation tools or as starting points for whole novel designs. The performance of each plasmid and building block was determined independently. For illustration purposes, some simple direct practical applications were conducted. PMID:24205392

Cloning and Expression of Major Surface Antigen 1 Gene of Toxoplasma gondii RH Strain Using the Expression Vector pVAX1 in Chinese Hamster Ovary Cells

PubMed Central

Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh

2015-01-01

Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

[Hypoxia responsive element regulated herpes simplex virus-thymidine kinase system enhances killing effect of gancyclovir on Ewing's sarcoma cell line under hypoxic condition].

PubMed

Si, Ying-jian; Guang, Li-xia; Yuan, Fa-huan; Zhang, Ke-bin

2006-08-01

To find out a possible approach to improve the effectiveness of radiotherapy and chemotherapy for Ewing's sarcoma by constructing a eukaryotic expression vector expressing herpes simplex virus-thymidine kinase (HSV-TK) regulated by hypoxia responsive element (HRE) under hypoxia and to evaluate the effects of this HRE regulated HSV-TK system on killing effect of gancyclovir (GCV) on Ewing's sarcoma cell line SK-ES under hypoxic condition. The HRE was synthesized according to the literature and cloned into the enhancer site of pIRES(2)-EGFP vector to obtain the pHRE recombinant plasmid. The HSV-TK was amplified by PCR and cloned into the multiple clone site of pIRES(2)-EGFP and pHRE to obtain pTK and pHRE-TK recombinant plasmid. The human Ewing's sarcoma cell line SK-ES was transfected by pTK or pHRE-TK recombinant plasmid with liposome and then was exposed to normoxic (21% oxygen) or hypoxic (3% oxygen) condition. The expression of enhanced green fluorescent protein (EGFP) was monitored by fluorescent microscopy. The sensitivity of human Ewing's sarcoma cell line SK-ES transfected with pTK or pHRE-TK recombinant plasmid to the anti-tumour drug GCV was determined with the method of tetrazolium (MTT) after treating with GCV for five days. (1) The result of sequencing showed that the recombinant plasmid pHRE contained HRE, and that the recombinant plasmid pTK and pHRE-TK contained HSV-TK gene in the sense direction. (2) Comparison of fluorescent optical density (FOD) showed that (1) the EGFP FOD value of pHRE and pHRE-TK group cells exposed to hypoxia was significantly higher than those exposed to normoxia (P < 0.01); (2) when the cells were exposed to hypoxia, the EGFP FOD value of pHRE and pHRE-TK group cells was significantly higher than that of pTK and empty vector group (P < 0.01); (3) there was no significant difference among the four groups of cells when they were exposed to normoxia (P > 0.05). (3) Comparison of the sensitivity of four groups of cells to GCV showed that (1) the cells in pHRE-TK and pTK groups were much more sensitive to GCV than the cells in pHRE group under hypoxia condition (P < 0.01), the higher the GCV concentration, the greater the difference; (2) the cells of pHRE-TK group were more sensitive to GCV than those in pTK group under hypoxic condition (P < 0.01), but was almost equally sensitive under normoxic condition (P > 0.05); (3) the pHRE-TK group cells had higher sensitivity to GCV under hypoxia than normoxia (P < 0.01) while the pTK group cells had almost the same sensitivity to GCV under hypoxia and normoxia (P > 0.05). (1) The eukaryotic expression vector expressing herpes simplex virus-thymidine kinase (HSV-TK) regulated by hypoxia responsive element (HRE) under hypoxia was constructed successfully. (2) HRE could up-regulate expression of EGFP by SK-ES cells under hypoxia condition. (3) HRE could enhance the killing effect of HSV-TK/GCV system on human Ewing's sarcoma cell line SK-ES under hypoxic condition.

Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel

1991-01-01

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.

[Construction, expression and immunogenicity study of a chimeric MS/hIL-12 eukaryotic expression plasmid].

PubMed

Li, Hui; Li, Rong; Zhong, Sen; Ren, Hong; Deng, Cun-liang; Shi, Xiao-ling; Wang, Ming-yong

2006-04-01

To construct and express a chimeric Mtb8.4 with signal peptide (MS)/hIL12 eukaryotic expression plasmid, and to study the immunogenicity of the MS/hIL-12 chimeric genetic vaccines. The MS/hIL-12 chimeric gene was amplified by polymerase chain reaction (PCR) and cloned into the eukaryotic expression vector pCI-neo. The correct pCI-neo-MS/hIL12 (pMSI) recombinant plasmid was identified by PCR, restricted enzyme digestion and DNA sequencing. COS-7 cells were transfected with pMSI constructs by cationic liposome. After 48 hours, mRNA of the target gene was detected by RT-PCR, and hIL-12 protein in culture supernatant and cell lysates was detected by Western blot. C57BL/6N mice were vaccinated with MS/hIL-12 chimeric gene vaccine for three times at 3 week intervals. Four weeks after the final inoculation, three mice were sacrificed for measurement of the cytokine response and cytotoxic T lymphocyte (CTL) induction. The accuracy of plasmid construction was confirmed by a number of molecular biological techniques. Transfection of COS-7 cells with plasmids pMSI lead to transient expression of fusion proteins. The IFN-gamma and IL-2 titers were (1,521 +/- 48) ng/L and (755 +/- 41) ng/L in MS/hIL-12 chimeric gene vaccine group, (820 +/- 50) ng/L and (297 +/- 31) ng/L in MS gene vaccine group, (1,487 +/- 40) ng/L and (767 +/- 50) ng/L in BCG group, (121 +/- 16) ng/L and (62 +/- 10) ng/L in vacant vector group, and (48 +/- 16) ng/L and (32 +/- 17) ng/L in PBS group respectively. The levels of IFN-gamma and IL-2 in MS/hIL-12 chimeric gene vaccine group were higher than those of MS gene vaccine group, vacant vector group and PBS group (P < 0.01) and was similar to the BCG group (P > 0.05). The level of IL-4 in BCG group [(91 +/- 11) ng/L] increased significantly as compared to other groups (P < 0.01). When effector-cell-to-target-cell ratio (E:T ratio) were 100:1, 50:1, and 10:1 respectively, the CTL activity was 77.5%, 51.2%, 30.3% in MS/hIL-12 chimeric gene vaccine group, 56.2%, 37.8%, 11.5% in MS gene vaccine group, 28.9%, 21.4%, 9.8% in BCG group. The cytotoxicity in MS/hIL-12 chimeric gene vaccine group was higher than that of other groups (P < 0.01). When used to construct the chimeric gene vaccine, hIL-12 could improve the immunogenicity of MS gene vaccine.

Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodyer, P.R.; Torban, E.; Dehbi, M.

1994-09-01

The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less

Analysis of protein function in clinical C. albicans isolates

PubMed Central

Gerami-Nejad, Maryam; Forche, Anja; McClellan, Mark; Berman, Judith

2012-01-01

Clinical isolates are prototrophic and hence are not amenable to genetic manipulation using nutritional markers. Here we describe a new set of plasmids carrying the NAT1 (nourseothricin) drug resistance marker (Shen et al., 2005) that can be used both in clinical isolates and in laboratory strains. We constructed novel plasmids containing HA-NAT1 or MYC-NAT1 cassettes to facilitate PCR-mediated construction of strains with C-terminal epitope-tagged proteins and a NAT1-pMet3-GFP plasmid to enable conditional expression of proteins with or without the green fluorescent protein fused at the N-terminus. Furthermore, for proteins that require both the endogenous N- and C-termini for function, we have constructed a GF-NAT1-FP cassette carrying truncated alleles that facilitate insertion of an intact, single copy of GFP internal to the coding sequence. In addition, GFP-NAT1, RFP-NAT1, and M-Cherry-NAT1 plasmids were constructed expressing two differently labeled gene products for the study of protein co-expression and co-localization in vivo. Together, these vectors provide a useful set of genetic tools for studying diverse aspects of gene function in C. albicans clinical as well as laboratory strains. PMID:22777821

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

[Establishment and identification of mouse lymphoma cell line EL4 expressing red fluorescent protein].

PubMed

Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin

2010-02-01

This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.

Ultrasound-targeted hepatic delivery of factor IX in hemophiliac mice.

PubMed

Anderson, C D; Moisyadi, S; Avelar, A; Walton, C B; Shohet, R V

2016-06-01

Ultrasound-targeted microbubble destruction (UTMD) was used to direct the delivery of plasmid and transposase-based vectors encoding human factor IX (hFIX) to the livers of hemophilia B (FIX-/-) mice. The DNA vectors were incorporated into cationic lipid microbubbles, injected intravenously, and transfected into hepatocytes by acoustic cavitation of the bubbles as they transited the liver. Ultrasound parameters were identified that produced transfection of hepatocytes in vivo without substantial damage or bleeding in the livers of the FIX-deficient mice. These mice were treated with a conventional expression plasmid, or one containing a piggyBac transposon construct, and hFIX levels in the plasma and liver were evaluated at multiple time points after UTMD. We detected hFIX in the plasma by western blotting from mice treated with either plasmid during the 12 days after UTMD, and in the hepatocytes of treated livers by immunofluorescence. Reductions in clotting time and improvements in the percentage of FIX activity were observed for both plasmids, conventional (4.15±1.98%), and transposon based (2.70±.75%), 4 to 5 days after UTMD compared with untreated FIX (-/-) control mice (0.92±0.78%) (P=0.001 and P=0.012, respectively). Reduced clotting times persisted for both plasmids 12 days after treatment (reflecting percentage FIX activity of 3.12±1.56%, P=0.02 and 3.08±0.10%, P=0.001, respectively). Clotting times from an additional set of mice treated with pmGENIE3-hFIX were evaluated for long-term effects and demonstrated a persistent reduction in average clotting time 160 days after a single treatment. These data suggest that UTMD could be a minimally invasive, nonviral approach to enhance hepatic FIX expression in patients with hemophilia.

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed Central

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.

Increased proliferation of endothelial cells with overexpression of soluble TNF-alpha receptor I gene.

PubMed

Sugano, Masahiro; Tsuchida, Keiko; Tomita, Hideharu; Makino, Naoki

2002-05-01

Vascular endothelial growth factor (VEGF) can overcome a potential anti-angiogenic effect of TNF-alpha by inhibiting endothelial apoptosis induced by this cytokine. Soluble TNF-alpha receptor I (sTNFRI) is an extracellular domain of TNFRI and antagonizes the activity of TNF-alpha. Here we report that sTNFRI is able to stimulate the growth of endothelial cells not by antagonizing TNF-alpha. Exogenously added recombinant human sTNFRI stimulated significantly more cell growth of human umbilical venous endothelial cells (HUVEC) with a low dose (50-200 pg/ml) compared with smooth muscle cells. In contrast, monoclonal antibody against TNF-alpha did not stimulate growth of human HUVEC. The sTNFRI expression plasmid (pcDNA3.1 plasmid) was introduced into the cell culture using OPTI-MEM, lipofectin and transferrin. Growth of HUVEC transfected with sTNFRI vector also increased significantly compared with those transfected with control vector. HUVEC transfected with sTNFRI vector increased the extracellular domain of TNFRI mRNA levels, but did not affect the intracellular domain of TNFRI mRNA levels. Accumulation of sTNFRI significantly increased in conditioned medium from HUVEC transfected with sTNFRI vector compared with those transfected with control vector. HUVEC transfected with sTNFRI vector not only increased sTNFRI but also prevented shedding of sTNFRI from TNFRI. The TNF-alpha -induced internucleosomic fragmentation was also significantly prevented in HUVEC transfected with sTNFRI vector compared with those transfected with control vector. These results suggest that instead of growth factors such as VEGF, local transfection of the sTNFRI gene may have potential therapeutic value in vascular diseases in which TNF-alpha is also usually highly expressed.

[Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].

PubMed

Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V

2010-01-01

The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.

PubMed

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

PubMed Central

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908

Golden Gate Assembly of CRISPR gRNA expression array for simultaneously targeting multiple genes.

PubMed

Vad-Nielsen, Johan; Lin, Lin; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2016-11-01

The engineered CRISPR/Cas9 technology has developed as the most efficient and broadly used genome editing tool. However, simultaneously targeting multiple genes (or genomic loci) in the same individual cells using CRISPR/Cas9 remain one technical challenge. In this article, we have developed a Golden Gate Assembly method for the generation of CRISPR gRNA expression arrays, thus enabling simultaneous gene targeting. Using this method, the generation of CRISPR gRNA expression array can be accomplished in 2 weeks, and contains up to 30 gRNA expression cassettes. We demonstrated in the study that simultaneously targeting 10 genomic loci or simultaneously inhibition of multiple endogenous genes could be achieved using the multiplexed gRNA expression array vector in human cells. The complete set of plasmids is available through the non-profit plasmid repository Addgene.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

The use of the replication region of plasmid pRS7 from Oenococcus oeni as a putative tool to generate cloning vectors for lactic acid bacteria.

PubMed

Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M

2015-01-01

A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.

Transformation of Sordaria macrospora to hygromycin B resistance: characterization of transformants by electrophoretic karyotyping and tetrad analysis.

PubMed

Walz, M; Kück, U

1995-12-01

The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.

pHg/pSILBAγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihpRNA – triggering in the mycorrhizal fungus Laccaria bicolor

PubMed Central

Kemppainen, Minna J.; Pardo, Alejandro G.

2010-01-01

Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319

Characterization of the cryptic plasmid pOfk55 from Legionella pneumophila and construction of a pOfk55-derived shuttle vector.

PubMed

Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa

2017-03-01

In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.

Expression of the core antigen gene of hepatitis B virus (HBV) in Acetobacter methanolicus using broad-host-range vectors.

PubMed

Schröder, R; Maassen, A; Lippoldt, A; Börner, T; von Baehr, R; Dobrowolski, P

1991-08-01

Using the broad-host-range promoter probe vector pRS201 for cloning of phage Acm1 promoters, we established a convenient vector system for expression of heterologous genes in different Gram-negative bacteria. The usefulness of this system was demonstrated by expression of the HBV core gene in Acetobacter methanolicus. Plasmids carrying the HBV core gene downstream of different Acm1-phage promoters were transferred to A. methanolicus, a new potential host for recombinant DNA expression. Using enzyme immunoassay and immunoblot techniques, the amount and composition of core antigen produced in A. methanolicus were compared with that derived from Escherichia coli. The expression of immunoreactive core antigen in A. methanolicus exceeds by sevenfold that in E. coli using an expression system with tandemly arranged promoters. Morphological observations by electron microscopy show that the HBV core gene products isolated from both hosts are assembled into regular spherical particles with a diameter of about 28 nm that are comparable to original viral nucleocapsids.

Human HOXA5 homeodomain enhances protein transduction and its application to vascular inflammation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ji Young; Park, Kyoung sook; Cho, Eun Jung

2011-07-01

Highlights: {yields} We have developed an E. coli protein expression vector including human specific gene sequences for protein cellular delivery. {yields} The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence. {yields} HOXA5-APE1/Ref-1 inhibited TNF-alpha-induced monocyte adhesion to endothelial cells. {yields} Human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins. -- Abstract: Cellular protein delivery is an emerging technique by which exogenous recombinant proteins are delivered into mammalian cells across the membrane. We have developed an Escherichia coli expression vector including humanmore » specific gene sequences for protein cellular delivery. The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence which was matched with protein transduction domain (PTD) of homeodomain protein A5 (HOXA5) into pET expression vector. The cellular uptake of HOXA5-PTD-EGFP was detected in 1 min and its transduction reached a maximum at 1 h within cell lysates. The cellular uptake of HOXA5-EGFP at 37 {sup o}C was greater than in 4 {sup o}C. For study for the functional role of human HOXA5-PTD, we purified HOXA5-APE1/Ref-1 and applied it on monocyte adhesion. Pretreatment with HOXA5-APE1/Ref-1 (100 nM) inhibited TNF-{alpha}-induced monocyte adhesion to endothelial cells, compared with HOXA5-EGFP. Taken together, our data suggested that human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins.« less

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

Part I: Minicircle vector technology limits DNA size restrictions on ex vivo gene delivery using nanoparticle vectors: Overcoming a translational barrier in neural stem cell therapy.

PubMed

Fernandes, Alinda R; Chari, Divya M

2016-09-28

Genetically engineered neural stem cell (NSC) transplant populations offer key benefits in regenerative neurology, for release of therapeutic biomolecules in ex vivo gene therapy. NSCs are 'hard-to-transfect' but amenable to 'magnetofection'. Despite the high clinical potential of this approach, the low and transient transfection associated with the large size of therapeutic DNA constructs is a critical barrier to translation. We demonstrate for the first time that DNA minicircles (small DNA vectors encoding essential gene expression components but devoid of a bacterial backbone, thereby reducing construct size versus conventional plasmids) deployed with magnetofection achieve the highest, safe non-viral DNA transfection levels (up to 54%) reported so far for primary NSCs. Minicircle-functionalized magnetic nanoparticle (MNP)-mediated gene delivery also resulted in sustained gene expression for up to four weeks. All daughter cell types of engineered NSCs (neurons, astrocytes and oligodendrocytes) were transfected (in contrast to conventional plasmids which usually yield transfected astrocytes only), offering advantages for targeted cell engineering. In addition to enhancing MNP functionality as gene delivery vectors, minicircle technology provides key benefits from safety/scale up perspectives. Therefore, we consider the proof-of-concept of fusion of technologies used here offers high potential as a clinically translatable genetic modification strategy for cell therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

Sequential cloning of chromosomes

DOEpatents

Lacks, Sanford A.

1995-07-18

A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.

Biocontrol of the Sugarcane Borer Eldana saccharina by Expression of the Bacillus thuringiensis cry1Ac7 and Serratia marcescens chiA Genes in Sugarcane-Associated Bacteria

PubMed Central

Downing, Katrina J.; Leslie, Graeme; Thomson, Jennifer A.

2000-01-01

The cry1Ac7 gene of Bacillus thuringiensis strain 234, showing activity against the sugarcane borer Eldana saccharina, was cloned under the control of the tac promoter. The fusion was introduced into the broad-host-range plasmid pKT240 and the integration vector pJFF350 and without the tac promoter into the broad-host-range plasmids pML122 and pKmM0. These plasmids were introduced into a Pseudomonas fluorescens strain isolated from the phylloplane of sugarcane and the endophytic bacterium Herbaspirillum seropedicae found in sugarcane. The ptac-cry1Ac7 construct was introduced into the chromosome of P. fluorescens using the integration vector pJFF350 carrying the artificial interposon Omegon-Km. Western blot analysis showed that the expression levels of the integrated cry1Ac7 gene were much higher under the control of the tac promoter than under the control of its endogenous promoter. It was also determined that multicopy expression in P. fluorescens and H. seropedicae of ptac-cry1Ac7 carried on pKT240 caused plasmid instability with no detectable protein expression. In H. seropedicae, more Cry1Ac7 toxin was produced when the gene was cloned under the control of the Nmr promoter on pML122 than in the opposite orientation and bioassays showed that the former resulted in higher mortality of E. saccharina larvae than the latter. P. fluorescens 14::ptac-tox resulted in higher mortality of larvae than did P. fluorescens 14::tox. An increased toxic effect was observed when P. fluorescens 14::ptac-tox was combined with P. fluorescens carrying the Serratia marcescens chitinase gene chiA, under the control of the tac promoter, integrated into the chromosome. PMID:10877771

Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

PubMed Central

Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

2012-01-01

Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

Three-Dimensional Imaging of the Intracellular Fate of Plasmid DNA and Transgene Expression: ZsGreen1 and Tissue Clearing Method CUBIC Are an Optimal Combination for Multicolor Deep Imaging in Murine Tissues.

PubMed

Fumoto, Shintaro; Nishimura, Koyo; Nishida, Koyo; Kawakami, Shigeru

2016-01-01

Evaluation methods for determining the distribution of transgene expression in the body and the in vivo fate of viral and non-viral vectors are necessary for successful development of in vivo gene delivery systems. Here, we evaluated the spatial distribution of transgene expression using tissue clearing methods. After hydrodynamic injection of plasmid DNA into mice, whole tissues were subjected to tissue clearing. Tissue clearing followed by confocal laser scanning microscopy enabled evaluation of the three-dimensional distribution of transgene expression without preparation of tissue sections. Among the tested clearing methods (ClearT2, SeeDB, and CUBIC), CUBIC was the most suitable method for determining the spatial distribution of transgene expression in not only the liver but also other tissues such as the kidney and lung. In terms of the type of fluorescent protein, the observable depth for green fluorescent protein ZsGreen1 was slightly greater than that for red fluorescent protein tdTomato. We observed a depth of ~1.5 mm for the liver and 500 μm for other tissues without preparation of tissue sections. Furthermore, we succeeded in multicolor deep imaging of the intracellular fate of plasmid DNA in the murine liver. Thus, tissue clearing would be a powerful approach for determining the spatial distribution of plasmid DNA and transgene expression in various murine tissues.

One pyrimidine dimer inactivates expression of a transfected gene in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Protic-Sabljic, M.; Kraemer, K.H.

1985-10-01

The authors have developed a host cell reactivation assay of DNA repair utilizing UV-treated plasmid vectors. The assay primarily reflects cellular repair of transcriptional activity of damaged DNA measured indirectly as enzyme activity of the transfected genes. They studied three plasmids (pSV2cat, 5020 base pairs; pSV2catSVgpt, 7268 base pairs; and pRSVcat, 5027 base pairs) with different sizes and promoters carrying the bacterial cat gene (CAT, chloramphenicol acetyltransferase) in a construction that permits cat expression in human cells. All human simian virus 40-transformed cells studied expressed high levels of the transfected cat gene. UV treatment of the plasmids prior to transfectionmore » resulted in differential decrease in CAT activity in different cell lines. With pSV2catSVgpt, UV inactivation of CAT expression was greater in the xeroderma pigmentosum group A and D lines than in the other human cell lines tested. The D0 of the CAT inactivation curve was 50 J X m-2 for pSV2cat and for pRSVcat in the xeroderma pigmentosum group A cells. The similarity of the D0 data in the xeroderma pigmentosum group A cells for three plasmids of different size and promoters implies they all have similar UV-inactivation target size. UV-induced pyrimidine dimer formation in the plasmids was quantified by assay of the number of UV-induced T4 endonuclease V-sensitive sites. In the most sensitive xeroderma pigmentosum cells, with all three plasmids, one UV-induced pyrimidine dimer inactivates a target of about 2 kilobases, close to the size of the putative CAT mRNA.« less

Hyaluronic acid synthase-2 gene transfer into the joints of Beagles by use of recombinant adeno-associated viral vectors.

PubMed

Kyostio-Moore, Sirkka; Berthelette, Patricia; Cornell, Cathleen Sookdeo; Nambiar, Bindu; Figueiredo, Monica Dias

2018-05-01

OBJECTIVE To evaluate gene transfer of recombinant adeno-associated viral (rAAV) vectors with AAV2 or AAV5 capsid and encoding hyaluronic acid (HA) synthase-2 (HAS2) into joints of healthy dogs. ANIMALS 22 purpose-bred Beagles. PROCEDURES Plasmid expression cassettes encoding canine HAS2 (cHAS2) were assessed in vitro for concentration and molecular size of secreted HA. Thereafter, rAAV2-cHAS2 vectors at 3 concentrations and rAAV5-cHAS2 vectors at 1 concentration were each administered intra-articularly into the left stifle joint of 5 dogs; 2 dogs received PBS solution instead. Synovial fluid HA concentration and serum and synovial fluid titers of neutralizing antibodies against AAV capsids were measured at various points. Dogs were euthanized 28 days after treatment, and cartilage and synovium samples were collected for vector DNA and mRNA quantification and histologic examination. RESULTS Cell transfection with plasmids encoding cHAS2 resulted in an increase in production and secretion of HA in vitro. In vivo, the rAAV5-cHAS2 vector yielded uniform genome transfer and cHAS2 expression in collected synovium and cartilage samples. In contrast, rAAV2-cHAS2 vectors were detected inconsistently in synovium and cartilage samples and failed to produce clear dose-related responses. Histologic examination revealed minimal synovial inflammation in joints injected with rAAV vectors. Neutralizing antibodies against AAV capsids were detected in serum and synovial fluid samples from all vector-treated dogs. CONCLUSIONS AND CLINICAL RELEVANCE rAAV5-mediated transfer of the gene for cHAS2 into healthy joints of dogs by intra-articular injection appeared safe and resulted in vector-derived cHAS2 production by synoviocytes and chondrocytes. Whether this treatment may increase HA production by synoviocytes and chondrocytes in osteoarthritic joints remains to be determined.

A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor.

PubMed

Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S

2012-02-01

Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.

A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor

PubMed Central

Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.

2012-01-01

Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659

Enhanced animal growth via ligand-regulated GHRH myogenic-injectable vectors

NASA Technical Reports Server (NTRS)

Draghia-Akli, Ruxandra; Malone, P. Brandon; Hill, Leigh Anne; Ellis, Kenneth M.; Schwartz, Robert J.; Nordstrom, Jeffrey L.

2002-01-01

Regulated animal growth occurred following a single electroporated injection of a mixture of two plasmids (10 microg of DNA), one expressing the GeneSwitch regulator protein, the other an inducible growth hormone releasing hormone (GHRH) gene, into the tibialis anterior muscles of adult SCID mice. Administration of the ligand mifepristone (MFP) up-regulated GHRH expression, as shown by elevations of IGF-I levels, and when MFP dosing was withdrawn, IGF-I returned to baseline levels. Five cycles of IGF-I induction were observed during a five-month period. Chronic MFP dosing for 25 days increased lean body mass, weight gain, and bone mineral density significantly compared with non-MFP treated controls. In summary, long-term drug-regulated GHRH expression was achieved following plasmid-based gene therapy, and chronic induction of GHRH expression in adult animals led to improvements in weight gain and body composition.

Enhanced animal growth via ligand-regulated GHRH myogenic-injectable vectors.

PubMed

Draghia-Akli, Ruxandra; Malone, P Brandon; Hill, Leigh Anne; Ellis, Kenneth M; Schwartz, Robert J; Nordstrom, Jeffrey L

2002-03-01

Regulated animal growth occurred following a single electroporated injection of a mixture of two plasmids (10 microg of DNA), one expressing the GeneSwitch regulator protein, the other an inducible growth hormone releasing hormone (GHRH) gene, into the tibialis anterior muscles of adult SCID mice. Administration of the ligand mifepristone (MFP) up-regulated GHRH expression, as shown by elevations of IGF-I levels, and when MFP dosing was withdrawn, IGF-I returned to baseline levels. Five cycles of IGF-I induction were observed during a five-month period. Chronic MFP dosing for 25 days increased lean body mass, weight gain, and bone mineral density significantly compared with non-MFP treated controls. In summary, long-term drug-regulated GHRH expression was achieved following plasmid-based gene therapy, and chronic induction of GHRH expression in adult animals led to improvements in weight gain and body composition.

Plasmid vectors for Xylella fastidiosa utilizing a toxin-antitoxin system for plasmid stability in the absence of antibiotic selection

USDA-ARS?s Scientific Manuscript database

The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacte...

Limiting an Insect Infestation of Nitrogen-Fixing Root Nodules of the Pigeon Pea (Cajanus cajan) by Engineering the Expression of an Entomocidal Gene in Its Root Nodules

PubMed Central

Nambiar, P. T. C.; Ma, S.-W.; Iyer, V. N.

1990-01-01

A region of DNA which determined the production of the insecticidal toxin of Bacillus thuringiensis subsp. israelensis was cloned into a derivative of a broad-host-range group IncQ plasmid vector of gram-negative bacteria. The plasmid which we constructed was transferred by conjugative mobilization into a Bradyrhizobium species that nodulates pigeon peas. In this species the construction was maintained stably in the absence of selection and expressed the gene that was installed. Experiments in a greenhouse with the strain which we constructed indicated that this organism provides protection against root nodule damage by the larvae of the insect Rivellia angulata (Diptera). Images PMID:16348294

Immune responses of mice immunized by DNA plasmids encoding PCV2 ORF 2 gene, porcine IL-15 or the both.

PubMed

Dong, Bo; Feng, Jing; Lin, Hai; Li, Lanxiang; Su, Dingding; Tu, Di; Zhu, Weijuan; Yang, Qing; Ren, Xiaofeng

2013-11-19

Porcine circovirus type 2 (PCV2) is associated with many kinds of diseases including postweaning multisystemic wasting syndrome (PMWS). It affects the immune system of swine and causes huge epidemic losses every year. In our previous study, we provided evidence that DNA plasmid bearing porcine IL-15 (pVAX-pIL-15) might serve as an immune enhancer for DNA plasmid encoding porcine reproductive and respiratory syndrome virus GP5 gene. In this study, PCV2 open reading frame (ORF)2 gene was cloned into the eukaryotic expression vector pVAX, resulting in the plasmid pVAX-PCV2-ORF2. Transient expression of the plasmid in BHK-21 cells could be detected using immunofluorescence assay. Experimental mice were divided into 5 groups and immunized with PBS, pVAX, pVAX-pIL-15, pVAX-PCV2-ORF2 or pVAX-pIL-15 plus pVAX-PCV2-ORF2. The results showed that the mice co-inoculated with pVAX-PCV2-ORF2 plus pVAX-pIL-15 had higher humoral and cellular immune responses than the others. In addition, DNA plasmid bearing PCV2 ORF2 gene had a protective effect against challenge with PCV2 in mice which could be promoted with the utilization of pIL-15. Copyright © 2013 Elsevier Ltd. All rights reserved.

Functional characterization of replication and stability factors of an incompatibility group P-1 plasmid from Xylella fastidiosa.

PubMed

Lee, Min Woo; Rogers, Elizabeth E; Stenger, Drake C

2010-12-01

Xylella fastidiosa strain riv11 harbors a 25-kbp plasmid (pXF-RIV11) belonging to the IncP-1 incompatibility group. Replication and stability factors of pXF-RIV11 were identified and used to construct plasmids able to replicate in X. fastidiosa and Escherichia coli. Replication in X. fastidiosa required a 1.4-kbp region from pXF-RIV11 containing a replication initiation gene (trfA) and the adjacent origin of DNA replication (oriV). Constructs containing trfA and oriV from pVEIS01, a related IncP-1 plasmid of the earthworm symbiont Verminephrobacter eiseniae, also were competent for replication in X. fastidiosa. Constructs derived from pXF-RIV11 but not pVEIS01 replicated in Agrobacterium tumefaciens, Xanthomonas campestris, and Pseudomonas syringae. Although plasmids bearing replication elements from pXF-RIV11 or pVEIS01 could be maintained in X. fastidiosa under antibiotic selection, removal of selection resulted in plasmid extinction after 3 weekly passages. Addition of a toxin-antitoxin addiction system (pemI/pemK) from pXF-RIV11 improved plasmid stability such that >80 to 90% of X. fastidiosa cells retained plasmid after 5 weekly passages in the absence of antibiotic selection. Expression of PemK in E. coli was toxic for cell growth, but toxicity was nullified by coexpression of PemI antitoxin. Deletion of N-terminal sequences of PemK containing the conserved motif RGD abolished toxicity. In vitro assays revealed a direct interaction of PemI with PemK, suggesting that antitoxin activity of PemI is mediated by toxin sequestration. IncP-1 plasmid replication and stability factors were added to an E. coli cloning vector to constitute a stable 6.0-kbp shuttle vector (pXF20-PEMIK) suitable for use in X. fastidiosa.

Enhanced expression of the Escherichia coli serA gene in a plasmid vector. Purification, crystallization, and preliminary X-ray data of D-3 phosphoglycerate dehydrogenase.

PubMed

Schuller, D J; Fetter, C H; Banaszak, L J; Grant, G A

1989-02-15

The serA gene of Escherichia coli strain K-12, which codes for the cooperative allosteric enzyme D-3-phosphoglycerate dehydrogenase, was inserted into an inducible expression vector which produced phosphoglycerate dehydrogenase as 8% of the soluble protein of E. coli. The purified protein was used to grow several different single crystal forms. One of these, with space group P2(1), appears to contain all four subunits of the tetrameric enzyme in the asymmetric unit and diffracts to sufficient resolution to allow determination of the structure of phosphoglycerate dehydrogenase.

Cloning and expression of L-asparaginase gene in Escherichia coli.

PubMed

Wang, Y; Qian, S; Meng, G; Zhang, S

2001-08-01

The L-asparaginase (ASN) from Escherichia coli AS1.357 was cloned as a DNA fragment generated using polymerase chain reaction technology and primers derived from conserved regions of published ASN gene sequences. Recombinant plasmid pASN containing ASN gene and expression vector pBV220 was transformed in different E. coli host strains. The activity and expression level of ASN in the engineering strains could reach 228 IU/mL of culture fluid and about 50% of the total soluble cell protein respectively, more than 40-fold the enzyme activity of the wild strain. The recombinant plasmid in E. coli AS1.357 remained stable after 72 h of cultivation and 5 h of heat induction without selective pressure. The ASN gene of E. coli AS1.357 was sequenced and had high homology compared to the reported data.

Oral immunization using HgbA in a recombinant chancroid vaccine delivered by attenuated Salmonella typhimurium SL3261 in the temperature-dependent rabbit model.

PubMed

Breau, Cathy; Cameron, D William; Desjardins, Marc; Lee, B Craig

2012-01-31

Chancroid, a sexually transmitted genital ulcer disease caused by the Gram-negative bacterium Haemophilus ducreyi, facilitates the acquisition and transmission of HIV. An effective vaccine against chancroid has not been developed. In this preliminary study, the gene encoding the H. ducreyi outer membrane hemoglobin receptor HgbA was cloned into the plasmid pTETnir15. The recombinant construct was introduced into the attenuated Salmonella typhimurium SL3261 strain and stable expression was induced in vitro under anaerobic conditions. The vaccine strain was delivered into the temperature-dependent rabbit model of chancroid by intragastric immunization as a single dose, or as three doses administered at two-weekly intervals. No specific antibody to HgbA was elicited after either dose schedule. Although the plasmid vector survived in vivo passage for up to 15 days following single oral challenge, HgbA expression was restricted to plasmid isolates recovered one day after immunization. Rabbits inoculated with the 3-dose booster regimen achieved no protective immunity from homologous challenge. These results emphasize that refinements in plasmid design to enhance a durable heterologous protein expression are necessary for the development of a live oral vaccine against chancroid. Copyright © 2011 Elsevier B.V. All rights reserved.

[Eukaryotic Expression and Immunogenic Research of Recombination Ebola Virus Membrane Protein Gp-Fc].

PubMed

Zhang, Xiaoguang; Yang, Ren; Wang, Jiao; Wang, Xuan; Hou, Mieling; An, Lina; Zhu, Ying; Cao, Yuxi; Zeng, Yi

2016-01-01

We used 293 cells to express the recombinant membrane protein of the Ebola virus. Then, the immunogenicity of the recombinant protein was studied by immunized BALB/c mice. According to the codon use frequency of humans, the gene encoding the extracellular domain of the Ebola virus membrane protein was optimized, synthesized, and inserted into the eukaryotic expression plasmid pXG-Fc to construct the human IgG Fc and Ebola GP fusion protein expression plasmid pXG-modGP-Fc. To achieve expression, the fusion protein expression vector was transfected into high-density 293 cells using transient transfection technology. The recombinant protein was purified by protein A affinity chromatography. BALB/c mice were immunized with the purified fusion protein, and serum antibody titers evaluated by an indirect enzyme-linked immunosorbent assay (ELISA). Purification and analyses of the protein revealed that the eukaryotic expression vector could express the recombinant protein GP-Fc effectively, and that the recombinant protein in the supernatant of the cell culture was present as a dimer. After immunization with the purified recombinant protein, a high titer of antigen-specific IgG could be detected in the serum of immunized mice by indirect ELISA, showing that the recombinant protein had good immunogenicity. These data suggest that we obtained a recombinant protein with good immunogenicity. Our study is the basis for development of a vaccine against the Ebola virus and for screening of monoclonal antibodies.

Sequential cloning of chromosomes

DOEpatents

Lacks, S.A.

1995-07-18

A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Construction of a recombinant-BCG containing the LMP2A and BZLF1 genes and its significance in the Epstein-Barr virus positive gastric carcinoma.

PubMed

Xue, Qing-Jie; Dai, Jun; Li, Xiu-Zhen; Zhu, Wei; Si, Chuan-Ping; Chen, Ting

2014-10-01

The signal peptide Ag85B of Bacillus Chalmette-Guerin (BCG) was used to construct a recombinant plasmid of BCG. The BCG-Ag85B gene and fused EBV LMP2A and BZLF1 genes were amplified and successively inserted into the Escherichia coli-BCG shuttle-vector pMV261. The recombinant plasmids were then amplified in E. coli DH5α and transformed into competent BCG. The expression of BZLF1 and LMP2A fusion proteins in recombinant-BCG (rBCG) was shown by Western blot. After the injection of recombinant-BCG into mice, antibodies against the fusion protein BZLF1 and LMP2A were measured by ELISA, and the cellular immune effects were determined by the lactate dehydrogenate (LDH) release assays. The results confirmed that the cloned genes of BCG-Ag85B and Z2A were correctly inserted into the vector pMV261. The recombinant plasmid pMVZ2A expressed Z2A in BCG effectively after transformation. The rBCG proteins were recognized by the BZLF1 (LMP2A) antibody. An ELISA demonstrated that rBCG could stimulate the generation of antibody against the fusion protein. The fusion gene was constructed successfully, and the rBCG induced humoral and cellular immune response in mice. © 2014 Wiley Periodicals, Inc.

Construction of KHV-CJ ORF25 DNA vaccine and immune challenge test.

PubMed

Zhou, J-X; Wang, H; Li, X-W; Zhu, X; Lu, W-L; Zhang, D-M

2014-04-01

KHV ORF25 fragments were cloned from Koi Herpes Virus-CJ (KHV-CJ) strains isolated in our laboratory. The amplified products were inserted into the eukaryotic expression vector pIRES-neo, forming recombinant plasmid pIRES-ORF25. The recombinant plasmid pIRES-ORF25 at 1 μg per koi, 10 μg per koi and 50 μg per koi was intramuscularly injected into healthy kois, respectively. The results showed that the recombinant pIRES-ORF25 could induce the production of specific antibodies in koi determined by indirect ELISA. The differences of immune effect between three doses were not significant (P > 0.05), but all of them could induce the production of neutralizing antibodies. The immune challenge test showed that the mortality of koi injected with PBS, blank pIRES-neo vector and nothing was 90%, 92.5% and 85% at 25 days. While the mortalities of koi injected with eukaryotic expression plasmid pIRES-ORF25 were 20%, 17.5% and 12.5%. Differences in comparison with the control group were highly significant (P < 0.01). Histopathological staining revealed that the tissues of the immunized koi did not change apparently. In conclusion, the DNA vaccine pIRES-ORF25 construct could well protect koi against KHV and had the potential to be applied in practice. © 2013 John Wiley & Sons Ltd.

A convenient method of preparing gene vector for real time monitoring transfection process based on the quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong

2012-11-15

Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less

Partial complementation of the UV sensitivity of E. coli and yeast excision repair mutants by the cloned denV gene of bacteriophage T4.

PubMed

Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C

1986-04-01

The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.

Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

PubMed

Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

2015-01-01

Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

[Effect of Golgi α-mannosidase 2 (GM2) gene knockdown on adhesion abilities of human gastric carcinoma cell line BGC-823 and its mechanism].

PubMed

Zeng, Bo; Zeng, Zhen; Liu, Chang; Yang, Yaying

2017-06-01

Objective To investigate the effect of Golgi α-mannosidase II (GM2) gene knockdown on adhesion abilities of BGC-823 human gastric carcinoma cells. Methods Three plasmid vectors expressing GM2 shRNAs and a negative control plasmid vector were designed, constructed and then transfected into BGC-823 cells by Lipofectamine TM 2000. After transfection, the mRNA and protein levels of GM2 in BGC-823 cells were detected by real-time quantitative PCR (qRT-PCR) and Western blotting to evaluate the transfection efficacy. The best plasmid for GM2 gene knockdown was selected and stably transfected into BGC-823 cells. Adhesion abilities of BGC-823 cells after GM2 gene silencing were observed by cell-cell, cell-matrix and cell-endothelial cell adhesion assays. At the same time, the expressions of E-cadherin, P-selectin, CD44v6 and intercellular adhesion molecule-1 (ICAM-1) proteins were detected by Western blotting after GM2 gene knockdown. Results The expression of GM2 was effectively knockdown in GM2-shRNA-2-transfected BGC-823 cells. Compared with the blank control group and the negative control group, the intercellular adhesion ability of the GM2-shRNA-2-transfected cells increased significantly, while their cell-matrix and cell-endothelium adhesion abilities markedly decreased. In GM2-shRNA-2 transfection group, E-cadherin expression was significantly elevated and the P-selectin expression was significantly reduced, while the expression levels of CD44v6 and ICAM-1 were not obviously changed. Conclusion After GM2 gene knockdown, the intercellular adhesion ability of gastric carcinoma BGC-823 cells is enhanced, while the adhesion abilities with the extracellular matrix and endothelial cells are weakened. The changes might be related to the up-regulated expression of E-cadherin and the down-regulation of P-selectin.

[Prokaryotic expression of Nanog gene and preparation of anti-Nanog antibody].

PubMed

Li, Jun; Wang, Xiao-min; Dou, Zhong-ying; Li, Yong

2012-07-01

To express Nanog fusion protein in Escherichia coli ( E.coli), and to prepare rabbit anti-mouse polyclonal antibodies to the Nanog fusion protein. Mouse Nanog gene was amplified from the pNA992 recombinant plasmid and inserted into pET-32a vector to construct a recombinant expression vector pET-32a-Nanog. The recombinant vector was transfected into E.coli BL21 and induced by IPTG to express in them. The acquired Nanog fusion protein was purified with HisTrap affinity column and injected as an antigen into rabbits for preparing polyclonal antibodies. At last, the titer and specificity of the polyclonal antibodies were analyzed with indirect ELISA, Western blotting and immunocytochemical staining, respectively. The recombinant expression vector pET-32a-Nanog was successfully prepared, transfected and induced to obtain the high expression of the Nanog fusion protein in a form of inclusion bodies in E.coli. After purification, its purity was up to 97%. The titer of anti-Nanog antibodies was 1:32 000 in the immunized rabbit serum, and exhibited a high specificity to Nanog protein. The rabbit anti-mouse polyclonal antibodies have been prepared successfully with a high titer and specificity to the Nanog fusion protein.

A transposase strategy for creating libraries of circularly permuted proteins.

PubMed

Mehta, Manan M; Liu, Shirley; Silberg, Jonathan J

2012-05-01

A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions.

A transposase strategy for creating libraries of circularly permuted proteins

PubMed Central

Mehta, Manan M.; Liu, Shirley; Silberg, Jonathan J.

2012-01-01

A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions. PMID:22319214

8-Methoxypsoralen photoinduced plasmid-chromosome recombination in Saccharomyces cerevisiae using a centromeric vector.

PubMed Central

Meira, L B; Henriques, J A; Magaña-Schwencke, N

1995-01-01

The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218

Stable expression of the hepatitis B virus surface antigen containing pre-S2 protein in mouse cells using a bovine papillomavirus vector.

PubMed

Yoneyama, T; Akatsuka, T; Miyamura, T

1988-08-01

The large BglII fragment (2.8 kilobases) of hepatitis B virus DNA including the transcription unit for the hepatitis B surface antigen (HBsAg) was inserted into a bovine papillomavirus vector containing the neomycin resistance gene. The recombinant DNA was transfected into mouse C127 cells. A stable transformed cell line (MS128) secreting a large amount of 22 nm HBsAg particles containing pre-S2 protein was established. The secreted HBsAg particles had the receptor for polymerized human serum albumin. Immunoprecipitation and Western blot analyses showed that HBsAg particles consisted of two major proteins of 22K and 26K encoded by the S gene and a minor protein of 35K encoded by the pre-S2 and S genes. Southern blot analysis revealed that the transfected plasmid was integrated into the host chromosomal DNA and that most of the plasmid sequences were present. These results suggest that the stable expression of the HBsAg in MS128 cells is related to the integrated state of the recombinant DNA.

Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

PubMed Central

Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza

2015-01-01

Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

A prototype subunit vaccine to IHN virus is being developed by recombinant DNA techniques. The techniques involve the isolation and characterization of the glycoprotein gene, which encodes the viral protein responsible for inducing a protective immune response in fish. The viral glycoprotein gene has been cloned and a restriction map of the cloned gene has been prepared. Preliminary DNA sequence analysis of the cloned gene has been initiated so that manipulation of the gene for maximum expression in appropriate plasmid vectors is possible. A recombinant plasmid containing the viral gene inserted in the proper orientation adjacent to a very strongmore » lambda promoter and ribosome binding site has been constructed. Evaluation of this recombinant plasmid for gene expression is being conducted. Immunization trials with purified viral glycoprotein indicate that fish are protected against lethal doses of IHNV after immersion and intraperitoneal methods of immunization. In addition, cross protection immunization trials indicate that Type 2 and Type 1 IHN virus produce glycoproteins that are cross-protective.« less

Transformation of Schwanniomyces occidentalis with an ADE2 gene cloned from S. occidentalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, R.D.; Favreau, M.A.

1988-12-01

We have developed an efficient transformation system for the industrial yeast Schwanniomyces occidentalis (formerly Schwanniomyces castellii). The transformation system is based on ade2 mutants of S. occidentalis deficient for phosphoribosylaminoimidazole carboxylase that were generated by mutagenesis. As a selectable marker, we isolated and characterized the S. occidentalis ADE2 gene by complementation in an ade2 strain of Saccharomyces cerevisiae. S. occidentalis was transformed with the recombinant plasmid pADE, consisting of a 4.5-kilobase-pair (kbp) DNA fragment from S. occidentalis containing the ADE2 gene inserted into the S. cerevisiae expression vector pYcDE8 by a modification of the spheroplasting procedure of Beggs. Intact plasmidsmore » were recovered in Escherichia coli from whole-cell lysates of ADE+ transformants, indicating that plasmids were replicating autonomously. High-molecular-mass species of pADE2 were found by Southern hybridization analysis of intact genomic DNA preparations. The shift to higher molecular mass of these plasmids during electrophoresis in the presence ethidium bromide after exposure to shortwave UV suggests that they exist in a supercoiled form in the transformed host. Subclones of the 4.5-kbp insert indicated that ADE2-complementing activity and sequences conferring autonomous replication in S. occidentalis were located within a 2.7-kbp EcoRI-SphI fragment. Plasmids containing this region cloned into the bacterial vector pUC19 complemented ade2 mutants of S. occidentalis with efficiencies identical to those of the original plasmid pADE.« less

[Construction and identification of recombinant human platelet-derived growth factor-B adenoviral vector and transfection into periodontal ligament stem cells].

PubMed

Shang, Shu-huan; Zhang, Yu-feng; Shi, Bin; Cheng, Xiang-rong

2008-10-01

To construct a recombinant human platelet-derived growth factor-B (PDGF-B) adenoviral vector and to transfect it into human periodontal ligament stem cells (PDLSC). The recombinant plasmid pAd-PDGF-B was constructed by homologous recombination and confirmed by restriction endonucleases digestion. Recombinant adenovirus was packaged in HEK293 cells. PDLSC were transfected with recombinant adenovirus and PDGF-B expression was confirmed. Expression of collagen type I gene was determined by quantitative analysis of the products of RT-PCR. The cell proliferation was determined with MTT colorimetric assay. The recombinant plasmid pAd-PDGF-B was confirmed by restriction endonucleases digestion. EGFP expression was observed on the third day after transfecting, and the expression of PDGF-B was detected. Immunohistochemical methods revealed that PDGF-B was expressed in PDLSC. Levels of expression of collagen type I gene were increased significantly by transfer of the exogenous PDGF-B gene to PDLSC. At the same time, findings indicated that Ad-PDGF-B stimulated PDLSC proliferation. MTT assay indicated the absorbance of PDLSC by stimulating with Ad-PDGF-B was (0.68 +/- 0.02), P < 0.01. Using the AdEasy system, the human PDGF-B recombinant adenovirus can be rapidly obtained. These results indicate that recombinant adenoviruses encoding PDGF-B transgenes could modulate proliferative activity of PDLSC, enhance the high expression of collagen type I and lay the foundation for periodontal tissue regeneration and dental implant gene therapy.

Phage display vectors for in vivo recombination of immunoglobulin heavy and light chain genes to make large combinatorial libraries.

PubMed

Tsurushita, N; Fu, H; Warren, C

1996-06-12

New phage display vectors for in vivo recombination of immunoglobulin (Ig) heavy (VH) and light (VL) chain variable genes, to make single-chain Fv fragments (scFv), were constructed. The VH and VL genes of monoclonal antibody (mAb) EP-5C7, which binds to both human E- and P-selectin, were cloned into a pUC19-derived plasmid vector, pCW93, and a pACYC184-derived phagemid vector, pCW99, respectively. Upon induction of Cre recombinase (phage P1 recombinase), the VH and VL genes were efficiently recombined into the same plasmid via the two loxP sites (phage P1 recombination sites), one located downstream from a VH gene in pCW93 and another upstream from a VL gene in pCW99. In the resulting phagemid, the loxP sequence also encodes a polypeptide linker connecting the VH and VL domains to form a scFv of EP-5C7. Whether expressed on the phage surface or as a soluble form, the EP-5C7 scFv showed specific binding to human E- and P-selectin. This phagemid vector system provides a way to recombine VH and VL gene libraries efficiently in vivo to make extremely large Ig combinatorial libraries.

Detection of osteoclastic cell-cell fusion through retroviral vector packaging.

PubMed

Kondo, Takako; Ikeda, Kyoji; Matsuo, Koichi

2004-11-01

Cell-cell fusion generates multinucleated cells such as osteoclasts in bone, myotubes in muscle, and trophoblasts in placenta. Molecular details governing these fusion processes are still largely unknown. As a step toward identification of fusogenic genes, we tested the concept that retroviral vectors can be packaged as a result of cell-cell fusion. First, we introduced replication-deficient retroviral vectors expressing mCAT-1, which mediates fusogenic interaction with the retroviral envelope protein Env, into Chinese hamster ovary (CHO) cells to generate vector cells. Plasmids expressing virion proteins Gag, Pol, and Env were introduced into a separate culture of CHO cells to generate packaging cells. Co-culturing vector and packaging cells resulted in production of infectious retroviruses carrying the mCAT-1 gene as a consequence of cell-cell fusion. Second, we introduced a retroviral vector into primary osteoclast precursors and co-cultured them with established osteoclast precursor RAW264.7 cells, which turned out to harbor packaging activity. Packaged retroviral vector was detected in culture supernatants only where the osteoclast differentiation factor receptor activator for NF-kappaB ligand (RANKL) induced fusion between these two cell types. These data suggest that retrovirus production can occur as a result of cell-cell fusion. This provides a novel approach for isolating and characterizing fusogenic genes using retroviral expression vectors.

Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

PubMed

Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P

2012-09-01

Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

PubMed

Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

2016-05-01

On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

Long-term increase in mVEGF164 in mouse hindlimb muscle mediated by phage phiC31 integrase after nonviral DNA delivery.

PubMed

Portlock, Joylette L; Keravala, Annahita; Bertoni, Carmen; Lee, Solomon; Rando, Thomas A; Calos, Michele P

2006-08-01

Peripheral vascular disease (PVD), characterized by insufficient blood supply to extremities, can be a devastating illness. Although many gene therapy strategies for PVD using vascular endothelial growth factor (VEGF) have resulted in increased blood vessel formation, the vessels are often impermanent and regress after therapy, probably because of the short-lived VEGF expression mediated by gene therapy vectors (14 days or less). phiC31 integrase is a recombinase originally isolated from a bacteriophage of Streptomyces. This integrase performs efficient chromosomal integration of plasmid DNA into mammalian genomes that results in long-term transgene expression. In this study, gene transfer was achieved by intramuscular injection of VEGF and integrase plasmid DNAs into the tibialis anterior muscle in the mouse hindlimb, followed by electroporation of the muscle with needle electrodes. We observed VEGF levels significantly above background 40 days after injection in animals that received phiC31 integrase and the VEGF plasmid. Site-specific integration of plasmid DNA in the chromosomes of muscle tissue was verified by polymerase chain reaction at a common integration site. These results suggest the possible utility of the phiC31 integrase system to treat ischemic disease.

[Experimental study on human periodontal ligament cells transfected with human amelogenin gene].

PubMed

Yu, Guang; Shu, Rong; Sun, Ying; Cheng, Lan; Song, Zhong-Chen; Zhang, Xiu-Li

2008-02-01

To construct the recombinant lentiviral vector of human amelogenin gene, infect human periodontal ligament cells with the recombinant lentivirus, and evaluate the feasibility of applying modified PDLCs as seeds for a further periodontal reconstruction. The mature peptide of hAm cDNA was cloned and linked into the vector plasmid, the recombinant plasmid FUAmW was confirmed by double enzyme digestion and sequence analysis. Recombinant lentivirus was prepared from 293T cells by polytheylenimine (PEI)-mediated transient cotransfection. The hPDLCs and 293T cells were infected with the generated lentivirus. The infection efficiency was analysed by detection of green fluorescence protein (GFP) with fluorescent microscope and flow cytometer 72 hours later. The expression of hAm gene was detected by reverse transcription polymerase chain reaction (RT-PCR). The sequence of inserted fragment in recombinant plasmid was identical to the hAm sequence reported in Genebank. Green fluorescence was visible under fluorescent microscope, FCM assay showed that positive percentage was 69.46% and 33.99% in 293T and hPDLCs, respectively. The targeted gene was obtained in the experimental groups by RT-PCR. The recombinan lentiviral vector of hAm gene is constructed successfully and it could be transfected into cultured hPDLCs. hAm gene and seed cells may be used for further study in the fields periodontal tissue engineering. Supported by National Natural Science Foundation of China (Grant No. 30672315).

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

Hypoxia/hepatoma dual specific suicide gene expression plasmid delivery using bio-reducible polymer for hepatocellular carcinoma therapy.

PubMed

Kim, Hyun Ah; Nam, Kihoon; Lee, Minhyung; Kim, Sung Wan

2013-10-10

Gene therapy is suggested as a promising alternative strategy of hepatocellular carcinoma (HCC, also called hepatoma) therapy. To achieve a successful and safe gene therapy, tight regulation of gene expression is required to minimize side-effects in normal tissues. In this study, we developed a novel hypoxia and hepatoma dual specific gene expression vector. The constructed vectors were transfected into various cell lines using bio-reducible polymer, PAM-ABP. First, pAFPS-Luc or pAFPL-Luc vector was constructed with the alpha-fectoprotein (AFP) promoter and enhancer for hepatoma tissue specific gene expression. Then, pEpo-AFPL-Luc was constructed by insertion of the erythropoietin (Epo) enhancer for hypoxic cancer specific gene expression. In vitro transfection assay showed that pEpo-AFPL-Luc transfected hepatoma cell increased gene expression under hypoxic condition. To confirm the therapeutic effect of dual specific vector, herpes simplex virus thymidine kinase (HSV-TK) gene was introduced for cancer cell killing. The pEpo-AFPL-TK was transfected into hepatoma cell lines in the presence of ganciclovir (GCV) pro-drug. Caspase-3/7, MTT and TUNEL assays elucidated that pEpo-AFPL-TK transfected cells showed significant increasing of death rate in hypoxic hepatoma cells compared to controls. Therefore, the hypoxia/hepatoma dual specific gene expression vector with the Epo enhancer and AFP promoter may be useful for hepatoma specific gene therapy. © 2013.

[Overexpression of SEPP1 inhibits the proliferation and induces cell cycle G2/M arrest of 786-O and 769-P human renal carcinoma cells].

PubMed

Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu

2016-06-01

Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.

Scarless genome editing and stable inducible expression vectors for Geobacter sulfurreducens

DOE PAGES

Chan, Chi Ho; Levar, Caleb E.; Zacharoff, Lori; ...

2015-08-07

Metal reduction by members of the Geobacteraceae is encoded by multiple gene clusters, and the study of extracellular electron transfer often requires biofilm development on surfaces. Genetic tools that utilize polar antibiotic cassette insertions limit mutant construction and complementation. In addition, unstable plasmids create metabolic burdens that slow growth, and the presence of antibiotics such as kanamycin can interfere with the rate and extent of Geobacter biofilm growth. We report here genetic system improvements for the model anaerobic metal-reducing bacterium Geobacter sulfurreducens. A motile strain of G. sulfurreducens was constructed by precise removal of a transposon interrupting the fgrM flagellarmore » regulator gene using SacB/sucrose counterselection, and Fe(III) citrate reduction was eliminated by deletion of the gene encoding the inner membrane cytochrome imcH. We also show that RK2-based plasmids were maintained in G. sulfurreducens for over 15 generations in the absence of antibiotic selection in contrast to unstable pBBR1 plasmids. Therefore, we engineered a series of new RK2 vectors containing native constitutive Geobacter promoters, and modified one of these promoters for VanR-dependent induction by the small aromatic carboxylic acid vanillate. Inducible plasmids fully complemented Δ imcH mutants for Fe(III) reduction, Mn(IV) oxide reduction, and growth on poised electrodes. A real-time, high-throughput Fe(III) citrate reduction assay is described that can screen numerous G. sulfurreducens strain constructs simultaneously and shows the sensitivity of imcH expression by the vanillate system. Lastly, these tools will enable more sophisticated genetic studies in G. sulfurreducens without polar insertion effects or need for multiple antibiotics.« less

Comparison of immune responses to different foot-and-mouth disease genetically engineered vaccines in guinea pigs.

PubMed

Yao, Qingxia; Qian, Ping; Huang, Qinfeng; Cao, Yi; Chen, Huanchun

2008-01-01

The P12A3C gene from FMDV (serotype O) encoding the capsid precursor protein, and the highly immunogenic gene FHG, which encodes multiple epitopes of FMDV capsid proteins, were inserted into eukaryotic expression vectors to compare different candidate genetically engineered vaccines for foot-and-mouth disease (FMD). A modified live pseudorabies virus (MLPRV) was also used to deliver P12A3C. Guinea pigs were inoculated intramuscularly with the candidate vaccines to compare the ability to elicit immunity of the DNA vector and a live viral vector. An indirect enzyme-linked immunosorbent assay (iELISA), virus-neutralization test and lymphoproliferation assay were used to detect antibody and cellular responses. The group immunized with P12A3C delivered by MLPRV produced significantly greater antibody and cellular responses indicating that MLPRV has a greater ability to mediate exogenous gene delivery than the plasmid DNA vector. Comparison of the immune responses induced by P12A3C and FHG, which were both mediated by DNA plasmids, showed that FHG and P12A3C elicited similar cellular responses, while P12A3C induced higher antibody levels, suggesting that P12A3C is a more powerful immunogen than FHG. In challenge experiments, guinea pigs vaccinated with P12A3C delivered by MLPRV were protected fully from FMDV challenge, whereas guinea pigs vaccinated with P12A3C or FHG delivered by DNA plasmid were only protected partially. This study provides a basis for future construction of a genetically engineered vaccine for FMDV.

Genomic Analysis and Isolation of RNA Polymerase II Dependent Promoters from Spodoptera frugiperda.

PubMed

Bleckmann, Maren; Fritz, Markus H-Y; Bhuju, Sabin; Jarek, Michael; Schürig, Margitta; Geffers, Robert; Benes, Vladimir; Besir, Hüseyin; van den Heuvel, Joop

2015-01-01

The Baculoviral Expression Vector System (BEVS) is the most commonly used method for high expression of recombinant protein in insect cells. Nevertheless, expression of some target proteins--especially those entering the secretory pathway--provides a severe challenge for the baculovirus infected insect cells, due to the reorganisation of intracellular compounds upon viral infection. Therefore, alternative strategies for recombinant protein production in insect cells like transient plasmid-based expression or stable expression cell lines are becoming more popular. However, the major bottleneck of these systems is the lack of strong endogenous polymerase II dependent promoters, as the strong baculoviral p10 and polH promoters used in BEVS are only functional in presence of the viral transcription machinery during the late phase of infection. In this work we present a draft genome and a transcriptome analysis of Sf21 cells for the identification of the first known endogenous Spodoptera frugiperda promoters. Therefore, putative promoter sequences were identified and selected because of high mRNA level or in analogy to other strong promoters in other eukaryotic organism. The chosen endogenous Sf21 promoters were compared to early viral promoters for their efficiency to trigger eGFP expression using transient plasmid based transfection in a BioLector Microfermentation system. Furthermore, promoter activity was not only shown in Sf21 cells but also in Hi5 cells. The novel endogenous Sf21 promoters were ranked according to their activity and expand the small pool of available promoters for stable insect cell line development and transient plasmid expression in insect cells. The best promoter was used to improve plasmid based transient transfection in insect cells substantially.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

PubMed

Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

2014-01-01

A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

Application of methylation in improving plasmid transformation into Helicobacter pylori.

PubMed

Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

2018-05-23

Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

[Construction and expression of fusion protein TRX-hJagged1 in E.coli BL21].

PubMed

Li, Guo-Hui; Fan, Yu-Zhen; Huang, Si-Yong; Liu, Qiang; Yin, Dan-Dan; Liu, Li; Chen, Ren-An; Hao, Miao-Wang; Liang, Ying-Min

2014-06-01

This study was purposed to construct prokaryotic expression vector and to investigate the expression of Notch ligand Jagged1 in E.coli. An expression vector pET-hJagged1 was constructed, which can be inserted in Jagged1 with different lengths, but the DSL domain of human Jagged1 should be contained. Then the recombinant plasmids were transformed into the competent cell of E.coli BL21, and the expression of the fusion protein was induced by IPTG. Fusion protein was purified from the supernatant of cell lysates via the Nickel affinity chromatography. The results showed that prokaryotic expression vectors pET-hJagged1 (Bgl II), pET-hJagged1 (Hind I) and pET-hJagged1 (Stu I) were successfully constructed, but only pET-hJagged1 (Stu I) could express the soluble TRX-hJagged1. The purified TRX-Jagged1 protein could be obtained via the Nickel affinity chromatography, and then confirmed by Western Blot. It is concluded that prokaryotic expression vector pET-hJagged1 is successfully constructed, but only pET-hJagged1 (Stu I) can express the soluble TRX-hJagged1 and the TRX-Jagged1 fusion protein is obtained through the prokaryotic expression system, which laid a solid foundation for further to explore the effects of Jagged1 in hematopoietic and lymphoid system.

Undetectable Transcription of cap in a Clinical AAV Vector: Implications for Preformed Capsid in Immune Responses

PubMed Central

Hauck, Bernd; Murphy, Samuel L; Smith, Peter H; Qu, Guang; Liu, Xingge; Zelenaia, Olga; Mingozzi, Federico; Sommer, Jürg M; High, Katherine A; Wright, J. Fraser

2008-01-01

In a gene therapy clinical trial for hemophilia B, adeno-associated virus 2 (AAV2) capsid–specific CD8+ T cells were previously implicated in the elimination of vector-transduced hepatocytes, resulting in loss of human factor IX (hFIX) transgene expression. To test the hypothesis that expression of AAV2 cap DNA impurities in the AAV2-hFIX vector was the source of epitopes presented on transduced cells, transcription of cap was assessed by quantitative reverse transcription–PCR (Q-RT-PCR) following transduction of target cells with the vector used in the clinical trial. Transcriptional profiling was also performed for residual AmpR, and adenovirus E2A and E4. Although trace amounts of DNA impurities were present in the clinical vector, transcription of these sequences was not detected after transduction of human hepatocytes, nor in mice administered a dose 26-fold above the highest dose administered in the clinical study. Two methods used to minimize encapsidated DNA impurities in the clinical vector were: (i) a vector (cis) production plasmid with a backbone exceeding the packaging limit of AAV; and (ii) a vector purification step that achieved separation of the vector from vector-related impurities (e.g., empty capsids). In conclusion, residual cap expression was undetectable following transduction with AAV2-hFIX clinical vectors. Preformed capsid protein is implicated as the source of epitopes recognized by CD8+ T cells that eliminated vector-transduced cells in the clinical study. PMID:18941440

Transformation of Saccharomyces cerevisiae and Schizosaccharomyces pombe with linear plasmids containing 2 micron sequences.

PubMed Central

Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P

1985-01-01

Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773

A Peptide-based Vector for Efficient Gene Transfer In Vitro and In Vivo

PubMed Central

Lehto, Taavi; Simonson, Oscar E; Mäger, Imre; Ezzat, Kariem; Sork, Helena; Copolovici, Dana-Maria; Viola, Joana R; Zaghloul, Eman M; Lundin, Per; Moreno, Pedro MD; Mäe, Maarja; Oskolkov, Nikita; Suhorutšenko, Julia; Smith, CI Edvard; Andaloussi, Samir EL

2011-01-01

Finding suitable nonviral delivery vehicles for nucleic acid–based therapeutics is a landmark goal in gene therapy. Cell-penetrating peptides (CPPs) are one class of delivery vectors that has been exploited for this purpose. However, since CPPs use endocytosis to enter cells, a large fraction of peptides remain trapped in endosomes. We have previously reported that stearylation of amphipathic CPPs, such as transportan 10 (TP10), dramatically increases transfection of oligonucleotides in vitro partially by promoting endosomal escape. Therefore, we aimed to evaluate whether stearyl-TP10 could be used for the delivery of plasmids as well. Our results demonstrate that stearyl-TP10 forms stable nanoparticles with plasmids that efficiently enter different cell-types in a ubiquitous manner, including primary cells, resulting in significantly higher gene expression levels than when using stearyl-Arg9 or unmodified CPPs. In fact, the transfection efficacy of stearyl-TP10 almost reached the levels of Lipofectamine 2000 (LF2000), however, without any of the observed lipofection-associated toxicities. Most importantly, stearyl-TP10/plasmid nanoparticles are nonimmunogenic, mediate efficient gene delivery in vivo, when administrated intramuscularly (i.m.) or intradermally (i.d.) without any associated toxicity in mice. PMID:21343913

Expression of the human blood coagulation protein factor XIIIa in Saccharomyces cerevisiae: dependence of the expression levels from host-vector systems and medium conditions.

PubMed

Bröker, M; Bäuml, O; Göttig, A; Ochs, J; Bodenbenner, M; Amann, E

1991-03-01

The human blood coagulation protein Factor XIIIa (FXIIIa) was expressed in Saccharomyces cerevisiae employing Escherichia coli-yeast shuttle vectors based on a 2-mu plasmid. Several factors affecting high production yield of recombinant FXIIIa were analysed. The use of the regulatable GAL-CYC1 hybrid promoter resulted in higher FXIIIa expression when compared with the constitutive ADCI promoter. Screening for suitable yeast strains for expression of FXIIIa under the transcriptional control of the GAL-CYC1 hybrid promoter revealed a broad spectrum of productivity. No obvious correlation between the expression rate and the genetic markers of the strains could be identified. The medium composition markedly influenced the FXIIIa expression rates. The expression of FXIIIa was strictly regulated by the carbon source. Glucose as the only sugar and energy source repressed the synthesis of FXIIIa, whereas addition of galactose induced FXIIIa expression. Special feeding schemes resulted in a productivity of up to 100 mg FXIIIa/l in shake flasks.

Cloning systems for Rhodococcus and related bacteria

DOEpatents

Finnerty, W.R.; Singer, M.E.

1990-08-28

A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors. 2 figs.

Cloning systems for Rhodococcus and related bacteria

DOEpatents

Finnerty, William R.; Singer, Mary E.

1990-01-01

A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors.

[Obtaining marker-free transgenic soybean plants with optimal frequency by constructing three T-DNAs binary vector].

PubMed

Ye, Xing-Guo; Qin, Hua

2007-01-01

Obtaining marker-free plants with high efficiency will benefit the environmental release of transgenic crops. To achieve this point, a binary vector pNB35SVIP1 with three T-DNAs was constructed by using several mediate plasmids, in which one copy of bar gene expression cassette and two copies of VIP1 gene expression cassette were included. EHA101 Agrobacterium strain harboring the final construct was applied to transform soybean (Glycine max) cotyledon nodes. Through 2 - 3 months regeneration and selection on 3 - 5mg/L glufosinate containing medium, transgenic soybean plants were confirmed to be obtained at 0.83% - 3.16%, and co-transformation efficiency of both gene in the same individual reached up to 86.4%, based on southern blot test. By the analysis of PCR, southern blot and northern blot combining with leaf painting of herbicide in T1 progenies, 41 plants were confirmed to be eliminated of bar gene with the frequency of 7.6% . Among the T1 populations tested, the loss of the alien genes happened in 22.7% lines, the silence of bar gene took place in 27.3% lines, and VIP1 gene silence existed in 37.1% marker-free plants. The result also suggested that the plasmid with three T-DNAs might be an ideal vector to generate maker-free genetic modified organism.

Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

PubMed

Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

2016-03-01

Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

A Recombinant Probiotic, Lactobacillus casei, Expressing the Clostridium perfringens α-toxoid, as an Orally Vaccine Candidate Against Gas Gangrene and Necrotic Enteritis.

PubMed

Alimolaei, Mojtaba; Golchin, Mehdi; Abshenas, Jalil; Ezatkhah, Majid; Bafti, Mehrdad Shamsaddini

2018-06-01

The alpha-toxin is one of the virulence factors of Clostridium perfringens for gas gangrene in humans and animals or necrotic enteritis in poultry. The C-terminal domain of this toxin ( cpa 247-370 ) was synthesized and cloned into pT1NX vector to construct the pT1NX-alpha plasmid. This surface-expressing plasmid was electroporated into Lactobacillus casei ATCC 393, generating the recombinant L. casei strain expressing alpha-toxoid (LC-α strain). Expression of this modified alpha-toxoid was confirmed by SDS-PAGE, immunoblotting, and direct immunofluorescence microscopy. BALB/c mice, immunized orally by the recombinant LC-α strain, elicited mucosal and significantly humoral immune responses (p < 0.05) and developed a protection against 900 MLD/mL of the standard alpha-toxin. This study showed that this recombinant LC-α strain could be a promising vaccine candidate against gas gangrene and necrotic enteritis.

Dual‑sensitive HRE/Egr1 promoter regulates Smac overexpression and enhances radiation‑induced A549 human lung adenocarcinoma cell death under hypoxia.

PubMed

Li, Chang-Feng; Chen, Li-Bo; Li, Dan-Dan; Yang, Lei; Zhang, Bao-Gang; Jin, Jing-Peng; Zhang, Ying; Zhang, Bin

2014-08-01

The aim of this study was to construct an expression vector carrying the hypoxia/radiation dual‑sensitive chimeric hypoxia response element (HRE)/early growth response 1 (Egr‑1) promoter in order to overexpress the therapeutic second mitochondria‑derived activator of caspases (Smac). Using this expression vector, the present study aimed to explore the molecular mechanism underlying radiotherapy‑induced A549 human lung adenocarcinoma cell death and apoptosis under hypoxia. The plasmids, pcDNA3.1‑Egr1‑Smac (pE‑Smac) and pcDNA3.1‑HRE/Egr-1‑Smac (pH/E‑Smac), were constructed and transfected into A549 human lung adenocarcinoma cells using the liposome method. CoCl2 was used to chemically simulate hypoxia, followed by the administration of 2 Gy X‑ray irradiation. An MTT assay was performed to detect cell proliferation and an Annexin V‑fluorescein isothiocyanate apoptosis detection kit was used to detect apoptosis. Quantitative polymerase chain reaction and western blot analyses were used for the detection of mRNA and protein expression, respectively. Infection with the pE‑Smac and pH/E‑Smac plasmids in combination with radiation and/or hypoxia was observed to enhance the expression of Smac. Furthermore, Smac overexpression was found to enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis. The cytochrome c/caspase‑9/caspase‑3 pathway was identified to be involved in this regulation of apoptosis. Plasmid infection in combination with X‑ray irradiation was found to markedly induce cell death under hypoxia. In conclusion, the hypoxia/radiation dual‑sensitive chimeric HRE/Egr‑1 promoter was observed to enhance the expression of the therapeutic Smac, as well as enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis under hypoxia. This apoptosis was found to involve the mitochondrial pathway.

Anaerobically controlled expression system derived from the arcDABC operon of Pseudomonas aeruginosa: application to lipase production.

PubMed Central

Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D

1996-01-01

The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231

A Split-GFP Gateway Cloning System for Topology Analyses of Membrane Proteins in Plants.

PubMed

Xie, Wenjun; Nielsen, Mads Eggert; Pedersen, Carsten; Thordal-Christensen, Hans

2017-01-01

To understand the function of membrane proteins, it is imperative to know their topology. For such studies, a split green fluorescent protein (GFP) method is useful. GFP is barrel-shaped, consisting of 11 β-sheets. When the first ten β-sheets (GFP1-10) and the 11th β-sheet (GFP11) are expressed from separate genes they will self-assembly and reconstitute a fluorescent GFP protein. However, this will only occur when the two domains co-localize in the same cellular compartment. We have developed an easy-to-use Gateway vector set for determining on which side of the membrane the N- and C-termini are located. Two vectors were designed for making N- and C-terminal fusions between the membrane proteins-of-interest and GFP11, while another three plasmids were designed to express GFP1-10 in either the cytosol, the endoplasmic reticulum (ER) lumen or the apoplast. We tested functionality of the system by applying the vector set for the transmembrane domain, CNXTM, of the ER membrane protein, calnexin, after transient expression in Nicotiana benthamiana leaves. We observed GFP signal from the ER when we reciprocally co-expressed GFP11-CNXTM with GFP1-10-HDEL and CNXTM-GFP with cytosolic GFP1-10. The opposite combinations did not result in GFP signal emission. This test using the calnexin ER-membrane domain demonstrated its C-terminus to be in the cytosol and its N-terminus in the ER lumen. This result confirmed the known topology of calnexin, and we therefore consider this split-GFP system highly useful for ER membrane topology studies. Furthermore, the vector set provided is useful for detecting the topology of proteins on other membranes in the cell, which we confirmed for a plasma membrane syntaxin. The set of five Ti-plasmids are easily and efficiently used for Gateway cloning and transient transformation of N. benthamiana leaves.

Expression of bacteriocin LsbB is dependent on a transcription terminator.

PubMed

Uzelac, Gordana; Miljkovic, Marija; Lozo, Jelena; Radulovic, Zorica; Tosic, Natasa; Kojic, Milan

2015-10-01

The production of LsbB, leaderless class II bacteriocin, is encoded by genes (lsbB and lmrB) located on plasmid pMN5 in Lactococcus lactis BGMN1-5. Heterologous expression of the lsbB gene using the pAZIL vector (pAZIL-lsbB) in L. lactis subsp. cremoris MG7284 resulted in a significant reduction (more than 30 times) of bacteriocin LsbB expression. Subcloning and deletion experiments with plasmid pMN5 revealed that full expression of LsbB requires the presence of a complete transcription terminator located downstream of the lsbB gene. RNA stability analysis revealed that the presence of a transcription terminator increased the RNA stability by three times and the expression of LsbB by 30 times. The study of the influence of transcription terminator on the expression of other bacteriocin genes (lcnB, for lactococcin B production) indicated that this translational terminator likely functions in a lsbB-specific manner rather than in a general manner. Copyright © 2015 Elsevier GmbH. All rights reserved.

Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

PubMed Central

Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

1985-01-01

The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

Phenotypic and molecular characterization of 5 novel CTX-M enzymes carried by Klebsiella pneumoniae and Escherichia coli.

PubMed

Cheng, Jun; Ye, Ying; Wang, Ying-ying; Li, Hui; Li, Xu; Li, Jia-bin

2008-02-01

The aim of the present study was to study the phenotypic and molecular characterization of 5 novel CTX-M-beta-1actamases carried by 5 Klebsiella pneumoniae isolates and 3 Escherichia coli isolates collected from 4 hospitals in Hefei, China. The purified PCR products were ligated with pGEM-Teasy vectors, expressed, and sequenced. The complete genes of the CTX-M-beta-lactamases were ligated with the pHSG398 vector to express prokaryotic recombinant proteins. Plasmids were extracted by rapid alkaline lysis protocol, and the PCR method was performed to determine whether the prokaryotic expression was successful or not. Antimicrobial susceptibility was tested and the phenotypes of transformants were determined according to criteria recommended by the Clinical and Laboratory Standards Institute. The kinetic parameters of enzymes were confirmed. The isoelectric points (pI) were determined by isoelectric focusing assay. Pulsed-field gel electrophoresis and plasmid profiling were performed. The PCR products had 1101 nucleotides and were determined as CTX-M-46, CTX-M-47, CTX-M-48, CTX-M-49, and CTX-M-50. All strains were resistant to cefotaxime, but most of them were susceptible or intermediate to ceftazidime. The phenotypes of novel enzymes were determined as extended-spectrum-beta-lactamases (ESBL). Penicillin G, cephalothin, cefuroxime, and cefotaxime were determined to good substrates, whereas ceftazidime hydrolysis was not detected. The pI of the 5 novel CTX-M-beta-lactamases were 8.0. CTX-M-derivatives could be the multiplex genesis in our area. This is the first report of these 5 novel plasmid-mediated CTX-M ESBL produced from China in the world. Molecular typing reveals notably different origin in genes encoding different CTX-M variants of 8 strains.

Plasmid-encoded biosynthetic genes alleviate metabolic disadvantages while increasing glucose conversion to shikimate in an engineered Escherichia coli strain.

PubMed

Rodriguez, Alberto; Martínez, Juan A; Millard, Pierre; Gosset, Guillermo; Portais, Jean-Charles; Létisse, Fabien; Bolivar, Francisco

2017-06-01

Metabolic engineering strategies applied over the last two decades to produce shikimate (SA) in Escherichia coli have resulted in a battery of strains bearing many expression systems. However, the effects that these systems have on the host physiology and how they impact the production of SA are still not well understood. In this work we utilized an engineered E. coli strain to determine the consequences of carrying a vector that promotes SA production from glucose with a high-yield but that is also expected to impose a significant cellular burden. Kinetic comparisons in fermentors showed that instead of exerting a negative effect, the sole presence of the plasmid increased glucose consumption without diminishing the growth rate. By constitutively expressing a biosynthetic operon from this vector, the more active glycolytic metabolism was exploited to redirect intermediates toward the production of SA, which further increased the glucose consumption rate and avoided excess acetate production. Fluxomics and metabolomics experiments revealed a global remodeling of the carbon and energy metabolism in the production strain, where the increased SA production reduced the carbon available for oxidative and fermentative pathways. Moreover, the results showed that the production of SA relies on a specific setup of the pentose phosphate pathway, where both its oxidative and non-oxidative branches are strongly activated to supply erythrose-4-phosphate and balance the NADPH requirements. This work improves our understanding of the metabolic reorganization observed in E. coli in response to the plasmid-based expression of the SA biosynthetic pathway. Biotechnol. Bioeng. 2017;114: 1319-1330. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Identification of the Propionicin F Bacteriocin Immunity Gene (pcfI) and Development of a Food-Grade Cloning System for Propionibacterium freudenreichii▿ †

PubMed Central

Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F.

2007-01-01

This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 107 transformants/μg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive PpampS promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by ∼91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains. PMID:17933941

Identification of the propionicin F bacteriocin immunity gene (pcfI) and development of a food-grade cloning system for Propionibacterium freudenreichii.

PubMed

Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F

2007-12-01

This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 10(7) transformants/microg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive P(pampS) promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by approximately 91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains.

Retrofitting BACs with G418 resistance, luciferase, and oriP and EBNA-1 – new vectors for in vitro and in vivo delivery

PubMed Central

Magin-Lachmann, Christine; Kotzamanis, George; D'Aiuto, Leonardo; Wagner, Ernst; Huxley, Clare

2003-01-01

Background Bacterial artificial chromosomes (BACs) have been used extensively for sequencing the human and mouse genomes and are thus readily available for most genes. The large size of BACs means that they can generally carry intact genes with all the long range controlling elements that drive full levels of tissue-specific expression. For gene expression studies and gene therapy applications it is useful to be able to retrofit the BACs with selectable genes such as G418 resistance, reporter genes such as luciferase, and oriP/EBNA-1 from Epstein Barr virus which allows long term episomal maintenance in mammalian cells. Results We describe a series of retrofitting plasmids and a protocol for in vivo loxP/Cre recombination. The vector pRetroNeo carries a G418 resistance cassette, pRetroNeoLuc carries G418 resistance and a luciferase expression cassette, pRetroNeoLucOE carries G418 resistance, luciferase and an oriP/EBNA-1 cassette and pRetroNeoOE carries G418 resistance and oriP/EBNA-1. These vectors can be efficiently retrofitted onto BACs without rearrangement of the BAC clone. The luciferase cassette is expressed efficiently from the retrofitting plasmids and from retrofitted BACs after transient transfection of B16F10 cells in tissue culture and after electroporation into muscles of BALB/c mice in vivo. We also show that a BAC carrying GFP, oriP and EBNA-1 can be transfected into B16F10 cells with Lipofectamine 2000 and can be rescued intact after 5 weeks. Conclusion The pRetro vectors allow efficient retrofitting of BACs with G418 resistance, luciferase and/or oriP/EBNA-1 using in vivo expression of Cre. The luciferase reporter gene is expressed after transient transfection of retrofitted BACs into cells in tissue culture and after electroporation into mouse muscle in vivo. OriP/EBNA-1 allows stable maintenance of a 150-kb BAC without rearrangement for at least 5 weeks. PMID:12609052

Gene expression systems in corynebacteria.

PubMed

Srivastava, Preeti; Deb, J K

2005-04-01

Corynebacterium belongs to a group of gram-positive bacteria having moderate to high G+C content, the other members being Mycobacterium, Nocardia, and Rhodococcus. Considerable information is now available on the plasmids, gene regulatory elements, and gene expression in corynebacteria, especially in soil corynebacteria such as Corynebacterium glutamicum. These bacteria are non-pathogenic and, unlike Bacillus and Streptomyces, are low in proteolytic activity and thus have the potential of becoming attractive systems for expression of heterologous proteins. This review discusses recent advances in our understanding of the organization of various regulatory elements, such as promoters, transcription terminators, and development of vectors for cloning and gene expression.

Generation of recombinant rotaviruses expressing fluorescent proteins using an optimized reverse genetics system.

PubMed

Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki

2018-04-18

An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.

A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.

PubMed

Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei

2018-05-01

Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.

Development of plasmid vector and electroporation condition for gene transfer in sporogenic lactic acid bacterium, Bacillus coagulans.

PubMed

Rhee, Mun Su; Kim, Jin-Woo; Qian, Yilei; Ingram, L O; Shanmugam, K T

2007-07-01

Bacillus coagulans is a sporogenic lactic acid bacterium that ferments glucose and xylose, major components of plant biomass, a potential feedstock for cellulosic ethanol. The temperature and pH for optimum rate of growth of B. coagulans (50 to 55 degrees C, pH 5.0) are very similar to that of commercially developed fungal cellulases (50 degrees C; pH 4.8). Due to this match, simultaneous saccharification and fermentation (SSF) of cellulose to products by B. coagulans is expected to require less cellulase than needed if the SSF is conducted at a sub-optimal temperature, such as 30 degrees C, the optimum for yeast, the main biocatalyst used by the ethanol industry. To fully exploit B. coagulans as a platform organism, we have developed an electroporation method to transfer plasmid DNA into this genetically recalcitrant bacterium. We also constructed a B. coagulans/E. coli shuttle vector, plasmid pMSR10 that contains the rep region from a native plasmid (pMSR0) present in B. coagulans strain P4-102B. The native plasmid, pMSR0 (6823bp), has 9 ORFs, and replicates by rolling-circle mode of replication. Plasmid pNW33N, developed for Geobacillus stearothermophilus, was also transformed into this host and stably maintained while several other Bacillus/Escherichia coli shuttle vector plasmids were not transformed into B. coagulans. The transformation efficiency of B. coagulans strain P4-102B using the plasmids pNW33N or pMSR10 was about 1.5x10(16) per mole of DNA. The availability of shuttle vectors and an electroporation method is expected to aid in genetic and metabolic engineering of B. coagulans.

Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.

PubMed Central

Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C

1997-01-01

We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus. PMID:9097439

Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.

PubMed

Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C

1997-04-01

We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus.

Bacteriophage-based vectors for site-specific insertion of DNA in the chromosome of Corynebacteria.

PubMed

Oram, Mark; Woolston, Joelle E; Jacobson, Andrew D; Holmes, Randall K; Oram, Diana M

2007-04-15

In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as beta. beta-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally encoded genes, is regulated by the DtxR protein in response to Fe(2+) levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the beta-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae DeltadtxR strain. Additionally, strains of beta-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for beta, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species.

A novel expression system for intracellular production and purification of recombinant affinity-tagged proteins in Aspergillus niger.

PubMed

Roth, Andreas H F J; Dersch, Petra

2010-03-01

A set of different integrative expression vectors for the intracellular production of recombinant proteins with or without affinity tag in Aspergillus niger was developed. Target genes can be expressed under the control of the highly efficient, constitutive pkiA promoter or the novel sucrose-inducible promoter of the beta-fructofuranosidase (sucA) gene of A. niger in the presence or absence of alternative carbon sources. All expression plasmids contain an identical multiple cloning sequence that allows parallel construction of N- or C-terminally His6- and StrepII-tagged versions of the target proteins. Production of two heterologous model proteins, the green fluorescence protein and the Thermobifida fusca hydrolase, proved the functionality of the vector system. Efficient production and easy detection of the target proteins as well as their fast purification by a one-step affinity chromatography, using the His6- or StrepII-tag sequence, was demonstrated.

Ultrashort laser pulse cell manipulation using nano- and micro- materials

NASA Astrophysics Data System (ADS)

Schomaker, Markus; Killian, Doreen; Willenbrock, Saskia; Diebold, Eric; Mazur, Eric; Bintig, Willem; Ngezahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo; Junghanß, Christian; Lubatschowski, Holger; Heisterkamp, Alexander

2010-08-01

The delivery of extra cellular molecules into cells is essential for cell manipulation. For this purpose genetic materials (DNA/RNA) or proteins have to overcome the impermeable cell membrane. To increase the delivery efficiency and cell viability of common methods different nano- and micro material based approaches were applied. To manipulate the cells, the membrane is in contact with the biocompatible material. Due to a field enhancement of the laser light at the material and the resulting effect the cell membrane gets perforated and extracellular molecules can diffuse into the cytoplasm. Membrane impermeable dyes, fluorescent labelled siRNA, as well as plasmid vectors encoded for GFP expression were used as an indicator for successful perforation or transfection, respectively. Dependent on the used material, perforation efficiencies over 90 % with a cell viability of about 80 % can be achieved. Additionally, we observed similar efficiencies for siRNA transfection. Due to the larger molecule size and the essential transport of the DNA into the nucleus cells are more difficult to transfect with GFP plasmid vectors. Proof of principle experiments show promising and adequate efficiencies by applying micro materials for plasmid vector transfection. For all methods a weakly focused fs laser beam is used to enable a high manipulation throughput for adherent and suspension cells. Furthermore, with these alternative optical manipulation methods it is possible to perforate the membrane of sensitive cell types such as primary and stem cells with a high viability.

Protection from ischemic heart injury by a vigilant heme oxygenase-1 plasmid system.

PubMed

Tang, Yao Liang; Tang, Yi; Zhang, Y Clare; Qian, Keping; Shen, Leping; Phillips, M Ian

2004-04-01

Although human heme oxygenase-1 (hHO-1) could provide a useful approach for cellular protection in the ischemic heart, constitutive overexpression of hHO-1 may lead to unwanted side effects. To avoid this, we designed a hypoxia-regulated hHO-1 gene therapy system that can be switched on and off. This vigilant plasmid system is composed of myosin light chain-2v promoter and a gene switch that is based on an oxygen-dependent degradation domain from the hypoxia inducible factor-1-alpha. The vector can sense ischemia and switch on the hHO-1 gene system, specifically in the heart. In an in vivo experiment, the vigilant hHO-1 plasmid or saline was injected intramyocardially into myocardial infarction mice or sham operation mice. After gene transfer, expression of hHO-1 was only detected in the ischemic heart treated with vigilant hHO-1 plasmids. Masson trichrome staining showed significantly fewer fibrotic areas in vigilant hHO-1 plasmids-treated mice compared with saline control (43.0%+/-4.8% versus 62.5%+/-3.3%, P<0.01). The reduction of interstitial fibrosis is accompanied by an increase in myocardial hHO-1 expression in peri-infarct border areas, concomitant with higher Bcl-2 levels and lower Bax, Bak, and caspase 3 levels in the ischemic myocardium compared with saline control. By use of a cardiac catheter, heart from vigilant hHO-1 plasmids-treated mice showed improved recovery of contractile and diastolic performance after myocardial infarction compared with saline control. This study documents the beneficial regulation and therapeutic potential of vigilant plasmid-mediated hHO-1 gene transfer. This novel gene transfer strategy can provide cardiac-specific protection from future repeated bouts of ischemic injury.

A single EBV-based vector for stable episomal maintenance and expression of GFP in human embryonic stem cells.

PubMed

Thyagarajan, Bhaskar; Scheyhing, Kelly; Xue, Haipeng; Fontes, Andrew; Chesnut, Jon; Rao, Mahendra; Lakshmipathy, Uma

2009-03-01

Stable expression of transgenes in stem cells has been a challenge due to the nonavailability of efficient transfection methods and the inability of transgenes to support sustained gene expression. Several methods have been reported to stably modify both embryonic and adult stem cells. These methods rely on integration of the transgene into the genome of the host cell, which could result in an expression pattern dependent on the number of integrations and the genomic locus of integration. To overcome this issue, site-specific integration methods mediated by integrase, adeno-associated virus or via homologous recombination have been used to generate stable human embryonic stem cell (hESC) lines. In this study, we describe a vector that is maintained episomally in hESCs. The vector used in this study is based on components derived from the Epstein-Barr virus, containing the Epstein-Barr virus nuclear antigen 1 expression cassette and the OriP origin of replication. The vector also expresses the drug-resistance marker gene hygromycin, which allows for selection and long-term maintenance of cells harboring the plasmid. Using this vector system, we show sustained expression of green fluorescent protein in undifferentiated hESCs and their differentiating embryoid bodies. In addition, the stable hESC clones show comparable expression with and without drug selection. Consistent with this observation, bulk-transfected adipose tissue-derived mesenchymal stem cells showed persistent marker gene expression as they differentiate into adipocytes, osteoblasts and chondroblasts. Episomal vectors offer a fast and efficient method to create hESC reporter lines, which in turn allows one to test the effect of overexpression of various genes on stem cell growth, proliferation and differentiation.

Role of IncP-1β Plasmids pWDL7::rfp and pNB8c in Chloroaniline Catabolism as Determined by Genomic and Functional Analyses

PubMed Central

Król, J. E.; Penrod, J. T.; McCaslin, H.; Rogers, L. M.; Yano, H.; Stancik, A. D.; Dejonghe, W.; Brown, C. J.; Parales, R. E.; Wuertz, S.

2012-01-01

Broad-host-range catabolic plasmids play an important role in bacterial degradation of man-made compounds. To gain insight into the role of these plasmids in chloroaniline degradation, we determined the first complete nucleotide sequences of an IncP-1 chloroaniline degradation plasmid, pWDL7::rfp and its close relative pNB8c, as well as the expression pattern, function, and bioaugmentation potential of the putative 3-chloroaniline (3-CA) oxidation genes. Based on phylogenetic analysis of backbone proteins, both plasmids are members of a distinct clade within the IncP-1β subgroup. The plasmids are almost identical, but whereas pWDL7::rfp carries a duplicate inverted catabolic transposon, Tn6063, containing a putative 3-CA oxidation gene cluster, dcaQTA1A2BR, pNB8c contains only a single copy of the transposon. No genes for an aromatic ring cleavage pathway were detected on either plasmid, suggesting that only the upper 3-CA degradation pathway was present. The dcaA1A2B gene products expressed from a high-copy-number vector were shown to convert 3-CA to 4-chlorocatechol in Escherichia coli. Slight differences in the dca promoter region between the plasmids and lack of induction of transcription of the pNB8c dca genes by 3-CA may explain previous findings that pNB8C does not confer 3-CA transformation. Bioaugmentation of activated sludge with pWDL7::rfp accelerated removal of 3-CA, but only in the presence of an additional carbon source. Successful bioaugmentation requires complementation of the upper pathway genes with chlorocatechol cleavage genes in indigenous bacteria. The genome sequences of these plasmids thus help explain the molecular basis of their catabolic activities. PMID:22101050

A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

PubMed

Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H

2016-01-01

The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

[Cloning of Clostridium perfringens alpha-toxin gene and extracellular expression in Escherichia coli].

PubMed

Inoue, Masaharu; Kikuchi, Maho; Komoriya, Tomoe; Watanabe, Kunitomo; Kouno, Hideki

2007-01-01

Clostridium perfringens (C. perfringens) is a Gram-positive bacterial pathogen that widely propagets in the soil and the gastrointestinal tract of human and animals. This bacteria causes food poisoning, gas gangrene and other various range of infectious diseases. But there is no standard diagnosis method of C. perfringens. In order to develop a new type of immunoassay for clinical purpose, we studied expression and extracellular secretion of recombinant alpha-toxin having enzyme activity in E. coli expression system. Cloning was carried out after PCR amplification from C. perfringens GAI 94074 which was clinical isolate. Three kinds of fragment were cloned using pET100/D-TOPO vector. These fragments coded for ribosome binding site, signal peptide, and alpha-toxin gene respectively. Recombinant pET100 plasmid transformed into TOP 10 cells and the obtained plasmids were transformed into BL21 (DE3) cells. Then, the transformants were induced expression with IPTG. In conclusion, we successfully cloned, expressed and exteracellular secreted C. perfringens alpha-toxin containing signal peptide. Biologically, the obtained recombinant protein was positive for phospholipase C activity.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

PubMed

Woods, J P; Heinecke, E L; Goldman, W E

1998-04-01

We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.

New multifunctional Escherichia coli-Streptomyces shuttle vectors allowing blue-white screening on XGal plates.

PubMed

Wehmeier, U F

1995-11-07

Four new shuttle vectors for Escherichia coli (Ec) and Streptomyces, pUWL218, pUWL219, pUWL-SK and pUWL-KS, which permit recognition of recombinant (re-) plasmids on XGal plates in Ec, were constructed. These vectors contain the replication functions of the Streptomyces wide-host-range multicopy plasmid pIJ101, the tsr gene conferring resistance to thiostrepton in Streptomyces, the ColEI origin of replication from the pUC plasmids for replication in Ec and the bla gene conferring resistance to ampicillin in Ec. They possess multiple cloning sites with a number of unique restriction sites and allow direct sequencing of re-derivatives using the pUC sequencing primers.

Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.

1989-01-01

Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less

Mobilome and genetic modification of bifidobacteria.

PubMed

Guglielmetti, S; Mayo, B; Álvarez-Martín, P

2013-06-01

Until recently, proper development of molecular studies in Bifidobacterium species has been hampered by growth difficulties, because of their exigent nutritive requirements, oxygen sensitivity and lack of efficient genetic tools. These studies, however, are critical to uncover the cross-talk between bifidobacteria and their hosts' cells and to prove unequivocally the supposed beneficial effects provided through the endogenous bifidobacterial populations or after ingestion as probiotics. The genome sequencing projects of different bifidobacterial strains have provided a wealth of genetic data that will be of much help in deciphering the molecular basis of the physiological properties of bifidobacteria. To this end, the purposeful development of stable cloning and expression vectors based on robust replicons - either from temperate phages or resident plasmids - is still needed. This review addresses the current knowledge on the mobile genetic elements of bifidobacteria (prophages, plasmids and transposons) and summarises the different types of vectors already available, together with the transformation procedures for introducing DNA into the cells. It also covers recent molecular studies performed with such vectors and incipient results on the genetic modification of these organisms, establishing the basis that would allow the use of bifidobacteria for future biotechnological applications.

Genetic alteration of Mycobacterium smegmatis to improve mycobacterium-mediated transfer of plasmid DNA into mammalian cells and DNA immunization.

PubMed

Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J

2007-10-01

Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.

High-efficiency transformation of Pichia stipitis based on its URA3 gene and a homologous autonomous replication sequence, ARS2.

PubMed Central

Yang, V W; Marks, J A; Davis, B P; Jeffries, T W

1994-01-01

This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063

Evaluation of the immune response induced by DNA vaccines expressing MIF and MCD-1 genes of Trichinella spiralis in BALB/c mice.

PubMed

Tang, F; Xu, L; Yan, R; Song, X; Li, X

2012-12-01

Plasmids expressing macrophage migration inhibitory factor (MIF) of Trichinella spiralis (TsMIF), multi-cystatin-like domain protein (MCD-1) of T. spiralis (TsMCD-1), or co-expressing TsMIF and TsMCD-1 were constructed with a pVAX1 vector. Their ability to generate a protective immune response against T. spiralis infection was evaluated in BALB/c mice. Groups of mice were immunized twice at 2-week intervals with 100 μg of recombinant plasmids pVAX1-Tsmif, pVAX1-Tsmcd-1 or pVAX1-Tsmif-Tsmcd-1. Control animals were immunized with phosphate-buffered saline (PBS) or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17) and CD4+/CD8+ T cells were monitored. Challenge infection was performed 2 weeks following the second immunization and worm burden was assayed at 35 days post-challenge. Vaccination with pVAX1-Tsmif induced moderate serum IFN-γ and increases of CD4+ and CD8+ T cells, but no specific immunoglobulin antibody response. Vaccination with pVAX1-Tsmcd-1 induced a predominant Th1 antibody (IgG2a and IgG2b) response and strong levels of serum IFN-γ, and increases of CD4+ T cells. Importantly, co-expression of TsMIF and TsMCD-1 in DNA immunization produced more serum IFN-γ and markedly enhanced CD4+ and CD8+ T cells than the single DNA vaccine of the two genes. Challenge infection demonstrated that immunization with pVAX1-Tsmif-Tsmcd-1 reduced worm burdens (by 23.17%; P < 0.05).

PCR-mediated site-directed mutagenesis.

PubMed

Carey, Michael F; Peterson, Craig L; Smale, Stephen T

2013-08-01

Unlike traditional site-directed mutagenesis, this protocol requires only a single PCR step using full plasmid amplification to generate point mutants. The method can introduce small mutations into promoter sites and is even better suited for introducing single or double mutations into proteins. It is elegant in its simplicity and can be applied quite easily in any laboratory using standard protein expression vectors and commercially available reagents.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

PubMed

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.

Development of a live, attenuated, potential vaccine strain of R. equi expressing vapA and the virR operon, and virulence assessment in the mouse.

PubMed

Whitehead, Ashley E; Parreira, Valeria R; Hewson, Joanne; Watson, Johanna L; Prescott, John F

2012-01-15

Pneumonia caused by Rhodococcus equi remains a significant problem in foals. The objective of this study was to develop a safe and efficacious attenuated strain of R. equi for eventual use in oral immunization of foals. The approach involved expression of vapA in a live, virulence plasmid-negative, strain of R. equi (strain 103-). PCR-amplified fragments of the vapA gene, with and without the upstream genes virR, orf5, vapH, orf7 and orf8 (orf4-8), were cloned into a shuttle vector pNBV1. These plasmids, named pAW48A and pAWVapA respectively, were electroporated into strain 103-. The presence of the recombinant vectors in the attenuated strain (103-) and the integrity of the inserted genes were confirmed, and both constructs expressed VapA. The virulence of the two strains was compared to that of wild type R. equi 103+ and negative controls by their intravenous inoculation into mice, followed by examination of liver clearance 4 days later. Mice inoculated with R. equi 103-, 103-/pAWVapA and 103-/pNBV1 completely cleared infection, whereas strain 103-/pAW48A persisted in 47% of mice. Copyright © 2011 Elsevier B.V. All rights reserved.

A toolset of aequorin expression vectors for in planta studies of subcellular calcium concentrations in Arabidopsis thaliana

PubMed Central

Mehlmer, Norbert; Parvin, Nargis; Hurst, Charlotte H.; Knight, Marc R.; Teige, Markus; Vothknecht, Ute C.

2014-01-01

Calcium has long been acknowledged as one of the most important signalling components in plants. Many abiotic and biotic stimuli are transduced into a cellular response by temporal and spatial changes in cellular calcium concentration and the calcium-sensitive protein aequorin has been exploited as a genetically encoded calcium indicator for the measurement of calcium in planta. The objective of this work was to generate a compatible set of aequorin expression plasmids for the generation of transgenic plant lines to measure changes in calcium levels in different cellular subcompartments. Aequorin was fused to different targeting peptides or organellar proteins as a means to localize it to the cytosol, the nucleus, the plasma membrane, and the mitochondria. Furthermore, constructs were designed to localize aequorin in the stroma as well as the inner and outer surface of the chloroplast envelope membranes. The modular set-up of the plasmids also allows the easy replacement of targeting sequences to include other compartments. An additional YFP-fusion was included to verify the correct subcellular localization of all constructs by laser scanning confocal microscopy. For each construct, pBin19-based binary expression vectors driven by the 35S or UBI10 promoter were made for Agrobacterium-mediated transformation. Stable Arabidopsis lines were generated and initial tests of several lines confirmed their feasibility to measure calcium signals in vivo. PMID:22213817

A helper virus-free HSV-1 vector containing the vesicular glutamate transporter-1 promoter supports expression preferentially in VGLUT1-containing glutamatergic neurons.

PubMed

Zhang, Guo-rong; Geller, Alfred I

2010-05-17

Multiple potential uses of direct gene transfer into neurons require restricting expression to specific classes of glutamatergic neurons. Thus, it is desirable to develop vectors containing glutamatergic class-specific promoters. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. We previously reported a plasmid (amplicon) Herpes Simplex Virus (HSV-1) vector that placed the Lac Z gene under the regulation of the VGLUT1 promoter (pVGLUT1lac). Using helper virus-free vector stocks, we showed that this vector supported approximately 90% glutamatergic neuron-specific expression in postrhinal (POR) cortex, in rats sacrificed at either 4 days or 2 months after gene transfer. We now show that pVGLUT1lac supports expression preferentially in VGLUT1-containing glutamatergic neurons. pVGLUT1lac vector stock was injected into either POR cortex, which contains primarily VGLUT1-containing glutamatergic neurons, or into the ventral medial hypothalamus (VMH), which contains predominantly VGLUT2-containing glutamatergic neurons. Rats were sacrificed at 4 days after gene transfer, and the types of cells expressing ss-galactosidase were determined by immunofluorescent costaining. Cell counts showed that pVGLUT1lac supported expression in approximately 10-fold more cells in POR cortex than in the VMH, whereas a control vector supported expression in similar numbers of cells in these two areas. Further, in POR cortex, pVGLUT1lac supported expression predominately in VGLUT1-containing neurons, and, in the VMH, pVGLUT1lac showed an approximately 10-fold preference for the rare VGLUT1-containing neurons. VGLUT1-specific expression may benefit specific experiments on learning or specific gene therapy approaches, particularly in the neocortex. Copyright 2010 Elsevier B.V. All rights reserved.

Development of a chromosome-plasmid balanced lethal system for Lactobacillus acidophilus with thyA gene as selective marker.

PubMed

Fu, X; Xu, J G

2000-01-01

A chromosome-plasmid balanced lethal gene delivery system for Lactobacillus acidophilus based on the thyA gene was developed. The selected L. acidophilus DOM La strain carries a mutated thyA gene and has an obligate requirement for thymidine. This strain can be used as a host for the constructed shuttle vector pFXL03, lacking antibiotic-resistant markers but having the wild-type thyA gene from L. casei which complements the thyA chromosomal mutation. The vector also contains the replicon region from plasmid pUC19 and that of the Lactococcus plasmid pWV01, which allows the transfer between Escherichia coli, L. casei and L. acidophilus. Eight unique restriction sites (i.e., PstI, HindIII, SphI, SalI, AccI, XbaI, KpnI and SacI) are available for cloning. After 40-time transfers in modified MRS medium, no plasmid loss was observed. The vector pFXL03 is potentially useful as a food-grade vaccine delivery system for L. acidophilus.

Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

PubMed Central

Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

2000-01-01

A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

Hypoxia-inducible vascular endothelial growth factor gene therapy using the oxygen-dependent degradation domain in myocardial ischemia.

PubMed

Kim, Hyun Ah; Lim, Soyeon; Moon, Hyung-Ho; Kim, Sung Wan; Hwang, Ki-Chul; Lee, Minhyung; Kim, Sun Hwa; Choi, Donghoon

2010-10-01

A hypoxia-inducible VEGF expression system with the oxygen-dependent degradation (ODD) domain was constructed and tested to be used in gene therapy for ischemic myocardial disease. Luciferase and VEGF expression vector systems were constructed with or without the ODD domain: pEpo-SV-Luc (or pEpo-SV-VEGF) and pEpo-SV-Luc-ODD (or pEpo-SV-VEGF-ODD). In vitro gene expression efficiency of each vector type was evaluated in HEK 293 cells under both hypoxic and normoxic conditions. The amount of VEGF protein was estimated by ELISA. The VEGF expression vectors with or without the ODD domain were injected into ischemic rat myocardium. Fibrosis, neovascularization, and cardiomyocyte apoptosis were assessed using Masson's trichrome staining, α-smooth muscle actin (α-SMA) immunostaining, and the TUNEL assay, respectively. The plasmid vectors containing ODD significantly improved the expression level of VEGF protein in hypoxic conditions. The enhancement of VEGF protein production was attributed to increased protein stability due to oxygen deficiency. In a rat model of myocardial ischemia, the pEpo-SV-VEGF-ODD group exhibited less myocardial fibrosis, higher microvessel density, and less cardiomyocyte apoptosis compared to the control groups (saline and pEpo-SV-VEGF treatments). An ODD-mediated VEGF expression system that facilitates VEGF-production under hypoxia may be useful in the treatment of ischemic heart disease.

Directed chromosomal integration and expression of porcine rotavirus outer capsid protein VP4 in Lactobacillus casei ATCC393.

PubMed

Yin, Ji-Yuan; Guo, Chao-Qun; Wang, Zi; Yu, Mei-Ling; Gao, Shuai; Bukhari, Syed M; Tang, Li-Jie; Xu, Yi-Gang; Li, Yi-Jing

2016-11-01

Using two-step plasmid integration in the presence of 5-fluorouracil (5-FU), we developed a stable and markerless Lactobacillus casei strain for vaccine antigen expression. The upp of L. casei, which encodes uracil phosphoribosyltransferase (UPRTase), was used as a counterselection marker. We employed the Δupp isogenic mutant, which is resistant to 5-FU, as host and a temperature-sensitive suicide plasmid bearing upp expression cassette as counterselectable integration vector. Extrachromosomal expression of UPRTase complemented the mutated chromosomal upp allele and restored sensitivity to 5-FU. The resultant genotype can either be wild type or recombinant. The efficacy of the system was demonstrated by insertion and expression of porcine rotavirus (PRV) VP4. To improve VP4 expression, we analyzed L. casei transcriptional profiles and selected the constitutive highly expressed enolase gene (eno). The VP4 inserted after the eno termination codon were screened in the presence of 5-FU. Using genomic PCR amplification, we confirmed that VP4 was successfully integrated and stably inherited for at least 50 generations. Western blot demonstrated that VP4 was steadily expressed in medium with different carbohydrates. RT-qPCR and ELISA analysis showed that VP4 expression from the chromosomal location was similar to that achieved by a plasmid expression system. Applying the recombinant strain to immunize BALB/c mice via oral administration revealed that the VP4-expressing L. casei could induce both specific local and systemic humoral immune responses in mice. Overall, the improved gene replacement system represents an efficient method for chromosome recombination in L. casei and provides a safe tool for vaccine production.

Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

PubMed

Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

2016-07-01

Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Construction, expression and in vitro biological behaviors of Ig scFv fragment in patients with chronic B cell leukemia.

PubMed

Zhu, Lijuan; Liao, Wenjun; Zhu, Huifen; Lei, Ping; Wang, Zhihua; Shao, Jingfang; Zhang, Yue; Shen, Guanxin

2006-01-01

The expression vector of SmIg scFv fragment was constructed in patient with B cell chronic lymphocyte leukemia (B-CLL) and expressed in E. coli to obtain scFv fragment, and the effect of the protein on the proliferation of stimulated peripheral blood mononuclear cells (PBMC) was investigated in vitro. Two pairs of primers were designed, and variable region genes of light chain and heavy chain were amplified by PCR respectively from the pGEM-T vectors previously constructed in our laboratory which containing light chain gene or Fd fragment of heavy chain gene. The PCR product was digested, purified and inserted into pHEN2 vector to construct the soluble expression vector pHEN2-scFv. After the induction by IPTG, the scFv protein was identified by SDS-PAGE electrophoresis and purified by Ni-NTA-Chromatography. MTT was used to determine the effect of purified protein on the proliferation of stimulated PBMC in vitro. Plasmid PCR and restriction enzyme digestion of pHEN2-scFv revealed the pHEN2-scFv vector was constructed successfully. Id-scFv protein was expressed in positive clone after induced by IPTG. SDS-PAGE analysis showed that the relative molecular weight of fusion protein was about 30 kD (1 kD= 0.9921 ku), which was consistent with the theoretically predicted value. Proliferation of PBMC could be induced by purified Id-scFv. It was suggested that the expression vector of SmIg scFv fragment was constructed successfully, and scFv protein was expressed and secreted from E. coli, which could induce proliferation of PBMC. This may lay an experimental foundation for further research of Id-HSP complex vaccine for B-CLL.

[Expression patterns of non-viral transfection with GFP in the organ of Corti in vitro and in vivo. Gene therapy of the inner ear with non-viral vectors].

PubMed

Praetorius, M; Pfannenstiel, S; Klingmann, C; Baumann, I; Plinkert, P K; Staecker, H

2008-05-01

Diseases of the inner ear such as presbycusis, tinnitus, sudden hearing loss, and vertigo affect many patients, but so far there are no specific therapy options. Gene therapy might become a potential modality of treatment. Viral vectors are standard in animal models to date. Future considerations, however, call for a further evaluation of non-viral transfection methods. The non-viral transfection agents Metafectene, Superfect, Effectene, and Mirus TransIT were incubated with a plasmid coding for GFP. In vivo, the plasmid-agent mix was injected via the membrane of the round window, and 48 h later the inner ear was perfused, harvested, decalcified, and histologically evaluated for GFP expression. Cationic lipids (Metafectene) and dendrimers (Superfect) were able to transfect cells in the area of the organ of Corti and lead to GFP expression. The polyamine (Mirus TransIT) did show expression of GFP in the area of Rosenthal's canal and in the area of the inner hair cell. The combination of a non-liposomal lipid with a DNA condensing component (Effectene) did not show transfection of the organ of Corti. In the area of the spiral ganglia cells, GFP expression was seen with all the transfection agents. Non-viral transfection agents are able to introduce a reporter gene in cells of the inner ear in vitro and in vivo. There are, however, differences in the efficiency of the transfection. They might be an alternative in gene therapy of the inner ear. Further investigations to elucidate their potential are needed.

Synthesis and evaluation of cationic nanomicelles for in vitro and in vivo gene delivery

NASA Astrophysics Data System (ADS)

Mandke, Rhishikesh Subhash

The goal of proposed study was to contribute towards the development of a nano size, high efficiency and low toxicity non-viral polymeric vector for gene delivery in vitro and in vivo. A series of fatty acid grafted low-molecular-weight chitosan (N-acyl LMWCs) were synthesized, purified and characterized for their physicochemical properties using various analytical techniques such as infrared spectroscopy, elemental analysis and dynamic light scattering. The formulation parameters including pH, sonication duration, and filtration altered the physicochemical characteristics of N-acyl LMWC nanomicelles. The acyl chain length and degree of unsaturation in fatty acids also had an impact on the physicochemical properties and the transfection efficiency of nanomicelles. N-acyl LMWC nanomicelles showed efficient in vitro transfection as visualized and quantified using a reporter plasmid (encoding green fluorescent protein), and therapeutic plasmids (encoding for interleukin-4 and interleukin-10), respectively. The in vitro transfection efficiencies of N-acyl LMWCs with 18:1 and 18:2 grafts (oleic and linoleic acids) were comparable with FuGENERTM HD (marketed non-viral vector) but were ˜8-fold and 35-fold higher as compared to LMWC and naked DNA, respectively. The in vivo transfection efficiency of N-acyl LMWC to deliver plasmids individually encoding IL-4 and IL-10 as well as a bicistronic plasmid encoding both IL-4 and IL-10 was studied in a multiple, low-dose streptozotocin induced diabetic mouse model. The transfection efficiency of pDNA/N-acyl LMWC polyplexes injected via intramuscular route showed significant improvement (p<0.05) over passive (naked DNA) or positive (FuGENE HD) controls. Additionally, a sustained and efficient expression of IL-4 and IL-10 was observed, accompanied by a reduction in interferon-gamma (INF-gamma), and tumor necrosis factor-alpha (TNF-alpha) levels. The pancreas of pDNA/N-acyl LMWC polyplex treated animals exhibited protection from streptozotocin-induced insulitis and the delivery systems were biocompatible. Histological studies revealed that there were no signs of chronic inflammation at the injection site. The bicistronic plasmid exhibited significantly (p<0.05) greater expression of IL-4 and IL-10, and demonstrated the feasibility of bicistronic IL-4/IL-10 plasmid/N-acyl LMWC nanomicelles-based polyplexes as an efficient and biocompatible system for the prevention of autoimmune diabetes.

Nonviral vectors for cancer gene therapy: prospects for integrating vectors and combination therapies.

PubMed

Ohlfest, John R; Freese, Andrew B; Largaespada, David A

2005-12-01

Gene therapy has the potential to improve the clinical outcome of many cancers by transferring therapeutic genes into tumor cells or normal host tissue. Gene transfer into tumor cells or tumor-associated stroma is being employed to induce tumor cell death, stimulate anti-tumor immune response, inhibit angiogenesis, and control tumor cell growth. Viral vectors have been used to achieve this proof of principle in animal models and, in select cases, in human clinical trials. Nevertheless, there has been considerable interest in developing nonviral vectors for cancer gene therapy. Nonviral vectors are simpler, more amenable to large-scale manufacture, and potentially safer for clinical use. Nonviral vectors were once limited by low gene transfer efficiency and transient or steadily declining gene expression. However, recent improvements in plasmid-based vectors and delivery methods are showing promise in circumventing these obstacles. This article reviews the current status of nonviral cancer gene therapy, with an emphasis on combination strategies, long-term gene transfer using transposons and bacteriophage integrases, and future directions.

A self-initiating eukaryotic transient gene expression system based on contransfection of bacteriophage T7 RNA polymerase and DNA vectors containing a T7 autogene.

PubMed Central

Chen, X; Li, Y; Xiong, K; Wagner, T E

1994-01-01

A novel cytoplasmic gene expression system has been developed. This system differs from other expression systems in that it relies on the co-delivery of plasmid DNA and T7 RNA polymerase (RNAP) during transfection. The plasmid contains a T7 RNAP gene driven by the T7 promoter (T7 autogene) and a functional/reporter gene driven by another T7 promoter (T7T7/T7-gene construct). Once this DNA-enzyme complex is introduced into eukaryotic cells, the transcription of the T7 RNAP and the functional/reporter genes is initiated by the co-delivered T7 RNAP. The T7 RNAP, which is responsible for the initiation and maintenance of expression of both T7 and functional/reporter genes, is replenished by translation of newly synthesized T7 mRNA. This T7 system was designed in such a manner that the expression of the functional/reporter genes can occur in the cytoplasm and does not require any nuclear involvement. When transfected by either a pT7T7/T7Luc or a pT7T7/T7hGH plasmids with the cointroduced T7 RNAP, mouse L cells were found to express high levels of luciferase immediately after transfection, apparently due to the cytoplasmic gene expression; the expression of human growth hormone (hGH) could be sustained for at least 6 days. Both T7 and hGH mRNA were expressed by the cells transfected with pT7T7/T7hGH. These results suggest that this cytoplasmic expression system may be used for certain targets of somatic gene therapy. Images PMID:8029020

A vigilant, hypoxia-regulated heme oxygenase-1 gene vector in the heart limits cardiac injury after ischemia-reperfusion in vivo.

PubMed

Tang, Yao Liang; Qian, Keping; Zhang, Y Clare; Shen, Leping; Phillips, M Ian

2005-12-01

The effect of a cardiac specific, hypoxia-regulated, human heme oxygenase-1 (hHO-1) vector to provide cardioprotection from ischemia-reperfusion injury was assessed. When myocardial ischemia and reperfusion is asymptomatic, the damaging effects are cumulative and patients miss timely treatment. A gene therapy approach that expresses therapeutic genes only when ischemia is experienced is a desirable strategy. We have developed a cardiac-specific, hypoxia-regulated gene therapy "vigilant vector'' system that amplifies cardioprotective gene expression. Vigilant hHO-1 plasmids, LacZ plasmids, or saline (n = 40 per group) were injected into mouse heart 2 days in advance of ischemia-reperfusion injury. Animals were exposed to 60 minutes of ischemia followed by 24 hours of reperfusion. For that term (24 hours) effects, the protein levels of HO-1, inflammatory responses, apoptosis, and infarct size were determined. For long-term (3 week) effects, the left ventricular remodeling and recovery of cardiac function were assessed. Ischemia-reperfusion resulted in a timely overexpression of HO-1 protein. Infarct size at 24 hours after ischemia-reperfusion was significantly reduced in the HO-1-treated animals compared with the LacZ-treated group or saline-treated group (P < .001). The reduction of infarct size was accompanied by a decrease in lipid peroxidant activity, inflammatory cell infiltration, and proapoptotic protein level in ischemia-reperfusion-injured myocardium. The long-term study demonstrated that timely, hypoxia-induced HO-1 overexpression is beneficial in conserving cardiac function and attenuating left ventricle remodelling. The vigilant HO-1 vector provides a protective therapy in the heart for reducing cellular damage during ischemia-reperfusion injury and preserving heart function.

Construction of shuttle vectors capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous cyanobacteria.

PubMed Central

Wolk, C P; Vonshak, A; Kehoe, P; Elhai, J

1984-01-01

Wild-type cyanobacteria of the genus Anabaena are capable of oxygenic photosynthesis, differentiation of cells called heterocysts at semiregular intervals along the cyanobacterial filaments, and aerobic nitrogen fixation by the heterocysts. To foster analysis of the physiological processes characteristic of these cyanobacteria, we have constructed a family of shuttle vectors capable of replication and selection in Escherichia coli and, in unaltered form, in several strains of Anabaena. Highly efficient conjugative transfer of these vectors from E. coli to Anabaena is dependent upon the presence of broad host-range plasmid RP-4 and of helper plasmids. The shuttle vectors contain portions of plasmid pBR322 required for replication and mobilization, with sites for Anabaena restriction enzymes deleted; cyanobacterial replicon pDU1, which lacks such sites; and determinants for resistance to chloramphenicol, streptomycin, neomycin, and erythromycin. Images PMID:6324204

Adenovirus Type 5 Viral Particles Pseudotyped with Mutagenized Fiber Proteins Show Diminished Infectivity of Coxsackie B-Adenovirus Receptor-Bearing Cells

PubMed Central

Jakubczak, John L.; Rollence, Michele L.; Stewart, David A.; Jafari, Jonathon D.; Von Seggern, Dan J.; Nemerow, Glen R.; Stevenson, Susan C.; Hallenbeck, Paul L.

2001-01-01

A major limitation of adenovirus type 5 (Ad5)-based gene therapy, the inability to target therapeutic genes to selected cell types, is attributable to the natural tropism of the virus for the widely expressed coxsackievirus-adenovirus receptor (CAR) protein. Modifications of the Ad5 fiber knob domain have been shown to alter the tropism of the virus. We have developed a novel system to rapidly evaluate the function of modified fiber proteins in their most relevant context, the adenoviral capsid. This transient transfection/infection system combines transfection of cells with plasmids that express high levels of the modified fiber protein and infection with Ad5.βgal.ΔF, an E1-, E3-, and fiber-deleted adenoviral vector encoding β-galactosidase. We have used this system to test the adenoviral transduction efficiency mediated by a panel of fiber protein mutants that were proposed to influence CAR interaction. A series of amino acid modifications were incorporated via mutagenesis into the fiber expression plasmid, and the resulting fiber proteins were subsequently incorporated onto adenoviral particles. Mutations located in the fiber knob AB and CD loops demonstrated the greatest reduction in fiber-mediated gene transfer in HeLa cells. We also observed effects on transduction efficiency with mutations in the FG loop, indicating that the binding site may extend to the adjacent monomer in the fiber trimer and in the HI loop. These studies support the concept that modification of the fiber knob domain to diminish or ablate CAR interaction should result in a detargeted adenoviral vector that can be combined simultaneously with novel ligands for the development of a systemically administered, targeted adenoviral vector. PMID:11222722

AJUBA increases the cisplatin resistance through hippo pathway in cervical cancer.

PubMed

Bi, Lihong; Ma, Feng; Tian, Rui; Zhou, Yanli; Lan, Weiguang; Song, Quanmao; Cheng, Xiankui

2018-02-20

Though LIM-domain protein AJUBA was identified as a putative oncogene, the function and underlying mechanisms of AJUBA in cervical cancer remain largely unknown. Firstly, AJUBA expression was detected via real-time quantitative PCR in patients' samples. Furthermore, Hela and Siha cells were transfected with AJUBA-overexpressing plasmids, and then exposed to cisplatin, the apoptosis was measured by cytometry assay. In addition, the expression of YAP and TAZ was disclosed through western blot assay. Our results revealed that AJUBA expression was significantly higher in the cervical cancer patients resistant to cisplatin treatment compared with cervical cancer patients sensitive to cisplatin treatment. In addition, overall survival time was significantly shorter in the cervical cancer patients with high AJUBA expression compare with those with low AJUBA expression using kaplan-meier analysis. Hela and Siha cells transfected with AJUBA-expressing plasmids exposed to cisplatin treatment had higher survival rate compared with the cells transfected with empty vector control. Mechanistic studies revealed the AJUBA upregulated the downstream targets YAP and TAZ. These results suggest that high AJUBA level enhances cervical cancer cells drug resistance to cisplatin, also associates with decreased patient survival times. Copyright © 2017 Elsevier B.V. All rights reserved.

Bacteriophage-based Vectors for Site-specific Insertion of DNA in the Chromosome of Corynebacteria

PubMed Central

Oram, Mark; Woolston, Joelle E.; Jacobson, Andrew D.; Holmes, Randall K.; Oram, Diana M.

2007-01-01

In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as β. β-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally-encoded genes, is regulated by the DtxR protein in response to Fe2+ levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the β-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae ΔdtxR strain. Additionally, strains of β-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for β, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species. PMID:17275217

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

A simple Gateway-assisted construction system of TALEN genes for plant genome editing.

PubMed

Kusano, Hiroaki; Onodera, Hitomi; Kihira, Miho; Aoki, Hiromi; Matsuzaki, Hikaru; Shimada, Hiroaki

2016-07-25

TALEN is an artificial nuclease being applied for sequence-specific genome editing. For the plant genome editing, a pair of TALEN genes is expressed in the cells, and a binary plasmid for Agrobacterium-mediated transformation should be assembled. We developed a novel procedure using the Gateway-assisted plasmids, named Emerald-Gateway TALEN system. We constructed entry vectors, pPlat plasmids, for construction of a desired TALEN gene using Platinum Gate TALEN kit. We also created destination plasmid, pDual35SGw1301, which allowed two TALEN genes to both DNA strands to recruit using Gateway technology. Resultant TALEN genes were evaluated by the single-strand annealing (SSA) assay in E. coli cells. By this assay, the TALENs recognized the corresponding targets in the divided luciferase gene, and induced a specific recombination to generate an active luciferase gene. Using the TALEN genes constructed, we created a transformant potato cells in which a site-specific mutation occurred at the target site of the GBSS gene. This suggested that our system worked effectively and was applicable as a convenient tool for the plant genome editing.

Streptomyces griseus streptomycin phosphotransferase: expression of its gene in Escherichia coli and sequence homology with other antibiotic phosphotransferases and with eukaryotic protein kinases.

PubMed

Lim, C K; Smith, M C; Petty, J; Baumberg, S; Wootton, J C

1989-12-01

The aphD gene of Streptomyces griseus, encoding a streptomycin 6-phosphotransferase (SPH), was sub-cloned in the pBR322-based expression vector pRK9 (which contains the Serratia marcescens trp promoter) with selection for expression of streptomycin resistance in Escherichia coli. Two hybrid plasmids, pCKL631 and pCKL711, were isolated which conferred resistance. Both contained a approximately 2 kbp fragment already suspected to include aphD. The properties of in vitro deletion derivatives of these plasmids were consistent with the presumed location of aphD. In vitro deletion of a sequence including most of the trp promoter largely, but not quite completely, abolished the ability of the plasmid to confer streptomycin resistance, confirming that expression was indeed principally from the trp promoter. A polypeptide of approximately 34.5 kDa was present in minicells containing plasmids that conferred streptomycin resistance, but was absent when the plasmids contained in vitro deletions removing streptomycin resistance. Part of the fragment was sequenced and an open reading frame corresponding to aphD identified. A computer-assisted comparison of the deduced SPH sequence with those of other antibiotic phosphotransferases suggested a common structure A-B-C-D-E, where B and D were conserved between all sequences compared while A, C and E divided between the streptomycin and hygromycin B phosphotransferases on one hand and kanamycin/neomycin ones on the other. A composite sequence data base was searched for homologues to consensus matrices constructed from five approximately 12-residue subsequences within blocks B and D. For one subsequence, corresponding to the N-terminal portion of block D, those sequences from the database that yielded the highest homology scores comprised almost entirely either antibiotic phosphotransferases or eukaryotic protein kinases. Possible evolutionary implications of this homology, previously described by other groups, are discussed.

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

PubMed Central

Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

2007-01-01

While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

Development of new plasmid DNA vaccine vectors with R1-based replicons

PubMed Central

2012-01-01

Background There has been renewed interest in biopharmaceuticals based on plasmid DNA (pDNA) in recent years due to the approval of several veterinary DNA vaccines, on-going clinical trials of human pDNA-based therapies, and significant advances in adjuvants and delivery vehicles that have helped overcome earlier efficacy deficits. With this interest comes the need for high-yield, cost-effective manufacturing processes. To this end, vector engineering is one promising strategy to improve plasmid production. Results In this work, we have constructed a new DNA vaccine vector, pDMB02-GFP, containing the runaway R1 origin of replication. The runaway replication phenotype should result in plasmid copy number amplification after a temperature shift from 30°C to 42°C. However, using Escherichia coli DH5α as a host, we observed that the highest yields of pDMB02-GFP were achieved during constant-temperature culture at 30°C, with a maximum yield of approximately 19 mg pDNA/g DCW being observed. By measuring mRNA and protein levels of the R1 replication initiator protein, RepA, we determined that RepA may be limiting pDMB02-GFP yield at 42°C. A mutant plasmid, pDMB-ATG, was constructed by changing the repA start codon from the sub-optimal GTG to ATG. In cultures of DH5α[pDMB-ATG], temperature-induced plasmid amplification was more dramatic than that observed with pDMB02-GFP, and RepA protein was detectable for several hours longer than in cultures of pDMB02-GFP at 42°C. Conclusions Overall, we have demonstrated that R1-based plasmids can produce high yields of high-quality pDNA without the need for a temperature shift, and have laid the groundwork for further investigation of this class of vectors in the context of plasmid DNA production. PMID:22889338

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE PAGES

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.; ...

2018-01-25

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

[Construction of Plasmodium falciparum signal peptide peptidase-GFP mutant and its expression analysis in the malaria parasite].

PubMed

Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti

2014-08-01

To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.

Cloning and expression of Tenebrio molitor antifreeze protein in Escherichia coli.

PubMed

Yue, Chang-Wu; Zhang, Yi-Zheng

2009-03-01

A novel antifreeze protein cDNA was cloned by RT-PCR from the larva of the yellow mealworm Tenebrio molitor. The coding fragment of 339 bp encodes a protein of 112 amino acid residues and was fused to the expression vectors pET32a and pTWIN1. The resulted expression plasmids were transformed into Escherischia coli strains BL21 (DE3), ER2566, and Origami B (DE3), respectively. Several strategies were used for expression of the highly disulfide-bonded beta-helix-contained protein with the activity of antifreeze in different expression systems. A protocol for production of refolded and active T. molitor antifreeze protein in bacteria was obtained.

[Immunogenicity of chimeric gene vaccine Mtb8.4/hIL12].

PubMed

Li, Hui; Li, Rong; Zhong, Sen; Luo, Yue-bei; Ren, Hong; Deng, Cun-liang

2006-09-01

To construct chimeric gene vaccine Mtb8.4/hIL-12, express it in COS-7 cells and study its immunogenicity. Chimeric gene Mtb8.4/hIL-12 was amplified by PCR and cloned into the eukaryotic vector pCI-neo to construct the recombinant plasmid pCI-neo-Mtb8.4/hIL12. After the recombinant plasmid was identified by restriction enzyme digestion analysis, PCR and DNA sequencing, COS-7 cells were transfected with pCI-neo-Mtb8.4/hIL12 through cationic liposome. 48 hours later, the expression of mRNA was detected by RT-PCR and the level of hIL-12 in culture supernatant and cell lysates were detected by Western blot. C57BL/6N mice were vaccinated with chimeric gene vaccine Mtb8.4/hIL-12 three times at the interval of 3 weeks each time. Four weeks after the final inoculation, three mice were sacrificed to assess the cytotoxicity of CTLs and response to cytokine. The recombinant plasmid pCI-neo-Mtb8.4/hIL12 was constructed successfully. After COS-7 cells were transfected with pCI-neo-Mtb8.4/hIL12, chimeric gene Mtb8.4/hIL12 was expressed in COS-7 cells. The chimeric gene vaccine could induce strong antigen-specific immune response. With the increase of IFN-gamma and IL-2 secretion and the decrease of IL-4 secretion, the cytotoxicity of specific CTLs was heightened. Recombinant plasmid pCI-neo-Mtb8.4/hIL12 has been successfully constructed and expressed in COS-7 cells. The constructed chimeric gene vaccine Mtb8.4/hIL12 is of strong immunogenicity and can obviously induce the cytotoxicity of CTLs.

Persistence of transferable extended-spectrum-β-lactamase resistance in the absence of antibiotic pressure.

PubMed

Cottell, Jennifer L; Webber, Mark A; Piddock, Laura J V

2012-09-01

The treatment of infections caused by antibiotic-resistant bacteria is one of the great challenges faced by clinicians in the 21st century. Antibiotic resistance genes are often transferred between bacteria by mobile genetic vectors called plasmids. It is commonly believed that removal of antibiotic pressure will reduce the numbers of antibiotic-resistant bacteria due to the perception that carriage of resistance imposes a fitness cost on the bacterium. This study investigated the ability of the plasmid pCT, a globally distributed plasmid that carries an extended-spectrum-β-lactamase (ESBL) resistance gene (bla(CTX-M-14)), to persist and disseminate in the absence of antibiotic pressure. We investigated key attributes in plasmid success, including conjugation frequencies, bacterial-host growth rates, ability to cause infection, and impact on the fitness of host strains. We also determined the contribution of the bla(CTX-M-14) gene itself to the biology of the plasmid and host bacterium. Carriage of pCT was found to impose no detectable fitness cost on various bacterial hosts. An absence of antibiotic pressure and inactivation of the antibiotic resistance gene also had no effect on plasmid persistence, conjugation frequency, or bacterial-host biology. In conclusion, plasmids such as pCT have evolved to impose little impact on host strains. Therefore, the persistence of antibiotic resistance genes and their vectors is to be expected in the absence of antibiotic selective pressure regardless of antibiotic stewardship. Other means to reduce plasmid stability are needed to prevent the persistence of these vectors and the antibiotic resistance genes they carry.

Identification of facultatively heterotrophic, N/sub 2/-fixing cyanobacteria able to receive plasmid vectors from Escherichia coli by conjugation. [Anabaena spp; Nostoc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, E.; Wolk, C.P.

1985-06-01

Plasmid vectors transferable by conjugation from Escherichia coli to obligately photoautotrophic strains of Anabaena spp. are also transferred to and maintained in heterotrophic, filamentous cyanobacteria of the genus Nostoc. These organisms can be used for the genetic analysis of oxygenic photosynthesis, chromatic adaptation, nitrogen fixation, and heterocyst development.

Construction of a star-shaped copolymer as a vector for FGF receptor-mediated gene delivery in vitro and in vivo.

PubMed

Li, Da; Ping, Yuan; Xu, Fujian; Yu, Hai; Pan, Hongming; Huang, Hongliang; Wang, Qingqing; Tang, Guping; Li, Jun

2010-09-13

The success of cancer gene therapy highly relies on the gene delivery vector with high transfection activity and low toxicity. In the present study, eight-armed polyethylene glycol (EAP) and low molecular weight (LMW) polyethylenimine (PEI) were used as basic units to construct the architecture of a new star-shaped EAP-PEI copolymer (EAPP). MC11, a peptide capable of selectively binding fibroblast growth factor receptor (FGFR) on tumor cell membranes, was further conjugated to EAPP to produce the vector EAPP-MC11 (EAPPM) to enhance tumor targetability. This tumor-targeting vector EAPPM was observed to retard the plasmids mobility at a nitrogen/phosphorus (N/P) ratio of 3. The vector could efficiently condense plasmids within 300 nm nanoparticles with a positive zeta potential at the N/P ratio of 20 or above. While the cytotoxicity of EAPPM polyplexes was similar to that of LMW PEI, it was significantly lower than that of PEI (25 kDa) in HepG2 and PC3 cell lines. In vitro gene transfection with pDNA mediated by EAPPM showed that the transfection efficiency increased 15 times in HepG2 cells but remained at a similar level in PC3 cells in comparison with that of EAPP. By systemic injection of EAPPM/pDNA complexes into a HepG2-bearing mice model, luciferase expression detected in lung, liver, and tumor tissues demonstrated EAPPM could deliver in a targeted manner a reporter gene into tumor tissues, where the luciferase expression of EAPPM was 4 times higher than that of EAPP and even 23 times higher than that of PEI (25 kDa). Furthermore, it was found that the systemic delivery of EAPPM/pCSK-α-interferon complexes in vivo were much more effective in inhibiting tumor growth than EAPP or PEI (25 kDa). These results clearly show that EAPPM is an efficient and safe vector for FGFR-mediated targeted gene delivery both in vitro and in vivo. With low cytotoxicity and high targetability, EAPPM may have great potential as a delivery vector for future cancer gene therapy applications.

Oral Administration of Recombinant Lactococcus lactis Expressing the Cellulase Gene Increases Digestibility of Fiber in Geese.

PubMed

Zhou, Haizhu; Gao, Yunhang; Gao, Guang; Lou, Yujie

2015-12-01

Enhancing cellulose digestibility in animals is important for improving the utilization of forage, which can decrease the amount of food used in animal production. The aim of the present study was to achieve recombinant expression of the cellulase gene in Lactococcus lactis and evaluate the effects of oral administration of the recombinant L. lactis on fiber digestibility in geese. Cellulase (Cell) and green fluorescent protein (GFP) genes were cloned into a L. lactis expression vector (pNZ8149) to construct the recombinant expression plasmid (pNZ8149-GFP-Cell). Then, the recombinant expression plasmid was transformed into L. lactis (NZ3900) competent cells by electroporation to obtain recombinant L. lactis (pNZ8149-GFP-Cell/NZ3900) in which protein expression was induced by Nisin. Expression of GFP and Cell by the recombinant L. lactis was confirmed using SDS-PAGE, fluorescence detection, and Congo red assays. A feeding experiment showed that oral administration of pNZ8149-GFP-Cell/NZ3900 significantly increased the digestibility of dietary fiber in geese fed either a maize stalk diet or a rice chaff diet. Therefore, oral administration of recombinant L. lactis cells expressing the cellulase gene increases fiber digestibility in geese, offering a way to increase the utilization of dietary fiber in geese.

Reverse Genetics of Newcastle Disease Virus.

PubMed

Cardenas-Garcia, Stivalis; Afonso, Claudio L

2017-01-01

Reverse genetics allows for the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique enables genetic manipulation and cloning of viral genomes, gene mutation through site-directed mutagenesis, along with gene insertion or deletion, among other studies. An in vitro infection-based system including the highly attenuated vaccinia virus Ankara strain expressing the T7 RNA polymerase from bacteriophage T7, with co-transfection of three helper plasmids and a full-length cDNA plasmid, was successfully developed to rescue genetically modified Newcastle disease viruses in 1999. In this chapter, the materials and the methods involved in rescuing Newcastle disease virus (NDV) from cDNA, utilizing site-directed mutagenesis and gene replacement techniques, are described in detail.

Robust one-Tube Ω-PCR Strategy Accelerates Precise Sequence Modification of Plasmids for Functional Genomics

PubMed Central

Chen, Letian; Wang, Fengpin; Wang, Xiaoyu; Liu, Yao-Guang

2013-01-01

Functional genomics requires vector construction for protein expression and functional characterization of target genes; therefore, a simple, flexible and low-cost molecular manipulation strategy will be highly advantageous for genomics approaches. Here, we describe a Ω-PCR strategy that enables multiple types of sequence modification, including precise insertion, deletion and substitution, in any position of a circular plasmid. Ω-PCR is based on an overlap extension site-directed mutagenesis technique, and is named for its characteristic Ω-shaped secondary structure during PCR. Ω-PCR can be performed either in two steps, or in one tube in combination with exonuclease I treatment. These strategies have wide applications for protein engineering, gene function analysis and in vitro gene splicing. PMID:23335613

[Recombinant OspC identification and antigenicity detection from Borrelia burgdorferi PD91 in China].

PubMed

Chen, Jian; Wan, Kang-Lin

2003-10-01

To recombine OspC gene from Borrelia burgdorferi PD91 of China and expressed it in E. coli for early diagnosis of Lyme disease. The OspC gene was amplified from the genome of Borrelia burgdorferi PD91 strain by polymerase chain reaction and recombined with plasmid PET-11D. The recombinant plasmid PET-11D-OspC was identified with PCR, restriction endonuclease analysis and sequencing. The antigenicity was verified with Western Blot. OspC gene was cloned correctly into vector PET-11D. The resultant sequence was definitely different from the published sequence. The recombinant OspC seemed to have had strong antigenicity. The findings laid basis for the studies on early diagnosis of Lyme disease.

pLS010 plasmid vector

DOEpatents

Lacks, Sanford A.; Balganesh, Tanjore S.

1988-01-01

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

A quantitative and high-throughput assay of human papillomavirus DNA replication.

PubMed

Gagnon, David; Fradet-Turcotte, Amélie; Archambault, Jacques

2015-01-01

Replication of the human papillomavirus (HPV) double-stranded DNA genome is accomplished by the two viral proteins E1 and E2 in concert with host DNA replication factors. HPV DNA replication is an established model of eukaryotic DNA replication and a potential target for antiviral therapy. Assays to measure the transient replication of HPV DNA in transfected cells have been developed, which rely on a plasmid carrying the viral origin of DNA replication (ori) together with expression vectors for E1 and E2. Replication of the ori-plasmid is typically measured by Southern blotting or PCR analysis of newly replicated DNA (i.e., DpnI digested DNA) several days post-transfection. Although extremely valuable, these assays have been difficult to perform in a high-throughput and quantitative manner. Here, we describe a modified version of the transient DNA replication assay that circumvents these limitations by incorporating a firefly luciferase expression cassette in cis of the ori. Replication of this ori-plasmid by E1 and E2 results in increased levels of firefly luciferase activity that can be accurately quantified and normalized to those of Renilla luciferase expressed from a control plasmid, thus obviating the need for DNA extraction, digestion, and analysis. We provide a detailed protocol for performing the HPV type 31 DNA replication assay in a 96-well plate format suitable for small-molecule screening and EC50 determinations. The quantitative and high-throughput nature of the assay should greatly facilitate the study of HPV DNA replication and the identification of inhibitors thereof.

Efficient production of recombinant adeno-associated viral vector, serotype DJ/8, carrying the GFP gene.

PubMed

Hashimoto, Haruo; Mizushima, Tomoko; Chijiwa, Tsuyoshi; Nakamura, Masato; Suemizu, Hiroshi

2017-06-15

The purpose of this study was to establish an efficient method for the preparation of an adeno-associated viral (AAV), serotype DJ/8, carrying the GFP gene (AAV-DJ/8-GFP). We compared the yields of AAV-DJ/8 vector, which were produced by three different combination methods, consisting of two plasmid DNA transfection methods (lipofectamine and calcium phosphate co-precipitation; CaPi) and two virus DNA purification methods (iodixanol and cesium chloride; CsCl). The results showed that the highest yield of AAV-DJ/8-GFP vector was accomplished with the combination method of lipofectamine transfection and iodixanol purification. The viral protein expression levels and the transduction efficacy in HEK293 and CHO cells were not different among four different combination methods for AAV-DJ/8-GFP vectors. We confirmed that the AAV-DJ/8-GFP vector could transduce to human and murine hepatocyte-derived cell lines. These results show that AAV-DJ/8-GFP, purified by the combination of lipofectamine and iodixanol, produces an efficient yield without altering the characteristics of protein expression and AAV gene transduction. Copyright © 2017 Elsevier B.V. All rights reserved.

Cre-lox Univector acceptor vectors for functional screening in protoplasts: analysis of Arabidopsis donor cDNAs encoding ABSCISIC ACID INSENSITIVE1-Like protein phosphatases

PubMed Central

Jia, Fan; Gampala, Srinivas S.L.; Mittal, Amandeep; Luo, Qingjun; Rock, Christopher D.

2009-01-01

The 14,200 available full length Arabidopsis thaliana cDNAs in the Universal Plasmid System (UPS) donor vector pUNI51 should be applied broadly and efficiently to leverage a “functional map-space” of homologous plant genes. We have engineered Cre-lox UPS host acceptor vectors (pCR701- 705) with N-terminal epitope tags in frame with the loxH site and downstream from the maize Ubiquitin promoter for use in transient protoplast expression assays and particle bombardment transformation of monocots. As an example of the utility of these vectors, we recombined them with several Arabidopsis cDNAs encoding Ser/Thr protein phosphatase type 2C (PP2Cs) known from genetic studies or predicted by hierarchical clustering meta-analysis to be involved in ABA and stress responses. Our functional results in Zea mays mesophyll protoplasts on ABA-inducible expression effects on the Late Embryogenesis Abundant promoter ProEm:GUS reporter were consistent with predictions and resulted in identification of novel activities of some PP2Cs. Deployment of these vectors can facilitate functional genomics and proteomics and identification of novel gene activities. PMID:19499346

New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.

PubMed

Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel

2016-03-01

Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.

Physical Characterization of Gemini Surfactant-Based Synthetic Vectors for the Delivery of Linear Covalently Closed (LCC) DNA Ministrings

PubMed Central

Sum, Chi Hong; Nafissi, Nafiseh; Slavcev, Roderick A.; Wettig, Shawn

2015-01-01

In combination with novel linear covalently closed (LCC) DNA minivectors, referred to as DNA ministrings, a gemini surfactant-based synthetic vector for gene delivery has been shown to exhibit enhanced delivery and bioavailability while offering a heightened safety profile. Due to topological differences from conventional circular covalently closed (CCC) plasmid DNA vectors, the linear topology of LCC DNA ministrings may present differences with regards to DNA interaction and the physicochemical properties influencing DNA-surfactant interactions in the formulation of lipoplexed particles. In this study, N,N-bis(dimethylhexadecyl)-α,ω-propanediammonium(16-3-16)gemini-based synthetic vectors, incorporating either CCC plasmid or LCC DNA ministrings, were characterized and compared with respect to particle size, zeta potential, DNA encapsulation, DNase sensitivity, and in vitro transgene delivery efficacy. Through comparative analysis, differences between CCC plasmid DNA and LCC DNA ministrings led to variations in the physical properties of the resulting lipoplexes after complexation with 16-3-16 gemini surfactants. Despite the size disparities between the plasmid DNA vectors (CCC) and DNA ministrings (LCC), differences in DNA topology resulted in the generation of lipoplexes of comparable particle sizes. The capacity for ministring (LCC) derived lipoplexes to undergo complete counterion release during lipoplex formation contributed to improved DNA encapsulation, protection from DNase degradation, and in vitro transgene delivery. PMID:26561857

Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

PubMed Central

Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

2018-01-01

Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

PubMed Central

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

[Expression of Dengue virus type 2 nonstructural protein 3 and isolation of host proteins interacting with it].

PubMed

Weng, Daihui; Lei, Yingfeng; Dong, Yangchao; Han, Peijun; Ye, Chuantao; Yang, Jing; Wang, Yuan; Yin, Wen

2015-12-01

To construct the plasmid expressing the fusion protein of Dengue virus type 2 (DENV2) nonstructural protein 3 (NS3) with affinity tag, and isolate the cellular proteins interacting with NS3 protein using tandem affinity purification (TAP) assay. Primers for amplifying NS3 gene were designed according to the sequence of DENV2 genome and chemically synthesized. The NS3 fragments, after amplified by PCR with DENV2 cDNA as template, were digested and cloned into the mammalian eukaryotic expression vector pCI-SF with the tandem affinity tag (FLAG-StrepII). The recombinant pCI-NS3-SF was transiently transformed by Lipofectamine(TM) 2000 into HEK293T cells, and the expression of the fusion protein was confirmed by Western blotting. Cellular proteins that interacted with NS3 were isolated and purified by TAP assay. The eukaryotic expression vector expressing NS3 protein was successfully constructed. The host proteins interacting with NS3 protein were isolated by TAP system. TAP is an efficient method to isolate the cellular proteins interacting with DENV2 NS3.

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

PubMed

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

Development of A Flexible System for the Simultaneous Conversion of Biomass to Industrial Chemicals and the Production of Industrial Biocatalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Johnway; Hooker, Brian S.; Skeen, R S.

2002-01-01

A flexible system was developed for the simultaneous conversion of biomass to industrial chemicals and the production of industrial biocatalysts. In particular, the expression of a bacterial enzyme, beta-glucuronidase (GUS), was investigated using a genetically modified starch-degrading Saccharomyces strain in suspension cultures in starch media. Different sources of starch including corn and waste potato starch were used for yeast biomass accumulation and GUS expression studies under controls of inducible and constitutive promoters. A thermostable bacterial cellulase, Acidothermus cellulolyticus E1 endoglucanase gene was also cloned into an episomal plasmid expression vector and expressed in the starch-degrading Saccharomyces strain.

Multiplexing clonality: combining RGB marking and genetic barcoding

PubMed Central

Cornils, Kerstin; Thielecke, Lars; Hüser, Svenja; Forgber, Michael; Thomaschewski, Michael; Kleist, Nadja; Hussein, Kais; Riecken, Kristoffer; Volz, Tassilo; Gerdes, Sebastian; Glauche, Ingmar; Dahl, Andreas; Dandri, Maura; Roeder, Ingo; Fehse, Boris

2014-01-01

RGB marking and DNA barcoding are two cutting-edge technologies in the field of clonal cell marking. To combine the virtues of both approaches, we equipped LeGO vectors encoding red, green or blue fluorescent proteins with complex DNA barcodes carrying color-specific signatures. For these vectors, we generated highly complex plasmid libraries that were used for the production of barcoded lentiviral vector particles. In proof-of-principle experiments, we used barcoded vectors for RGB marking of cell lines and primary murine hepatocytes. We applied single-cell polymerase chain reaction to decipher barcode signatures of individual RGB-marked cells expressing defined color hues. This enabled us to prove clonal identity of cells with one and the same RGB color. Also, we made use of barcoded vectors to investigate clonal development of leukemia induced by ectopic oncogene expression in murine hematopoietic cells. In conclusion, by combining RGB marking and DNA barcoding, we have established a novel technique for the unambiguous genetic marking of individual cells in the context of normal regeneration as well as malignant outgrowth. Moreover, the introduction of color-specific signatures in barcodes will facilitate studies on the impact of different variables (e.g. vector type, transgenes, culture conditions) in the context of competitive repopulation studies. PMID:24476916

pLS101 plasmid vector

DOEpatents

Lacks, S.A.; Balganesh, T.S.

1985-02-19

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

[Construction of BAD Lentivirus Vector and Its Effect on Proliferation in A549 Cell Lines].

PubMed

Huang, Na; He, Yan-qi; Zhu, Jing; Li, Wei-min

2015-05-01

To construct the recombinant lentivirus expressing vector BAD (Bcl-2-associated death protein) gene and to study its effect on A549 cell proliferation. The BAD gene was amplified from plasmid pAV-MCMV-BAD-GFP by PCR. The purified BAD gene fragment was inserted into a lentivirus vector (pLVX-IRES-ZsGreen 1), and the insertion was identified by PCR, restriction endonuclease analysis and DNA sequencing. A549 cells were then transfected with the packaged recombinant lentivirus, and resistant cell clones were selected with flow cytometry. The expression of BAD in A549 cell lines stably transduction with a lentivirus was examined using Western blot. The effect of BAD overexpression on proliferation of A549 cells was evaluated by using CCK-8 kit. Restriction enzyme digestion and DNA sequencing showed that the full-length BAD gene (507 bp) had been successfully subcloned into the lentiviral vector to result in the recombinant vector pLVX-IRES-ZsGreen 1. Monoclonal cell lines BAD-A549 was produced after transfection with the recombinant lentivirus and selected with flow cytometry. Stable expression of BAD protein was verified by Western blot. In vitro, the OD value in BAD group was significantly lower than that of control groups from 120-144 h (P<0. 05). A549 cell lines stably transduced with a lentivirus expressing the BAD gene had been successfully generated. In vitro, BAD overexpression significantly inhibited A549 cells proliferation.

Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.

PubMed

Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei

2018-01-01

Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.

Vectors for fluorescent protein tagging in Phytophthora: tools for functional genomics and cell biology.

PubMed

Ah-Fong, Audrey M V; Judelson, Howard S

2011-09-01

Fluorescent tagging has become the strategy of choice for examining the subcellular localisation of proteins. To develop a versatile community resource for this method in oomycetes, plasmids were constructed that allow the expression of either of four spectrally distinct proteins [cyan fluorescent protein (CFP), green fluorescent protein (GFP), yellow fluorescent protein (YFP), and mCherry], alone or fused at their N- or C-termini, to sequences of interest. Equivalent sets of plasmids were made using neomycin or hygromycin phosphotransferases (nptII, hpt) as selectable markers, to facilitate double-labelling and aid work in diverse species. The fluorescent proteins and drug-resistance markers were fused to transcriptional regulatory sequences from the oomycete Bremia lactucae, which are known to function in diverse oomycetes, although the promoter in the fluorescence cassette (ham34) can be replaced easily by a promoter of interest. The function of each plasmid was confirmed in Phytophthora infestans. Moreover, fusion proteins were generated using targeting sequences for the endoplasmic reticulum, Golgi, mitochondria, nuclei, and peroxisomes. Studies of the distribution of the fusions in mycelia and sporangia provided insight into cellular organisation at different stages of development. This toolbox of vectors should advance studies of gene function and cell biology in Phytophthora and other oomycetes. Copyright © 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Plasmids for increased efficiency of vector construction and genetic engineering in filamentous fungi.

PubMed

Schoberle, Taylor J; Nguyen-Coleman, C Kim; May, Gregory S

2013-01-01

Fungal species are continuously being studied to not only understand disease in humans and plants but also to identify novel antibiotics and other metabolites of industrial importance. Genetic manipulations, such as gene deletion, gene complementation, and gene over-expression, are common techniques to investigate fungal gene functions. Although advances in transformation efficiency and promoter usage have improved genetic studies, some basic steps in vector construction are still laborious and time-consuming. Gateway cloning technology solves this problem by increasing the efficiency of vector construction through the use of λ phage integrase proteins and att recombination sites. We developed a series of Gateway-compatible vectors for use in genetic studies in a range of fungal species. They contain nutritional and drug-resistance markers and can be utilized to manipulate different filamentous fungal genomes. Copyright © 2013 Elsevier Inc. All rights reserved.

Identification of three extra-chromosomal replicons in Leptospira pathogenic strain and development of new shuttle vectors.

PubMed

Zhu, Weinan; Wang, Jin; Zhu, Yongzhang; Tang, Biao; Zhang, Yunyi; He, Ping; Zhang, Yan; Liu, Boyu; Guo, Xiaokui; Zhao, Guoping; Qin, Jinhong

2015-02-15

The genome of pathogenic Leptospira interrogans contains two chromosomes. Plasmids and prophages are known to play specific roles in gene transfer in bacteria and can potentially serve as efficient genetic tools in these organisms. Although plasmids and prophage remnants have recently been reported in Leptospira species, their characteristics and potential applications in leptospiral genetic transformation systems have not been fully evaluated. Three extrachromosomal replicons designated lcp1 (65,732 bp), lcp2 (56,757 bp), and lcp3 (54,986 bp) in the L. interrogans serovar Linhai strain 56609 were identified through whole genome sequencing. All three replicons were stable outside of the bacterial chromosomes. Phage particles were observed in the culture supernatant of 56609 after mitomycin C induction, and lcp3, which contained phage-related genes, was considered to be an inducible prophage. L. interrogans-Escherichia coli shuttle vectors, constructed with the predicted replication elements of single rep or rep combined with parAB loci from the three plasmids were shown to successfully transform into both saprophytic and pathogenic Leptospira species, suggesting an essential function for rep genes in supporting auto-replication of the plasmids. Additionally, a wide distribution of homologs of the three rep genes was identified in L. interrogans isolates, and correlation tests showed that the transformability of the shuttle vectors in L. interrogans isolates depended, to certain extent, on genetic compatibility between the rep sequences of both plasmid and host. Three extrachromosomal replicons co-exist in L. interrogans, one of which we consider to be an inducible prophage. The vectors constructed with the rep genes of the three replicons successfully transformed into saprophytic and pathogenic Leptospira species alike, but this was partly dependent on genetic compatibility between the rep sequences of both plasmid and host.

[Overexpression of liver kinase B1 inhibits the proliferation of lung cancer cells].

PubMed

Li, Yang; Zhang, Libin; Wang, Ping

2017-01-01

Objective To explore the effect of overexpressed liver kinase B1(LKB1) on the proliferation of lung cancer cell lines. Methods The expression levels of LKB1 and PTEN in A549, NCI-H23, NCI-H157, XWLC-05, NCI-H446 lung cancer cells were detected by immunocytochemistry (ICC) and Western blotting. Plasmid pcDNA3.1 + -LKB1 and empty vector pcDNA3.1 + -null were separately transfected into the above five cell lines, and then the expression of LKB1 mRNA and protein were determined by quantitative real-time PCR and Western blotting, respectively. Finally, CCK-8 assay was used to analyze the proliferation ability of the transfected cells. Results LKB1 and PTEN were positive in NCI-H23 cells; LKB1 was negative while PTEN was positive in A549 and NCI-H446 cells; both LKB1 and PTEN were negative in NCI-H157 and XWLC-05 cells. Quantitative real-time PCR and Western blotting showed that the expression level of LKB1 significantly increased in the above cell lines transfected with plasmid pcDNA3.1 + -LKB1 compared with the ones with empty vector pcDNA3.1 + -null. Besides, CCK-8 assay showed that the overexpression of LKB1 in the lung cancer cells transfected with pcDNA3.1 + -LKB1 had an obvious inhibitory effect on cell proliferation. Conclusion The expression of LKB1 is down-regulated in most of the lung cell lines to different extent and the over-expression of LKB1 can remarkably inhibit the proliferation ability of lung cancer cell lines.

Construction of small plasmid vectors for use in genetic improvement of the extremely acidophilic Acidithiobacillus caldus.

PubMed

Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang

2013-10-01

The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

[Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].

PubMed

Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min

2014-03-01

To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.

Mitochondrial Gene Therapy: Advances in Mitochondrial Gene Cloning, Plasmid Production, and Nanosystems Targeted to Mitochondria.

PubMed

Coutinho, Eduarda; Batista, Cátia; Sousa, Fani; Queiroz, João; Costa, Diana

2017-03-06

Mitochondrial gene therapy seems to be a valuable and promising strategy to treat mitochondrial disorders. The use of a therapeutic vector based on mitochondrial DNA, along with its affinity to the site of mitochondria, can be considered a powerful tool in the reestablishment of normal mitochondrial function. In line with this and for the first time, we successfully cloned the mitochondrial gene ND1 that was stably maintained in multicopy pCAG-GFP plasmid, which is used to transform E. coli. This mitochondrial-gene-based plasmid was encapsulated into nanoparticles. Furthermore, the functionalization of nanoparticles with polymers, such as cellulose or gelatin, enhances their overall properties and performance for gene therapy. The fluorescence arising from rhodamine nanoparticles in mitochondria and a fluorescence microscopy study show pCAG-GFP-ND1-based nanoparticles' cell internalization and mitochondria targeting. The quantification of GFP expression strongly supports this finding. This work highlights the viability of gene therapy based on mitochondrial DNA instigating further in vitro research and clinical translation.

Viral Paratransgenesis in the Malaria Vector Anopheles gambiae

PubMed Central

Ren, Xiaoxia; Hoiczyk, Egbert; Rasgon, Jason L.

2008-01-01

Paratransgenesis, the genetic manipulation of insect symbiotic microorganisms, is being considered as a potential method to control vector-borne diseases such as malaria. The feasibility of paratransgenic malaria control has been hampered by the lack of candidate symbiotic microorganisms for the major vector Anopheles gambiae. In other systems, densonucleosis viruses (DNVs) are attractive agents for viral paratransgenesis because they infect important vector insects, can be genetically manipulated and are transmitted to subsequent generations. However, An. gambiae has been shown to be refractory to DNV dissemination. We discovered, cloned and characterized the first known DNV (AgDNV) capable of infection and dissemination in An. gambiae. We developed a flexible AgDNV-based expression vector to express any gene of interest in An. gambiae using a two-plasmid helper-transducer system. To demonstrate proof-of-concept of the viral paratransgenesis strategy, we used this system to transduce expression of an exogenous gene (enhanced green fluorescent protein; EGFP) in An. gambiae mosquitoes. Wild-type and EGFP-transducing AgDNV virions were highly infectious to An. gambiae larvae, disseminated to and expressed EGFP in epidemiologically relevant adult tissues such as midgut, fat body and ovaries and were transmitted to subsequent mosquito generations. These proof-of-principle data suggest that AgDNV could be used as part of a paratransgenic malaria control strategy by transduction of anti-Plasmodium peptides or insect-specific toxins in Anopheles mosquitoes. AgDNV will also be extremely valuable as an effective and easy-to-use laboratory tool for transient gene expression or RNAi in An. gambiae. PMID:18725926

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Gateway Vectors for Efficient Artificial Gene Assembly In Vitro and Expression in Yeast Saccharomyces cerevisiae

PubMed Central

Giuraniuc, Claudiu V.; MacPherson, Murray; Saka, Yasushi

2013-01-01

Construction of synthetic genetic networks requires the assembly of DNA fragments encoding functional biological parts in a defined order. Yet this may become a time-consuming procedure. To address this technical bottleneck, we have created a series of Gateway shuttle vectors and an integration vector, which facilitate the assembly of artificial genes and their expression in the budding yeast Saccharomyces cerevisiae. Our method enables the rapid construction of an artificial gene from a promoter and an open reading frame (ORF) cassette by one-step recombination reaction in vitro. Furthermore, the plasmid thus created can readily be introduced into yeast cells to test the assembled gene’s functionality. As flexible regulatory components of a synthetic genetic network, we also created new versions of the tetracycline-regulated transactivators tTA and rtTA by fusing them to the auxin-inducible degron (AID). Using our gene assembly approach, we made yeast expression vectors of these engineered transactivators, AIDtTA and AIDrtTA and then tested their functions in yeast. We showed that these factors can be regulated by doxycycline and degraded rapidly after addition of auxin to the medium. Taken together, the method for combinatorial gene assembly described here is versatile and would be a valuable tool for yeast synthetic biology. PMID:23675537

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

PubMed

Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

2003-05-01

Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

PubMed

Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter

2012-05-14

Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand, displayed high DNA binding efficiency and pH-sensitive release.

Construction of PR39 recombinant AAV under control of the HRE promoter and the effect of recombinant AAV on gene therapy of ischemic heart disease

PubMed Central

SUN, LIJUN; HAO, YUEWEN; NIE, XIAOWEI; ZHANG, XUEXIN; YANG, GUANGXIAO; WANG, QUANYING

2012-01-01

The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the immunohistochemical method and results showed that the expression was positive in the experimental group. Myocardium perfusion MRI displayed that the infracted area significantly decreased under the action of pSS-HRE-CMV-NT4-PR39-PolyA-AAV. The artificial minimal HRE in CRL-1730 cells effectively and rapidly regulates the expression of the downstream gene NT4-TAT-His-PR39 of the CMV promoter. Recombinant pSS-HRE-CMV-NT4-PR39-Poly-AAAV promotes neoangiogenesis in the ischemic area, reduces the area of infarction and improves heart function. PMID:23226731

Construction of PR39 recombinant AAV under control of the HRE promoter and the effect of recombinant AAV on gene therapy of ischemic heart disease.

PubMed

Sun, Lijun; Hao, Yuewen; Nie, Xiaowei; Zhang, Xuexin; Yang, Guangxiao; Wang, Quanying

2012-11-01

The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the immunohistochemical method and results showed that the expression was positive in the experimental group. Myocardium perfusion MRI displayed that the infracted area significantly decreased under the action of pSS-HRE-CMV-NT4-PR39-PolyA-AAV. The artificial minimal HRE in CRL-1730 cells effectively and rapidly regulates the expression of the downstream gene NT4-TAT-His-PR39 of the CMV promoter. Recombinant pSS-HRE-CMV-NT4-PR39-Poly-AAAV promotes neoangiogenesis in the ischemic area, reduces the area of infarction and improves heart function.

DNASU plasmid and PSI:Biology-Materials repositories: resources to accelerate biological research

PubMed Central

Seiler, Catherine Y.; Park, Jin G.; Sharma, Amit; Hunter, Preston; Surapaneni, Padmini; Sedillo, Casey; Field, James; Algar, Rhys; Price, Andrea; Steel, Jason; Throop, Andrea; Fiacco, Michael; LaBaer, Joshua

2014-01-01

The mission of the DNASU Plasmid Repository is to accelerate research by providing high-quality, annotated plasmid samples and online plasmid resources to the research community through the curated DNASU database, website and repository (http://dnasu.asu.edu or http://dnasu.org). The collection includes plasmids from grant-funded, high-throughput cloning projects performed in our laboratory, plasmids from external researchers, and large collections from consortia such as the ORFeome Collaboration and the NIGMS-funded Protein Structure Initiative: Biology (PSI:Biology). Through DNASU, researchers can search for and access detailed information about each plasmid such as the full length gene insert sequence, vector information, associated publications, and links to external resources that provide additional protein annotations and experimental protocols. Plasmids can be requested directly through the DNASU website. DNASU and the PSI:Biology-Materials Repositories were previously described in the 2010 NAR Database Issue (Cormier, C.Y., Mohr, S.E., Zuo, D., Hu, Y., Rolfs, A., Kramer, J., Taycher, E., Kelley, F., Fiacco, M., Turnbull, G. et al. (2010) Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community. Nucleic Acids Res., 38, D743–D749.). In this update we will describe the plasmid collection and highlight the new features in the website redesign, including new browse/search options, plasmid annotations and a dynamic vector mapping feature that was developed in collaboration with LabGenius. Overall, these plasmid resources continue to enable research with the goal of elucidating the role of proteins in both normal biological processes and disease. PMID:24225319

Polycation-induced Cell Membrane Permeability Does Not Enhance Cellular Uptake or Expression Efficiency of Delivered DNA

PubMed Central

Prevette, Lisa E.; Mullen, Douglas G.; Banaszak Holl, Mark M.

2010-01-01

Polycationic materials commonly used to delivery DNA to cells are known to induce cell membrane porosity in a charge-density dependent manner. It has been suggested that these pores may provide a mode of entry of the polymer-DNA complexes (polyplexes) into cells. To examine the correlation between membrane permeability and biological activity, we used two-color flow cytometry on two mammalian cell lines to simultaneously measure gene expression of a plasmid DNA delivered with four common nonviral vectors and cellular uptake of normally excluded fluorescent dye molecules of two different sizes, 668 Da and 2 MDa. We also followed gene expression in cells sorted based on the retention of endogenous fluorescein. We have found that cell membrane porosity caused by polycationic vectors does not enhance internalization or gene expression. Based on this single-cell study, membrane permeability is found to be an unwanted side effect that limits transfection efficiency, possibly through leakage of the delivered nucleic acid through the pores prior to transcription and translation and/or activation of cell defense mechanisms that restrict transgene expression. PMID:20349965

The Antibiotic-free pFAR4 Vector Paired with the Sleeping Beauty Transposon System Mediates Efficient Transgene Delivery in Human Cells.

PubMed

Pastor, Marie; Johnen, Sandra; Harmening, Nina; Quiviger, Mickäel; Pailloux, Julie; Kropp, Martina; Walter, Peter; Ivics, Zoltán; Izsvák, Zsuzsanna; Thumann, Gabriele; Scherman, Daniel; Marie, Corinne

2018-06-01

The anti-angiogenic and neurogenic pigment epithelium-derived factor (PEDF) demonstrated a potency to control choroidal neovascularization in age-related macular degeneration (AMD) patients. The goal of the present study was the development of an efficient and safe technique to integrate, ex vivo, the PEDF gene into retinal pigment epithelial (RPE) cells for later transplantation to the subretinal space of AMD patients to allow continuous PEDF secretion in the vicinity of the affected macula. Because successful gene therapy approaches require efficient gene delivery and stable gene expression, we used the antibiotic-free pFAR4 mini-plasmid vector to deliver the hyperactive Sleeping Beauty transposon system, which mediates transgene integration into the genome of host cells. In an initial study, lipofection-mediated co-transfection of HeLa cells with the SB100X transposase gene and a reporter marker delivered by pFAR4 showed a 2-fold higher level of genetically modified cells than when using the pT2 vectors. Similarly, with the pFAR4 constructs, electroporation-mediated transfection of primary human RPE cells led to 2.4-fold higher secretion of recombinant PEDF protein, which was still maintained 8 months after transfection. Thus, our results show that the pFAR4 plasmid is a superior vector for the delivery and integration of transgenes into eukaryotic cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Plasmid expression and maintenance during long-term starvation-survival of bacteria in well water.

PubMed Central

Caldwell, B A; Ye, C; Griffiths, R P; Moyer, C L; Morita, R Y

1989-01-01

Strains of enteric bacteria and pseudomonads containing plasmid R388::Tnl721 (Tpr, Tcr) or pRO101 (Hgr, Tcr) were starved for over 250 days in sterile well water to evaluate effects of starvation-survival on plasmid expression and maintenance. Viable populations dropped to between approximately 0.1 and 1% of the initial populations. Escherichia coli(pRO101) and Pseudomonas cepacia(pRO101) lost both viability and plasmid expression at a lower rate than strains containing R388::Tnl721. Three patterns of host-plasmid interaction were detected: (i) no apparent loss of plasmid expression, (ii) loss of plasmid expression on initial recovery with subsequent expression upon resuscitation, and (iii) loss of capability to produce functional plasmid resistance. PMID:2782868

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Expression of a synthetic gene encoding human insulin-like growth factor I in cultured mouse fibroblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bayne, M.L.; Cascieri, M.A.; Kelder, B.

1987-05-01

A synthetic gene encoding human insulin-like growth factor I (hIGF-I) was assembled and inserted into an expression vector containing the cytomegalovirus immediate early (CMV-IE) transcriptional regulatory region and portions of the bovine growth hormone gene. The recombinant plasmid encodes a 97 amino acid fusion protein containing the first 27 amino acids of the bovine growth hormone precursor and the 70 amino acids of hIGF-I. This plasmid, when transiently introduced into cultured mouse fibroblasts, directs synthesis of the fusion protein, subsequent proteolytic removal of the bovine growth hormone signal peptide, and secretion of hIGF-I into the culture medium. Conditioned medium frommore » transfected cells inhibits binding of /sup 125/I-labeled IGF-I to type I IGF receptors on human placental membranes and to acid-stable human serum carrier proteins. The recombinant hIGF-I produced is biologically active, as monitored by the stimulation of DNA synthesis in vascular smooth muscle cells.« less

High-level fluorescence labeling of gram-positive pathogens.

PubMed

Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

2011-01-01

Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.

Anti-metastatic effects of viral and non-viral mediated Nk4 delivery to tumours.

PubMed

Buhles, Alexandra; Collins, Sara A; van Pijkeren, Jan P; Rajendran, Simon; Miles, Michelle; O'Sullivan, Gerald C; O'Hanlon, Deirdre M; Tangney, Mark

2009-03-09

The most common cause of death of cancer sufferers is through the occurrence of metastases. The metastatic behaviour of tumour cells is regulated by extracellular growth factors such as hepatocyte growth factor (HGF), a ligand for the c-Met receptor tyrosine kinase, and aberrant expression/activation of the c-Met receptor is closely associated with metastatic progression. Nk4 (also known as Interleukin (IL)32b) is a competitive antagonist of the HGF c-Met system and inhibits c-Met signalling and tumour metastasis. Nk4 has an additional anti-angiogenic activity independent of its HGF-antagonist function. Angiogenesis-inhibitory as well as cancer-specific apoptosis inducing effects make the Nk4 sequence an attractive candidate for gene therapy of cancer. This study investigates the inhibition of tumour metastasis by gene therapy mediated production of Nk4 by the primary tumour. Optimal delivery of anti-cancer genes is vital in order to achieve the highest therapeutic responses. Non-viral plasmid delivery methods have the advantage of safety and ease of production, providing immediate transgene expression, albeit short-lived in most tumours. Sustained presence of anti-angiogenic molecules is preferable with anti-angiogenic therapies, and the long-term expression mediated by Adeno-associated Virus (AAV) might represent a more appropriate delivery in this respect. However, the incubation time required by AAV vectors to reach appropriate gene expression levels hampers efficacy in many fast-growing murine tumour models. Here, we describe murine trials assessing the effects of Nk4 on the spontaneously metastatic Lewis Lung Carcinoma (LLC) model when delivered to primary tumour via plasmid lipofection or AAV2 vector. Intratumoural AAV-Nk4 administration produced the highest therapeutic response with significant reduction in both primary tumour growth and incidence of lung metastases. Plasmid-mediated therapy also significantly reduced metastatic growth, but with moderate reduction in primary subcutaneous tumour growth. Overall, this study demonstrates the potential for Nk4 gene therapy of metastatic tumours, when delivered by AAV or non-viral methods.

Heterologous Expression of Gene of Interest Using the Marine Protozoan Perkinsus marinus

NASA Astrophysics Data System (ADS)

Cold, E. R.

2016-02-01

Perkinsus marinus is a marine protozoan parasite that causes "Dermo" disease in eastern oysters (Crassostrea virginica). P. marinus is closely related to Plasmodium falciparum which causes malaria. A recent study has showed that P. marinus causes no pathology damage but an immune response in humanized mouse, providing the bases for a genetically modified P. marinus expressing Plasmodium genes to be used as a vaccination delivery system for malaria and other pathogenic diseases. A modified plasmid vector (pMOE-GFP) based on highly expressed gene tagged with green fluorescence protein and targeted to P. marinus cell wall was used to clone MSP8 and HAP2. MSP8 encodes for merozoite surface in P. falciparum and HAP2 is essential for fusion of male and female gametes; genetic disruption of the HAP2 locus revealed that parasite fertilization is prevented. Using electroporation, MSP8 and HAP2 plasmid were introduced into the P. marinus trophozoites. As controls pMOE-GFP was transfected into P. mediterraneus, P. atlanticus and P. chesapeaki. Transfection conditions included 5x107 Perkinsus trophozoites and 10 µg of plasmid using Nucleofector® technology (D-023 program). The cells were recovered in 3 mL of Perkinsus culture media and transfected trophozoites were examined for green fluorescence. To facilitate subcloning of cells expressing GFP, we optimized a DME: HAM's F12 -5% FBS -containing agar solid medium for plating Perkinsus. Examination of all transfected cells indicates expression of both MSP8 and HAP2. This is the first time that genes of a protozoan parasite have been expressed in a marine protozoan. It was also concluded that P. mediterraneus, P. atlanticus and P. chesapeaki were stable mutation and can be isolated for further research.

Engineering endostatin-producing cartilaginous constructs for cartilage repair using nonviral transfection of chondrocyte-seeded and mesenchymal-stem-cell-seeded collagen scaffolds.

PubMed

Jeng, Lily; Olsen, Bjorn R; Spector, Myron

2010-10-01

Although there is widespread recognition of the importance of angiogenesis in tissue repair, there is little work on the inhibition of angiogenesis in the context of tissue engineering of naturally avascular tissues, like articular cartilage. The objective was to engineer a collagen-scaffold-based cartilaginous construct overexpressing a potent antiangiogenic factor, endostatin, using nonviral transfection. Endostatin-plasmid-supplemented collagen scaffolds were seeded with mesenchymal stem cells and chondrocytes and cultured for 20–22 days. The effects of the following variables on endostatin expression and chondrogenesis were examined: collagen scaffold material, method of nonviral vector incorporation, plasmid load, culture medium, and oxygen tension. An increase and peak of endostatin protein was observed during the first week of culture, followed by a decrease to low levels, suggesting that overexpression of endostatin could be sustained for several days using the nonviral vector. The amount of endostatin produced was tunable with the external factors. Chondrogenesis was observed in the engineered constructs cultured in chondrogenic medium at the 3-week time point, demonstrating that endostatin did not inhibit the chondrogenic potential of mesenchymal stem cells or the general viability of the cells. The ability to engineer endostatin-expressing cartilaginous constructs will be of value for future work exercising regulatory control of angiogenesis in cartilage repair.

Survey of Navy Funded Marine Mammal Research and Studies FY 00-01

DTIC Science & Technology

2001-05-10

protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to

Vector modifications to eliminate transposase expression following piggyBac-mediated transgenesis

PubMed Central

Chakraborty, Syandan; Ji, HaYeun; Chen, Jack; Gersbach, Charles A.; Leong, Kam W.

2014-01-01

Transgene insertion plays an important role in gene therapy and in biological studies. Transposon-based systems that integrate transgenes by transposase-catalyzed “cut-and-paste” mechanism have emerged as an attractive system for transgenesis. Hyperactive piggyBac transposon is particularly promising due to its ability to integrate large transgenes with high efficiency. However, prolonged expression of transposase can become a potential source of genotoxic effects due to uncontrolled transposition of the integrated transgene from one chromosomal locus to another. In this study we propose a vector design to decrease post-transposition expression of transposase and to eliminate the cells that have residual transposase expression. We design a single plasmid construct that combines the transposase and the transpositioning transgene element to share a single polyA sequence for termination. Consequently, the separation of the transposase element from the polyA sequence after transposition leads to its deactivation. We also co-express Herpes Simplex Virus thymidine kinase (HSV-tk) with the transposase. Therefore, cells having residual transposase expression can be eliminated by the administration of ganciclovir. We demonstrate the utility of this combination transposon system by integrating and expressing a model therapeutic gene, human coagulation Factor IX, in HEK293T cells. PMID:25492703

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

Catalytic site of human protein-glucosylgalactosylhydroxylysine glucosidase: Three crucial carboxyl residues were determined by cloning and site-directed mutagenesis.

PubMed

Hamazaki, Hideaki; Hamazaki, Michiko Horikawa

2016-01-15

Protein-glucosylgalactosylhydroxylysine glucosidase (PGGHG; EC3.2.1.107) cleaves glucose from disaccharide unit (Glc-α1,2-Gal) linked to hydroxylysine residues of collagen. In the present paper we first show that PGGHG is the product of ATHL1 gene as follows. (1) PGGHG was purified from chick embryos and digested with trypsin. LC-MS/MS analysis suggested the tryptic-peptides were from the ATHL1 gene product. (2) Chick embryo ATHL1 cDNA was cloned to a cloning and expression vector and two plasmid clones with different ATHL1 CDS insert were obtained. (3) Each plasmid DNA was transformed into Escherichia coli cells for expression and two isoforms of chicken PGGHG were obtained. (4) Both isoforms effectively released glucose from type IV collagen. Next, we searched for carboxyl residues crucial for catalytic activity as follows; human ATHL1 cDNA was cloned into a cloning and expression vector and 18 mutants were obtained by site-directed mutagenesis for 15 carboxyl residues conserved in ATHL1 of jawed vertebrates. The expression analysis indicated that substitutions of Asp301, Glu430 and Glu574 with sterically conservative (D301N, E430Q, E574Q) or functionally conservative (D301E, E430D, E574D) residues led to the complete elimination of enzyme activity. These findings lead us to the conclusion that PGGHG is encoded by ATHL1 and three carboxyl residues (corresponding to Asp301, Glu430 and Glu574 of human PGGHG) might be involved in the catalytic site of PGGHG. Copyright © 2015 Elsevier Inc. All rights reserved.

Sustained exogenous expression of therapeutic levels of IFN-gamma ameliorates atopic dermatitis in NC/Nga mice via Th1 polarization.

PubMed

Hattori, Kayoko; Nishikawa, Makiya; Watcharanurak, Kanitta; Ikoma, Akihiko; Kabashima, Kenji; Toyota, Hiroyasu; Takahashi, Yuki; Takahashi, Rei; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-03-01

The short in vivo half-life of IFN-gamma can prevent the cytokine from inducing immunological changes that are favorable for the treatment of Th2-dominant diseases, such as atopic dermatitis. To examine whether a sustained supply of IFN-gamma is effective in regulating the balance of Th lymphocyte subpopulations, plasmid vector encoding mouse IFN-gamma, pCpG-Mugamma, or pCMV-Mugamma was injected into the tail vein of NC/Nga mice, a model for human atopic dermatitis. A single hydrodynamic injection of a CpG motif reduced pCpG-Mugamma at a dose of 0.14 microg/mouse resulted in a sustained concentration of IFN-gamma in the serum, and the concentration was maintained at >300 pg/ml over 80 d. The pCpG-Mugamma-mediated IFN-gamma gene transfer was associated with an increase in the serum concentration of IL-12, reduced production of IgE, and inhibition of mRNA expression of IL-4, -5, -10, -13, and -17 and thymus and activation-regulated chemokine in the spleen. These immunological changes were not clearly observed in mice receiving two injections of 20 microg pCMV-Mugamma, a CpG-replete plasmid DNA, because of the transient nature of the expression from the vector. The mice receiving pCpG-Mugamma showed a significant reduction in the severity of skin lesions and in the intensity of their scratching behavior. Furthermore, high transepidermal water loss, epidermal thickening, and infiltration of lymphocytes and eosinophils, all of which were obvious in the untreated mice, were significantly inhibited. These results indicate that an extraordinary sustained IFN-gamma expression induces favorable immunological changes, leading to a Th1-dominant state in the atopic dermatitis model.

Generation of Marker- and/or Backbone-Free Transgenic Wheat Plants via Agrobacterium-Mediated Transformation.

PubMed

Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin

2016-01-01

Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.

Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

PubMed

Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

2003-08-01

Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its effective induction of apoptosis and tumor growth inhibition.

Single-Step Conversion of Cells to Retrovirus Vector Producers with Herpes Simplex Virus–Epstein-Barr Virus Hybrid Amplicons

PubMed Central

Sena-Esteves, Miguel; Saeki, Yoshinaga; Camp, Sara M.; Chiocca, E. Antonio; Breakefield, Xandra O.

1999-01-01

We report here on the development and characterization of a novel herpes simplex virus type 1 (HSV-1) amplicon-based vector system which takes advantage of the host range and retention properties of HSV–Epstein-Barr virus (EBV) hybrid amplicons to efficiently convert cells to retrovirus vector producer cells after single-step transduction. The retrovirus genes gag-pol and env (GPE) and retroviral vector sequences were modified to minimize sequence overlap and cloned into an HSV-EBV hybrid amplicon. Retrovirus expression cassettes were used to generate the HSV-EBV-retrovirus hybrid vectors, HERE and HERA, which code for the ecotropic and the amphotropic envelopes, respectively. Retrovirus vector sequences encoding lacZ were cloned downstream from the GPE expression unit. Transfection of 293T/17 cells with amplicon plasmids yielded retrovirus titers between 106 and 107 transducing units/ml, while infection of the same cells with amplicon vectors generated maximum titers 1 order of magnitude lower. Retrovirus titers were dependent on the extent of transduction by amplicon vectors for the same cell line, but different cell lines displayed varying capacities to produce retrovirus vectors even at the same transduction efficiencies. Infection of human and dog primary gliomas with this system resulted in the production of retrovirus vectors for more than 1 week and the long-term retention and increase in transgene activity over time in these cell populations. Although the efficiency of this system still has to be determined in vivo, many applications are foreseeable for this approach to gene delivery. PMID:10559361

Cutaneous gene expression of plasmid DNA in excised human skin following delivery via microchannels created by radio frequency ablation.

PubMed

Birchall, James; Coulman, Sion; Anstey, Alexander; Gateley, Chris; Sweetland, Helen; Gershonowitz, Amikam; Neville, Lewis; Levin, Galit

2006-04-07

The skin is a valuable organ for the development and exploitation of gene medicines. Delivering genes to skin is restricted however by the physico-chemical properties of DNA and the stratum corneum (SC) barrier. In this study, we demonstrate the utility of an innovative technology that creates transient microconduits in human skin, allowing DNA delivery and resultant gene expression within the epidermis and dermis layers. The radio frequency (RF)-generated microchannels were of sufficient morphology and depth to permit the epidermal delivery of 100 nm diameter nanoparticles. Model fluorescent nanoparticles were used to confirm the capacity of the channels for augmenting diffusion of macromolecules through the SC. An ex vivo human organ culture model was used to establish the gene expression efficiency of a beta-galactosidase reporter plasmid DNA applied to ViaDerm treated skin. Skin treated with ViaDerm using 50 microm electrode arrays promoted intense levels of gene expression in the viable epidermis. The intensity and extent of gene expression was superior when ViaDerm was used following a prior surface application of the DNA formulation. In conclusion, the RF-microchannel generator (ViaDerm) creates microchannels amenable for delivery of nanoparticles and gene therapy vectors to the viable region of skin.

Improved graft mesenchymal stem cell survival in ischemic heart with a hypoxia-regulated heme oxygenase-1 vector.

PubMed

Tang, Yao Liang; Tang, Yi; Zhang, Y Clare; Qian, Keping; Shen, Leping; Phillips, M Ian

2005-10-04

The goal of this study was to modify mesenchymal stem cells (MSCs) cells with a hypoxia-regulated heme oxygenase-1 (HO-1) plasmid to enhance the survival of MSCs in acute myocardial infarction (MI) heart. Although stem cells are being tested clinically for cardiac repair, graft cells die in the ischemic heart because of the effects of hypoxia/reoxygenation, inflammatory cytokines, and proapoptotic factors. Heme oxygenase-1 is a key component in inhibiting most of these factors. Mesenchymal stem cells from bone marrow were transfected with either HO-1 or LacZ plasmids. Cell apoptosis was assayed in vitro after hypoxia-reoxygen treatment. In vivo, 1 x 10(6) of male MSC(HO-1), MSC(LacZ), MSCs, or medium was injected into mouse hearts 1 h after MI (n = 16/group). Cell survival was assessed in a gender-mismatched transplantation model. Apoptosis, left ventricular remodeling, and cardiac function were tested in a gender-matched model. In the ischemic myocardium, the MSC(HO-1) group had greater expression of HO-1 and a 2-fold reduction in the number of terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick end labeling-positive cells compared with the MSC(LacZ) group. At seven days after implantation, the survival MSC(HO-1) was five-fold greater than the MSC(LacZ) group; MSC(HO-1) also attenuated left ventricular remodeling and enhanced the functional recovery of infarcted hearts two weeks after MI. A hypoxia-regulated HO-1 vector modification of MSCs enhances the tolerance of engrafted MSCs to hypoxia-reoxygen injury in vitro and improves their viability in ischemic hearts. This demonstration is the first showing that a physiologically inducible vector expressing of HO-1 genes improves the survival of stem cells in myocardial ischemia.

Anti-tumor function of double-promoter regulated adenovirus carrying SEA gene, in the treatment of bladder cancer.

PubMed

Hu, Jianpeng; Xuan, Xujun; Han, Conghui; Hao, Lin; Zhang, Peiying; Chen, Meng; He, Houguang; Fan, Tao; Dong, Binzheng

2012-03-01

To construct an adenovirus carrying SEA gene and regulated by telomerase reverse transcriptase (hTERT) and hypoxia-inducible factor (HIF) promoters and investigate its anti-tumor function in vitro, as well as its role in lymphocyte production. hTERT and HIF genes were cloned into adenovirus E1A and E1B shuttle plasmids. The control vector for SEA gene expression is under the regulation of CMV and SV40 promoters. Double regulation was obtained through homologous recombination. The positive clones of replicable adenovirus H2-SEA-Ad were selected by plaque assay. The adenovirus was purified, titrated, and DNA was verified by PCR. The obtained virus was used to infect EJ bladder tumor cells and the SEA Mrna, and protein expression was measured by RT-PCR, western blot, and immunofluorescence microscopy, respectively. Co-culture of lymphocytes and tumor cells was observed dynamically under microscope. The construction of shuttle plasmid p315-CSS-SEA was confirmed by PCR and DNA sequencing. Insertion of superantigen SEA gene in adenovirus (H2-SEA-Ad.SEA) was obtained by homologous recombination. In lymphocytes and tumor cell co-culture, the number of viable tumor cells in test groups was significantly lower than that in control group after 12, 24, and 48 h of treatment. Production of interleukin-2, interleukin-4, and tumor necrosis factor were higher in test groups than in control group. Expression of SEA gene in bladder tumor cells by adenoviral vector caused reduced tumor cell proliferation, as well as stimulation of inflammatory cytokine productions in co-cultures with lymphocytes.

Rational plasmid design and bioprocess optimization to enhance recombinant adeno-associated virus (AAV) productivity in mammalian cells.

PubMed

Emmerling, Verena V; Pegel, Antje; Milian, Ernest G; Venereo-Sanchez, Alina; Kunz, Marion; Wegele, Jessica; Kamen, Amine A; Kochanek, Stefan; Hoerer, Markus

2016-02-01

Viral vectors used for gene and oncolytic therapy belong to the most promising biological products for future therapeutics. Clinical success of recombinant adeno-associated virus (rAAV) based therapies raises considerable demand for viral vectors, which cannot be met by current manufacturing strategies. Addressing existing bottlenecks, we improved a plasmid system termed rep/cap split packaging and designed a minimal plasmid encoding adenoviral helper function. Plasmid modifications led to a 12-fold increase in rAAV vector titers compared to the widely used pDG standard system. Evaluation of different production approaches revealed superiority of processes based on anchorage- and serum-dependent HEK293T cells, exhibiting about 15-fold higher specific and volumetric productivity compared to well-established suspension cells cultivated in serum-free medium. As for most other viral vectors, classical stirred-tank bioreactor production is thus still not capable of providing drug product of sufficient amount. We show that manufacturing strategies employing classical surface-providing culture systems can be successfully transferred to the new fully-controlled, single-use bioreactor system Integrity(TM) iCELLis(TM) . In summary, we demonstrate substantial bioprocess optimizations leading to more efficient and scalable production processes suggesting a promising way for flexible large-scale rAAV manufacturing. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Strategies to optimize capsid protein expression and single-stranded DNA formation of adeno-associated virus in Saccharomyces cerevisiae.

PubMed

Galli, A; Della Latta, V; Bologna, C; Pucciarelli, D; Cipriani, F; Backovic, A; Cervelli, T

2017-08-01

Adeno-associated virus type 2 (AAV) is a nonpathogenic parvovirus that is a promising tool for gene therapy. We aimed to construct plasmids for optimal expression and assembly of capsid proteins and evaluate adenovirus (Ad) protein effect on AAV single-stranded DNA (ssDNA) formation in Saccharomyces cerevisiae. Yeast expression plasmids have been developed in which the transcription of AAV capsid proteins (VP1,2,3) is driven by the constitutive ADH1 promoter or galactose-inducible promoters. Optimal VP1,2,3 expression was obtained from GAL1/10 bidirectional promoter. Moreover, we demonstrated that AAP is expressed in yeast and virus-like particles (VLPs) assembled inside the cell. Finally, the expression of two Ad proteins, E4orf6 and E1b55k, had no effect on AAV ssDNA formation. This study confirms that yeast is able to form AAV VLPs; however, capsid assembly and ssDNA formation are less efficient in yeast than in human cells. Moreover, the expression of Ad proteins did not affect AAV ssDNA formation. New manufacturing strategies for AAV-based gene therapy vectors (rAAV) are needed to reduce costs and time of production. Our study explores the feasibility of yeast as alternative system for rAAV production. © 2017 The Society for Applied Microbiology.

The evolution of heart gene delivery vectors.

PubMed

Wasala, Nalinda B; Shin, Jin-Hong; Duan, Dongsheng

2011-10-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. Copyright © 2011 John Wiley & Sons, Ltd.

The evolution of heart gene delivery vectors

PubMed Central

Wasala, Nalinda B.; Shin, Jin-Hong; Duan, Dongsheng

2012-01-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. PMID:21837689

Characterization of a Theta-Type Plasmid from Lactobacillus sakei: a Potential Basis for Low-Copy-Number Vectors in Lactobacilli

PubMed Central

Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique

2003-01-01

The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947

Parvoviral Left-End Hairpin Ears Are Essential during Infection for Establishing a Functional Intranuclear Transcription Template and for Efficient Progeny Genome Encapsidation

PubMed Central

Li, Lei; Cotmore, Susan F.

2013-01-01

The 121-nucleotide left-end telomere of Minute Virus of Mice (MVM) can be folded into a Y-shaped hairpin with short axial ears that are highly conserved within genus Parvovirus. To explore their potential role(s) during infection, we constructed infectious plasmid clones that lacked one or other ear. Although these were nonviable when transfected into A9 cells, excision of the viral genome and DNA amplification appeared normal, and viral transcripts and proteins were expressed, but progeny virion production was minimal, supporting the idea of a potential role for the ears in genome packaging. To circumvent the absence of progeny that confounded further analysis of these mutants, plasmids were transfected into 293T cells both with and without an adenovirus helper construct, generating single bursts of progeny. These virions bound to A9 cells and were internalized but failed to initiate viral transcription, protein expression, or DNA replication. No defects in mutant virion stability or function could be detected in vitro. Significantly, mutant capsid gene expression and DNA replication could be rescued by coinfection with wild-type virions carrying a replication-competent, capsid-gene-replacement vector. To pinpoint where such complementation occurred, prior transfection of plasmids expressing only MVM nonstructural proteins was explored. NS1 alone, but not NS2, rescued transcription and protein expression from both P4 and P38 promoters, whereas NS1 molecules deleted for their C-terminal transactivation domain did not. These results suggest that the mutant virions reach the nucleus, uncoat, and are converted to duplex DNA but require an intact left-end hairpin structure to form the initiating transcription complex. PMID:23903839

Plasmidic Expression of nemA and yafC* Increased Resistance of Ethanologenic Escherichia coli LY180 to Nonvolatile Side Products from Dilute Acid Treatment of Sugarcane Bagasse and Artificial Hydrolysate

PubMed Central

Shi, Aiqin; Zheng, Huabao; Yomano, Lorraine P.; York, Sean W.; Shanmugam, Keelnatham T.

2016-01-01

Hydrolysate-resistant Escherichia coli SL100 was previously isolated from ethanologenic LY180 after sequential transfers in AM1 medium containing a dilute acid hydrolysate of sugarcane bagasse and was used as a source of resistance genes. Many genes that affect tolerance to furfural, the most abundant inhibitor, have been described previously. To identify genes associated with inhibitors other than furfural, plasmid clones were selected in an artificial hydrolysate that had been treated with a vacuum to remove furfural. Two new resistance genes were discovered from Sau3A1 libraries of SL100 genomic DNA: nemA (N-ethylmaleimide reductase) and a putative regulatory gene containing a mutation in the coding region, yafC*. The presence of these mutations in SL100 was confirmed by sequencing. A single mutation was found in the upstream regulatory region of nemR (nemRA operon) in SL100. This mutation increased nemA activity 20-fold over that of the parent organism (LY180) in AM1 medium without hydrolysate and increased nemA mRNA levels >200-fold. Addition of hydrolysates induced nemA expression (mRNA and activity), in agreement with transcriptional control. NemA activity was stable in cell extracts (9 h, 37°C), eliminating a role for proteinase in regulation. LY180 with a plasmid expressing nemA or yafC* was more resistant to a vacuum-treated sugarcane bagasse hydrolysate and to a vacuum-treated artificial hydrolysate than LY180 with an empty-vector control. Neither gene affected furfural tolerance. The vacuum-treated hydrolysates inhibited the reduction of N-ethylmaleimide by NemA while also serving as substrates. Expression of the nemA or yafC* plasmid in LY180 doubled the rate of ethanol production from the vacuum-treated sugarcane bagasse hydrolysate. PMID:26826228

Plasmidic Expression of nemA and yafC* Increased Resistance of Ethanologenic Escherichia coli LY180 to Nonvolatile Side Products from Dilute Acid Treatment of Sugarcane Bagasse and Artificial Hydrolysate.

PubMed

Shi, Aiqin; Zheng, Huabao; Yomano, Lorraine P; York, Sean W; Shanmugam, Keelnatham T; Ingram, Lonnie O

2016-01-29

Hydrolysate-resistant Escherichia coli SL100 was previously isolated from ethanologenic LY180 after sequential transfers in AM1 medium containing a dilute acid hydrolysate of sugarcane bagasse and was used as a source of resistance genes. Many genes that affect tolerance to furfural, the most abundant inhibitor, have been described previously. To identify genes associated with inhibitors other than furfural, plasmid clones were selected in an artificial hydrolysate that had been treated with a vacuum to remove furfural. Two new resistance genes were discovered from Sau3A1 libraries of SL100 genomic DNA: nemA (N-ethylmaleimide reductase) and a putative regulatory gene containing a mutation in the coding region, yafC*. The presence of these mutations in SL100 was confirmed by sequencing. A single mutation was found in the upstream regulatory region of nemR (nemRA operon) in SL100. This mutation increased nemA activity 20-fold over that of the parent organism (LY180) in AM1 medium without hydrolysate and increased nemA mRNA levels >200-fold. Addition of hydrolysates induced nemA expression (mRNA and activity), in agreement with transcriptional control. NemA activity was stable in cell extracts (9 h, 37°C), eliminating a role for proteinase in regulation. LY180 with a plasmid expressing nemA or yafC* was more resistant to a vacuum-treated sugarcane bagasse hydrolysate and to a vacuum-treated artificial hydrolysate than LY180 with an empty-vector control. Neither gene affected furfural tolerance. The vacuum-treated hydrolysates inhibited the reduction of N-ethylmaleimide by NemA while also serving as substrates. Expression of the nemA or yafC* plasmid in LY180 doubled the rate of ethanol production from the vacuum-treated sugarcane bagasse hydrolysate. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Genomic Approaches for Detection and Treatment of Breast Cancer

DTIC Science & Technology

2007-07-01

The T7Select 10-3b system of lytic phage display is a mid-copy vector that displays between 5-15 copies on the surface of the T7 capsid. The natural... Phage are amplified on a bacterial host that carries an ampicillin-resistant plasmid expressing additional 10A capsid protein from a T7 promoter. We... phage display library of coding fragments encompassing all open reading frames of the human genome. We designed approximately 467,000 overlapping

[Zinc-dependent metalloprotease 1 promotes apoptosis of RAW264.7 macrophages].

PubMed

Li, Peng; He, Yonglin; Zhang, Jiming; Fang, Chencheng

2015-12-01

To construct the eukaryotic expression vector of zinc-dependent metalloprotease 1 (zmp1) gene from Bacillus Calmette-Guerin (BCG) and investigate its impact on the apoptosis of RAW264.7 macrophages. Zmp1 gene was amplified from the genome of BCG by PCR. The zmp1 gene fragment was inserted into multiple cloning sites of pEGFP-N1 to construct the eukaryotic expression vector pEGFP-N1-zmp1. The constructed pEGFP-N1-zmp1 was transfected into RAW264.7 cells by Lipofectamine(TM) 2000. The expression of green fluorescent protein (GFP) was observed by fluorescence microscopy. The zmp1 mRNA was detected by quantitative real-time PCR (qR-PCR). The effect of Zmp1 protein on the apoptosis of RAW264.7 macrophages was detected by flow cytometry (FCM). With zmp1 gene amplified by PCR, we successfully constructed the recombinant vector pEGFP-N1-zmp1 as demonstrated by restriction enzyme analysis and sequencing. GFP was seen in RAW264.7 cells 24 hours after transfected with the recombinant plasmid. As qRT-PCR showed, the expression level of zmp1 mRNA was up-regulated. The early apoptotic rate increased 48 hours after transfection. The increased expression of Zmp1 in RAW264.7 cells promotes the apoptosis of RAW264.7 cells.

Over-expression of angiotensin II type 2 receptor gene induces cell death in lung adenocarcinoma cells.

PubMed

Pickel, Lara; Matsuzuka, Takaya; Doi, Chiyo; Ayuzawa, Rie; Maurya, Dharmendra Kumar; Xie, Sheng-Xue; Berkland, Cory; Tamura, Masaaki

2010-02-01

The endogenous angiotensin II (Ang II) type 2 receptor (AT 2) has been shown to mediate apoptosis in cardiovascular tissues. Thus, the aim of this study was to explore the anti-cancer effect of AT 2 over-expression on lung adenocarcinoma cells in vitro using adenoviral (Ad), FuGENE, and nanoparticle vectors. All three gene transfection methods efficiently transfected AT 2 cDNA into lung cancer cells but caused minimal gene transfection in normal lung epithelial cells. Ad-AT 2 significantly attenuated multiple human lung cancer cell growth (A549 and H358) as compared to the control viral vector, Ad-LacZ, when cell viability was examined by direct cell count. Examination of annexin V by flow cytometry revealed the activation of the apoptotic pathway via AT 2 over-expression. Western Blot analysis confirmed the activation of caspase-3. Similarly, poly (lactide-co-glycolic acid) (PLGA) biodegradable nanoparticles encapsulated AT 2 plasmid DNA were shown to be effectively taken up into the lung cancer cell. Nanoparticle-based AT 2 gene transfection markedly increased AT 2 expression and resultant cell death in A549 cells. These results indicate that AT 2 over-expression effectively attenuates growth of lung adenocarcinoma cells through intrinsic apoptosis. Our results also suggest that PLGA nanoparticles can be used as an efficient gene delivery vector for lung adenocarcinoma targeted therapy.

Effect of TCEA3 on the differentiation of bovine skeletal muscle satellite cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Yue; Tong, Hui-Li; Li, Shu-Feng

Bovine muscle-derived satellite cells (MDSCs) are important for animal growth. In this study, the effect of transcription elongation factor A3 (TCEA3) on bovine MDSC differentiation was investigated. Western blotting, immunofluorescence assays, and cytoplasmic and nuclear protein isolation and purification techniques were used to determine the expression pattern and protein localization of TCEA3 in bovine MDSCs during in vitro differentiation. TCEA3 expression was upregulated using the CRISPR/Cas9 technique to study its effects on MDSC differentiation in vitro. TCEA3 expression gradually increased during the in vitro differentiation of bovine MDSCs and peaked on the 5th day of differentiation. TCEA3 was mainly localized in the cytoplasmmore » of bovine MDSCs, and its expression was not detected in the nucleus. The level of TCEA3 was relatively higher in myotubes at a higher degree of differentiation than during early differentiation. After transfection with a TCEA3-activating plasmid vector (TCEA3 overexpression) for 24 h, the myotube fusion rate, number of myotubes, and expression levels of the muscle differentiation-related loci myogenin (MYOG) and myosin heavy chain 3 (MYH3) increased significantly during the in vitro differentiation of bovine MDSCs. After transfection with a TCEA3-inhibiting plasmid vector for 24 h, the myotube fusion rate, number of myotubes, and expression levels of MYOG and MYH3 decreased significantly. Our results indicated, for the first time, that TCEA3 promotes the differentiation of bovine MDSCs and have implications for meat production and animal rearing. - Highlights: • Muscle-derived satellite cell differentiation is promoted by TCEA3. • TCEA3 protein was localized in the cytoplasm, but not nuclei of bovine MDSCs. • TCEA3 levels increased as myotube differentiation increased. • TCEA3 affected myotube fusion, myotube counts, and MYOG and MYH3 levels.« less

Construction of CRISPR Libraries for Functional Screening.

PubMed

Carstens, Carsten P; Felts, Katherine A; Johns, Sarah E

2018-01-01

Identification of gene function has been aided by the ability to generate targeted gene knockouts or transcriptional repression using the CRISPR/CAS9 system. Using pooled libraries of guide RNA expression vectors that direct CAS9 to a specific genomic site allows identification of genes that are either enriched or depleted in response to a selection scheme, thus linking the affected gene to the chosen phenotype. The quality of the data generated by the screening is dependent on the quality of the guide RNA delivery library with regards to error rates and especially evenness of distribution of the guides. Here, we describe a method for constructing complex plasmid libraries based on pooled designed oligomers with high representation and tight distributions. The procedure allows construction of plasmid libraries of >60,000 members with a 95th/5th percentile ratio of less than 3.5.

Transformation with green fluorescent protein of Trichoderma harzianum 1051, a strain with biocontrol activity against Crinipellis perniciosa, the agent of witches'-broom disease of cocoa.

PubMed

Inglis, Peter W.; Queiroz, Paulo R.; Valadares-Inglis, M. Cléria

1999-04-01

A plasmid vector for fungal expression of an enhanced, red-shifted variant of the Aequoria victoriae green fluorescent protein was constructed by fusion of the EGFP gene to the highly expressed Aspergillus nidulans gpd promoter and the A. nidulans trpC terminator. This construction was introduced by cotransformation, using benomyl selection, into Trichoderma harzianum strain 1051, a strain being evaluated for the biological control of witches'-broom disease of cocoa caused by Crinipellis perniciosa. Epifluorescence microscopy was used to monitor germination and attachment of stable transformant conidia on the surface of C. perniciosa hyphae.

Metatranscriptomics of Soil Eukaryotic Communities.

PubMed

Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2016-01-01

Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

PubMed

Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

2013-05-01

Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

Characterization of the FoxL2 proximal promoter and coding sequence from the common snapping turtle (Chelydra serpentina).

PubMed

Guo, Lei; Rhen, Turk

2017-10-01

Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.

Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells.

PubMed

Tay, Felix Chang; Lim, Jia Kai; Zhu, Haibao; Hin, Lau Cia; Wang, Shu

2015-01-01

Widely observed dysregulation of microRNAs (miRNAs) in human cancer has led to substantial speculation regarding possible functions of these short, non-coding RNAs in cancer development and manipulation of miRNA expression to treat cancer. To achieve miRNA loss-of-function, miRNA sponge technology has been developed to use plasmid or viral vectors for intracellular expression of tandemly arrayed, bulged miRNA binding sites complementary to a miRNA target to saturate its ability to regulate natural mRNAs. A strong viral promoter can be used in miRNA sponge vectors to generate high-level expression of the competitive inhibitor transcripts for either transient or long-term inhibition of miRNA function. Taking the advantage of sharing a common seed sequence by members of a miRNA family, this technology is especially useful in knocking down the expression of a family of miRNAs, providing a powerful means for simultaneous inhibition of multiple miRNAs of interest with a single inhibitor. Knockdown of overexpressed oncogenic miRNAs with the technology can be a rational therapeutic strategy for cancer, whereas inhibition of tumor-suppressive miRNAs by the sponges will be useful in deciphering functions of miRNAs in oncogenesis. Herein, we discuss the design of miRNA sponge expression vectors and the use of the vectors to gain better understanding of miRNA's roles in cancer biology and as an alternative tool for anticancer gene therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

PubMed

Ho, Steven C L; Yang, Yuansheng

2014-08-01

Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

Pullulan-protamine as efficient haemocompatible gene delivery vector: synthesis and in vitro characterization.

PubMed

Priya, S S; Rekha, M R; Sharma, Chandra P

2014-02-15

Biodegradable non-viral vectors with good transfection efficiency is essential for successful gene delivery. The purpose of this study was to design a non-viral vector by conjugating protamine to pullulan and elucidate the potential use of pullulan protamine conjugate (PPA) as an effective, non toxic and haemocompatible gene delivery system. The particle size and surface charge were measured using Nanosizer. Derivatization was confirmed by NMR, FTIR and DSC analyses. Acid base titration revealed the buffering behaviour of the conjugate. The protection of DNA from nuclease enzyme and interaction of plasma components on the stability of nanoplexes were also analysed. The uptake studies confirmed the plasmid delivery into the nucleus and the inhibitor studies determined the uptake mechanism. Transfection experiments revealed the capability of PPA to cellular uptake in C6 cells and facilitate high gene expression. Thus, PPA proves to be a promising non-viral vector. Copyright © 2013 Elsevier Ltd. All rights reserved.

Utilization of RNA polymerase I promoter and terminator sequences to develop a DNA transfection system for the study of hepatitis C virus internal ribosomal entry site-dependent translation.

PubMed

Oem, Jae-Ku; Xiang, Zhonghua; Zhou, Yan; Babiuk, Lorne A; Liu, Qiang

2007-09-01

Hepatitis C virus (HCV) causes severe liver diseases in a large population worldwide. HCV protein translation is controlled by an internal ribosomal entry site (IRES) within the 5'-untranslated region (UTR). HCV IRES-dependent translation is critical for HCV-associated pathogenesis. To develop a plasmid DNA transfection system by using RNA polymerase I promoter and terminator sequences for studying HCV IRES-dependent translation. A gene cassette containing HCV 5'-UTR, Renilla luciferase reporter gene, and HCV 3'-UTR was inserted between RNA polymerase I promoter and terminator sequences. HCV IRES-directed translation was determined by luciferase assay after transfection. Transfection of the RNA polymerase I-HCV IRES plasmid into human hepatoma Huh-7 and HepG2 cells resulted in luciferase gene expression. Deletion of the IIIf domain in HCV IRES dramatically reduced luciferase activity. Our results indicated that the plasmid vector system-based on RNA polymerase I promoter and terminator sequences represents an effective approach for the study of HCV IRES-dependent translation.

Description of two new plasmids isolated from Francisella philomiragia strains and construction of shuttle vectors for the study of Francisella tularensis.

PubMed

Le Pihive, E; Blaha, D; Chenavas, S; Thibault, F; Vidal, D; Valade, E

2009-11-01

Francisella tularensis is the causative agent of tularemia, a zoonotic disease often transmitted to humans by infected animals. The lack of useful specific genetic tools has long hampered the study of F. tularensis subspecies. We identified and characterized two new plasmids, pF242 and pF243, isolated from Francisella philomiragia strains ATCC 25016 and ATCC 25017, respectively. Sequence analysis revealed that pF242 and pF243 are closely related to pC194 and pFNL10 plasmids, respectively. Two generations of pF242- and pF243-based shuttle vectors, harboring several antibiotic resistance markers, were developed. We used the first generation to compare transformation efficiencies in two virulent F. tularensis subspecies. We found that electroporation was more efficient than cryotransformation: almost all vectors tested were successfully introduced by electroporation into Francisella strains with a high level of efficiency. The second generation of shuttle vectors, containing a multiple cloning site and/or gfp gene downstream of Francisella groES promotor, was used for GFP production in F. tularensis. The development of new shuttle vectors offers new perspectives in the genetic manipulation of F. tularensis, helping to elucidate the mechanisms underlying its virulence.

A Potential Food-Grade Cloning Vector for Streptococcus thermophilus That Uses Cadmium Resistance as the Selectable Marker

PubMed Central

Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.

2003-01-01

A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cdr phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus. PMID:14532023

A potential food-grade cloning vector for Streptococcus thermophilus that uses cadmium resistance as the selectable marker.

PubMed

Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W

2003-10-01

A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.

Practical Integration-Free Episomal Methods for Generating Human Induced Pluripotent Stem Cells.

PubMed

Kime, Cody; Rand, Tim A; Ivey, Kathryn N; Srivastava, Deepak; Yamanaka, Shinya; Tomoda, Kiichiro

2015-10-06

The advent of induced pluripotent stem (iPS) cell technology has revolutionized biomedicine and basic research by yielding cells with embryonic stem (ES) cell-like properties. The use of iPS-derived cells for cell-based therapies and modeling of human disease holds great potential. While the initial description of iPS cells involved overexpression of four transcription factors via viral vectors that integrated within genomic DNA, advances in recent years by our group and others have led to safer and higher quality iPS cells with greater efficiency. Here, we describe commonly practiced methods for non-integrating induced pluripotent stem cell generation using nucleofection of episomal reprogramming plasmids. These methods are adapted from recent studies that demonstrate increased hiPS cell reprogramming efficacy with the application of three powerful episomal hiPS cell reprogramming factor vectors and the inclusion of an accessory vector expressing EBNA1. Copyright © 2015 John Wiley & Sons, Inc.

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

Identification, Characterization, and Application of the Replicon Region of the Halophilic Temperate Sphaerolipovirus SNJ1.

PubMed

Wang, Yuchen; Sima, Linshan; Lv, Jie; Huang, Suiyuan; Liu, Ying; Wang, Jiao; Krupovic, Mart; Chen, Xiangdong

2016-07-15

The temperate haloarchaeal virus SNJ1 displays lytic and lysogenic life cycles. During the lysogenic cycle, the virus resides in its host, Natrinema sp. strain J7-1, in the form of an extrachromosomal circular plasmid, pHH205. In this study, a 3.9-kb region containing seven predicted genes organized in two operons was identified as the minimal replicon of SNJ1. Only RepA, encoded by open reading frame 11-12 (ORF11-12), was found to be essential for replication, and its expression increased during the lytic cycle. Sequence analysis suggested that RepA is a distant homolog of HUH endonucleases, a superfamily that includes rolling-circle replication initiation proteins from various viruses and plasmids. In addition to RepA, two genetic elements located within both termini of the 3.9-kb replicon were also required for SNJ1 replication. SNJ1 genome and SNJ1 replicon-based shuttle vectors were present at 1 to 3 copies per chromosome. However, the deletion of ORF4 significantly increased the SNJ1 copy number, suggesting that the product of ORF4 is a negative regulator of SNJ1 abundance. Shuttle vectors based on the SNJ1 replicon were constructed and validated for stable expression of heterologous proteins, both in J7 derivatives and in Natrinema pallidum JCM 8980(T), suggesting their broad applicability as genetic tools for Natrinema species. Archaeal viruses exhibit striking morphological diversity and unique gene content. In this study, the minimal replicon of the temperate haloarchaeal virus SNJ1 was identified. A number of ORFs and genetic elements controlling virus genome replication, maintenance, and copy number were characterized. In addition, based on the replicon, a novel expression shuttle vector has been constructed and validated for protein expression and purification in Natrinema sp. CJ7 and Natrinema pallidum JCM 8980(T) This study not only provided mechanistic and functional insights into SNJ1 replication but also led to the development of useful genetic tools to investigate SNJ1 and other viruses infecting Natrinema species as well as their hosts. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

High-Level Fluorescence Labeling of Gram-Positive Pathogens

PubMed Central

Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

2011-01-01

Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10–50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration. PMID:21731607

Tumor targeting of gene expression through metal-coordinated conjugation with dextran.

PubMed

Hosseinkhani, Hossein; Aoyama, Teruyoshi; Ogawa, Osamu; Tabata, Yasuhiko

2003-03-07

Tumor targeting of plasmid DNA was achieved through the conjugation of dextran derivatives with chelate residues based on metal coordination. Diethylenetriamine pentaacetic acid (DTPA), spermidine (Sd), and spermine (Sm) were chemically introduced to the hydroxyl groups of dextran to obtain dextran-DTPA, dextran-Sd and dextran-Sm derivatives. Conjugation of the dextran derivative by Zn(2+) coordination decreased the apparent size of the plasmid DNA, depending on the derivative type. The negative zeta potential of plasmid DNA became almost 0 mV after Zn(2+)-coordinated conjugation with dextran-Sm. When the dextran derivative-plasmid DNA conjugates with Zn(2+) coordination were intravenously injected subcutaneously into mice bearing Meth-AR-1 fibrosarcoma, the dextran-Sm-plasmid DNA conjugate significantly enhanced the level of gene expression in the tumor, in contrast to the conjugate of other dextran derivatives and free plasmid DNA. The enhanced gene expression produced by the Zn(2+)-coordinated dextran-Sm-plasmid DNA conjugate was specific to the tumor, whereas a simple mixture of dextran-Sm and plasmid DNA was not effective. The level of gene expression depended on the percentage of chelate residues introduced, the mixing weight ratio of the plasmid DNA/Sm residue used for conjugate preparation, and the plasmid DNA dose. A fluorescent microscopic study revealed that localization of plasmid DNA in the tumor tissue was observed only after injection of the dextran-Sm-plasmid DNA conjugate with Zn(2+) coordination. In addition, the gene expression induced by the conjugate lasted for more than 10 days after the injection. We conclude that Zn(2+)-coordinated dextran-Sm conjugation is a promising way to enable plasmid DNA to target the tumor in gene expression as well as to prolong the duration of gene expression.

A Modular Plasmid Assembly Kit for Multigene Expression, Gene Silencing and Silencing Rescue in Plants

PubMed Central

Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin

2014-01-01

The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083

Construction of recombinant FGFR1 containing full-length gene and its potential application.

PubMed

Zhou, Yali; Luo, Wenjuan; Zheng, Lei; Li, Miao; Zhang, Yanmin

2010-07-01

FGFR1, one of the four fibroblast growth factor receptors, has been found to be over-expressed in many cancers. In this study, a full-length expression plasmid for FGFR1 was obtained by fragment amplification. The amplified PCR product was then digested and inserted into the pcDNA3.1(+) vector. A recombinant eukaryotic expression vector containing the complete CDS region of FGFR1 was successfully constructed. After it was transfected to Hek293 cell, the expression of the FGFR1 receptor in recombinant Hek293/FGFR1 was 18 times higher than that of Hek293 cell. The biological activities of high expression FGFR1 cell (Hek293/FGFR1) were verified by FCM, immunofluorescent, RT-PCR, western blot and cell cycle analysis. Then, Hek293/FGFR1 was used to screen taspine with cell membrane chromatography (CMC). Finally, we analyzed the effects of taspine on Hek293/FGFR1 cell and MCF-7 cell. In conclusion, Hek293/FGFR1 was successfully constructed. The results demonstrate that taspine can down-regulate phosphorylation of FGFR1 and ERK, and inhibit Hek293/FGFR1 and MCF-7 cell proliferation. Copyright 2010 Elsevier Inc. All rights reserved.

Rapid Assembly of Customized TALENs into Multiple Delivery Systems

PubMed Central

Zhang, Zhengxing; Zhang, Siliang; Huang, Xin; Orwig, Kyle E.; Sheng, Yi

2013-01-01

Transcriptional activator-like effector nucleases (TALENs) have become a powerful tool for genome editing. Here we present an efficient TALEN assembly approach in which TALENs are assembled by direct Golden Gate ligation into Gateway® Entry vectors from a repeat variable di-residue (RVD) plasmid array. We constructed TALEN pairs targeted to mouse Ddx3 subfamily genes, and demonstrated that our modified TALEN assembly approach efficiently generates accurate TALEN moieties that effectively introduce mutations into target genes. We generated “user friendly” TALEN Entry vectors containing TALEN expression cassettes with fluorescent reporter genes that can be efficiently transferred via Gateway (LR) recombination into different delivery systems. We demonstrated that the TALEN Entry vectors can be easily transferred to an adenoviral delivery system to expand application to cells that are difficult to transfect. Since TALENs work in pairs, we also generated a TALEN Entry vector set that combines a TALEN pair into one PiggyBac transposon-based destination vector. The approach described here can also be modified for construction of TALE transcriptional activators, repressors or other functional domains. PMID:24244669

Construction of a novel shuttle vector for use in Gluconobacter oxydans.

PubMed

Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming

2010-11-01

A shuttle vector pZL1 which can replicate both in Gluconobacter oxydans and Escherichia coli was constructed based on G. oxydans DSM2003 cryptic plasmid pGOX3, a homology of G. oxydans 621H pGOX3, and E. coli cloning vector pUC18. It was found to be stably maintained in G. oxydans during the serial subcultures in the absence of antibiotic pressure for 144 h. With pGOX3 as the reference sample, the relative copy number of pZL1 in G. oxydans is 13 determined by real-time fluorescence quantitative PCR (qPCR). The copy number of pZL1 is much higher than pBBR1MCS5 in E. coli. The vector pZL1 contains six commonly used restriction endonuclease sites, HindIII, SalI, XbaI, BamHI, SmaI, KpnI, and SacI, and is easy to manipulate in molecular biology experiments. The shuttle vector was used to express a reporter protein wasabi successfully in G. oxydans DSM2003 under the control of the tufB promoter.

A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.

PubMed

Hassan, Sally; Keshavarz-Moore, Eli; Ward, John

2016-09-01

With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.

Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki

Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS,more » and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.« less

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Antiosteoporotic compounds from seeds of Cuscuta chinensis.

PubMed

Yang, Lijuan; Chen, Qianfeng; Wang, Fei; Zhang, Guolin

2011-05-17

The seeds of Cuscuta chinensis (Tu-Si-Zi, TSZ) have long been used for the treatment of osteoporosis in China and some Asian countries. The compounds in TSZ responsible for the antiosteoporotic activity are still poorly understood. The present study was designed to investigate the osteogenic compounds in TSZ, and to evaluate their antiosteoporotic effects in osteoblastic cells. Osteoblast-like UMR-106 cells were used for bioactivity-guided isolation of the active compounds. The activity of alkaline phosphatase (ALP) in UMR-106 cells was measured by p-nitrophenyl sodium phosphate assay. The proliferation of UMR-106 cells was assayed by Alamar-Blue method. Estrogenic activity of the extracts and isolated compounds was evaluated by activation of estrogen response element (ERE) luciferase reporter expression in HeLa cells co-transfected with human estrogen receptor subtypes (ERα or ERβ) expression vectors and 5×ERE luciferase reporter plasmid. Antiestrogenic activity of the extracts and isolated compounds were evaluated by activation of activator protein-1 (AP-1) luciferase reporter expression in HeLa cells co-transfected with human estrogen receptor subtypes (ERα or ERβ) expression vectors and 6×AP-1 luciferase reporter plasmid. ALP-guided fractionation led to the isolation of five known flavonoids, quercetin, kaempferol, isorhamnetin, hyperoside and astragalin from the crude ethanolic extract of TSZ. Further study showed that kaempferol and hyperoside significantly increased the ALP activity in UMR-106 cells. Astragalin promoted the proliferation of UMR-106 cells whereas other compounds had no such effect. The isolated compounds showed estrogenic activity but quercetin, kaempferol and isorhamnetin showed more potent ERβ agonist activity. However, compared with their ER agonist activity, only quercetin and kaempferol showed potent ER antagonist activity by activating ERα/β-mediated AP-1 reporter expression. Our findings validated the clinical use of TSZ in the treatment of osteoporosis, and demonstrated that kaempferol and hyperoside are the active compounds in TSZ for the osteogenic effect. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression.

PubMed

Puckette, Michael; Burrage, Thomas; Neilan, John G; Rasmussen, Max

2017-06-12

The Gaussia princeps luciferase is used as a stand-alone reporter of transgene expression for in vitro and in vivo expression systems due to the rapid and easy monitoring of luciferase activity. We sought to simultaneously quantitate production of other recombinant proteins by transcriptionally linking the Gaussia princeps luciferase gene to other genes of interest through the foot-and-mouth disease virus 2A translational interrupter sequence. We produced six plasmids, each encoding a single open reading frame, with the foot-and-mouth disease virus 2A sequence placed either N-terminal or C-terminal to the Gaussia princeps luciferase gene. Two plasmids included novel Gaussia princeps luciferase variants with the position 1 methionine deleted. Placing a foot-and-mouth disease virus 2A translational interrupter sequence on either the N- or C-terminus of the Gaussia princeps luciferase gene did not prevent the secretion or luminescence of resulting chimeric luciferase proteins. We also measured the ability of another polycistronic plasmid vector with a 2A-luciferase sequence placed downstream of the foot-and-mouth disease virus P1 and 3C protease genes to produce of foot-and-mouth disease virus-like particles and luciferase activity from transfected cells. Incorporation of the 2A-luciferase sequence into a transgene encoding foot-and-mouth disease virus structural proteins retained luciferase activity and the ability to form virus-like particles. We demonstrated a mechanism for the near real-time, sequential, non-destructive quantitative monitoring of transcriptionally-linked recombinant proteins and a valuable method for monitoring transgene expression in recombinant vaccine constructs.

Utilization of Virus ϕCh1 Elements To Establish a Shuttle Vector System for Halo(alkali)philic Archaea via Transformation of Natrialba magadii

PubMed Central

Mayrhofer-Iro, M.; Ladurner, A.; Meissner, C.; Derntl, C.; Reiter, M.; Haider, F.; Dimmel, K.; Rössler, N.; Klein, R.; Baranyi, U.; Scholz, H.

2013-01-01

In the study described here, we successfully developed a transformation system for halo(alkali)philic members of the Archaea. This transformation system comprises a series of Natrialba magadii/Escherichia coli shuttle vectors based on a modified method to transform halophilic members of the Archaea and genomic elements of the N. magadii virus ϕCh1. The shuttle vector pRo-5, based on the repH-containing region of ϕCh1, stably replicated in E. coli and N. magadii and in several halophilic and haloalkaliphilic members of the Archaea not transformable so far. The ϕCh1 operon ORF53/ORF54 (repH) was essential for pRo-5 replication and was thus identified as the minimal replication origin. The plasmid allowed homologous and heterologous gene expression, as exemplified by the expression of ϕCh1 ORF3452, which encodes a structural protein, and the reporter gene bgaH of Haloferax lucentense in N. magadii. The new transformation/vector system will facilitate genetic studies within N. magadii and other haloalkaliphilic archaea and will allow the detailed characterization of the gene functions of N. magadii virus ϕCh1 in their extreme environments. PMID:23416999

Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria

PubMed Central

Taton, Arnaud; Unglaub, Federico; Wright, Nicole E.; Zeng, Wei Yue; Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian; Peterson, Todd C.; Haerizadeh, Farzad; Golden, Susan S.; Golden, James W.

2014-01-01

Inspired by the developments of synthetic biology and the need for improved genetic tools to exploit cyanobacteria for the production of renewable bioproducts, we developed a versatile platform for the construction of broad-host-range vector systems. This platform includes the following features: (i) an efficient assembly strategy in which modules released from 3 to 4 donor plasmids or produced by polymerase chain reaction are assembled by isothermal assembly guided by short GC-rich overlap sequences. (ii) A growing library of molecular devices categorized in three major groups: (a) replication and chromosomal integration; (b) antibiotic resistance; (c) functional modules. These modules can be assembled in different combinations to construct a variety of autonomously replicating plasmids and suicide plasmids for gene knockout and knockin. (iii) A web service, the CYANO-VECTOR assembly portal, which was built to organize the various modules, facilitate the in silico construction of plasmids, and encourage the use of this system. This work also resulted in the construction of an improved broad-host-range replicon derived from RSF1010, which replicates in several phylogenetically distinct strains including a new experimental model strain Synechocystis sp. WHSyn, and the characterization of nine antibiotic cassettes, four reporter genes, four promoters, and a ribozyme-based insulator in several diverse cyanobacterial strains. PMID:25074377

Plasmid DNA Delivery: Nanotopography Matters.

PubMed

Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

2017-12-20

Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

PubMed

Sakai, Y; Goh, T K; Tani, Y

1993-06-01

We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.

[Preparation and activity validation of PP7 bacteriophage-like particles displaying PAP114-128 peptide].

PubMed

Sun, Yanli; Sun, Yanhua

2016-10-01

Objective To obtain the PP7 bacteriophage-like particles carrying the peptide of prostatic acid phosphatase PAP 114-128 , and prove that they retain the original biological activity. Methods First, the plasmid pETDuet-2PP7 was constructed as follows: the gene of PP7 coat protein dimer was amplified by gene mutation combined with overlapping PCR technology, and inserted into the vector pETDuet-1. Following that, the plasmid pETDuet-2PP7-PAP 114-128 was constructed as follows: the PP7 coat protein gene carrying the coding gene of PAP 114-128 peptide was amplified using PCR, and then inserted into the vector pETDuet-2PP7. Both pETDuet-2PP7 and pETDuet-2PP7-PAP 114-128 were transformed into E.coli and expressed. The expression product was verified by SDS-PAGE, double immunodiffusion assay and ELISA. Results The gene fragment of PP7 coat protein dimer was obtained by overlapping PCR using Ex Taq DNA polymerase, and the antigenicity of its expression product was the same as that of the coat protein of wild-type PP7 bacteriophage. Moreover, the PAP 114-128 peptide epitope that was displayed on the surface of PP7 bacteriophage was identical with the corresponding epitope of natural human PAP, and it was able to induce high levels of antibodies. Conclusion The gene of PP7 coat protein dimer with repeated sequences can be prepared by gene mutation combined with overlapping PCR. Based on this, PP7 bacteriophage-like particles carrying PAP peptide can be prepared, which not only solves the problem of the instability of the peptides, but also lays a foundation for the study on their delivery and function.

Application and expression of HSV gG1 protein from a recombinant strain.

PubMed

Yan, Hua; Yan, Huishen; Huang, Tao; Li, Guocai; Gong, Weijuan; Jiao, Hongmei; Chen, Hongju; Ji, Mingchun

2010-11-01

According to the homologous sequence of glycoprotein G1 (gG1) genes from different strains of herpes simplex virus type 1 (HSV-1), a pair of primers was designed to amplify the gG1 gene fragment by PCR. Both the PCR product and the pGEX-4T-1 vector were digested with EcoR I and Sal I. The gG1 gene fragment was subcloned into the digested pGEX-4T-1 vector to construct a recombinant plasmid (pGEX-4T-1-gG1). The resultant plasmid was identified by dual-enzyme digestion and sequence analysis, and then transformed into Escherichia coli BL21 for expression under the induction of isopropyl β-D-1-thiogalactoside (IPTG). The expressed GST-gG1 fragment was detected by SDS-PAGE and purified by affinity chromatography. The properties of GST-gG1 fragment were evaluated by immunoblot analysis. Enzyme-linked immunosorbent assays (ELISAs) based on the GST-gG1 fragment were used for determining IgG or IgM to HSV-1. The GST-gG1 fragment-specific ELISA was also compared with ELISA with whole-HSV-1 antigen and commercial ELISA kits. The gG1-specific IgG and IFN-γ producing CD8+ T cells were induced in mice immunized with the GST-gG1 fragment. These results indicated that the GST-gG1 fragment could be used for replacing whole-virus antigen to detect IgM and IgG to HSV-1 in human sera, which provided a strategy for developing vaccines to protect HSV-1 infection using gG1 fragment. Copyright © 2010 Elsevier B.V. All rights reserved.

In ovo electroporation of miRNA-based plasmids in the developing neural tube and assessment of phenotypes by DiI injection in open-book preparations.

PubMed

Wilson, Nicole H; Stoeckli, Esther T

2012-10-16

Commissural dI1 neurons have been extensively studied to elucidate the mechanisms underlying axon guidance during development(1,2). These neurons are located in the dorsal spinal cord and send their axons along stereotyped trajectories. Commissural axons initially project ventrally towards and then across the floorplate. After crossing the midline, these axons make a sharp rostral turn and project longitudinally towards the brain. Each of these steps is regulated by the coordinated activities of attractive and repulsive guidance cues. The correct interpretation of these cues is crucial to the guidance of axons along their demarcated pathway. Thus, the physiological contribution of a particular molecule to commissural axon guidance is ideally investigated in the context of the living embryo. Accordingly, gene knockdown in vivo must be precisely controlled in order to carefully distinguish axon guidance activities of genes that may play multiple roles during development. Here, we describe a method to knockdown gene expression in the chicken neural tube in a cell type-specific, traceable manner. We use novel plasmid vectors(3) harboring cell type-specific promoters/enhancers that drive the expression of a fluorescent protein marker, followed directly by a miR30-RNAi transcript(4) (located within the 3'-UTR of the cDNA encoding the fluorescent protein) (Figure 1). When electroporated into the developing neural tube, these vectors elicit efficient downregulation of gene expression and express bright fluorescent marker proteins to enable direct tracing of the cells experiencing knockdown(3). Mixing different RNAi vectors prior to electroporation allows the simultaneous knockdown of two or more genes in independent regions of the spinal cord. This permits complex cellular and molecular interactions to be examined during development, in a manner that is fast, simple, precise and inexpensive. In combination with DiI tracing of commissural axon trajectories in open-book preparations(5), this method is a useful tool for in vivo studies of the cellular and molecular mechanisms of commissural axon growth and guidance. In principle, any promoter/enhancer could be used, potentially making the technique more widely applicable for in vivo studies of gene function during development(6). This video first demonstrates how to handle and window eggs, the injection of DNA plasmids into the neural tube and the electroporation procedure. To investigate commissural axon guidance, the spinal cord is removed from the embryo as an open-book preparation, fixed, and injected with DiI to enable axon pathways to be traced. The spinal cord is mounted between coverslips and visualized using confocal microscopy.

Enhanced immune response and protective efficacy of a Treponema pallidum Tp92 DNA vaccine vectored by chitosan nanoparticles and adjuvanted with IL-2.

PubMed

Zhao, Feijun; Wu, Yimou; Zhang, Xiaohong; Yu, Jian; Gu, Weiming; Liu, Shuangquan; Zeng, Tiebing; Zhang, Yuejun; Wang, Shiping

2011-10-01

In this study, the immune-modulatory and protective efficacy of using an interleukin-2 (IL-2) expression plasmid as a genetic adjuvant and chitosan (CS) nanoparticles as vectors to enhance a Tp92 DNA vaccine candidate were investigated in a Treponema pallidum (Tp) rabbit challenge model. CS vectoring of pTp92 or pIL-2 were both demonstrated to augment anti-Tp92 antibody levels induced by pTp92 DNA vaccines. Interestingly, the combination of CS vectored Tp92 and pIL-2 led to the greatest enhancements of anti-Tp92 antibodies and T-cell proliferation (p < 0.05). At week 10 after the first immunization, 15 of the 18 rabbits in each group were challenged with Tp Nichols strain and monitored for skin lesions and ulcer lesions. Ratios of positive skin lesions and ratios of ulcer lesions in groups immunized with pTp92 were significantly lower than those of the empty vector or PBS groups (p < 0.05), demonstrating that pTp92 immunization elicited significant protective efficacy against the Tp Nichols strain challenge. CS vectored and pIL-2 adjuvanted pTp92 immunized animals exhibited the lowest rates of positive skin and ulcer lesions. Male New Zealand white rabbits were randomly assigned to groups (n = 18/group) and immunized intramuscularly with pTp92 based plasmid DNA constructs (100 μg of DNA/rabbit/immunization). Two weeks before Tp challenge (Week 8), three rabbits from each group were used to determine cytokine measurements and fifteen rabbits from each group were used for Tp challenge studies. Intramuscular injection of pTp92 induced strong humoral and cellular immune responses and conferred protection from Tp challenge in rabbits. The use of CS as a pTp92 vector or pIL-2 as an adjuvant achieved a superior level of protective efficacy against Tp challenge, however CS vectored, IL-2 adjuvanted pTp92 immunization conferred the highest level of protective efficacy.

Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis with Various Plasmids

PubMed Central

Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle

2002-01-01

We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607

Cell Cycle Dependent Regulation of Human Progesterone Receptor in Breast Cancer

DTIC Science & Technology

2004-10-01

wt PR or S400A PR (0.01-1.0 [tg each), CDK2 (ljig), and PRE-2x-TATA-luc reporter plasmid (lig) along with Renilla plasmid (10ng) as a control for...8 hours prior to treatment. Cells were collected following treatment with 10 nM R5020 or ETOH vehicle control for 18 hrs. Luciferase and renilla ...reporter, a renilla reporter construct as a transfection control, either wt PR-B or S400A mutant PR-B, and control parental vector or a vector encoding an

Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

PubMed Central

Madsen, Jonas Stenløkke; Riber, Leise; Kot, Witold; Basfeld, Alrun; Burmølle, Mette; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes

2016-01-01

Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed to have originated. We find that mrkABCDFs of plasmids are highly expressed via a unique promoter that differs from the original Klebsiella promoter resulting in fundamental behavioral consequences. Plasmid associated mrkABCDFs did not influence the swimming behavior of the host, that hereby acquired an exceptional phenotype being able to both actively swim (planktonic behavior) and express biofilm associated fimbriae (sessile behavior). We show that this exceptional phenotype enhances the conjugal transfer of the plasmid. PMID:27627107

Binding and condensation of plasmid DNA onto functionalized carbon nanotubes: toward the construction of nanotube-based gene delivery vectors.

PubMed

Singh, Ravi; Pantarotto, Davide; McCarthy, David; Chaloin, Olivier; Hoebeke, Johan; Partidos, Charalambos D; Briand, Jean-Paul; Prato, Maurizio; Bianco, Alberto; Kostarelos, Kostas

2005-03-30

Carbon nanotubes (CNTs) constitute a class of nanomaterials that possess characteristics suitable for a variety of possible applications. Their compatibility with aqueous environments has been made possible by the chemical functionalization of their surface, allowing for exploration of their interactions with biological components including mammalian cells. Functionalized CNTs (f-CNTs) are being intensively explored in advanced biotechnological applications ranging from molecular biosensors to cellular growth substrates. We have been exploring the potential of f-CNTs as delivery vehicles of biologically active molecules in view of possible biomedical applications, including vaccination and gene delivery. Recently we reported the capability of ammonium-functionalized single-walled CNTs to penetrate human and murine cells and facilitate the delivery of plasmid DNA leading to expression of marker genes. To optimize f-CNTs as gene delivery vehicles, it is essential to characterize their interactions with DNA. In the present report, we study the interactions of three types of f-CNTs, ammonium-functionalized single-walled and multiwalled carbon nanotubes (SWNT-NH3+; MWNT-NH3+), and lysine-functionalized single-walled carbon nanotubes (SWNT-Lys-NH3+), with plasmid DNA. Nanotube-DNA complexes were analyzed by scanning electron microscopy, surface plasmon resonance, PicoGreen dye exclusion, and agarose gel shift assay. The results indicate that all three types of cationic carbon nanotubes are able to condense DNA to varying degrees, indicating that both nanotube surface area and charge density are critical parameters that determine the interaction and electrostatic complex formation between f-CNTs with DNA. All three different f-CNT types in this study exhibited upregulation of marker gene expression over naked DNA using a mammalian (human) cell line. Differences in the levels of gene expression were correlated with the structural and biophysical data obtained for the f-CNT:DNA complexes to suggest that large surface area leading to very efficient DNA condensation is not necessary for effective gene transfer. However, it will require further investigation to determine whether the degree of binding and tight association between DNA and nanotubes is a desirable trait to increase gene expression efficiency in vitro or in vivo. This study constitutes the first thorough investigation into the physicochemical interactions between cationic functionalized carbon nanotubes and DNA toward construction of carbon nanotube-based gene transfer vector systems.

Chitosan-plasmid nanoparticle formulations for IM and SC delivery of recombinant FGF-2 and PDGF-BB or generation of antibodies.

PubMed

Jean, M; Smaoui, F; Lavertu, M; Méthot, S; Bouhdoud, L; Buschmann, M D; Merzouki, A

2009-09-01

Growth factor therapy is an emerging treatment modality that enhances tissue vascularization, promotes healing and regeneration and can treat a variety of inflammatory diseases. Both recombinant human growth factor proteins and their gene therapy are in human clinical trials to heal chronic wounds. As platelet-derived growth factor-bb (PDGF-BB) and fibroblast growth factor-2 (FGF-2) are known to induce chemotaxis, proliferation, differentiation, and matrix synthesis, we investigated a non-viral means for gene delivery of these factors using the cationic polysaccharide chitosan. Chitosan is a polymer of glucosamine and N-acetyl-glucosamine, in which the percentage of the residues that are glucosamine is called the degree of deacetylation (DDA). The purpose of this study was to express PDGF-BB and FGF-2 genes in mice using chitosan-plasmid DNA nanoparticles for the controlled delivery of genetic material in a specific, efficient, and safe manner. PDGF-BB and FGF-2 genes were amplified from human tissues by RT-PCR. To increase the secretion of FGF-2, a recombinant 4sFGF-2 was constructed bearing eight amino-acid residues of the signal peptide of FGF-4. PCR products were inserted into the expression vector pVax1 to produce recombinant plasmids pVax1-4sFGF2 and pVax1-PDGF-BB, which were then injected into BALB/C mice in the format of polyelectrolyte nanocomplexes with specific chitosans of controlled DDA and molecular weight, including 92-10, 80-10, and 80-80 (DDA-number average molecular weight or M(n) in kDa). ELISA assays on mice sera showed that recombinant FGF-2 and PDGF-BB proteins were efficiently expressed and specific antibodies to these proteins could be identified in sera of injected mice, but with levels that were clearly dependent on the specific chitosan used. We found high DDA low molecular weight chitosans to be efficient protein expressors with minimal or no generation of neutralizing antibodies, while lowering DDA resulted in greater antibody levels and correspondingly lower levels of detected recombinant protein. Histological analyses corroborated these results by revealing greater inflammatory infiltrates in lower DDA chitosans, which produced higher antibody titers. We found, in general, a more efficient delivery of the plasmids by subcutaneous than by intramuscular injection. Specific chitosan carriers were identified to be either efficient non-toxic therapeutic protein delivery systems or vectors for DNA vaccines.

The transcription factor titration effect dictates level of gene expression.

PubMed

Brewster, Robert C; Weinert, Franz M; Garcia, Hernan G; Song, Dan; Rydenfelt, Mattias; Phillips, Rob

2014-03-13

Models of transcription are often built around a picture of RNA polymerase and transcription factors (TFs) acting on a single copy of a promoter. However, most TFs are shared between multiple genes with varying binding affinities. Beyond that, genes often exist at high copy number-in multiple identical copies on the chromosome or on plasmids or viral vectors with copy numbers in the hundreds. Using a thermodynamic model, we characterize the interplay between TF copy number and the demand for that TF. We demonstrate the parameter-free predictive power of this model as a function of the copy number of the TF and the number and affinities of the available specific binding sites; such predictive control is important for the understanding of transcription and the desire to quantitatively design the output of genetic circuits. Finally, we use these experiments to dynamically measure plasmid copy number through the cell cycle. Copyright © 2014 Elsevier Inc. All rights reserved.

Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli

PubMed Central

Jacobus, Ana Paula; Gross, Jeferson

2015-01-01

PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528

Production of Phytase Enzyme by a Bioengineered Probiotic for Degrading of Phytate Phosphorus in the Digestive Tract of Poultry.

PubMed

Pakbaten, Bahareh; Majidzadeh Heravi, Reza; Kermanshahi, Hassan; Sekhavati, Mohammad-Hadi; Javadmanesh, Ali; Mohammadi Ziarat, Masoud

2018-04-21

Probiotics are beneficial microorganisms and have long been used in food production as well as health promotion products. Bioengineered probiotics are used to express and transfer native or recombinant molecules to the mucosal surface of the digestive tract to improve feed efficiency and promote health. Lactococcus lactis is a potential probiotic candidate to produce useful biological proteins. The aim of this investigation was to develop a recombinant Lactococcus lactis with the potential of producing phytase. To enhance the efficiency of expression and secretion of recombinant phytase, usp45 signal peptide was added to the expression vector containing phytase gene (appA2) derived from Escherichia coli. Sequencing of recombinant plasmid containing appA2 showed the correct construction of plasmid. Total length of the phytase insert was 1.25 kbp. A Blast search of the cloned fragment showed 99% similarity to the reported E. coli phytase sequence in the GenBank (accession number: AM946981.2). A plasmid containing usp45 and appA2 electrotransferred into Lactococcus lactis. Zymogram with polyacrylamide gel revealed that the protein extract from the supernatant and the cell pellet of recombinant bacteria had phytase activity. Enzyme activity of 4 U/ml was obtained in cell extracts, and supernatant maximal phytase activity was 19 U/ml. The recombinant L. lactis was supplemented in broiler chicken feed and showed the increase of apparent digestibility on phytate phosphorus in the digestive tract and it was same as performance of E. coli commercial phytase.

New Recombinant Mycobacterium bovis BCG Expression Vectors: Improving Genetic Control over Mycobacterial Promoters.

PubMed

Kanno, Alex I; Goulart, Cibelly; Rofatto, Henrique K; Oliveira, Sergio C; Leite, Luciana C C; McFadden, Johnjoe

2016-04-01

The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such as Mycobacterium bovis BCG or M. smegmatis was made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5 promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinant M. smegmatis bacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in both M. smegmatis and M. bovisBCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of the Schistosoma mansoni antigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. Copyright © 2016 Kanno et al.

Vero/BC-F: an efficient packaging cell line stably expressing F protein to generate single round-infectious human parainfluenza virus type 2 vector.

PubMed

Ohtsuka, J; Fukumura, M; Tsurudome, M; Hara, K; Nishio, M; Kawano, M; Nosaka, T

2014-08-01

A stable packaging cell line (Vero/BC-F) constitutively expressing fusion (F) protein of the human parainfluenza virus type 2 (hPIV2) was established for production of the F-defective and single round-infectious hPIV2 vector in a strategy for recombinant vaccine development. The F gene expression has not evoked cytostatic or cytotoxic effects on the Vero/BC-F cells and the F protein was physiologically active to induce syncytial formation with giant polykaryocytes when transfected with a plasmid expressing hPIV2 hemagglutinin-neuraminidase (HN). Transduction of the F-defective replicon RNA into the Vero/BC-F cells led to the release of the infectious particles that packaged the replicon RNA (named as hPIV2ΔF) without detectable mutations, limiting the infectivity to a single round. The maximal titer of the hPIV2ΔF was 6.0 × 10(8) median tissue culture infections dose per ml. The influenza A virus M2 gene was inserted into hPIV2ΔF, and the M2 protein was found to be highly expressed in a human lung cancer cell line after transduction. Furthermore, in vivo airway infection experiments revealed that the hPIV2ΔF was capable of delivering transgenes to hamster tracheal cells. Thus, non-transmissible or single round-infectious hPIV2 vector will be potentially applicable to human gene therapy or recombinant vaccine development.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

Generation, Analysis and Functional Annotation of Expressed Sequence Tags from the Sheepshead Minnow (Cyprinodon variegatus)

DTIC Science & Technology

2010-01-01

any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it does not display a...CA) were cloned using the pGEM-T Easy Vector System (Promega, Madison, WI) and Electromax DH10B T1 Phage Resistant Cells (Invitrogen, Carlsbad, CA...reactions were performed using 75ng of plasmid DNA template and a M13 (-40) forward primer according to the manufac- turer’s protocol for DNA sequencing of

In vitro gene expression by cationized derivatives of an artificial protein with repeated RGD sequences, Pronectin.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2003-01-09

The objective of this study is to investigate the efficiency of a non-viral gene carrier with RGD sequences, Pronectin F(+) for gene transfection. The Pronectin F(+) was cationized by introducing ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) to the hydroxyl groups while the corresponding gelatin derivative was prepared similarly because gelatin also has one RGD sequence per molecule. The zeta potential and molecular size of Pronectin F(+) and gelatin derivatives were examined before and after polyion complexation with a plasmid DNA of luciferase. When complexed with the plasmid DNA at the Pronectin F(+)/plasmid DNA mixing ratio of 50, the complex exhibited a zeta potential of about 10 mV, which is similar to that of the gelatin derivative-plasmid DNA complex. Irrespective of the type of Pronectin F(+) and gelatin derivatives, their complexation enabled the apparent molecular size of plasmid DNA to reduce to about 200 nm, the size decreasing with the increased derivative/plasmid DNA weight mixing ratio. The rat gastric mucosal (RGM)-1 cells treated with both complexes exhibited significantly stronger luciferase activities than free plasmid DNA although the enhanced extent was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. Cell attachment was enhanced by the Pronectin F(+) derivative to a significant high extent compared with the gelatin derivative. The amount of plasmid DNA internalized into the cells was enhanced by the complexation with every Pronectin F(+) derivative compared with the gelatin derivative. For both of Pronectin F(+) and gelatin carriers, the buffering capacity of Sm derivatives was higher than that of Ed and Sd derivatives and comparable to that of polyethyleneimine. It is likely that the high efficiency of gene transfection for the Sm derivative is due to the superior buffering effect. We conclude that the Sm derivative of Pronectin F(+) is promising as a non-viral vector of gene transfection.

A recombinant plasmid containing CpG motifs as a novel vaccine adjuvant for immune protection against herpes simplex virus 2.

PubMed

He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan

2016-08-01

The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Cloning, expression, and purification of the virulence-associated protein D from Xylella fastidiosa.

PubMed

Catani, Cleide Ferreira; Azzoni, Adriano Rodrigues; Paula, Débora Pires; Tada, Susely Ferraz Siqueira; Rosselli, Luciana Kauer; de Souza, Anete Pereira; Yano, Tomomasa

2004-10-01

In this study, an efficient expression system, based on the pET32Xa/LIC vector, for producing a Xylella fastidiosa virulence-associated protein D, found to have a strong similarity to Riemerella anatipestifer and Actinobacillus actinomycetencomitans VapD protein, is presented. The protein has a molecular mass of 17.637 Da and a calculated pI of 5.49. The selected XFa0052 gene was cloned in the pET32Xa/LIC vector and the plasmid was transformed into Escherichia coli BL21 (DE3) strain at 37 degrees C, with an induction time of 2 h and 1 mM IPTG concentration. The protein present in the soluble fraction was purified by immobilized metal affinity chromatography (IMAC), and had its identity determined by mass spectrometry (MALDI-TOF) and N-terminal sequencing. The purified protein was found as a single band on SDS-PAGE and its correct folding was verified by circular dichroism spectroscopy.

Development of a rapid high-efficiency scalable process for acetylated Sus scrofa cationic trypsin production from Escherichia coli inclusion bodies.

PubMed

Zhao, Mingzhi; Wu, Feilin; Xu, Ping

2015-12-01

Trypsin is one of the most important enzymatic tools in proteomics and biopharmaceutical studies. Here, we describe the complete recombinant expression and purification from a trypsinogen expression vector construct. The Sus scrofa cationic trypsin gene with a propeptide sequence was optimized according to Escherichia coli codon-usage bias and chemically synthesized. The gene was inserted into pET-11c plasmid to yield an expression vector. Using high-density E. coli fed-batch fermentation, trypsinogen was expressed in inclusion bodies at 1.47 g/L. The inclusion body was refolded with a high yield of 36%. The purified trypsinogen was then activated to produce trypsin. To address stability problems, the trypsin thus produced was acetylated. The final product was generated upon gel filtration. The final yield of acetylated trypsin was 182 mg/L from a 5-L fermenter. Our acetylated trypsin product demonstrated higher BAEE activity (30,100 BAEE unit/mg) than a commercial product (9500 BAEE unit/mg, Promega). It also demonstrated resistance to autolysis. This is the first report of production of acetylated recombinant trypsin that is stable and suitable for scale-up. Copyright © 2015 Elsevier Inc. All rights reserved.

[Construction and eukaryotic expression of PVAX1-hPV58mE6E7fcGB composite gene vaccine].

PubMed

Wang, He; Yu, Jiyun; Li, Li

2013-10-01

To construct and express a composite gene vaccine for human papillomavirus 58(HPV58)-associated cervical cancer, we inserted HPV58mE6E7 fusion gene into pCI-Fc-GPI eukaryotic expression vector, constructing a recombinant plasmid named pCI-sig-HPV58mE6E7-Fc-GPI. Then we further inserted fragment of sig-HPV58mE6E7Fc-GPI into the novel vaccine vector PVAX1-IRES-GM/B7, constructing PVAX1-HPV58mE6E7FcGB composite gene vaccine. PVAX1-HPV58mE6E7FcGB vaccine was successfully constructed and identified by restriction endonuclease and sequencing analysis. Eukaryotic expression of fusion antigen sig-HPV58mE6E7-Fc-GPI and molecular ad-juvant GM-CSF and B7. 1 were proved to be realized at the same time by flow cytometry and immunofluorescence. So PVAX1-HPV58mE6E7FcGB can be taken as a candidate of therapeutic vaccine for HPV58-associated tumors and their precancerous transformations.

Fine-tuning synthesis of Yersinia pestis LcrV from runaway-like replication balanced-lethal plasmid in a Salmonella enterica serovar typhimurium vaccine induces protection against a lethal Y. pestis challenge in mice.

PubMed

Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M; Branger, Christine G; Tinge, Steven A; Curtiss, Roy

2010-06-01

A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal DeltaasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain chi9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/P(cro)) (P(R)), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC P(BAD) c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of beta-lactamase, and cloned into pYA4534 under the control of the P(trc) promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain chi9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route.

Fine-Tuning Synthesis of Yersinia pestis LcrV from Runaway-Like Replication Balanced-Lethal Plasmid in a Salmonella enterica Serovar Typhimurium Vaccine Induces Protection against a Lethal Y. pestis Challenge in Mice▿

PubMed Central

Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M.; Branger, Christine G.; Tinge, Steven A.; Curtiss, Roy

2010-01-01

A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal ΔasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain χ9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/Pcro) (PR), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC PBAD c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of β-lactamase, and cloned into pYA4534 under the control of the Ptrc promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain χ9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route. PMID:20308296

Viral load and clinical disease enhancement associated with a lentivirus cytotoxic T lymphocyte vaccine regimen

PubMed Central

Mealey, Robert H.; Leib, Steven R.; Littke, Matt H.; Wagner, Bettina; Horohov, David W.; McGuire, Travis C.

2009-01-01

Effective DNA-based vaccines against lentiviruses will likely induce CTL against conserved viral proteins. Equine infectious anemia virus (EIAV) infects horses worldwide, and serves as a useful model for lentiviral immune control. Although attenuated live EIAV vaccines have induced protective immune responses, DNA-based vaccines have not. In particular, DNA-based vaccines have had limited success in inducing CTL responses against intracellular pathogens in the horse. We hypothesized that priming with a codon-optimized plasmid encoding EIAV Gag p15/p26 with co-administration of a plasmid encoding an equine IL-2/IgG fusion protein as a molecular adjuvant, followed by boosting with a vaccinia vector expressing Gag p15/p26, would induce protective Gag-specific CTL responses. Although the regimen induced Gag-specific CTL in four of seven vaccinated horses, CTL were not detected until after the vaccinia boost, and protective effects were not observed in EIAV challenged vaccinates. Unexpectedly, vaccinates had significantly higher viral loads and more severe clinical disease, associated with the presence of vaccine-induced CTL. It was concluded that 1.) further optimization of the timing and route of DNA immunization was needed for efficient CTL priming in vivo, 2.) co-administration of the IL-2/IgG plasmid did not enhance CTL priming by the Gag p15/p26 plasmid, 3.) vaccinia vectors are useful for lentivirus-specific CTL induction in the horse, 4.) Gag-specific CTL alone are either insufficient or a more robust Gag-specific CTL response is needed to limit EIAV viremia and clinical disease, and 5.) CTL-inducing vaccines lacking envelope immunogens can result in lentiviral disease enhancement. Although the mechanisms for enhancement associated with this vaccine regimen remain to be elucidated, these results have important implications for development of lentivirus T cell vaccines. PMID:19368787

[Expression and Preliminary Research on the Soluble Domain of EV-D68 3A Protein].

PubMed

Li, Ting; Kong, Jia; Yu, Xiao-fang; Han, Xue

2015-11-01

To understand the structure of the soluble region of Enterovirus 68 3A protein, we construct a prokaryotic expression vector expressing the soluble region of EV-D68 3A protein, and identify the forms of expression product after purification. The EV-D68 3A(1-61) gene was amplified by PCR and then cloned into the expression vector pET-28a-His-SUMO. The recombinant plasmid was transformed into Escherichia coli BL21 induced by IPTG to express the fusion protein His-SUMO-3A(1-61). The recombinant protein was purified by Ni-NTA Agarose and cleaved by ULP Protease to remove His-SUMO tag. After that, the target protein 3A(1-61) was purified by a series of purification methods such as Ni-NTA, anion exchange chromatography and gel filtration chromato- graphy. Chemical cross-linking reaction assay was taken to determine the multiple polymerization state of the 3A soluble region. A prokaryotic expression vector pET28a-His-SUMO-3A(1-61) expressing the solution region of EV-D68 3A was successfully constructed and plenty of highly pure target proteins were obtained by multiple purification steps . The total protein amount was about 5 mg obtained from 1L Escherichia coli BL21 with purity > 95%. At the same time, those results determined the homomultimer form of soluble 3A construct. These data demonstrated that the expression and purification system of the soluble region of 3A were successfully set up and provide some basic konwledge for the research about 3A crystal structure and the development of antiviral drugs targeted at 3A to block viral replication.

In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56.

PubMed

Chen, Qiang; Fischer, Joshua R; Benoit, Vivian M; Dufour, Nicholas P; Youderian, Philip; Leong, John M

2008-12-01

Borrelia burgdorferi is the causative agent of Lyme disease, the most common vector-borne illness in the Northern hemisphere. Low-passage-number infectious strains of B. burgdorferi exhibit extremely low transformation efficiencies-so low, in fact, as to hinder the genetic study of putative virulence factors. Two putative restriction-modification (R-M) systems, BBE02 contained on linear plasmid 25 (lp25) and BBQ67 contained on lp56, have been postulated to contribute to this poor transformability. Restriction barriers posed by other bacteria have been overcome by the in vitro methylation of DNA prior to transformation. To test whether a methylation-sensitive restriction system contributes to poor B. burgdorferi transformability, shuttle plasmids were treated with the CpG methylase M.SssI prior to the electroporation of a variety of strains harboring different putative R-M systems. We found that for B. burgdorferi strains that harbor lp56, in vitro methylation increased transformation by at least 1 order of magnitude. These results suggest that in vitro CpG methylation protects exogenous DNA from degradation by an lp56-contained R-M system, presumably BBQ67. The utility of in vitro methylation for the genetic manipulation of B. burgdorferi was exemplified by the ease of plasmid complementation of a B. burgdorferi B31 A3 BBK32 kanamycin-resistant (B31 A3 BBK32::Kan(r)) mutant, deficient in the expression of the fibronectin- and glycosaminoglycan (GAG)-binding adhesin BBK32. Consistent with the observation that several surface proteins may promote GAG binding, the B. burgdorferi B31 A3 BBK32::Kan(r) mutant demonstrated no defect in the ability to bind purified GAGs or GAGs expressed on the surfaces of cultured cells.

Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum.

PubMed

Alvarez, B; Secades, P; McBride, M J; Guijarro, J A

2004-01-01

Flavobacterium psychrophilum, a member of the Cytophaga-Flavobacterium-Bacteroides group, is an important pathogen of salmonid fish. Previous attempts to develop genetic techniques for this fastidious, psychrotrophic bacterium have met with failure. Here we describe the development of techniques for the genetic manipulation of F. psychrophilum and the identification of plasmids, selectable markers, a reporter system, and a transposon that function in several isolates of this fish pathogen. The antibiotic resistance genes ermF, cfxA, and tetQ function in F. psychrophilum. Cloning vectors based on the F. psychrophilum cryptic plasmid pCP1 which carried these selectable markers were introduced by conjugation from E. coli, resulting in antibiotic-resistant colonies of F. psychrophilum. Conjugative transfer of DNA into F. psychrophilum was strain dependent. Efficient transfer was observed for two of the seven strains tested (THC02-90 and THC04-90). E. coli lacZY functioned in F. psychrophilum when expressed from a pCP1 promoter, allowing its development as a reporter for studies of gene expression. Plasmids isolated from F. psychrophilum were efficiently introduced into F. psychrophilum by electroporation, but plasmids isolated from E. coli were not suitable for transfer by this route, suggesting the presence of a restriction barrier. DNA isolated from F. psychrophilum was resistant to digestion by Sau3AI and BamHI, indicating that a Sau3AI-like restriction modification system may constitute part of this barrier. Tn4351 was introduced into F. psychrophilum from E. coli and transposed with apparent randomness, resulting in erythromycin-resistant colonies. The techniques developed in this study allow for genetic manipulation and analysis of this important fish pathogen.

Ultraviolet mutagenesis in a plasmid vector replicated in lymphoid cells from patient with the melanoma-prone disorder dysplastic nevus syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seetharam, S.; Waters, H.L.; Seidman, M.M.

The hereditary dysplastic nevus syndrome (DNS) is an autosomal dominant disorder in which affected individuals have increased numbers of dysplastic (premalignant) nevi and a greater than 100-fold increased risk of developing cutaneous melanoma. Epstein-Barr virus-transformed lymphoblastoid cell lines from patients with hereditary DNS have been shown to be hypermutable to UV radiation. To examine the mechanism involved in this UV hypermutability, we used a shuttle vector plasmid, pZ189, which carries a 160-base pair marker gene, supF, and can replicate in human cells. pZ189 was treated with UV radiation and transfected into DNS6BE, a lymphoblastoid cell line from a patient withmore » hereditary DNS. Plasmid survival after UV was similar with the DNS6BE line and with a lymphoblastoid cell line from a normal donor. Plasmid mutation frequency was greater with the DNS line in accord with the DNS cellular hypermutability. Base sequence analysis was performed on 69 mutated plasmids recovered from the DNS line. There were significantly more plasmids with single base substitution mutations (P less than 0.01) in comparison to UV-treated plasmids passed through normal fibroblasts. pZ189 hypermutability and an increased frequency of single base substitutions was previously found with a cell line from a melanoma-prone xeroderma pigmentosum patient. These differences may be related to the increased melanoma susceptibility in both DNS and xeroderma pigmentosum.« less

Manipulation for plasmid elimination by transforming synthetic competitors diversifies lactococcus lactis starters applicable to food products.

PubMed

Kobayashi, Miho; Nomura, Masaru; Kimoto, Hiromi

2007-11-01

This study was designed selectively to eliminate a theta-plasmid from Lactococcus lactis strains by transforming synthetic competitors. A shuttle vector for Escherichia coli and L. lactis, pDB1, was constructed by ligating a partial replicon of pDR1-1B, which is a 7.3 kb theta-plasmid in L. lactis DRC1, with an erythromycin resistance gene into pBluescript II KS(+). This versatile vector was used to construct competitors to common lactococcal theta-plasmids. pDB1 contains the 5' half of the replication origin and the 3' region of repB of pDR1-1B, but lacks the 1.1-kb region normally found between these two segments. A set of primers, Pv3 and Pv4, was designed to amplify the 1.1-kb middle parts of the general theta-replicons of lactococcal plasmids. When the PCR products were cloned into the Nru I and Xho I sites of pDB1, synthetic replicons were constructed and replication activity was restored. A number of theta-plasmids in L. lactis ssp. lactis and cremoris were eliminated selectively by transforming the synthetic competitors. These competitors were easily eliminated by subculture for a short time in the absence of selection. The resulting variants contained no exogenous DNA and are suitable for food products, since part of the phenotype was altered without altering other plasmids indispensable for fermentation.

Novel Antigen Identification Method for Discovery of Protective Malaria Antigens by Rapid Testing of DNA Vaccines Encoding Exons from the Parasite Genome

PubMed Central

Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.

2004-01-01

We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966

Cloning of the citrate permease gene of Lactococcus lactis subsp. lactis biovar diacetylactis and expression in Escherichia coli.

PubMed Central

Sesma, F; Gardiol, D; de Ruiz Holgado, A P; de Mendoza, D

1990-01-01

The citrate plasmid (Cit+ plasmid) from Lactococcus lactis subsp. lactis biovar diacetylactis was cloned into the EcoRI site of plasmid pUC18. This recombinant plasmid enabled Escherichia coli K-12 to transport and utilize citrate as a source of energy, indicating expression of the citrate permease from L. lactis biovar diacetylactis. The citrate permease was under the control of the lac promoter of pUC18. Genetic expression of the Cit+ plasmid in maxicells revealed that the plasmid encoded two polypeptides of 47 and 32 kilodaltons, determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2117878

[Construction and function identification of luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR].

PubMed

Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min

2016-01-01

This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.

Expression of the Bacillus anthracis protective antigen gene by baculovirus and vaccinia virus recombinants.

PubMed Central

Iacono-Connors, L C; Schmaljohn, C S; Dalrymple, J M

1990-01-01

The gene encoding Bacillus anthracis protective antigen (PA) was modified by site-directed mutagenesis, subcloned into baculovirus and vaccinia virus plasmid transfer vectors (pAcYM1 and pSC-11, respectively), and inserted via homologous recombinations into baculovirus Autographa californica nuclear polyhedrosis virus or vaccinia virus (strains WR and Connaught). Expression of PA was detected in both systems by immunofluorescence assays with antisera from rabbits immunized with B. anthracis PA. Western blot (immunoblot) analysis showed that the expressed product of both systems was slightly larger (86 kilodaltons) than B. anthracis-produced PA (83.5 kilodaltons). Analysis of trypsin digests of virus-expressed and authentic PA suggested that the size difference was due to the presence of a signal sequence remaining with the virus-expressed protein. Immunization of mice with either recombinant baculovirus-infected Spodoptera frugiperda cells or with vaccinia virus recombinants elicited a high-titer, anti-PA antibody response. Images PMID:2105271

Expression of enhancing-activity-free neutralizing antibody against dengue type 1 virus in plasmid-inoculated mice.

PubMed

Yamanaka, Atsushi; Pitaksajjakul, Pannamthip; Ramasoota, Pongrama; Konishi, Eiji

2015-11-09

Most candidate dengue vaccines currently under development induce neutralizing antibodies, which are considered important for immunoprotection. However, the concomitant induction of infection-enhancing antibodies is an unavoidable concern. In contrast, a neutralizing antibody developed for passive immunotherapy has been engineered to eliminate its enhancing activity. Therefore, a strategy for the long-term expression of enhancing-activity-free neutralizing antibodies may resolve this concern. A mouse monoclonal antibody, 7F4, of the IgG3 subclass and with no detectable enhancing activity, was selected as the model neutralizing antibody to evaluate the potential of this strategy. Equal amounts of commercial vector (pFUSE)-based plasmids containing 7F4 heavy (H)- or light (L)-chain variable region genes were mixed and used for the cotransfection of 293T cells and co-delivery into ICR and BALB/c mice. The recombinant plasmids were designed to express IgG2b or IgG3 subclass antibodies (p7F4G2b or p7F4G3, respectively). 293T cells transfected with 2 μg of p7F4G2b or p7F4G3 produced approximately 15,000 or 800 ng/ml IgG in the culture fluids, respectively. The dose is expressed as the total amount of H- and L-chain plasmids. Neutralizing antibody was detected dose-dependently in ICR mice inoculated with 50-200 μg of p7F4G2b. A 1:2 dilution of sera from ICR and BALB/c mice inoculated with 100 μg of p7F4G3 showed average plaque reduction levels of >70% on day 3 and >90% on days 5-9. BALB/c mice maintained detectable neutralizing antibody for at least 3 months. The neutralizing antibody expressed by p7F4G3 in mice showed no enhancing activity. Although the expression of neutralizing antibodies from immunoglobulin genes is a type of passive immunization, its durability can be utilized as a dengue vaccine strategy. This "proof-of-concept" study using a mouse model demonstrates that the enhancing-activity-free characteristic of this strategy augurs well for dengue vaccine development, although further improvement is required. Copyright © 2015 Elsevier Ltd. All rights reserved.

Co-expression of hepatitis C virus polytope-HBsAg and p19-silencing suppressor protein in tobacco leaves.

PubMed

Mohammadzadeh, Sara; Roohvand, Farzin; Memarnejadian, Arash; Jafari, Anis; Ajdary, Soheila; Salmanian, Ali-Hatef; Ehsani, Parastoo

2016-01-01

Plants transformed by virus-based vectors have emerged as promising tools to rapidly express large amounts and inexpensive antigens in transient condition. We studied the possibility of transient-expression of an HBsAg-fused polytopic construct (HCVpc) [containing H-2d and HLA-A2-restricted CD8+CTL-epitopic peptides of C (Core; aa 132-142), E6 (Envelope2; aa 614-622), N (NS3; aa 1406-1415), and E4 (Envelope2; aa 405-414) in tandem of CE6NE4] in tobacco (Nicotiana tabacum) leaves for the development of a plant-based HCV vaccine. A codon-optimized gene encoding the Kozak sequence, hexahistidine (6×His)-tag peptide, and HCVpc in tandem was designed, chemically synthesized, fused to HBsAg gene, and inserted into Potato virus X (PVX-GW) vector under the control of duplicated PVX coat protein promoter (CPP). The resulted recombinant plasmids (after confirmation by restriction and sequencing analyses) were transferred into Agrobacterium tumefaciens strain GV3101 and vacuum infiltrated into tobacco leaves. The effect of gene-silencing suppressor, p19 protein from tomato bushy stunt virus, on the expression yield of HCVpc-HBsAg was also evaluated by co-infiltration of a p19 expression vector. Codon-optimized gene increased adaptation index (CAI) value (from 0.61 to 0.92) in tobacco. The expression of the HCVpc-HBsAg was confirmed by western blot and HBsAg-based detection ELISA on total extractable proteins of tobacco leaves. The expression level of the fusion protein was significantly higher in p19 co-agroinfiltrated plants. The results indicated the possibility of expression of HCVpc-HBsAg constructs with proper protein conformations in tobacco for final application as a plant-derived HCV vaccine.

[Construction and prokaryotic expression of recombinant gene EGFRvIII HBcAg and immunogenicity analysis of the fusion protein].

PubMed

Duan, Xiao-yi; Wang, Jian-sheng; Guo, You-min; Han, Jun-li; Wang, Quan-ying; Yang, Guang-xiao

2007-01-01

To construct recombinant prokaryotic expression plasmid pET28a(+)/c-PEP-3-c and evaluate the immunogenicity of the fusion protein. cDNA fragment encoding PEP-3 was obtained from pGEM-T Easy/PEP-3 and inserted into recombinant plasmid pGEMEX/HBcAg. Then it was subcloned in prokaryotic expression vector and transformed into E.coli BL21(DE3). The fusion protein was expressed by inducing IPTG and purified by Ni(2+)-NTA affinity chromatography. BALB/c mice were immunized with fusion protein and the antibody titre was determined by indirect ELISA. The recombinant gene was confirmed to be correct by restriction enzyme digestion and DNA sequencing. After prokaryotic expression, fusion protein existed in sediment and accounted for 56% of all bacterial lysate. The purified product accounted for 92% of all protein and its concentration was 8 g/L. The antibody titre in blood serum reached 1:16 000 after the fourth immunization and reached 1:2.56x10(5) after the sixth immunization. The titre of anti-PEP-3 antibody reached 1:1.28x10(5) and the titre of anti-HBcAg antibody was less than 1:4x10(3). Fusion gene PEP-3-HBcAg is highly expressed in E.coli BL21. The expressed fusion protein can induce neutralizing antibody with high titer and specificity, which lays a foundation for the study of genetically engineering vaccine for malignant tumors with the high expression of EGFRvIII.

Design and characterization of plasmids encoding antigenic peptides of Aha1 from Aeromonas hydrophila as prospective fish vaccines.

PubMed

Rauta, Pradipta R; Nayak, Bismita; Monteiro, Gabriel A; Mateus, Marília

2017-01-10

The current investigation aimed at designing DNA vaccines against Aeromonas hydrophila infections. The DNA vaccine candidates were designed to express two antigenic outer membrane protein (Aha1) peptides and to be delivered by a nanoparticle-based delivery system. Gene sequences of conserved regions of antigenic Aha1 [aha1(211-381), aha1(211-381)opt, aha1(703-999) and aha1(703-999)opt] were cloned into pVAX-GFP expression vector. The selected DNA vaccine candidates were purified from E. coli DH5α and transfected into Chinese hamster ovary cells. The expression of the antigenic peptides was measured in cells along post-transfection time, through the fluorescence intensity of the reporter GFP. The lipofection efficiency of aha-pVAX-GFP was highest after 24h incubation. Formulated PLGA-chitosan nanoparticle/plasmid DNA complexes were characterized in terms of size, size distribution and zeta potential. Nanocomplexes with average diameters in the range of 150-170nm transfected in a similar fashion into CHO cells confirmed transfection efficiency comparable to that of lipofection. DNA entrapment and further DNase digestion assays demonstrated ability for pDNA protection by the nanoparticles against enzymatic digestion. Copyright © 2016 Elsevier B.V. All rights reserved.

Receptor-mediated transfer of pSV2CAT DNA to mouse liver cells using asialofetuin-labeled liposomes.

PubMed

Hara, T; Aramaki, Y; Takada, S; Koike, K; Tsuchiya, S

1995-12-01

Asialofetuin-labeled liposomes (AF-liposomes) were developed as a nonviral vector having high transfection activity for receptor-mediated gene transfer to hepatocytes by systemic administration. Initially, the majority of pSV2CAT, a chloramphenicol acetyltransferase (CAT) gene expression plasmid, was associated with AF-liposomes (AF-liposome-pSV2CAT), and they were injected into the portal vein of an adult mouse. Significantly high CAT activity was observed in the liver. The CAT activity in the liver was further increased two-fold by using AF-liposomes completely encapsulating pSV2CAT. Nonlabeled control liposomes, on the other hand, showed lower CAT activity in the liver than in the spleen or lung. The level of CAT mRNA reflected the CAT activity obtained by each liposome preparation in each tissue. Immunohistochemical staining showed that CAT was produced in a large number of parenchymal cells localizing in the periportal area. The plasmid encapsulated in the internal aqueous layer of the liposomes was effectively protected from environmental degradation. Thus, by administration into the blood circulation, AF-liposomes would be successfully incorporated into hepatocytes through receptor-mediated endocytosis, and the encapsulated plasmid would be transferred to the intracellular pathway.

Cationized pullulan 3D matrices as new materials for gene transfer.

PubMed

San Juan, Aurélie; Hlawaty, Hanna; Chaubet, Frédéric; Letourneur, Didier; Feldman, Laurent J

2007-08-01

This study deals with the development of a novel biocompatible cationized pullulan three-dimensional matrix for gene delivery. A water-soluble cationic polysaccharide, diethylaminoethyl-pullulan (DEAE-pullulan), was first synthesized and characterized. Fluorescence quenching and gel retardation assays evidenced the complexation in solution of DNA with DEAE-pullulan, but not with neutral pullulan. On cultured smooth muscle cells (SMCs) incubated with DEAE-pullulan and a plasmid vector expressing a secreted form of alkaline phosphatase (pSEAP), SEAP activity was 150-fold higher than with pSEAP alone or pSEAP with neutral pullulan. DEAE-pullulan was then chemically crosslinked using phosphorus oxychloride. The resulting matrices were obtained in less than a minute and molded as discs of 12 mm diameter and 2 mm thickness. Such DEAE-pullulan 3D matrices were loaded with up to 50 microg of plasmid DNA, with a homogeneous plasmid loading observed with YOYO-1 fluorescence staining. Moreover, the DEAE-pullulan matrix was shown to protect pSEAP from DNase I degradation. Incubation of cultured SMCs with pSEAP-loaded DEAE-pullulan matrices resulted in significant gene transfer without cell toxicity. This study suggests that these cationized pullulan 3D matrices could be useful biomaterials for local gene transfer.

The ability of a collagen/calcium phosphate scaffold to act as its own vector for gene delivery and to promote bone formation via transfection with VEGF(165).

PubMed

Keeney, Michael; van den Beucken, Jeroen J J P; van der Kraan, Peter M; Jansen, John A; Pandit, Abhay

2010-04-01

Collagen/calcium phosphate scaffolds have been used for bone reconstruction due to their inherent similarities to the bone extracellular matrix. Calcium phosphate alone has also been used as a non-viral vector for gene delivery. The aim of this study was to determine the capability of a collagen/calcium phosphate scaffold to deliver naked plasmid DNA and mediate transfection in vivo. The second goal of the study was to deliver a plasmid encoding vascular endothelial growth factor(165) (pVEGF(165)) to promote angiogenesis, and hence bone formation, in a mouse intra-femoral model. The delivery of naked plasmid DNA resulted in a 7.6-fold increase in mRNA levels of beta-Galactosidase compared to the delivery of plasmid DNA complexed with a partially degraded PAMAM dendrimer (dPAMAM) in a subcutaneous murine model. When implanted in a muirne intra-femoral model, the delivery of pVEGF(165) resulted in a 2-fold increase in bone volume at the defect site relative to control scaffolds without pVEGF(165). It was concluded that a collagen/calcium phosphate scaffold can mediate transfection without the use of additional transfection vectors and can promote bone formation in a mouse model via the delivery of pVEGF(165). 2009 Elsevier Ltd. All rights reserved.

Cell-Penetrating Peptide-Mediated Delivery of Cas9 Protein and Guide RNA for Genome Editing.

PubMed

Suresh, Bharathi; Ramakrishna, Suresh; Kim, Hyongbum

2017-01-01

The clustered, regularly interspaced, short palindromic repeat (CRISPR)-associated (Cas) system represents an efficient tool for genome editing. It consists of two components: the Cas9 protein and a guide RNA. To date, delivery of these two components has been achieved using either plasmid or viral vectors or direct delivery of protein and RNA. Plasmid- and virus-free direct delivery of Cas9 protein and guide RNA has several advantages over the conventional plasmid-mediated approach. Direct delivery results in shorter exposure time at the cellular level, which in turn leads to lower toxicity and fewer off-target mutations with reduced host immune responses, whereas plasmid- or viral vector-mediated delivery can result in uncontrolled integration of the vector sequence into the host genome and unwanted immune responses. Cell-penetrating peptide (CPP), a peptide that has an intrinsic ability to translocate across cell membranes, has been adopted as a means of achieving efficient Cas9 protein and guide RNA delivery. We developed a method for treating human cell lines with CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs that leads to endogenous gene disruption. Here we describe a protocol for preparing an efficient CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs, as well as treatment methods to achieve safe genome editing in human cell lines.

Construction of a Schizosaccharomyces pombe gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.

PubMed

Beach, D; Piper, M; Nurse, P

1982-01-01

A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.

Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization

NASA Astrophysics Data System (ADS)

Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.

1995-10-01

Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.

Sleeping Beauty transposon-based system for rapid generation of HBV-replicating stable cell lines.

PubMed

Wu, Yong; Zhang, Tian-Ying; Fang, Lin-Lin; Chen, Zi-Xuan; Song, Liu-Wei; Cao, Jia-Li; Yang, Lin; Yuan, Quan; Xia, Ning-Shao

2016-08-01

The stable HBV-replicating cell lines, which carry replication-competent HBV genome stably integrated into the genome of host cell, are widely used to evaluate the effects of antiviral agents. However, current methods to generate HBV-replicating cell lines, which are mostly dependent on random integration of foreign DNA via plasmid transfection, are less-efficient and time-consuming. To address this issue, we constructed an all-in-one Sleeping Beauty transposon system (denoted pTSMP-HBV vector) for robust generation of stable cell lines carrying replication-competent HBV genome of different genotype. This vector contains a Sleeping Beauty transposon containing HBV 1.3-copy genome with an expression cassette of the SV40 promoter driving red fluorescent protein (mCherry) and self-cleaving P2A peptide linked puromycin resistance gene (PuroR). In addition, a PGK promoter-driven SB100X hyperactive transposase cassette is placed in the outside of the transposon in the same plasmid.The HBV-replicating stable cells could be obtained from pTSMP-HBV transfected HepG2 cells by red fluorescence-activated cell sorting and puromycin resistant cell selection within 4-week. Using this system, we successfully constructed four cell lines carrying replication-competent HBV genome of genotypes A-D. The replication and viral protein expression profiles of these cells were systematically characterized. In conclusion, our study provides a high-efficiency strategy to generate HBV-replicating stable cell lines, which may facilitate HBV-related virological study. Copyright © 2016. Published by Elsevier B.V.

Short Hairpin RNA Gene Silencing of Prolyl Hydroxylase-2 with a Minicircle Vector Improves Neovascularization of Hindlimb Ischemia

PubMed Central

Lijkwan, Maarten A.; Hellingman, Alwine A.; Bos, Ernst J.; van der Bogt, Koen E.A.; Huang, Mei; Kooreman, Nigel G.; de Vries, Margreet R.; Peters, Hendrika A.B.; Robbins, Robert C.; Quax, Paul H.A.

2014-01-01

Abstract In this study, we target the hypoxia inducible factor-1 alpha (HIF-1-alpha) pathway by short hairpin RNA interference therapy targeting prolyl hydroxylase-2 (shPHD2). We use the minicircle (MC) vector technology as an alternative for conventional nonviral plasmid (PL) vectors in order to improve neovascularization after unilateral hindlimb ischemia in a murine model. Gene expression and transfection efficiency of MC and PL, both in vitro and in vivo, were assessed using bioluminescence imaging (BLI) and firefly luciferase (Luc) reporter gene. C57Bl6 mice underwent unilateral electrocoagulation of the femoral artery and gastrocnemic muscle injection with MC-shPHD2, PL-shPHD2, or phosphate-buffered saline (PBS) as control. Blood flow recovery was monitored using laser Doppler perfusion imaging, and collaterals were visualized by immunohistochemistry and angiography. MC-Luc showed a 4.6-fold higher in vitro BLI signal compared with PL-Luc. BLI signals in vivo were 4.3×105±3.3×105 (MC-Luc) versus 0.4×105±0.3×105 (PL-Luc) at day 28 (p=0.016). Compared with PL-shPHD2 or PBS, MC-shPHD2 significantly improved blood flow recovery, up to 50% from day 3 until day 14 after ischemia induction. MC-shPHD2 significantly increased collateral density and capillary density, as monitored by alpha-smooth muscle actin expression and CD31+ expression, respectively. Angiography data confirmed the histological findings. Significant downregulation of PHD2 mRNA levels by MC-shPHD2 was confirmed by quantitative polymerase chain reaction. Finally, Western blot analysis confirmed significantly higher levels of HIF-1-alpha protein by MC-shPHD2, compared with PL-shPHD2 and PBS. This study provides initial evidence of a new potential therapeutic approach for peripheral artery disease. The combination of HIF-1-alpha pathway targeting by shPHD2 with the robust nonviral MC plasmid improved postischemic neovascularization, making this approach a promising potential treatment option for critical limb ischemia. PMID:24090375

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

Stable transformation of a mosquito cell line results in extraordinarily high copy numbers of the plasmid.

PubMed Central

Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J

1992-01-01

Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052

Plasmid Vectors for Proteomic Analyses in Giardia: Purification of Virulence Factors and Analysis of the Proteasome

PubMed Central

Stadelmann, Britta; Birkestedt, Sandra; Hellman, Ulf; Svärd, Staffan G.

2012-01-01

In recent years, proteomics has come of age with the development of efficient tools for purification, identification, and characterization of gene products predicted by genome projects. The intestinal protozoan Giardia intestinalis can be transfected, but there is only a limited set of vectors available, and most of them are not user friendly. This work delineates the construction of a suite of cassette-based expression vectors for use in Giardia. Expression is provided by the strong constitutive ornithine carbamoyltransferase (OCT) promoter, and tagging is possible in both N- and C-terminal configurations. Taken together, the vectors are capable of providing protein localization and production of recombinant proteins, followed by efficient purification by a novel affinity tag combination, streptavidin binding peptide–glutathione S-transferase (SBP-GST). The option of removing the tags from purified proteins was provided by the inclusion of a PreScission protease site. The efficiency and feasibility of producing and purifying endogenous recombinant Giardia proteins with the developed vectors was demonstrated by the purification of active recombinant arginine deiminase (ADI) and OCT from stably transfected trophozoites. Moreover, we describe the tagging, purification by StrepTactin affinity chromatography, and compositional analysis by mass spectrometry of the G. intestinalis 26S proteasome by employing the Strep II-FLAG–tandem affinity purification (SF-TAP) tag. This is the first report of efficient production and purification of recombinant proteins in and from Giardia, which will allow the study of specific parasite proteins and protein complexes. PMID:22611020

Rapid protein production from stable CHO cell pools using plasmid vector and the cumate gene-switch.

PubMed

Poulain, Adeline; Perret, Sylvie; Malenfant, Félix; Mullick, Alaka; Massie, Bernard; Durocher, Yves

2017-08-10

To rapidly produce large amounts of recombinant proteins, the generation of stable Chinese Hamster Ovary (CHO) cell pools represents a useful alternative to large-scale transient gene expression (TGE). We have developed a cell line (CHO BRI/rcTA ) allowing the inducible expression of recombinant proteins, based on the cumate gene switch. After the identification of optimal plasmid DNA topology (supercoiled vs linearized plasmid) for PEIpro™ mediated transfection and of optimal conditions for methionine sulfoximine (MSX) selection, we were able to generate CHO BRI/rcTA pools producing high levels of recombinant proteins. Volumetric productivities of up to 900mg/L were reproducibly achieved for a Fc fusion protein and up to 350mg/L for an antibody after 14days post-induction in non-optimized fed-batch cultures. In addition, we show that CHO pool volumetric productivities are not affected by a freeze-thaw cycle or following maintenance in culture for over one month in the presence of MSX. Finally, we demonstrate that volumetric protein production with the CR5 cumate-inducible promoter is three- to four-fold higher than with the human CMV or hybrid EF1α-HTLV constitutive promoters. These results suggest that the cumate-inducible CHO BRI/rcTA stable pool platform is a powerful and robust system for the rapid production of gram amounts of recombinant proteins. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Facile Recovery of Individual High-Molecular-Weight, Low-Copy-Number Natural Plasmids for Genomic Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, L.E.; Detter, C,; Barrie, K.

2006-06-01

Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less

Cyanobacterium sp. host cell and vector for production of chemical compounds in cyanobacterial cultures

DOEpatents

Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan

2014-09-30

A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.

Cyanobacterium sp. host cell and vector for production of chemical compounds in Cyanobacterial cultures

DOEpatents

Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan

2016-04-19

A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.

Human HLA-Ev (147) Expression in Transgenic Animals.

PubMed

Matsuura, R; Maeda, A; Sakai, R; Eguchi, H; Lo, P-C; Hasuwa, H; Ikawa, M; Nakahata, K; Zenitani, M; Yamamichi, T; Umeda, S; Deguchi, K; Okuyama, H; Miyagawa, S

2016-05-01

In our previous study, we reported on the development of substituting S147C for HLA-E as a useful gene tool for xenotransplantation. In this study we exchanged the codon of HLA-Ev (147), checked its function, and established a line of transgenic mice. A new construct, a codon exchanging human HLA-Ev (147) + IRES + human beta 2-microgloblin, was established. The construct was subcloned into pCXN2 (the chick beta-actin promoter and cytomegalovirus enhancer) vector. Natural killer cell- and macrophage-mediated cytotoxicities were performed using the established the pig endothelial cell (PEC) line with the new gene. Transgenic mice with it were next produced using a micro-injection method. The expression of the molecule on PECs was confirmed by the transfection of the plasmid. The established molecules on PECs functioned well in regulating natural killer cell-mediated cytotoxicity and macrophage-mediated cytotoxicity. We have also successfully generated several lines of transgenic mice with this plasmid. The expression of HLA-Ev (147) in each mouse organ was confirmed by assessing the mRNA. The chick beta-actin promoter and cytomegalovirus enhancer resulted in a relatively broad expression of the gene in each organ, and a strong expression in the cases of the heart and lung. A synthetic HLA-Ev (147) gene with a codon usage optimized to a mammalian system represents a critical factor in the development of transgenic animals for xenotransplantation. Copyright © 2016 Elsevier Inc. All rights reserved.

[Overexpression of LaeA enhances mevastatin production and reduces sporulation of Penicillium citrinum].

PubMed

Zheng, Yueliang; Cao, Shuang; Huang, Yuqi; Liao, Guojian; Hu, Changhua

2014-12-04

To study the regulation of laeA overexpression on mevastatin production and sporulation in Penicillium citrinum. We cloned the laeA gene from Penicillium citrinum and constructed the vector pGiHTGi-laeA. The plasmid pGiHTGi-laeA was transformed in Penicillium citrinum by agrobacterium tumefaciens-mediated transformation. Positive transformants were detected by cloning the hygromycin gene. The mevastatin production of the wild type and OE:: laeA was compared by HPLC. The conidia number was counted by blood counting chamber. The biosynthetic gene cluster expression quantity of mevastatin in the wild type and OE: :laeA were analyzed by qRT-PCR. We constructed the plasmid pGiHTGi-laeA, and screened the positive transformants that overexpress the laeA in Penicillium citrinum. With the overexpression of laeA, the mevastatin production was increased from (0.69 ± 0.12) mg/g to (4.02 ± 0.50) mg/g dry cell weight. Compared to the wild type strain, the laeA expression quantity in the OE :: laeA strain increased 29%, and the mlcB expression increased 72%, the mlcR expression increased 153%. Moreover, the overexpression of laeA would decrease the conidia number. Overexpression of LaeA enhances mevastatin production and reduces sporulation of Penicillium citrinum, with increases expression of pathway-regulator mlcR, and biosynthetic gene MlcR. These results could guide global regulatory mechanism of mevastatin biosynthesis and the exploitation of high-production strain.

Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bredberg, A.; Kraemer, K.H.; Seidman, M.M.

1986-11-01

A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less

Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

PubMed Central

Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

2015-01-01

The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

Pheromone-Regulated Expression of Sex Pheromone Plasmid pAD1-Encoded Aggregation Substance Depends on at Least Six Upstream Genes and a cis-Acting, Orientation-Dependent Factor

PubMed Central

Muscholl-Silberhorn, Albrecht B.

2000-01-01

Conjugative transfer of Enterococcus faecalis-specific sex pheromone plasmids relies on an adhesin, called aggregation substance, to confer a tight cell-to-cell contact between the mating partners. To analyze the dependence of pAD1-encoded aggregation substance, Asa1, on pheromone induction, a variety of upstream fragments were fused to an α-amylase reporter gene, amyL, by use of a novel promoter probe vector, pAMY-em1. For pheromone-regulated α-amylase activity, a total of at least six genes, traB, traC, traA, traE1, orfY, and orf1, are required: TraB efficiently represses asa1 (by a mechanism unrelated to its presumptive function in pheromone shutdown, since a complete shutdown is observed exclusively in the presence of traC); only traC can relieve traB-mediated repression in a pheromone-dependent manner. In addition to traB, traA is required but not sufficient for negative control. Mutational inactivation of traE1, orfY, or orf1, respectively, results in a total loss of α-amylase activity for constructs normally mediating constitutive expression. Inversion of a fragment covering traA, P0, and traE1 without disrupting any gene or control element switches off amyL or asa1 expression, indicating the involvement of a cis-acting, orientation-dependent factor (as had been shown for plasmid pCF10). Unexpectedly, pAD1 represses all pAMY-em1 derivatives in trans, while its own pheromone-dependent functions are unaffected. The discrepancy between the new data and those of former studies defining TraE1 as a trans-acting positive regulator is discussed. PMID:10850999

Development of a new vector using Soybean yellow common mosaic virus for gene function study or heterologous protein expression in soybeans.

PubMed

Lim, Seungmo; Nam, Moon; Kim, Kil Hyun; Lee, Su-Heon; Moon, Jung-Kyung; Lim, Hyoun-Sub; Choung, Myoung-Gun; Kim, Sang-Mok; Moon, Jae Sun

2016-02-01

A new vector using Soybean yellow common mosaic virus (SYCMV) was constructed for gene function study or heterologous protein expression in soybeans. The in vitro transcript with a 5' cap analog m7GpppG from an SYCMV full-length infectious vector driven by a T7 promoter infected soybeans (pSYCMVT7-full). The symptoms observed in the soybeans infected with either the sap from SYCMV-infected leaves or pSYCMVT7-full were indistinguishable, suggesting that the vector exhibits equivalent biological activity as the virus itself. To utilize the vector further, a DNA-based vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter was constructed. The complete sequence of the SYCMV genome was inserted into a binary vector flanked by a CaMV 35S promoter at the 5' terminus of the SYCMV genome and a cis-cleaving ribozyme sequence followed by a nopaline synthase terminator at the 3' terminus of the SYCMV genome (pSYCMV-full). The SYCMV-derived vector was tested for use as a virus-induced gene silencing (VIGS) vector for the functional analysis of soybean genes. VIGS constructs containing either a fragment of the Phytoene desaturase (PDS) gene (pSYCMV-PDS1) or a fragment of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) gene (pSYCMV-RbcS2) were constructed. Plants infiltrated with each vector using the Agrobacterium-mediated inoculation method exhibited distinct symptoms, such as photo-bleaching in plants infiltrated with pSYCMV-PDS1 and yellow or pale green coloring in plants infiltrated with pSYCMV-RbcS2. In addition, down-regulation of the transcripts of the two target genes was confirmed via northern blot analysis. Particle bombardment and direct plasmid DNA rubbing were also confirmed as alternative inoculation methods. To determine if the SYCMV vector can be used for the expression of heterologous proteins in soybean plants, the vector encoding amino acids 135-160 of VP1 of Foot-and-mouth disease virus (FMDV) serotype O1 Campos (O1C) was constructed (pSYCMV-FMDV). Plants infiltrated with pSYCMV-FMDV were only detected via western blotting using the O1C antibody. Based on these results, we propose that the SYCMV-derived vector can be used for gene function study or expression of useful heterologous proteins in soybeans. Copyright © 2015 Elsevier B.V. All rights reserved.

Ultrasound enhances in vivo tumor expression of plasmid DNA by PEG-introduced cationized dextran.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2005-11-28

This study is an investigation to experimentally confirm whether or not ultrasound (US) irradiation is effective in enhancing the in vivo gene expression of plasmid DNA in tumor. Dextran was cationized by introducing spermine to the hydroxyl groups to allow to polyionically complex with a plasmid DNA. The cationized dextran prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have an active ester and methoxy groups at each terminal, to obtain cationized dextran with different percentages of PEG introduced. Various cationized dextrans with or without PEG introduction were mixed with a plasmid DNA of LacZ to form cationized dextran-plasmid DNA complexes. Electrophoretical examination revealed that the plasmid DNA was complexed both with the cationized dextran and PEG-introduced cationized dextran, irrespective of the PEG introduction percentage, although the higher N/P ratio was needed for plasmid DNA complexation with the latter. By complexation with the cationized dextran, the zeta potential of plasmid DNA was changed to be positive. The charge of PEG-introduced cationized dextran-plasmid DNA complexes became close to 0 mV as their percentage of PEG introduced increased, although the molecular size was about 250 nm, irrespective of the PEG introduction. When cationized dextran-plasmid DNA complexes with or without PEG introduction were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass and the subsequent US irradiation to the tumor mass percutaneously, the PEG-introduced cationized dextran-plasmid DNA complex plus US irradiation enhanced the tumor level of gene expression to a significantly high extent compared with the cationized dextran-plasmid DNA complex and free plasmid DNA with or without US irradiation. The enhanced level depended on the time period and timing of US irradiation. Fluorescent microscopic studies revealed that the localization of plasmid DNA and the gene expression were observed in the tumor tissue injected with the PEG-introduced cationized dextran-plasmid DNA complex plus the subsequent US irradiation. We conclude that complexation with the PEG-introduced cationized dextran combined with US irradiation is a promising way to target the plasmid DNA to the tumor for gene expression.

Characterization of new plasmids from methylotrophic bacteria.

PubMed

Brenner, V; Holubová, I; Benada, O; Hubácek, J

1991-07-01

Several tens of methanol-utilizing bacterial strains isolated from soil were screened for the presence of plasmids. From the obligate methylotroph Methylomonas sp. strain R103a plasmid pIH36 (36 kb) was isolated and its restriction map was constructed. In pink-pigmented facultative methylotrophs (PPFM), belonging to the genus Methylobacterium four plasmids were detected: plasmids pIB200 (200 kb) and pIB14 (14 kb) in the strain R15d and plasmids pWU14 (14 kb) and pWU7 (7.8 kb) in the strain M17. Because of the small size and the presence of several unique REN sites (HindIII, EcoRI, NcoI), plasmid pWU7 was chosen for the construction of a vector for cloning in methylotrophs. Cointegrates pKWU7A and pKWU7B were formed between pWU7 and the E. coli plasmid pK19 Kmr, which were checked for conjugative transfer from E. coli into the methylotrophic host.

Synthesis of Metallo-β-Lactamase VIM-2 Is Associated with a Fitness Reduction in Salmonella enterica Serovar Typhimurium

PubMed Central

Cordeiro, Nicolás F.; Chabalgoity, José A.; Yim, Lucía

2014-01-01

Antibiotic resistance, especially due to β-lactamases, has become one of the main obstacles in the correct treatment of Salmonella infections; furthermore, antibiotic resistance determines a gain of function that may encompass a biological cost, or fitness reduction, to the resistant bacteria. The aim of this work was to determine in vitro if the production of the class B β-lactamase VIM-2 determined a fitness cost for Salmonella enterica serovar Typhimurium. To that end the gene blaVIM-2 was cloned into the virulent strain S. Typhimurium SL1344, using both the tightly regulated pBAD22 vector and the natural plasmid pST12, for inducible and constitutive expression, respectively. Fitness studies were performed by means of motility, growth rate, invasiveness in epithelial cells, and plasmid stability. The expression of blaVIM-2 was accompanied by alterations in micro- and macroscopic morphology and reduced growth rate and motility, as well as diminished invasiveness in epithelial cells. These results suggest that VIM-2 production entails a substantial fitness cost for S. Typhimurium, which in turn may account for the extremely low number of reports of metallo-β-lactamase-producing Salmonella spp. PMID:25136026

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Adventitious viruses in insect cell lines used for recombinant protein expression.

PubMed

Geisler, Christoph; Jarvis, Donald L

2018-04-01

Insect cells are widely used for recombinant protein expression, typically as hosts for recombinant baculovirus vectors, but also for plasmid-mediated transient transfection or stable genetic transformation. Insect cells are used to express proteins for research, as well as to manufacture biologicals for human and veterinary medicine. Recently, several insect cell lines used for recombinant protein expression were found to be persistently infected with adventitious viruses. This has raised questions about how these infections might affect research performed using those cell lines. Furthermore, these findings raised serious concerns about the safety of biologicals produced using those cell lines. In response, new insect cell lines lacking adventitious viruses have been isolated for use as improved research tools and safer biological manufacturing platforms. Here, we review the scientific and patent literature on adventitious viruses found in insect cell lines, affected cell lines, and new virus-free cell lines. Copyright © 2017 Elsevier Inc. All rights reserved.

High Efficiency Transformation of Cultured Tobacco Cells 1

PubMed Central

An, Gynheung

1985-01-01

Tobacco calli were transformed at levels up to 50% by cocultivation of tobacco cultured cells with Agrobacterium tumefaciens harboring the binary transfer-DNA vector, pGA472, containing a kanamycin resistance marker. Transformation frequency was dependent on the physiological state of the tobacco cells, the nature of Agrobacterium strain and, less so, on the expression of the vir genes of the tumor-inducing plasmid. Maximum transformation frequency was obtained with exponentially growing plant cells, suggesting that rapid growth of plant cells is an essental factor for efficient transformation of higher plants. Images Fig. 1 PMID:16664453

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stols, L.; Donnelly, M.I.; Kulkarni, G.

The malic enzyme gene of Ascaris suum was cloned into the vector pTRC99a in two forms encoding alternative amino-termini. The resulting plasmids, pMEA1 and pMEA2, were introduced into Escherichia coli NZN111, a strain that is unable to grow fermentatively because of inactivation of the genes encoding pyruvate dissimilation. Induction of pMEA1, which encodes the native animoterminus, gave better overexpression of malic enzyme, approx 12-fold compared to uninduced cells. Under the appropriate culture conditions, expression of malic enzyme allowed the fermentative dissimilation of glucose by NZN111. The major fermentation product formed in induced cultures was succinic acid.

Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

DTIC Science & Technology

1986-11-26

cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a

System and method for introduction and stabilization of genes in Thermus sp.

DOEpatents

Kayser, Kevin J.; Park, Ho-Shin; Kilbane, II, John J.

2005-03-01

A method for introducing and stabilizing heterologous and recombinant genes in a thermophilic host in which a characteristic gene defining a detectable host characteristic is inactivated or deleted from the thermophilic host, resulting in a modified thermophilic host expressing an absence of the detectable host characteristic. A DNA fragment of interest is inserted into the modified thermophilic host together with an intact characteristic gene, whereby the detectable host characteristic is restored to the thermophilic host, thereby enabling detection and confirmation of successful transformation using plasmid vectors and integration of the DNA fragment into the chromosome of the thermophilic host.