Construction and production of oncotropic vectors, derived from MVM(p), that share reduced sequence homology with helper plasmids.

PubMed

Clément, Nathalie; Velu, Thierry; Brandenburger, Annick

2002-09-01

The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis.

PubMed

Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo

2015-01-01

To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.

Plasmid P1 replication: negative control by repeated DNA sequences.

PubMed Central

Chattoraj, D; Cordes, K; Abeles, A

1984-01-01

The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pieces of the incA fragment that each contain only three repeats destabilize P1 plasmids efficiently. This result makes it unlikely that incA specifies a regulatory product. Our in vivo results suggest that the repeating DNA sequence itself negatively controls replication by titrating a P1-determined protein, RepA, that is essential for replication. Consistent with this hypothesis is the observation that the RepA protein binds to the incA fragment in vitro. Images PMID:6387706

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

PubMed Central

Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

2007-01-01

While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

Development of new plasmid DNA vaccine vectors with R1-based replicons

PubMed Central

2012-01-01

Background There has been renewed interest in biopharmaceuticals based on plasmid DNA (pDNA) in recent years due to the approval of several veterinary DNA vaccines, on-going clinical trials of human pDNA-based therapies, and significant advances in adjuvants and delivery vehicles that have helped overcome earlier efficacy deficits. With this interest comes the need for high-yield, cost-effective manufacturing processes. To this end, vector engineering is one promising strategy to improve plasmid production. Results In this work, we have constructed a new DNA vaccine vector, pDMB02-GFP, containing the runaway R1 origin of replication. The runaway replication phenotype should result in plasmid copy number amplification after a temperature shift from 30°C to 42°C. However, using Escherichia coli DH5α as a host, we observed that the highest yields of pDMB02-GFP were achieved during constant-temperature culture at 30°C, with a maximum yield of approximately 19 mg pDNA/g DCW being observed. By measuring mRNA and protein levels of the R1 replication initiator protein, RepA, we determined that RepA may be limiting pDMB02-GFP yield at 42°C. A mutant plasmid, pDMB-ATG, was constructed by changing the repA start codon from the sub-optimal GTG to ATG. In cultures of DH5α[pDMB-ATG], temperature-induced plasmid amplification was more dramatic than that observed with pDMB02-GFP, and RepA protein was detectable for several hours longer than in cultures of pDMB02-GFP at 42°C. Conclusions Overall, we have demonstrated that R1-based plasmids can produce high yields of high-quality pDNA without the need for a temperature shift, and have laid the groundwork for further investigation of this class of vectors in the context of plasmid DNA production. PMID:22889338

The use of the replication region of plasmid pRS7 from Oenococcus oeni as a putative tool to generate cloning vectors for lactic acid bacteria.

PubMed

Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M

2015-01-01

A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.

Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression

PubMed Central

Camps, Manel

2010-01-01

ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961

Characterization of a Theta-Type Plasmid from Lactobacillus sakei: a Potential Basis for Low-Copy-Number Vectors in Lactobacilli

PubMed Central

Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique

2003-01-01

The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947

Copy number variability of expression plasmids determined by cell sorting and Droplet Digital PCR.

PubMed

Jahn, Michael; Vorpahl, Carsten; Hübschmann, Thomas; Harms, Hauke; Müller, Susann

2016-12-19

Plasmids are widely used for molecular cloning or production of proteins in laboratory and industrial settings. Constant modification has brought forth countless plasmid vectors whose characteristics in terms of average plasmid copy number (PCN) and stability are rarely known. The crucial factor determining the PCN is the replication system; most replication systems in use today belong to a small number of different classes and are available through repositories like the Standard European Vector Architecture (SEVA). In this study, the PCN was determined in a set of seven SEVA-based expression plasmids only differing in the replication system. The average PCN for all constructs was determined by Droplet Digital PCR and ranged between 2 and 40 per chromosome in the host organism Escherichia coli. Furthermore, a plasmid-encoded EGFP reporter protein served as a means to assess variability in reporter gene expression on the single cell level. Only cells with one type of plasmid (RSF1010 replication system) showed a high degree of heterogeneity with a clear bimodal distribution of EGFP intensity while the others showed a normal distribution. The heterogeneous RSF1010-carrying cell population and one normally distributed population (ColE1 replication system) were further analyzed by sorting cells of sub-populations selected according to EGFP intensity. For both plasmids, low and highly fluorescent sub-populations showed a remarkable difference in PCN, ranging from 9.2 to 123.4 for ColE1 and from 0.5 to 11.8 for RSF1010, respectively. The average PCN determined here for a set of standardized plasmids was generally at the lower end of previously reported ranges and not related to the degree of heterogeneity. Further characterization of a heterogeneous and a homogeneous population demonstrated considerable differences in the PCN of sub-populations. We therefore present direct molecular evidence that the average PCN does not represent the true number of plasmid molecules in individual cells.

Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria

PubMed Central

Taton, Arnaud; Unglaub, Federico; Wright, Nicole E.; Zeng, Wei Yue; Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian; Peterson, Todd C.; Haerizadeh, Farzad; Golden, Susan S.; Golden, James W.

2014-01-01

Inspired by the developments of synthetic biology and the need for improved genetic tools to exploit cyanobacteria for the production of renewable bioproducts, we developed a versatile platform for the construction of broad-host-range vector systems. This platform includes the following features: (i) an efficient assembly strategy in which modules released from 3 to 4 donor plasmids or produced by polymerase chain reaction are assembled by isothermal assembly guided by short GC-rich overlap sequences. (ii) A growing library of molecular devices categorized in three major groups: (a) replication and chromosomal integration; (b) antibiotic resistance; (c) functional modules. These modules can be assembled in different combinations to construct a variety of autonomously replicating plasmids and suicide plasmids for gene knockout and knockin. (iii) A web service, the CYANO-VECTOR assembly portal, which was built to organize the various modules, facilitate the in silico construction of plasmids, and encourage the use of this system. This work also resulted in the construction of an improved broad-host-range replicon derived from RSF1010, which replicates in several phylogenetically distinct strains including a new experimental model strain Synechocystis sp. WHSyn, and the characterization of nine antibiotic cassettes, four reporter genes, four promoters, and a ribozyme-based insulator in several diverse cyanobacterial strains. PMID:25074377

A new series of yeast shuttle vectors for the recovery and identification of multiple plasmids from Saccharomyces cerevisiae.

PubMed

Frazer, LilyAnn Novak; O'Keefe, Raymond T

2007-09-01

The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.

Ultra-low background DNA cloning system.

PubMed

Goto, Kenta; Nagano, Yukio

2013-01-01

Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

An improved ternary vector system for Agrobacterium-mediated rapid maize transformation.

PubMed

Anand, Ajith; Bass, Steven H; Wu, Emily; Wang, Ning; McBride, Kevin E; Annaluru, Narayana; Miller, Michael; Hua, Mo; Jones, Todd J

2018-05-01

A simple and versatile ternary vector system that utilizes improved accessory plasmids for rapid maize transformation is described. This system facilitates high-throughput vector construction and plant transformation. The super binary plasmid pSB1 is a mainstay of maize transformation. However, the large size of the base vector makes it challenging to clone, the process of co-integration is cumbersome and inefficient, and some Agrobacterium strains are known to give rise to spontaneous mutants resistant to tetracycline. These limitations present substantial barriers to high throughput vector construction. Here we describe a smaller, simpler and versatile ternary vector system for maize transformation that utilizes improved accessory plasmids requiring no co-integration step. In addition, the newly described accessory plasmids have restored virulence genes found to be defective in pSB1, as well as added virulence genes. Testing of different configurations of the accessory plasmids in combination with T-DNA binary vector as ternary vectors nearly doubles both the raw transformation frequency and the number of transformation events of usable quality in difficult-to-transform maize inbreds. The newly described ternary vectors enabled the development of a rapid maize transformation method for elite inbreds. This vector system facilitated screening different origins of replication on the accessory plasmid and T-DNA vector, and four combinations were identified that have high (86-103%) raw transformation frequency in an elite maize inbred.

Development of plasmid vector and electroporation condition for gene transfer in sporogenic lactic acid bacterium, Bacillus coagulans.

PubMed

Rhee, Mun Su; Kim, Jin-Woo; Qian, Yilei; Ingram, L O; Shanmugam, K T

2007-07-01

Bacillus coagulans is a sporogenic lactic acid bacterium that ferments glucose and xylose, major components of plant biomass, a potential feedstock for cellulosic ethanol. The temperature and pH for optimum rate of growth of B. coagulans (50 to 55 degrees C, pH 5.0) are very similar to that of commercially developed fungal cellulases (50 degrees C; pH 4.8). Due to this match, simultaneous saccharification and fermentation (SSF) of cellulose to products by B. coagulans is expected to require less cellulase than needed if the SSF is conducted at a sub-optimal temperature, such as 30 degrees C, the optimum for yeast, the main biocatalyst used by the ethanol industry. To fully exploit B. coagulans as a platform organism, we have developed an electroporation method to transfer plasmid DNA into this genetically recalcitrant bacterium. We also constructed a B. coagulans/E. coli shuttle vector, plasmid pMSR10 that contains the rep region from a native plasmid (pMSR0) present in B. coagulans strain P4-102B. The native plasmid, pMSR0 (6823bp), has 9 ORFs, and replicates by rolling-circle mode of replication. Plasmid pNW33N, developed for Geobacillus stearothermophilus, was also transformed into this host and stably maintained while several other Bacillus/Escherichia coli shuttle vector plasmids were not transformed into B. coagulans. The transformation efficiency of B. coagulans strain P4-102B using the plasmids pNW33N or pMSR10 was about 1.5x10(16) per mole of DNA. The availability of shuttle vectors and an electroporation method is expected to aid in genetic and metabolic engineering of B. coagulans.

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

Characterization of a minimal pKW2124 replicon from Weissella cibaria KLC140 and its application for the construction of the Weissella expression vector pKUCm1

PubMed Central

Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon

2015-01-01

A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882

GeneGuard: A modular plasmid system designed for biosafety.

PubMed

Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom

2015-03-20

Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.

Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.

PubMed

Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel

2018-06-16

ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

Construction of novel shuttle expression vectors for gene expression in Bacillus subtilis and Bacillus pumilus.

PubMed

Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong

2015-01-01

A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.

A stable shuttle vector system for efficient genetic complementation of Helicobacter pylori strains by transformation and conjugation.

PubMed

Heuermann, D; Haas, R

1998-03-01

A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.

Identification of three extra-chromosomal replicons in Leptospira pathogenic strain and development of new shuttle vectors.

PubMed

Zhu, Weinan; Wang, Jin; Zhu, Yongzhang; Tang, Biao; Zhang, Yunyi; He, Ping; Zhang, Yan; Liu, Boyu; Guo, Xiaokui; Zhao, Guoping; Qin, Jinhong

2015-02-15

The genome of pathogenic Leptospira interrogans contains two chromosomes. Plasmids and prophages are known to play specific roles in gene transfer in bacteria and can potentially serve as efficient genetic tools in these organisms. Although plasmids and prophage remnants have recently been reported in Leptospira species, their characteristics and potential applications in leptospiral genetic transformation systems have not been fully evaluated. Three extrachromosomal replicons designated lcp1 (65,732 bp), lcp2 (56,757 bp), and lcp3 (54,986 bp) in the L. interrogans serovar Linhai strain 56609 were identified through whole genome sequencing. All three replicons were stable outside of the bacterial chromosomes. Phage particles were observed in the culture supernatant of 56609 after mitomycin C induction, and lcp3, which contained phage-related genes, was considered to be an inducible prophage. L. interrogans-Escherichia coli shuttle vectors, constructed with the predicted replication elements of single rep or rep combined with parAB loci from the three plasmids were shown to successfully transform into both saprophytic and pathogenic Leptospira species, suggesting an essential function for rep genes in supporting auto-replication of the plasmids. Additionally, a wide distribution of homologs of the three rep genes was identified in L. interrogans isolates, and correlation tests showed that the transformability of the shuttle vectors in L. interrogans isolates depended, to certain extent, on genetic compatibility between the rep sequences of both plasmid and host. Three extrachromosomal replicons co-exist in L. interrogans, one of which we consider to be an inducible prophage. The vectors constructed with the rep genes of the three replicons successfully transformed into saprophytic and pathogenic Leptospira species alike, but this was partly dependent on genetic compatibility between the rep sequences of both plasmid and host.

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

Plasmids of corynebacteria.

PubMed

Deb, J K; Nath, N

1999-06-01

Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

An 'instant gene bank' method for gene cloning by mutant complementation.

PubMed

Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J

1994-02-01

We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.

Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.

1987-12-01

A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C tomore » A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation.« less

Cloning systems for Rhodococcus and related bacteria

DOEpatents

Finnerty, W.R.; Singer, M.E.

1990-08-28

A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors. 2 figs.

Cloning systems for Rhodococcus and related bacteria

DOEpatents

Finnerty, William R.; Singer, Mary E.

1990-01-01

A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors.

Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis with Various Plasmids

PubMed Central

Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle

2002-01-01

We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607

Ultraviolet mutagenesis in a plasmid vector replicated in lymphoid cells from patient with the melanoma-prone disorder dysplastic nevus syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seetharam, S.; Waters, H.L.; Seidman, M.M.

The hereditary dysplastic nevus syndrome (DNS) is an autosomal dominant disorder in which affected individuals have increased numbers of dysplastic (premalignant) nevi and a greater than 100-fold increased risk of developing cutaneous melanoma. Epstein-Barr virus-transformed lymphoblastoid cell lines from patients with hereditary DNS have been shown to be hypermutable to UV radiation. To examine the mechanism involved in this UV hypermutability, we used a shuttle vector plasmid, pZ189, which carries a 160-base pair marker gene, supF, and can replicate in human cells. pZ189 was treated with UV radiation and transfected into DNS6BE, a lymphoblastoid cell line from a patient withmore » hereditary DNS. Plasmid survival after UV was similar with the DNS6BE line and with a lymphoblastoid cell line from a normal donor. Plasmid mutation frequency was greater with the DNS line in accord with the DNS cellular hypermutability. Base sequence analysis was performed on 69 mutated plasmids recovered from the DNS line. There were significantly more plasmids with single base substitution mutations (P less than 0.01) in comparison to UV-treated plasmids passed through normal fibroblasts. pZ189 hypermutability and an increased frequency of single base substitutions was previously found with a cell line from a melanoma-prone xeroderma pigmentosum patient. These differences may be related to the increased melanoma susceptibility in both DNS and xeroderma pigmentosum.« less

Manipulation for plasmid elimination by transforming synthetic competitors diversifies lactococcus lactis starters applicable to food products.

PubMed

Kobayashi, Miho; Nomura, Masaru; Kimoto, Hiromi

2007-11-01

This study was designed selectively to eliminate a theta-plasmid from Lactococcus lactis strains by transforming synthetic competitors. A shuttle vector for Escherichia coli and L. lactis, pDB1, was constructed by ligating a partial replicon of pDR1-1B, which is a 7.3 kb theta-plasmid in L. lactis DRC1, with an erythromycin resistance gene into pBluescript II KS(+). This versatile vector was used to construct competitors to common lactococcal theta-plasmids. pDB1 contains the 5' half of the replication origin and the 3' region of repB of pDR1-1B, but lacks the 1.1-kb region normally found between these two segments. A set of primers, Pv3 and Pv4, was designed to amplify the 1.1-kb middle parts of the general theta-replicons of lactococcal plasmids. When the PCR products were cloned into the Nru I and Xho I sites of pDB1, synthetic replicons were constructed and replication activity was restored. A number of theta-plasmids in L. lactis ssp. lactis and cremoris were eliminated selectively by transforming the synthetic competitors. These competitors were easily eliminated by subculture for a short time in the absence of selection. The resulting variants contained no exogenous DNA and are suitable for food products, since part of the phenotype was altered without altering other plasmids indispensable for fermentation.

A quantitative and high-throughput assay of human papillomavirus DNA replication.

PubMed

Gagnon, David; Fradet-Turcotte, Amélie; Archambault, Jacques

2015-01-01

Replication of the human papillomavirus (HPV) double-stranded DNA genome is accomplished by the two viral proteins E1 and E2 in concert with host DNA replication factors. HPV DNA replication is an established model of eukaryotic DNA replication and a potential target for antiviral therapy. Assays to measure the transient replication of HPV DNA in transfected cells have been developed, which rely on a plasmid carrying the viral origin of DNA replication (ori) together with expression vectors for E1 and E2. Replication of the ori-plasmid is typically measured by Southern blotting or PCR analysis of newly replicated DNA (i.e., DpnI digested DNA) several days post-transfection. Although extremely valuable, these assays have been difficult to perform in a high-throughput and quantitative manner. Here, we describe a modified version of the transient DNA replication assay that circumvents these limitations by incorporating a firefly luciferase expression cassette in cis of the ori. Replication of this ori-plasmid by E1 and E2 results in increased levels of firefly luciferase activity that can be accurately quantified and normalized to those of Renilla luciferase expressed from a control plasmid, thus obviating the need for DNA extraction, digestion, and analysis. We provide a detailed protocol for performing the HPV type 31 DNA replication assay in a 96-well plate format suitable for small-molecule screening and EC50 determinations. The quantitative and high-throughput nature of the assay should greatly facilitate the study of HPV DNA replication and the identification of inhibitors thereof.

Versatile plasmid-based expression systems for Gram-negative bacteria--General essentials exemplified with the bacterium Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Schwab, Helmut; Koefinger, Petra

2015-12-25

The Gram-negative bacterium Escherichia coli is currently the most efficient and widely used prokaryotic host for recombinant protein and metabolite production. However, due to some limitations and to various interesting features of other Gram-negative bacteria efficient vector systems applicable to a broad range are desired. Basic building blocks for plasmid-based vectors include besides the need for a suitable selection marker in the first line a proper replication and maintenance system. In addition to these basic requirements, further elements are needed for Gram-negative bacteria beyond E. coli, such as Pseudomonas pudita, Ralstonia eutropha, Burkholderia glumae or Acinetobacter sp.. Established building blocks have to be adapted and new building blocks providing the desired functions need to be identified and exploited. This minireview addresses so far described and used genetic elements for broad host range replication, efficient plasmid maintenance, and conjugative plasmid transfer as well as expression elements and protein secretion signals. The industrially important bacterium R. eutropha H16 was chosen as a model organism to provide specific data on the effectivity and utility of building blocks based on such genetic elements. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization of the cryptic plasmid pOfk55 from Legionella pneumophila and construction of a pOfk55-derived shuttle vector.

PubMed

Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa

2017-03-01

In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production.

PubMed

Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

PubMed Central

Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731

Development of a Novel Escherichia coli-Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide.

PubMed

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.

Optimization of a one-step heat-inducible in vivo mini DNA vector production system.

PubMed

Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.

Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System

PubMed Central

Wettig, Shawn; Slavcev, Roderick A.

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704

Transformation of Rhodococcus fascians by High-Voltage Electroporation and Development of R. fascians Cloning Vectors

PubMed Central

Desomer, Jan; Dhaese, Patrick; Montagu, Marc Van

1990-01-01

The analysis of the virulence determinants of phytopathogenic Rhodococcus fascians has been hampered by the lack of a system for introducing exogenous DNA. We investigated the possibility of genetic transformation of R. fascians by high-voltage electroporation of intact bacterial cells in the presence of plasmid DNA. Electrotransformation in R. fascians D188 resulted in transformation frequencies ranging from 105/μg of DNA to 107/μg of DNA, depending on the DNA concentration. The effects of different electrical parameters and composition of electroporation medium on transformation efficiency are presented. By this transformation method, a cloning vector (pRF28) for R. fascians based on an indigenous 160-kilobase (chloramphenicol and cadmium resistance-encoding) plasmid pRF2 from strain NCPPB 1675 was developed. The origin of replication and the chloramphenicol resistance gene on pRF28 were used to construct cloning vectors that are capable of replication in R. fascians and Escherichia coli. The electroporation method presented was efficient enough to allow detection of the rare integration of replication-deficient pRF28 derivatives in the R. fascians D188 genome via either homologous or illegitimate recombination. Images PMID:16348290

The LE1 Bacteriophage Replicates as a Plasmid within Leptospira biflexa: Construction of an L. biflexa-Escherichia coli Shuttle Vector

PubMed Central

Girons, Isabelle Saint; Bourhy, Pascale; Ottone, Catherine; Picardeau, Mathieu; Yelton, David; Hendrix, Roger W.; Glaser, Philippe; Charon, Nyles

2000-01-01

We have discovered that LE1, one of the plaque-forming phages previously described as lytic for the Leptospira biflexa saprophytic spirochete (I. Saint Girons, D. Margarita, P. Amouriaux, and G. Baranton, Res. Microbiol. 141:1131–1138, 1990), was indeed temperate. LE1 was found to be unusual, as Southern blot analysis indicated that it is one of the few phages to replicate in the prophage state as a circular plasmid. The unavailability of such small endogenous replicons has hindered genetic experimentation in Leptospira. We have developed a shuttle vector with DNA derived from LE1. Random LE1 DNA fragments were cloned into a pGEM 7Zf(+) derivative devoid of most of the bla gene but carrying a kanamycin resistance marker from the gram-positive bacterium Enterococcus (Streptococcus) faecalis. These constructs were transformed into L. biflexa strain Patoc 1 by electroporation, giving rise to kanamycin-resistant transformants. A 2.2-kb fragment from LE1 was responsible for replication of the vector in L. biflexa. However, a larger region including an intact parA gene homologue was necessary for the stability of the shuttle vector. Direct repeats and AT-rich regions characterized the LE1 origin of replication. Our data indicate that the replicon derived from the LE1 leptophage, together with the kanamycin resistance gene, is a promising tool with which to develop the genetics of Leptospira species. PMID:11004167

Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization

NASA Astrophysics Data System (ADS)

Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.

1995-10-01

Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.

A plasmid-based reverse genetics system for influenza A virus.

PubMed Central

Pleschka, S; Jaskunas, R; Engelhardt, O G; Zürcher, T; Palese, P; García-Sastre, A

1996-01-01

A reverse genetics system for negative-strand RNA viruses was first successfully developed for influenza viruses. This technology involved the transfection of in vitro-reconstituted ribonucleoprotein (RNP) complexes into influenza virus-infected cells. We have now developed a method that allows intracellular reconstitution of RNP complexes from plasmid-based expression vectors. Expression of a viral RNA-like transcript is achieved from a plasmid containing a truncated human polymerase I (polI) promoter and a ribozyme sequence that generates the desired 3' end by autocatalytic cleavage. The polI-driven plasmid is cotransfected into human 293 cells with polII-responsive plasmids that express the viral PB1, PB2, PA, and NP proteins. This exclusively plasmid-driven system results in the efficient transcription and replication of the viral RNA-like reporter and allows the study of cis- and trans-acting signals involved in the transcription and replication of influenza virus RNAs. Using this system, we have also been able to rescue a synthetic neuraminidase gene into a recombinant influenza virus. This method represents a convenient alternative to the previously established RNP transfection system. PMID:8648766

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

PubMed

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Plasmids from Food Lactic Acid Bacteria: Diversity, Similarity, and New Developments

PubMed Central

Cui, Yanhua; Hu, Tong; Qu, Xiaojun; Zhang, Lanwei; Ding, Zhongqing; Dong, Aijun

2015-01-01

Plasmids are widely distributed in different sources of lactic acid bacteria (LAB) as self-replicating extrachromosomal genetic materials, and have received considerable attention due to their close relationship with many important functions as well as some industrially relevant characteristics of the LAB species. They are interesting with regard to the development of food-grade cloning vectors. This review summarizes new developments in the area of lactic acid bacteria plasmids and aims to provide up to date information that can be used in related future research. PMID:26068451

A human parvovirus, adeno-associated virus, as a eucaryotic vector: Transient expression and encapsidation of the procaryotic gene for chloramphenicol acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tratschin, J.D.; West, M.H.P.; Sandbank, T.

1984-10-01

The authors have used the defective human parvovirus adeno-associated virus (AAV) as a novel eurocaryotic vector (parvector) for the expression of a foreign gene in human cells. The recombinant, pAV2, contains the AAV genome in a pBR322-derived bacterial plasmid. When pAV2 is transfected into human cells together with helper adenovirus particles, the AAV genome is rescued from the recombinant plasmid and replicated to produce infectious AAV particles at high efficiency. To create a vector, we inserted a procaryotic sequence coding for chloramphenicol acetyltransferase (CAT) into derivatives of pAV2 following either of the AAV promoters p/sub 40/ (pAVHiCAT) and p/sub 19/more » (pAVBcCAT). When transfected into human 293 cells or HeLa cells, pAVHiCAT expressed CAT activity in the absence of adenovirus. In the presence of adenovirus, this vector produced increased amounts of CAT activity and the recombinant AAV-CAT genome was replicated. In 293 cells, pAVBcCAT expressed a similar amount of CAT activity in the absence or presence of adenovirus and the recombinant AAV-CAT genome was not replicated. In HeLa cells, pAVBcCAT expressed low levels of CAT activity, but this level was elevated by coinfection with adenovirus particles or by cotransfection with a plasmid which expressed the adenovirus early region 1A (E1A) product. The E1A product is a transcriptional activator and is expressed in 293 cells. Thus, expression from two AAV promoters is differentially regulated: expression from p/sub 19/ is increased by E1A, whereas p/sub 40/ yields high levels of constitutive expression in the absence of E1A. Both AAV vectors were packaged into AAV particles by complementation with wild-type AAV and yielded CAT activity when subsequently infected into cells in the presence of adenovirus.« less

Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-12-20

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-09-30

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of a Novel Escherichia coli–Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide

PubMed Central

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli–Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 (rhsmo) and alcohol dehydrogenase gene from Leifsonia sp. S749 (lsadh), in K. rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase (gapdh) promotor. The RhSMO–LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent–water biphasic reaction system to efficiently convert styrene into (S)-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells. PMID:29230202

Transformation of Schwanniomyces occidentalis with an ADE2 gene cloned from S. occidentalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, R.D.; Favreau, M.A.

1988-12-01

We have developed an efficient transformation system for the industrial yeast Schwanniomyces occidentalis (formerly Schwanniomyces castellii). The transformation system is based on ade2 mutants of S. occidentalis deficient for phosphoribosylaminoimidazole carboxylase that were generated by mutagenesis. As a selectable marker, we isolated and characterized the S. occidentalis ADE2 gene by complementation in an ade2 strain of Saccharomyces cerevisiae. S. occidentalis was transformed with the recombinant plasmid pADE, consisting of a 4.5-kilobase-pair (kbp) DNA fragment from S. occidentalis containing the ADE2 gene inserted into the S. cerevisiae expression vector pYcDE8 by a modification of the spheroplasting procedure of Beggs. Intact plasmidsmore » were recovered in Escherichia coli from whole-cell lysates of ADE+ transformants, indicating that plasmids were replicating autonomously. High-molecular-mass species of pADE2 were found by Southern hybridization analysis of intact genomic DNA preparations. The shift to higher molecular mass of these plasmids during electrophoresis in the presence ethidium bromide after exposure to shortwave UV suggests that they exist in a supercoiled form in the transformed host. Subclones of the 4.5-kbp insert indicated that ADE2-complementing activity and sequences conferring autonomous replication in S. occidentalis were located within a 2.7-kbp EcoRI-SphI fragment. Plasmids containing this region cloned into the bacterial vector pUC19 complemented ade2 mutants of S. occidentalis with efficiencies identical to those of the original plasmid pADE.« less

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells.

PubMed Central

Reeves, R; Gorman, C M; Howard, B

1985-01-01

The nucleoprotein structures formed on various plasmid expression vectors transfected into mammalian cells by both the calcium phosphate and DEAE-dextran methods have been studied. We demonstrate by a variety of means that mammalian cells are capable of rapidly assembling non-integrated circular plasmids (both replicating and non-replicating) into typical "minichromosomes" containing nucleosomes with a 190 bp repetitive spacing. Treatment of recipient cells with sodium butyrate for a short period of time (12-16 h) immediately following transfection markedly increased the DNase I digestion sensitivity of the newly assembled plasmid chromatin. Furthermore, minichromosomes isolated from such butyrate-treated cells are depleted in histone H1 and contain highly acetylated forms of histone H4. These findings are entirely consistent with our earlier speculation (Gorman et al., Nucleic Acids Res. 11, 1044; 1983) that appropriate butyrate treatment might stimulate transient expression of newly transfected genes by facilitating their assembly into an "active" type of chromatin structure. Images PMID:3859838

Sleeping Beauty transposon-based system for rapid generation of HBV-replicating stable cell lines.

PubMed

Wu, Yong; Zhang, Tian-Ying; Fang, Lin-Lin; Chen, Zi-Xuan; Song, Liu-Wei; Cao, Jia-Li; Yang, Lin; Yuan, Quan; Xia, Ning-Shao

2016-08-01

The stable HBV-replicating cell lines, which carry replication-competent HBV genome stably integrated into the genome of host cell, are widely used to evaluate the effects of antiviral agents. However, current methods to generate HBV-replicating cell lines, which are mostly dependent on random integration of foreign DNA via plasmid transfection, are less-efficient and time-consuming. To address this issue, we constructed an all-in-one Sleeping Beauty transposon system (denoted pTSMP-HBV vector) for robust generation of stable cell lines carrying replication-competent HBV genome of different genotype. This vector contains a Sleeping Beauty transposon containing HBV 1.3-copy genome with an expression cassette of the SV40 promoter driving red fluorescent protein (mCherry) and self-cleaving P2A peptide linked puromycin resistance gene (PuroR). In addition, a PGK promoter-driven SB100X hyperactive transposase cassette is placed in the outside of the transposon in the same plasmid.The HBV-replicating stable cells could be obtained from pTSMP-HBV transfected HepG2 cells by red fluorescence-activated cell sorting and puromycin resistant cell selection within 4-week. Using this system, we successfully constructed four cell lines carrying replication-competent HBV genome of genotypes A-D. The replication and viral protein expression profiles of these cells were systematically characterized. In conclusion, our study provides a high-efficiency strategy to generate HBV-replicating stable cell lines, which may facilitate HBV-related virological study. Copyright © 2016. Published by Elsevier B.V.

Stable transformation of a mosquito cell line results in extraordinarily high copy numbers of the plasmid.

PubMed Central

Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J

1992-01-01

Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052

Adeno-associated virus vectors can be efficiently produced without helper virus.

PubMed

Matsushita, T; Elliger, S; Elliger, C; Podsakoff, G; Villarreal, L; Kurtzman, G J; Iwaki, Y; Colosi, P

1998-07-01

The purpose of this work was to develop an efficient method for the production of adeno-associated virus (AAV) vectors in the absence of helper virus. The adenovirus regions that mediate AAV vector replication were identified and assembled into a helper plasmid. These included the VA, E2A and E4 regions. When this helper plasmid was cotransfected into 293 cells, along with plasmids encoding the AAV vector, and rep and cap genes, AAV vector was produced as efficiently as when using adenovirus infection as a source of help. CMV-driven constructs expressing the E4orf6 and the 72-M(r), E2A proteins were able to functionally replace the E4 and E2A regions, respectively. Therefore the minimum set of genes required to produce AAV helper activity equivalent to that provided by adenovirus infection consists of, or is a subset of, the following genes: the E4orf6 gene, the 72-M(r), E2A protein gene, the VA RNA genes and the E1 region. AAV vector preparations made with adenovirus and by the helper virus-free method were essentially indistinguishable with respect to particle density, particle to infectivity ratio, capsimer ratio and efficiency of muscle transduction in vivo. Only AAV vector preparations made by the helper virus-free method were not reactive with anti-adenovirus sera.

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

DNA transformations of Candida tropicalis with replicating and integrative vectors.

PubMed

Sanglard, D; Fiechter, A

1992-12-01

The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.

Site-specific integration of Streptomyces PhiC31 integrase-based vectors in the chromosome of Rhodococcus equi.

PubMed

Hong, Yang; Hondalus, Mary K

2008-10-01

Streptomyces PhiC31-based site-specific integration was used to transform the facultative intracellular pathogen Rhodococcus equi. The transformation efficiency of vectors incorporating the PhiC31 integrase and attP sites was comparable to that of replication plasmids using the same electroporation procedure. A single attB integration site was identified within an ORF encoding a pirin-like protein, which deviates slightly from the consensus sequence of Streptomyces attB sites. Vector integration was stably maintained in the R. equi chromosome for as many as 100 generations during unselected passage in vitro. In addition, integration does not appear to affect the replication of bacteria inside macrophages. Finally, this integration system was also used to successfully complement an R. equi mutant.

Cloning and Sequencing of Defective Particles Derived from the Autonomous Parvovirus Minute Virus of Mice for the Construction of Vectors with Minimal cis-Acting Sequences

PubMed Central

Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick

2001-01-01

The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501

Plasmids of Carotenoid-Producing Paracoccus spp. (Alphaproteobacteria) - Structure, Diversity and Evolution

PubMed Central

Maj, Anna; Dziewit, Lukasz; Czarnecki, Jakub; Wlodarczyk, Miroslawa; Baj, Jadwiga; Skrzypczyk, Grazyna; Giersz, Dorota; Bartosik, Dariusz

2013-01-01

Plasmids are components of many bacterial genomes. They enable the spread of a large pool of genetic information via lateral gene transfer. Many bacterial strains contain mega-sized replicons and these are particularly common in Alphaproteobacteria. Considerably less is known about smaller alphaproteobacterial plasmids. We analyzed the genomes of 14 such plasmids residing in 4 multireplicon carotenoid-producing strains of the genus Paracoccus (Alphaproteobacteria): P. aestuarii DSM 19484, P. haeundaensis LG P-21903, P. marcusii DSM 11574 and P. marcusii OS22. Comparative analyses revealed mosaic structures of the plasmids and recombinational shuffling of diverse genetic modules involved in (i) plasmid replication, (ii) stabilization (including toxin-antitoxin systems of the relBE/parDE, tad-ata, higBA, mazEF and toxBA families) and (iii) mobilization for conjugal transfer (encoding relaxases of the MobQ, MobP or MobV families). A common feature of the majority of the plasmids is the presence of AT-rich sequence islets (located downstream of exc1-like genes) containing genes, whose homologs are conserved in the chromosomes of many bacteria (encoding e.g. RelA/SpoT, SMC-like proteins and a retron-type reverse transcriptase). The results of this study have provided insight into the diversity and plasticity of plasmids of Paracoccus spp., and of the entire Alphaproteobacteria. Some of the identified plasmids contain replication systems not described previously in this class of bacteria. The composition of the plasmid genomes revealed frequent transfer of chromosomal genes into plasmids, which significantly enriches the pool of mobile DNA that can participate in lateral transfer. Many strains of Paracoccus spp. have great biotechnological potential, and the plasmid vectors constructed in this study will facilitate genetic studies of these bacteria. PMID:24260361

Cloning of an origin of DNA replication of Xenopus laevis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, S.; Taylor, J.H.

1980-09-01

DNA fragments of Xenopus laevis, the African frog, were cloned in the EcoRI site of the Eschrichia coli plasmid pACYC189 and tested for ability to initiate and complete replication of the recombinant plasmid when injected into unfertilized eggs of X. laevis. After measurement of the (/sup 3/H)-thymidine incorporation per egg for a number of recombinant plasmids, pSW14 and pSW9, which respectively contain a small segment (550 base pairs) and several kilobases of frog DNA, were selected for more extensive analysis. In spite of the small size of th segment in pSW14, it incorporates in 2 hr at least 3 timesmore » as much labeled thymidine as either pSW9 or the vector alone. To determine the number of replications of pSW14, a novel method was employed. The results showed that about 50% of the labeled, supercoiled DNA recovered from eggs after 4 hr was sensitive to EcoRI digestion, which indicates that most of the DNA that incorporated (/sup 3/H)thymidine had replicated twice during the 4 hr in the unfertilized eggs of X. laevis. We conclude the pSW14 has a functional origin in the Xenopus DNA segment.« less

ColE1-Plasmid Production in Escherichia coli: Mathematical Simulation and Experimental Validation.

PubMed

Freudenau, Inga; Lutter, Petra; Baier, Ruth; Schleef, Martin; Bednarz, Hanna; Lara, Alvaro R; Niehaus, Karsten

2015-01-01

Plasmids have become very important as pharmaceutical gene vectors in the fields of gene therapy and genetic vaccination in the past years. In this study, we present a dynamic model to simulate the ColE1-like plasmid replication control, once for a DH5α-strain carrying a low copy plasmid (DH5α-pSUP 201-3) and once for a DH5α-strain carrying a high copy plasmid (DH5α-pCMV-lacZ) by using ordinary differential equations and the MATLAB software. The model includes the plasmid replication control by two regulatory RNA molecules (RNAI and RNAII) as well as the replication control by uncharged tRNA molecules. To validate the model, experimental data like RNAI- and RNAII concentration, plasmid copy number (PCN), and growth rate for three different time points in the exponential phase were determined. Depending on the sampled time point, the measured RNAI- and RNAII concentrations for DH5α-pSUP 201-3 reside between 6 ± 0.7 and 34 ± 7 RNAI molecules per cell and 0.44 ± 0.1 and 3 ± 0.9 RNAII molecules per cell. The determined PCNs averaged between 46 ± 26 and 48 ± 30 plasmids per cell. The experimentally determined data for DH5α-pCMV-lacZ reside between 345 ± 203 and 1086 ± 298 RNAI molecules per cell and 22 ± 2 and 75 ± 10 RNAII molecules per cell with an averaged PCN of 1514 ± 1301 and 5806 ± 4828 depending on the measured time point. As the model was shown to be consistent with the experimentally determined data, measured at three different time points within the growth of the same strain, we performed predictive simulations concerning the effect of uncharged tRNA molecules on the ColE1-like plasmid replication control. The hypothesis is that these tRNA molecules would have an enhancing effect on the plasmid production. The in silico analysis predicts that uncharged tRNA molecules would indeed increase the plasmid DNA production.

Construction and Characterization of an in-vivo Linear Covalently Closed DNA Vector Production System

PubMed Central

2012-01-01

Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697

Construction and characterization of an in-vivo linear covalently closed DNA vector production system.

PubMed

Nafissi, Nafiseh; Slavcev, Roderick

2012-12-06

While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.

Cloning-independent plasmid construction for genetic studies in streptococci

PubMed Central

Xie, Zhoujie; Qi, Fengxia; Merritt, Justin

2013-01-01

Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in E. coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5×103 – 2×105 CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli – Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. PMID:23673081

Cloning-independent plasmid construction for genetic studies in streptococci.

PubMed

Xie, Zhoujie; Qi, Fengxia; Merritt, Justin

2013-08-01

Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in Escherichia coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5 × 10³ to 2 × 10⁵ CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli-Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. Copyright © 2013 Elsevier B.V. All rights reserved.

Production and purification of non replicative canine adenovirus type 2 derived vectors.

PubMed

Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard

2013-12-03

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.

Xeroderma pigmentosum variant cells are less likely than normal cells to incorporate dAMP opposite photoproducts during replication of UV-irradiated plasmids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Y.C.; Maher, V.M.; McCormich, J.J.

1991-09-01

Xeroderma pigmentosum (XP) variant patients show the clinical characteristics of the disease, with increased frequencies of skin cancer, but their cells have a normal, or nearly normal, rate of nucleotide excision repair of UV-induced DNA damage and are only slightly more sensitive than normal cells to the cytotoxic effect of UV radiation. However, they are significantly more sensitive to its mutagenic effect. To examine the mechanisms responsible for this hypermutability, the authors transfected an XP variant cell line with a UV-irradiated (at 254 nm) shuttle vector carrying the {sup F} gene as a target for mutations, allowed replication of themore » plasmid, determined the frequency and spectrum of mutations induced, and compared the results with those obtained previously when irradiated plasmids carrying the same target gene replicated in a normal cell line. The frequency of mutants increased linearly with dose, but with a slope 5 times steeper than that seen with normal cells. Sequence analysis of the {sup F} gene showed that 52 of 53 independent mutants generated in the XP variant cells contained base substitutions, with 62 of 64 of the substitutions involving a dipyrimidine.« less

Retroviral mutation rates and A-to-G hypermutations during different stages of retroviral replication.

PubMed Central

Kim, T; Mudry, R A; Rexrode, C A; Pathak, V K

1996-01-01

Retroviruses mutate at a high rate in vivo during viral replication. Mutations may occur during proviral transcription by RNA polymerase II, during minus-strand DNA synthesis (RNA template) by viral reverse transcriptase, or during plus-strand DNA synthesis (DNA template) by reverse transcriptase. To determine the contributions of different stages of replication to the retroviral mutation rates, we developed a spleen necrosis virus-based in vivo system to selectively identify mutations occurring during the early stage (RNA transcription plus minus-strand synthesis) and the late stage (plus-strand synthesis plus DNA repair). A lacZalpha reporter gene was inserted into the long terminal repeat (LTR) of a spleen necrosis virus shuttle vector, and proviruses were recovered from infected cells as plasmids containing either one or both LTRs. Plasmids containing both LTRs generated a mutant phenotype only if the lacZalpha genes in both LTRs were mutated, which is most likely to occur during the early stage. Mutant phenotypes were identified from plasmids containing one LTR regardless of the stage at which the mutations occurred. Thus, mutant frequencies obtained after recovery of plasmids containing both LTRs or one LTR provided early-stage and total mutation rates, respectively. Analysis of 56,409 proviruses suggested that the retroviral mutation rates during the early and late stages of replication were equal or within twofold of each other. In addition, two mutants with A-to-G hypermutations were discovered, suggesting a role for mammalian double-stranded RNA adenosine deaminase enzyme in retroviral mutations. These experiments provide a system to selectively identify mutations in the early stage of retroviral replication and to provide upper and lower limits to the in vivo mutation rates during minus-strand and plus-strand synthesis, respectively. PMID:8892879

Fine-tuning synthesis of Yersinia pestis LcrV from runaway-like replication balanced-lethal plasmid in a Salmonella enterica serovar typhimurium vaccine induces protection against a lethal Y. pestis challenge in mice.

PubMed

Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M; Branger, Christine G; Tinge, Steven A; Curtiss, Roy

2010-06-01

A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal DeltaasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain chi9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/P(cro)) (P(R)), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC P(BAD) c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of beta-lactamase, and cloned into pYA4534 under the control of the P(trc) promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain chi9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route.

Fine-Tuning Synthesis of Yersinia pestis LcrV from Runaway-Like Replication Balanced-Lethal Plasmid in a Salmonella enterica Serovar Typhimurium Vaccine Induces Protection against a Lethal Y. pestis Challenge in Mice▿

PubMed Central

Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M.; Branger, Christine G.; Tinge, Steven A.; Curtiss, Roy

2010-01-01

A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal ΔasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain χ9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/Pcro) (PR), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC PBAD c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of β-lactamase, and cloned into pYA4534 under the control of the Ptrc promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain χ9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route. PMID:20308296

“Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete”

PubMed Central

2012-01-01

Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256

Improvement and Optimization of Two Engineered Phage Resistance Mechanisms in Lactococcus lactis

PubMed Central

McGrath, Stephen; Fitzgerald, Gerald F.; van Sinderen, Douwe

2001-01-01

Homologous replication module genes were identified for four P335 type phages. DNA sequence analysis revealed that all four phages exhibited more than 90% DNA homology for at least two genes, designated rep2009 and orf17. One of these genes, rep2009, codes for a putative replisome organizer protein and contains an assumed origin of phage DNA replication (ori2009), which was identical for all four phages. DNA fragments representing the ori2009 sequence confer a phage-encoded resistance (Per) phenotype on lactococcal hosts when they are supplied on a high-copy-number vector. Furthermore, cloning multiple copies of the ori2009 sequence was found to increase the effectiveness of the Per phenotype conferred. A number of antisense plasmids targeting specific genes of the replication module were constructed. Two separate plasmids targeting rep2009 and orf17 were found to efficiently inhibit proliferation of all four phages by interfering with intracellular phage DNA replication. These results represent two highly effective strategies for inhibiting bacteriophage proliferation, and they also identify a novel gene, orf17, which appears to be important for phage DNA replication. Furthermore, these results indicate that although the actual mechanisms of DNA replication are very similar, if not identical, for all four phages, expression of the replication genes is significantly different in each case. PMID:11157223

The Aspartate-Semialdehyde Dehydrogenase of Edwardsiella ictaluri and Its Use as Balanced-Lethal System in Fish Vaccinology

PubMed Central

Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy

2010-01-01

asdA mutants of Gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd+ plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd+ plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric Gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd+ expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd+ vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd+ plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry. PMID:21209920

The aspartate-semialdehyde dehydrogenase of Edwardsiella ictaluri and its use as balanced-lethal system in fish vaccinology.

PubMed

Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy

2010-12-29

asdA mutants of gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd(+) plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd(+) plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd(+) expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd(+) vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd(+) plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry.

Cloning and characterization of an autonomous replication sequence from Coxiella burnetii.

PubMed Central

Suhan, M; Chen, S Y; Thompson, H A; Hoover, T A; Hill, A; Williams, J C

1994-01-01

A Coxiella burnetii chromosomal fragment capable of functioning as an origin for the replication of a kanamycin resistance (Kanr) plasmid was isolated by use of origin search methods utilizing an Escherichia coli host. The 5.8-kb fragment was subcloned into phagemid vectors and was deleted progressively by an exonuclease III-S1 technique. Plasmids containing progressively shorter DNA fragments were then tested for their capability to support replication by transformation of an E. coli polA strain. A minimal autonomous replication sequence (ARS) was delimited to 403 bp. Sequencing of the entire 5.8-kb region revealed that the minimal ARS contained two consensus DnaA boxes, three A + T-rich 21-mers, a transcriptional promoter leading rightwards, and potential integration host factor and factor of inversion stimulation binding sites. Database comparisons of deduced amino acid sequences revealed that open reading frames located around the ARS were homologous to genes often, but not always, found near bacterial chromosomal origins; these included identities with rpmH and rnpA in E. coli and identities with the 9K protein and 60K membrane protein in E. coli and Pseudomonas species. These and direct hybridization data suggested that the ARS was chromosomal and not associated with the resident plasmid QpH1. Two-dimensional agarose gel electrophoresis did not reveal the presence of initiating intermediates, indicating that the ARS did not initiate chromosome replication during laboratory growth of C. burnetii. Images PMID:8071197

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-10-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed Central

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-01-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

PubMed Central

Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

2010-01-01

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

Role of the Adenovirus DNA-Binding Protein in In Vitro Adeno-Associated Virus DNA Replication

PubMed Central

Ward, Peter; Dean, Frank B.; O’Donnell, Michael E.; Berns, Kenneth I.

1998-01-01

A basic question in adeno-associated virus (AAV) biology has been whether adenovirus (Ad) infection provided any function which directly promoted replication of AAV DNA. Previously in vitro assays for AAV DNA replication, using linear duplex AAV DNA as the template, uninfected or Ad-infected HeLa cell extracts, and exogenous AAV Rep protein, demonstrated that Ad infection provides a direct helper effect for AAV DNA replication. It was shown that the nature of this helper effect was to increase the processivity of AAV DNA replication. Left unanswered was the question of whether this effect was the result of cellular factors whose activity was enhanced by Ad infection or was the result of direct participation of Ad proteins in AAV DNA replication. In this report, we show that in the in vitro assay, enhancement of processivity occurs with the addition of either the Ad DNA-binding protein (Ad-DBP) or the human single-stranded DNA-binding protein (replication protein A [RPA]). Clearly Ad-DBP is present after Ad infection but not before, whereas the cellular level of RPA is not apparently affected by Ad infection. However, we have not measured possible modifications of RPA which might occur after Ad infection and affect AAV DNA replication. When the substrate for replication was an AAV genome inserted into a plasmid vector, RPA was not an effective substitute for Ad-DBP. Extracts supplemented with Ad-DBP preferentially replicated AAV sequences rather than adjacent vector sequences; in contrast, extracts supplemented with RPA preferentially replicated vector sequences. PMID:9420241

A Potential Food-Grade Cloning Vector for Streptococcus thermophilus That Uses Cadmium Resistance as the Selectable Marker

PubMed Central

Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.

2003-01-01

A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cdr phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus. PMID:14532023

A potential food-grade cloning vector for Streptococcus thermophilus that uses cadmium resistance as the selectable marker.

PubMed

Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W

2003-10-01

A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bredberg, A.; Kraemer, K.H.; Seidman, M.M.

1986-11-01

A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less

Assessment of the Mobilizable Vector Plasmids pSUP202 and pSUP404.2 as Genetic Tools for the Predatory Bacterium Bdellovibrio bacteriovorus

PubMed Central

Roschanski, Nicole

2010-01-01

Bdellovibrio and like organisms (BALOs) form the group of predatory bacteria which require Gram-negative bacteria as prey. Genetic studies with Bdellovibrio bacteriovorus can be performed with vectors which are introduced into the predator via conjugation. The usefulness of the two vectors pSUP202 and pSUP404.2 as genetic tools were assessed. Both vectors were transferable into B. bacteriovorus by conjugative matings with an Escherichia coli K12 strain as donor. The transfer frequency was higher for vector pSUP404.2 (approx. 10−1–10−4) as for pSUP202 (approx. 10−5–10−6). Vector pSUP202 with a pMB1 origin is unstable in the predatory bacterium, whereas pSUP404.2 is stably maintained in the absence of selective antibiotics. pSUP404.2 harbors two plasmid replicons, the p15A ori and the RSF1010 replication region The copy number of pSUP404.2 was determined by quantitative PCR in B. bacteriovorus and averages seven copies per genome. pSUP404.2 harbors two resistance genes (chloramphenicol and kanamycin) which can be used for cloning either by selection for transconjugants or by insertional inactivation. PMID:20824276

Replication-dependent and independent mechanisms for the chromosome-coupled persistence of a selfish genome.

PubMed

Liu, Yen-Ting; Chang, Keng-Ming; Ma, Chien-Hui; Jayaram, Makkuni

2016-09-30

The yeast 2-micron plasmid epitomizes the evolutionary optimization of selfish extra-chromosomal genomes for stable persistence without jeopardizing their hosts' fitness. Analyses of fluorescence-tagged single-copy reporter plasmids and/or the plasmid partitioning proteins in native and non-native hosts reveal chromosome-hitchhiking as the likely means for plasmid segregation. The contribution of the partitioning system to equal segregation is bipartite- replication-independent and replication-dependent. The former nearly eliminates 'mother bias' (preferential plasmid retention in the mother cell) according to binomial distribution, thus limiting equal segregation of a plasmid pair to 50%. The latter enhances equal segregation of plasmid sisters beyond this level, elevating the plasmid close to chromosome status. Host factors involved in plasmid partitioning can be functionally separated by their participation in the replication-independent and/or replication-dependent steps. In the hitchhiking model, random tethering of a pair of plasmids to chromosomes signifies the replication-independent component of segregation; the symmetric tethering of plasmid sisters to sister chromatids embodies the replication-dependent component. The 2-micron circle broadly resembles the episomes of certain mammalian viruses in its chromosome-associated propagation. This unifying feature among otherwise widely differing selfish genomes suggests their evolutionary convergence to the common logic of exploiting, albeit via distinct molecular mechanisms, host chromosome segregation machineries for self-preservation. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Replication-dependent and independent mechanisms for the chromosome-coupled persistence of a selfish genome

PubMed Central

Liu, Yen-Ting; Chang, Keng-Ming; Ma, Chien-Hui; Jayaram, Makkuni

2016-01-01

The yeast 2-micron plasmid epitomizes the evolutionary optimization of selfish extra-chromosomal genomes for stable persistence without jeopardizing their hosts’ fitness. Analyses of fluorescence-tagged single-copy reporter plasmids and/or the plasmid partitioning proteins in native and non-native hosts reveal chromosome-hitchhiking as the likely means for plasmid segregation. The contribution of the partitioning system to equal segregation is bipartite- replication-independent and replication-dependent. The former nearly eliminates ‘mother bias’ (preferential plasmid retention in the mother cell) according to binomial distribution, thus limiting equal segregation of a plasmid pair to 50%. The latter enhances equal segregation of plasmid sisters beyond this level, elevating the plasmid close to chromosome status. Host factors involved in plasmid partitioning can be functionally separated by their participation in the replication-independent and/or replication-dependent steps. In the hitchhiking model, random tethering of a pair of plasmids to chromosomes signifies the replication-independent component of segregation; the symmetric tethering of plasmid sisters to sister chromatids embodies the replication-dependent component. The 2-micron circle broadly resembles the episomes of certain mammalian viruses in its chromosome-associated propagation. This unifying feature among otherwise widely differing selfish genomes suggests their evolutionary convergence to the common logic of exploiting, albeit via distinct molecular mechanisms, host chromosome segregation machineries for self-preservation. PMID:27492289

Construction of a novel gene bank of Bacillus subtilis using a low copy number vector in Escherichia coli.

PubMed

Hasnain, S; Thomas, C M

1986-07-01

Low copy number vector plasmid pCT571 was constructed to clone Bacillus subtilis genomic fragments in Escherichia coli. pCT571 confers KmR, TcR and CmR in E. coli and CmR in B. subtilis. It has unique restriction sites within the KmR and TcR markers to allow screening for recombinant plasmids by insertional inactivation of these genes. It contains the pSC101 replicon and replicates normally at six to eight copies per chromosome equivalent in E. coli. It also contains oriVRK2, which when supplied with the product of the trfA gene of RK2 in trans, allows pCT571 to replicate at 35-40 copies per chromosome equivalent. A B. subtilis gene bank was created by cloning partially Sau3A-digested and size-fractionated fragments of B. subtilis chromosomal DNA into the BamHI site of pCT571. DNA from 1097 KmR TcS transformants was extracted and analysed electrophoretically as supercoiled DNA and after digesting with EcoRI or EcoRI and SalI. Approximately 1000 hybrid plasmids were found with reasonably sized B. subtilis fragments. The mean size of the inserts in pCT571 is 8 kb, ranging from 4 to 20 kb in different plasmids. The gene bank covers most of the B. subtilis chromosome, as demonstrated by the results of screening the gene bank for selectable nutritional markers in E. coli and B. subtilis. Hybrid plasmids which complement E. coli mutants for arg, his, lys, met, pdx, pyr and thr markers were identified from the gene bank. In B. subtilis the presence of argC, cysA, dal, hisA, ilvA, leuA, lys, metB, metC, phe, purA, purB, thr and trpC was established by transformation experiments. The effects of copy number on cloning and long-term maintenance in the bacterial strains were also investigated. At high copy number some hybrid plasmids cannot be maintained at all, while others show an increased rate of structural deletions and rearrangements.

Sequence and immunogenicity of a clinically approved novel measles virus vaccine vector

PubMed Central

Zuniga, Amando; Liniger, Mathias; Morin, Teldja Neige Azzouz; Marty, René R.; Wiegand, Marian; Ilter, Orhan; Weibel, Sara; Billeter, Martin A.; Knuchel, Marlyse C.; Naim, Hussein Y.

2013-01-01

The measles virus vaccine (MVbv) is a clinically certified and well-tolerated vaccine strain that has been given both parenterally and mucosally. It has been extensively used in children and has proven to be safe and effective in eliciting protective immunity. This specific strain was therefore chosen to generate a measles viral vector. The genome of the commercial MVbv vaccine strain was isolated, sequenced and a plasmid, p(+)MVb, enabling transcription of the viral antigenome and rescue of MVb, was constructed. Phylogenic and phenotypic analysis revealed that MVbv and the rescued MVb constitute another evolutionary branch within the hitherto classified measles vaccines. Plasmid p(+)MVb was modified by insertion of artificial MV-type transcription units (ATUs) for the generation of recombinant viruses (rMVb) expressing additional proteins. Replication characteristics and immunogenicity of rMVb vectors were similar to the parental MVbv and to other vaccine strains. The expression of the additional proteins was stable over 10 serial virus transfers, which corresponds to an amplification greater than 1020. The excellent safety record and its efficient application as aerosol may add to the usefulness of the derived vectors. PMID:23324616

Coupling between the basic replicon and the Kis-Kid maintenance system of plasmid R1: modulation by Kis antitoxin levels and involvement in control of plasmid replication.

PubMed

López-Villarejo, Juan; Lobato-Márquez, Damián; Díaz-Orejas, Ramón

2015-02-05

kis-kid, the auxiliary maintenance system of plasmid R1 and copB, the auxiliary copy number control gene of this plasmid, contribute to increase plasmid replication efficiency in cells with lower than average copy number. It is thought that Kis antitoxin levels decrease in these cells and that this acts as the switch that activates the Kid toxin; activated Kid toxin reduces copB-mRNA levels and this increases RepA levels that increases plasmid copy number. In support of this model we now report that: (i) the Kis antitoxin levels do decrease in cells containing a mini-R1 plasmid carrying a repA mutation that reduces plasmid copy number; (ii) kid-dependent replication rescue is abolished in cells in which the Kis antitoxin levels or the CopB levels are increased. Unexpectedly we found that this coordination significantly increases both the copy number of the repA mutant and of the wt mini-R1 plasmid. This indicates that the coordination between plasmid replication functions and kis-kid system contributes significantly to control plasmid R1 replication.

Coupling between the Basic Replicon and the Kis-Kid Maintenance System of Plasmid R1: Modulation by Kis Antitoxin Levels and Involvement in Control of Plasmid Replication

PubMed Central

López-Villarejo, Juan; Lobato-Márquez, Damián; Díaz-Orejas, Ramón

2015-01-01

kis-kid, the auxiliary maintenance system of plasmid R1 and copB, the auxiliary copy number control gene of this plasmid, contribute to increase plasmid replication efficiency in cells with lower than average copy number. It is thought that Kis antitoxin levels decrease in these cells and that this acts as the switch that activates the Kid toxin; activated Kid toxin reduces copB-mRNA levels and this increases RepA levels that increases plasmid copy number. In support of this model we now report that: (i) the Kis antitoxin levels do decrease in cells containing a mini-R1 plasmid carrying a repA mutation that reduces plasmid copy number; (ii) kid-dependent replication rescue is abolished in cells in which the Kis antitoxin levels or the CopB levels are increased. Unexpectedly we found that this coordination significantly increases both the copy number of the repA mutant and of the wt mini-R1 plasmid. This indicates that the coordination between plasmid replication functions and kis-kid system contributes significantly to control plasmid R1 replication. PMID:25664511

Utilization of Virus ϕCh1 Elements To Establish a Shuttle Vector System for Halo(alkali)philic Archaea via Transformation of Natrialba magadii

PubMed Central

Mayrhofer-Iro, M.; Ladurner, A.; Meissner, C.; Derntl, C.; Reiter, M.; Haider, F.; Dimmel, K.; Rössler, N.; Klein, R.; Baranyi, U.; Scholz, H.

2013-01-01

In the study described here, we successfully developed a transformation system for halo(alkali)philic members of the Archaea. This transformation system comprises a series of Natrialba magadii/Escherichia coli shuttle vectors based on a modified method to transform halophilic members of the Archaea and genomic elements of the N. magadii virus ϕCh1. The shuttle vector pRo-5, based on the repH-containing region of ϕCh1, stably replicated in E. coli and N. magadii and in several halophilic and haloalkaliphilic members of the Archaea not transformable so far. The ϕCh1 operon ORF53/ORF54 (repH) was essential for pRo-5 replication and was thus identified as the minimal replication origin. The plasmid allowed homologous and heterologous gene expression, as exemplified by the expression of ϕCh1 ORF3452, which encodes a structural protein, and the reporter gene bgaH of Haloferax lucentense in N. magadii. The new transformation/vector system will facilitate genetic studies within N. magadii and other haloalkaliphilic archaea and will allow the detailed characterization of the gene functions of N. magadii virus ϕCh1 in their extreme environments. PMID:23416999

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

Host range diversification within the IncP-1 plasmid group

PubMed Central

Yano, Hirokazu; Rogers, Linda M.; Knox, Molly G.; Heuer, Holger; Smalla, Kornelia; Brown, Celeste J.

2013-01-01

Broad-host-range plasmids play a critical role in the spread of antibiotic resistance and other traits. In spite of increasing information about the genomic diversity of closely related plasmids, the relationship between sequence divergence and host range remains unclear. IncP-1 plasmids are currently classified into six subgroups based on the genetic distance of backbone genes. We investigated whether plasmids from two subgroups exhibit a different host range, using two IncP-1γ plasmids, an IncP-1β plasmid and their minireplicons. Efficiencies of plasmid establishment and maintenance were compared using five species that belong to the Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria. The IncP-1β plasmid replicated and persisted in all five hosts in the absence of selection. Of the two IncP-1γ plasmids, both were unable to replicate in alphaproteobacterial host Sphingobium japonicum, and one established itself in Agrobacterium tumefaciens but was very unstable. In contrast, both IncP-1γ minireplicons, which produced higher levels of replication initiation protein than the wild-type plasmids, replicated in all strains, suggesting that poor establishment of the native plasmids is in part due to suboptimal replication initiation gene regulation. The findings suggest that host ranges of distinct IncP-1 plasmids only partially overlap, which may limit plasmid recombination and thus result in further genome divergence. PMID:24002747

Identification, Characterization, and Application of the Replicon Region of the Halophilic Temperate Sphaerolipovirus SNJ1.

PubMed

Wang, Yuchen; Sima, Linshan; Lv, Jie; Huang, Suiyuan; Liu, Ying; Wang, Jiao; Krupovic, Mart; Chen, Xiangdong

2016-07-15

The temperate haloarchaeal virus SNJ1 displays lytic and lysogenic life cycles. During the lysogenic cycle, the virus resides in its host, Natrinema sp. strain J7-1, in the form of an extrachromosomal circular plasmid, pHH205. In this study, a 3.9-kb region containing seven predicted genes organized in two operons was identified as the minimal replicon of SNJ1. Only RepA, encoded by open reading frame 11-12 (ORF11-12), was found to be essential for replication, and its expression increased during the lytic cycle. Sequence analysis suggested that RepA is a distant homolog of HUH endonucleases, a superfamily that includes rolling-circle replication initiation proteins from various viruses and plasmids. In addition to RepA, two genetic elements located within both termini of the 3.9-kb replicon were also required for SNJ1 replication. SNJ1 genome and SNJ1 replicon-based shuttle vectors were present at 1 to 3 copies per chromosome. However, the deletion of ORF4 significantly increased the SNJ1 copy number, suggesting that the product of ORF4 is a negative regulator of SNJ1 abundance. Shuttle vectors based on the SNJ1 replicon were constructed and validated for stable expression of heterologous proteins, both in J7 derivatives and in Natrinema pallidum JCM 8980(T), suggesting their broad applicability as genetic tools for Natrinema species. Archaeal viruses exhibit striking morphological diversity and unique gene content. In this study, the minimal replicon of the temperate haloarchaeal virus SNJ1 was identified. A number of ORFs and genetic elements controlling virus genome replication, maintenance, and copy number were characterized. In addition, based on the replicon, a novel expression shuttle vector has been constructed and validated for protein expression and purification in Natrinema sp. CJ7 and Natrinema pallidum JCM 8980(T) This study not only provided mechanistic and functional insights into SNJ1 replication but also led to the development of useful genetic tools to investigate SNJ1 and other viruses infecting Natrinema species as well as their hosts. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Reverse Genetics for Mammalian Orthoreovirus.

PubMed

Stuart, Johnasha D; Phillips, Matthew B; Boehme, Karl W

2017-01-01

Reverse genetics allows introduction of specific alterations into a viral genome. Studies performed with mutant viruses generated using reverse genetics approaches have contributed immeasurably to our understanding of viral replication and pathogenesis, and also have led to development of novel vaccines and virus-based vectors. Here, we describe the reverse genetics system that allows for production and recovery of mammalian orthoreovirus, a double-stranded (ds) RNA virus, from plasmids that encode the viral genome.

Biochemistry and genetics of autotrophy in Methanococcus. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whitman, W.B.

In the last two years of this research, the most exciting results have come from the work on the genetics of methanococci. First, the author demonstrated that the cryptic plasmid from Methanococcus maripaludis C5, pURB500, could be transformed into Methanococcus maripaludis JJ. Strain JJ is the type strain of M. maripaludis and has only about 65% DNA:DNA hybridization to strain C5. Because of the low relatedness of these strains, it was not obvious that pURB500 could be transferred between them. This goal was achieved by first transforming strain C5 with a series of suicide plasmids containing the pac cassette, whichmore » possessed the selectable puromycin resistance marker, and different cloned fragments of pURB500. From the puromycin-resistant transformants, a plasmid was isolated that transformed strain JJ. However, when this plasmid was electroporated into E. coli, only rearrangement products were obtained that contained small portions of the original pURB500. These plasmids no longer transformed Methanococcus. While these experiments did not yield a shuttle vector, they demonstrated that pURB500 could replicate in strain JJ.« less

Helper-Free Foamy Virus Vectors

PubMed Central

TROBRIDGE, GRANT D.; RUSSELL, DAVID W.

2010-01-01

Retroviral vectors based on human foamy virus (HFV) have been developed and show promise as gene therapy vehicles. Here we describe a method for the production of HFV vector stocks free of detectable helper virus. The helper and vector plasmid constructs used both lack the HFV bel genes, so recombination between these constructs cannot create a wild-type virus. A fusion promoter that combines portions of the cytomegalovirus (CMV) immediate-early and HFV long terminal repeat (LTR) promoters was used to drive expression of both the helper and vector constructs. The CMV–LTR fusion promoter allows for HFV vector production in the absence of the Bel-1 trans-activator protein, which would otherwise be necessary for efficient transcription from the HFV LTR. Vector stocks containing either neomycin phosphotransferase or alkaline phosphatase reporter genes were produced by transient transfection at titers greater than 105 transducing units/ml. G418-resistant BHK-21 cells obtained by transduction with neo vectors contained randomly integrated HFV vector proviruses without detectable deletions or rearrangements. The vector stocks generated were free of replication-competent retrovirus (RCR), as determined by assays for LTR trans-activation and a marker rescue assay developed here for the detection of Bel-independent RCR. OVERVIEW SUMMARY Vectors based on human foamy virus have been developed but low titers and the presence of replication-competent retrovirus (RCR) in vector stocks have prevented their use in preclinical animal experiments. We have developed a transient transfection method that can be used to produce replication-incompetent HFV vector stocks at titers greater than 105/ml, and that does not produce contaminating RCR. The use of CMV-HFV LTR fusion promoters in the helper and vector constructs has circumvented the requirement for the HFV Bel-1 trans-activator protein. Consequently, the potential for generating wild-type HFV by recombination between helper and vector constructs during vector production has been eliminated. Here we describe HFV vector production using this Bel-independent system. PMID:9853518

Chromosomal context and replication properties of ARS plasmids in Schizosaccharomyces pombe.

PubMed

Pratihar, Aditya S; Tripathi, Vishnu P; Yadav, Mukesh P; Dubey, Dharani D

2015-12-01

Short, specific DNA sequences called as Autonomously Replicating Sequence (ARS) elements function as plasmid as well as chromosomal replication origins in yeasts. As compared to ARSs, different chromosomal origins vary greatly in their efficiency and timing of replication probably due to their wider chromosomal context. The two Schizosaccharomyces pombe ARS elements, ars727 and ars2004, represent two extremities in their chromosomal origin activity - ars727 is inactive and late replicating, while ars2004 is a highly active, early-firing origin. To determine the effect of chromosomal context on the activity of these ARS elements, we have cloned them with their extended chromosomal context as well as in the context of each other in both orientations and analysed their replication efficiency by ARS and plasmid stability assays. We found that these ARS elements retain their origin activity in their extended/altered context. However, deletion of a 133-bp region of the previously reported ars727- associated late replication enforcing element (LRE) caused advancement in replication timing of the resulting plasmid. These results confirm the role of LRE in directing plasmid replication timing and suggest that the plasmid origin efficiency of ars2004 or ars727 remains unaltered by the extended chromosomal context.

Enhanced Control of Pathogenic Simian Immunodeficiency Virus SIVmac239 Replication in Macaques Immunized with an Interleukin-12 Plasmid and a DNA Prime-Viral Vector Boost Vaccine Regimen ▿ §

PubMed Central

Winstone, Nicola; Wilson, Aaron J.; Morrow, Gavin; Boggiano, Cesar; Chiuchiolo, Maria J.; Lopez, Mary; Kemelman, Marina; Ginsberg, Arielle A.; Mullen, Karl; Coleman, John W.; Wu, Chih-Da; Narpala, Sandeep; Ouellette, Ian; Dean, Hansi J.; Lin, Feng; Sardesai, Niranjan Y.; Cassamasa, Holly; McBride, Dawn; Felber, Barbara K.; Pavlakis, George N.; Schultz, Alan; Hudgens, Michael G.; King, C. Richter; Zamb, Timothy J.; Parks, Christopher L.; McDermott, Adrian B.

2011-01-01

DNA priming has previously been shown to elicit augmented immune responses when administered by electroporation (EP) or codelivered with a plasmid encoding interleukin-12 (pIL-12). We hypothesized that the efficacy of a DNA prime and recombinant adenovirus 5 boost vaccination regimen (DNA/rAd5) would be improved when incorporating these vaccination strategies into the DNA priming phase, as determined by pathogenic simian immunodeficiency virus SIVmac239 challenge outcome. The whole SIVmac239 proteome was delivered in 5 separate DNA plasmids (pDNA-SIV) by EP with or without pIL-12, followed by boosting 4 months later with corresponding rAd5-SIV vaccine vectors. Remarkably, after repeated low-dose SIVmac239 mucosal challenge, we demonstrate 2.6 and 4.4 log reductions of the median SIV peak and set point viral loads in rhesus macaques (RMs) that received pDNA-SIV by EP with pIL-12 compared to the median peak and set point viral loads in mock-immunized controls (P < 0.01). In 5 out of 6 infected RMs, strong suppression of viremia was observed, with intermittent “blips” in virus replication. In 2 RMs, we could not detect the presence of SIV RNA in tissue and lymph nodes, even after 13 viral challenges. RMs immunized without pIL-12 demonstrated a typical maximum of 1.5 log reduction in virus load. There was no significant difference in the overall magnitude of SIV-specific antibodies or CD8 T-cell responses between groups; however, pDNA delivery by EP with pIL-12 induced a greater magnitude of SIV-specific CD4 T cells that produced multiple cytokines. This vaccine strategy is relevant for existing vaccine candidates entering clinical evaluation, and this model may provide insights into control of retrovirus replication. PMID:21734035

Phagemid vectors for phage display: properties, characteristics and construction.

PubMed

Qi, Huan; Lu, Haiqin; Qiu, Hua-Ji; Petrenko, Valery; Liu, Aihua

2012-03-30

Phagemids are filamentous-phage-derived vectors containing the replication origin of a plasmid. Phagemids usually encode no or only one kind of coat proteins. Other structural and functional proteins necessary to accomplish the life cycle of phagemid are provided by the helper phage. In addition, other elements such as molecular tags and selective markers are introduced into the phagemids to facilitate the subsequent operations, such as gene manipulation and protein purification. This review summarizes the elements of the phagemids and their corresponding functions. Finally, the possible trends and future direction to improve the characteristics of the phagemids are highlighted. Copyright © 2012 Elsevier Ltd. All rights reserved.

Lambda Red Mediated Gap Repair Utilizes a Novel Replicative Intermediate in Escherichia coli

PubMed Central

Reddy, Thimma R.; Fevat, Léna M. S.; Munson, Sarah E.; Stewart, A. Francis; Cowley, Shaun M.

2015-01-01

The lambda phage Red recombination system can mediate efficient homologous recombination in Escherichia coli, which is the basis of the DNA engineering technique termed recombineering. Red mediated insertion of DNA requires DNA replication, involves a single-stranded DNA intermediate and is more efficient on the lagging strand of the replication fork. Lagging strand recombination has also been postulated to explain the Red mediated repair of gapped plasmids by an Okazaki fragment gap filling model. Here, we demonstrate that gap repair involves a different strand independent mechanism. Gap repair assays examining the strand asymmetry of recombination did not show a lagging strand bias. Directly testing an ssDNA plasmid showed lagging strand recombination is possible but dsDNA plasmids did not employ this mechanism. Insertional recombination combined with gap repair also did not demonstrate preferential lagging strand bias, supporting a different gap repair mechanism. The predominant recombination route involved concerted insertion and subcloning though other routes also operated at lower frequencies. Simultaneous insertion of DNA resulted in modification of both strands and was unaffected by mutations to DNA polymerase I, responsible for Okazaki fragment maturation. The lower efficiency of an alternate Red mediated ends-in recombination pathway and the apparent lack of a Holliday junction intermediate suggested that gap repair does not involve a different Red recombination pathway. Our results may be explained by a novel replicative intermediate in gap repair that does not involve a replication fork. We exploited these observations by developing a new recombineering application based on concerted insertion and gap repair, termed SPI (subcloning plus insertion). SPI selected against empty vector background and selected for correct gap repair recombinants. We used SPI to simultaneously insert up to four different gene cassettes in a single recombineering reaction. Consequently, our findings have important implications for the understanding of E. coli replication and Red recombination. PMID:25803509

Single-Vector, Single-Injection Recombinant Vesicular Stomatitis Virus Vaccines Against High-Containment Viruses.

PubMed

Whitt, Michael A; Geisbert, Thomas W; Mire, Chad E

2016-01-01

There are many avenues for making an effective vaccine against viruses. Depending on the virus these can include one of the following: inactivation of whole virions; attenuation of viruses; recombinant viral proteins; non-replication-competent virus particles; or surrogate virus vector systems such as vesicular stomatitis virus (VSV). VSV is a prototypic enveloped animal virus that has been used for over four decades to study virus replication, entry, and assembly due to its ability to replicate to high titers in a wide variety of mammalian and insect cells. The use of reverse genetics to recover infectious and single-cycle replicating VSV from plasmid DNA transfected in cell culture began a revolution in the study of recombinant VSV (rVSV). This platform can be manipulated to study the viral genetic sequences and proteins important in the virus life cycle. Additionally, foreign genes can be inserted between naturally occurring or generated start/stop signals and polyadenylation sites within the VSV genome. VSV has a tolerance for foreign gene expression which has led to numerous rVSVs reported in the literature. Of particular interest are the very effective single-dose rVSV vaccine vectors against high-containment viruses such as filoviruses, henipaviruses, and arenaviruses. Herein we describe the methods for selecting foreign antigenic genes, selecting the location within the VSV genome for insertion, generation of rVSV using reverse genetics, and proper vaccine study designs.

Epstein-Barr virus origin of lytic replication mediates association of replicating episomes with promyelocytic leukaemia protein nuclear bodies and replication compartments.

PubMed

Amon, Wolfgang; White, Robert E; Farrell, Paul J

2006-05-01

Epstein-Barr virus (EBV) establishes a latent persistence from which it can be reactivated to undergo lytic replication. Late lytic-cycle gene expression is linked to lytic DNA replication, as it is sensitive to the same inhibitors that block lytic replication, and it has recently been shown that the viral origin of lytic replication (ori lyt) is required in cis for late-gene expression. During the lytic cycle, the viral genome forms replication compartments, which are usually adjacent to promyelocytic leukaemia protein (PML) nuclear bodies. A tetracycline repressor DNA-binding domain-enhanced green fluorescent protein fusion was used to visualize replicating plasmids carrying a tetracycline operator sequence array. ori lyt mediated the production of plasmid replication compartments that were associated with PML nuclear bodies. Plasmids carrying ori lyt and EBV itself were visualized in the same cells and replicated in similar regions of the nucleus, further supporting the validity of the plasmids for studying late-gene regulation.

Initiation preference at a yeast origin of replication.

PubMed

Brewer, B J; Fangman, W L

1994-04-12

Replication origins in the yeast Saccharomyces cerevisiae are identified as autonomous replication sequence (ARS) elements. To examine the effect of origin density on replication initiation, we have analyzed the replication of a plasmid that contains two copies of the same origin, ARS1. The activation of origins and the direction that replication forks move through flanking sequences can be physically determined by analyzing replication intermediates on two-dimensional agarose gels. We find that only one of the two identical ARSs on the plasmid initiates replication on any given plasmid molecule; that is, this close spacing of ARSs results in an apparent interference between the potential origins. Moreover, in the particular plasmid that we constructed, one of the two identical copies of ARS1 is used four times more frequently than the other one. These results show that the plasmid context is critical for determining the preferred origin. This origin preference is also exhibited when the tandem copies of ARS1 are introduced into a yeast chromosome. The sequences responsible for establishing the origin preference have been identified by deletion analysis and are found to reside in a portion of the yeast URA3 gene.

Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.

PubMed

Dad, A-B K; Ramakrishna, S; Song, M; Kim, H

2014-11-01

Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Shifts in Host Range of a Promiscuous Plasmid through Parallel Evolution of its Replication Initiation Protein

PubMed Central

Sota, Masahiro; Yano, Hirokazu; Hughes, Julie; Daughdrill, Gary W.; Abdo, Zaid; Forney, Larry J.; Top, Eva M.

2011-01-01

The ability of bacterial plasmids to adapt to novel hosts and thereby shift their host range is key to their long-term persistence in bacterial communities. Promiscuous plasmids of the IncP-1 group can colonize a wide range of hosts, but it is not known if and how they can contract, shift or further expand their host range. To understand the evolutionary mechanisms of host range shifts of IncP-1 plasmids, an IncP-1β mini-replicon was experimentally evolved in four hosts wherein it was initially unstable. After 1000 generations in serial batch cultures under antibiotic selection for plasmid maintenance (kanamycin resistance), the stability of the mini-plasmid had dramatically improved in all coevolved hosts. However, only plasmids evolved in Shewanella oneidensis showed improved stability in the ancestor, indicating that adaptive mutations had occurred in the plasmid itself. Complete genome sequence analysis of nine independently evolved plasmids showed seven unique plasmid genotypes that had various kinds of single mutations at one locus, namely the N-terminal region of the replication initiation protein TrfA. Such parallel evolution indicates that this region was under strong selection. In five of the seven evolved plasmids these trfA mutations resulted in a significantly higher plasmid copy number. Evolved plasmids were found to be stable in four other naïve hosts, but could no longer replicate in Pseudomonas aeruginosa. This study demonstrates that plasmids can specialize to a novel host through trade-offs between improved stability in the new host and the ability to replicate in a previously permissive host. PMID:20520653

The history of vaccination against cytomegalovirus.

PubMed

Plotkin, Stanley

2015-06-01

Cytomegalovirus vaccine development started in the 1970s with attenuated strains. In the 1980s, one of the strains was shown to be safe and effective in renal transplant patients. Then, attention switched to glycoprotein gB, which was shown to give moderate but transient protection against acquisition of the virus by women. The identification of the pp65 tegument protein as the principal target of cellular immune responses resulted in new approaches, particularly DNA, plasmids to protect hematogenous stem cell recipients. The subsequent discovery of the pentameric protein complex that generates most neutralizing antibodies led to efforts to incorporate that complex into vaccines. At this point, there are many candidate CMV vaccines, including live recombinants, replication-defective virus, DNA plasmids, soluble pentameric proteins, peptides, virus-like particles and vectored envelope proteins.

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE PAGES

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.; ...

2018-01-25

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

Two novel families of plasmids from hyperthermophilic archaea encoding new families of replication proteins

PubMed Central

Soler, Nicolas; Marguet, Evelyne; Cortez, Diego; Desnoues, Nicole; Keller, Jenny; van Tilbeurgh, Herman; Sezonov, Guennadi; Forterre, Patrick

2010-01-01

Thermococcales (phylum Euryarchaeota) are model organisms for physiological and molecular studies of hyperthermophiles. Here we describe three new plasmids from Thermococcales that could provide new tools and model systems for genetic and molecular studies in Archaea. The plasmids pTN2 from Thermococcus nautilus sp. 30-1 and pP12-1 from Pyrococcus sp. 12-1 belong to the same family. They have similar size (∼12 kb) and share six genes, including homologues of genes encoded by the virus PAV1 from Pyrococcus abyssi. The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales. Our analyses confirm that viruses and plasmids are evolutionary related and co-evolve with their hosts. Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism. The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase. This strengthens the idea that plasmids and viruses are a reservoir of novel protein families involved in DNA replication. PMID:20403814

Saccharomyces cerevisiae Shuttle vectors.

PubMed

Gnügge, Robert; Rudolf, Fabian

2017-05-01

Yeast shuttle vectors are indispensable tools in yeast research. They enable cloning of defined DNA sequences in Escherichia coli and their direct transfer into Saccharomyces cerevisiae cells. There are three types of commonly used yeast shuttle vectors: centromeric plasmids, episomal plasmids and integrating plasmids. In this review, we discuss the different plasmid systems and their characteristic features. We focus on their segregational stability and copy number and indicate how to modify these properties. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Genetic alteration of Mycobacterium smegmatis to improve mycobacterium-mediated transfer of plasmid DNA into mammalian cells and DNA immunization.

PubMed

Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J

2007-10-01

Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.

Genetic transformation of a clinical (genital tract), plasmid-free isolate of Chlamydia trachomatis: engineering the plasmid as a cloning vector.

PubMed

Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N

2013-01-01

Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.

A novel small animal model to study the replication of simian foamy virus in vivo.

PubMed

Blochmann, Rico; Curths, Christoph; Coulibaly, Cheick; Cichutek, Klaus; Kurth, Reinhard; Norley, Stephen; Bannert, Norbert; Fiebig, Uwe

2014-01-05

Preclinical evaluation in a small animal model would help the development of gene therapies and vaccines based on foamy virus vectors. The establishment of persistent, non-pathogenic infection with the prototype foamy virus in mice and rabbits has been described previously. To extend this spectrum of available animal models, hamsters were inoculated with infectious cell supernatant or bioballistically with a foamy virus plasmid. In addition, a novel foamy virus from a rhesus macaque was isolated and characterised genetically. Hamsters and mice were infected with this new SFVmac isolate to evaluate whether hamsters are also susceptible to infection. Both hamsters and mice developed humoral responses to either virus subtype. Virus integration and replication in different animal tissues were analysed by PCR and co-cultivation. The results strongly indicate establishment of a persistent infection in hamsters. These studies provide a further small animal model for studying FV-based vectors in addition to the established models. © 2013 Elsevier Inc. All rights reserved.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Role of the 85-Kilobase Plasmid and Plasmid-Encoded Virulence-Associated Protein A in Intracellular Survival and Virulence of Rhodococcus equi

PubMed Central

Giguère, Steeve; Hondalus, Mary K.; Yager, Julie A.; Darrah, Patricia; Mosser, David M.; Prescott, John F.

1999-01-01

Rhodococcus equi is a facultative intracellular pathogen of macrophages and a cause of pneumonia in young horses (foals) and immunocompromised people. Isolates of R. equi from pneumonic foals typically contain large, 85- or 90-kb plasmids encoding a highly immunogenic virulence-associated protein (VapA). The objective of this study was to determine the role of the 85-kb plasmid and VapA in the intracellular survival and virulence of R. equi. Clinical isolates containing the plasmid and expressing VapA efficiently replicated within mouse macrophages in vitro, while plasmid-cured derivatives of these organisms did not multiply intracellularly. An isolate harboring the large plasmid also replicated in the tissues of experimentally infected mice, whereas its plasmid-cured derivative was rapidly cleared. All foals experimentally infected with a plasmid-containing clinical isolate developed severe bronchopneumonia, whereas the foals infected with its plasmid-cured derivative remained asymptomatic and free of visible lung lesions. By day 14 postinfection, lung bacterial burdens had increased considerably in foals challenged with the plasmid-containing clinical isolate. In contrast, bacteria could no longer be cultured from the lungs of foals challenged with the isogenic plasmid-cured derivative. A recombinant, plasmid-cured derivative expressing wild-type levels of VapA failed to replicate in macrophages and remained avirulent for both mice and foals. These results show that the 85-kb plasmid of R. equi is essential for intracellular replication within macrophages and for development of disease in the native host, the foal. However, expression of VapA alone is not sufficient to restore the virulence phenotype. PMID:10377138

DNA adenine methylation is required to replicate both Vibrio cholerae chromosomes once per cell cycle.

PubMed

Demarre, Gaëlle; Chattoraj, Dhruba K

2010-05-06

DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated) sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII) of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.

Kis antitoxin couples plasmid R1 replication and parD (kis,kid) maintenance modules.

PubMed

López-Villarejo, Juan; Diago-Navarro, Elizabeth; Hernández-Arriaga, Ana María; Díaz-Orejas, Ramón

2012-03-01

The coupling between the replication and parD (kis, kid) maintenance modules of R1 has been revisited here by the isolation of a significant collection of conditional replication mutants in the pKN1562 mini-R1 plasmid, and in its derivative, pJLV01, specifically affected in the RNase activity of the Kid toxin. This new analysis aims to identify key factors in this coupling. For this purpose we have quantified and characterized the restriction introduced by parD to isolate conditional replication mutants of this plasmid, a signature of the modular coupling. This restriction depends on the RNase activity of the Kid toxin and it is relieved by either over-expression of the Kis antitoxin or by preventing its degradation by Lon and ClpAP proteases. Based on these data and on the correlation between copy numbers and parD transcriptional levels obtained in the different mutants, it is proposed that a reduction of Kis antitoxin levels in response to inefficient plasmid replication is the key factor for coupling plasmid replication and parD modules. Copyright © 2012 Elsevier Inc. All rights reserved.

Roles of Long and Short Replication Initiation Proteins in the Fate of IncP-1 Plasmids

PubMed Central

Yano, Hirokazu; Deckert, Gail E.; Rogers, Linda M.

2012-01-01

Broad-host-range IncP-1 plasmids generally encode two replication initiation proteins, TrfA1 and TrfA2. TrfA2 is produced from an internal translational start site within trfA1. While TrfA1 was previously shown to be essential for replication in Pseudomonas aeruginosa, its role in other bacteria within its broad host range has not been established. To address the role of TrfA1 and TrfA2 in other hosts, efficiency of transformation, plasmid copy number (PCN), and plasmid stability were first compared between a mini-IncP-1β plasmid and its trfA1 frameshift variant in four phylogenetically distant hosts: Escherichia coli, Pseudomonas putida, Sphingobium japonicum, and Cupriavidus necator. TrfA2 was sufficient for replication in these hosts, but the presence of TrfA1 enhanced transformation efficiency and PCN. However, TrfA1 did not contribute to, and even negatively affected, long-term plasmid persistence. When trfA genes were cloned under a constitutive promoter in the chromosomes of the four hosts, strains expressing either both TrfA1 and TrfA2 or TrfA1 alone, again, generally elicited a higher PCN of an IncP1-β replicon than strains expressing TrfA2 alone. When a single species of TrfA was produced at different concentrations in E. coli cells, TrfA1 maintained a 3- to 4-fold higher PCN than TrfA2 at the same TrfA concentrations, indicating that replication mediated by TrfA1 is more efficient than that by TrfA2. These results suggest that the broad-host-range properties of IncP-1 plasmids are essentially conferred by TrfA2 and the intact replication origin alone but that TrfA1 is nonetheless important to efficiently establish plasmid replication upon transfer into a broad range of hosts. PMID:22228734

Parvoviral Left-End Hairpin Ears Are Essential during Infection for Establishing a Functional Intranuclear Transcription Template and for Efficient Progeny Genome Encapsidation

PubMed Central

Li, Lei; Cotmore, Susan F.

2013-01-01

The 121-nucleotide left-end telomere of Minute Virus of Mice (MVM) can be folded into a Y-shaped hairpin with short axial ears that are highly conserved within genus Parvovirus. To explore their potential role(s) during infection, we constructed infectious plasmid clones that lacked one or other ear. Although these were nonviable when transfected into A9 cells, excision of the viral genome and DNA amplification appeared normal, and viral transcripts and proteins were expressed, but progeny virion production was minimal, supporting the idea of a potential role for the ears in genome packaging. To circumvent the absence of progeny that confounded further analysis of these mutants, plasmids were transfected into 293T cells both with and without an adenovirus helper construct, generating single bursts of progeny. These virions bound to A9 cells and were internalized but failed to initiate viral transcription, protein expression, or DNA replication. No defects in mutant virion stability or function could be detected in vitro. Significantly, mutant capsid gene expression and DNA replication could be rescued by coinfection with wild-type virions carrying a replication-competent, capsid-gene-replacement vector. To pinpoint where such complementation occurred, prior transfection of plasmids expressing only MVM nonstructural proteins was explored. NS1 alone, but not NS2, rescued transcription and protein expression from both P4 and P38 promoters, whereas NS1 molecules deleted for their C-terminal transactivation domain did not. These results suggest that the mutant virions reach the nucleus, uncoat, and are converted to duplex DNA but require an intact left-end hairpin structure to form the initiating transcription complex. PMID:23903839

Evidence for autonomous replication and stabilization of recombinant plasmids in the transformants of yeast Hansenula polymorpha.

PubMed

Tikhomirova, L P; Ikonomova, R N; Kuznetsova, E N

1986-01-01

For the transformation of the yeast Hansenula polymorpha we have constructed a set of hybrid plasmids carrying the LEU2 gene of Saccharomyces cerevisiae as a selective marker and fragments of mitochondrial DNA of Candida utilis and H. polymorpha or chromosomal DNA fragments of H. polymorpha as replicator sequences. The replication properties of chimeric plasmids in the yeast H. polymorpha were investigated. We showed that for plasmids propagated autonomously in this yeast the plasmid monomers could be detected in the transformants only during the immediate time after the transformation event. Further growth under selective conditions led to the selection of polymeric forms of plasmid DNA as it was clearly shown for transformants carrying cosmid pL2 with mtDNA fragment of C. utilis. Such transformants carrying polymerized plasmids showed a remarkably increased stability of the transformed phenotype. Cosmid pL2 was able to shuttle between Escherichia coli, S. cerevisiae and H. polymorpha, whereas plasmids with DNA fragments from H. polymorpha did not transform S. cerevisiae effectively.

Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

PubMed

Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

2003-05-01

Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

Structure-Function Aspects of Membrane Associated Prokaryotic DNA replication

DTIC Science & Technology

1994-09-01

Membrane associated DNA replication in prokaryotes has been studied intensively using two model systems, Bacillus subtilis and plasmid RK2 cultured...in its Escherichia coli host. In the former a new membrane protein that had previously been found to act as an inhibitor of DNA replication was...prior to a round of DNA replication . In the latter, plasmid DNA replication has been found to be associated with the inner but not outer membrane of

DIY series of genetic cassettes useful in construction of versatile vectors specific for Alphaproteobacteria.

PubMed

Dziewit, Lukasz; Adamczuk, Marcin; Szuplewska, Magdalena; Bartosik, Dariusz

2011-08-01

We have developed a DIY (Do It Yourself) series of genetic cassettes, which facilitate construction of novel versatile vectors for Alphaproteobacteria. All the cassettes are based on defined genetic modules derived from three natural plasmids of Paracoccus aminophilus JCM 7686. We have constructed over 50 DIY cassettes, which differ in structure and specific features. All of them are functional in eight strains representing three orders of Alphaproteobacteria: Rhodobacterales, Rhizobiales and Caulobacterales. Besides various replication and stabilization systems, many of the cassettes also contain selective markers appropriate for Alphaproteobacteria (40 cassettes) and genetic modules responsible for mobilization for conjugal transfer (24 cassettes). All the DIY cassettes are bordered by different types of polylinkers, which facilitate vector construction. Using these DIY cassettes, we have created a set of compatible Escherichia coli-Alphaproteobacteria mobilizable shuttle vectors (high or low copy number in E. coli), which will greatly assist the genetic manipulation of Alphaproteobacteria. Copyright © 2011 Elsevier B.V. All rights reserved.

DNA fusion product of phage P2 with plasmid pBR322 - A new phasmid

NASA Technical Reports Server (NTRS)

Nicoletti, M.; Bertani, G.

1983-01-01

The chromosome of the temperate bacteriophage P2 and that of the plasmid pBR322 have been joined in vitro after treatment with restriction endonuclease EcoRI. The fusion product - a phasmid - can behave as a plasmid, as a phage and as a prophage. It can replicate its DNA under the control of either the specific replication mechanism of the parent phage in a polA mutant or that of the parent plasmid in a rep mutant. Several interesting interactions between the two replication modes are indicated. In particular, phage particles may be produced even when the phage mode of DNA replication is blocked, and this throws new light on the involvement of the early gene A in the regulation of late gene expression in phage P2.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

PubMed

Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

2009-11-20

In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.

Characterization of replication and conjugation of plasmid pWTY27 from a widely distributed Streptomyces species

PubMed Central

2012-01-01

Background Streptomyces species are widely distributed in natural habitats, such as soils, lakes, plants and some extreme environments. Replication loci of several Streptomyces theta-type plasmids have been reported, but are not characterized in details. Conjugation loci of some Streptomyces rolling-circle-type plasmids are identified and mechanism of conjugal transferring are described. Results We report the detection of a widely distributed Streptomyces strain Y27 and its indigenous plasmid pWTY27 from fourteen plants and four soil samples cross China by both culturing and nonculturing methods. The complete nucleotide sequence of pWTY27 consisted of 14,288 bp. A basic locus for plasmid replication comprised repAB genes and an adjacent iteron sequence, to a long inverted-repeat (ca. 105 bp) of which the RepA protein bound specifically in vitro, suggesting that RepA may recognize a second structure (e.g. a long stem-loop) of the iteron DNA. A plasmid containing the locus propagated in linear mode when the telomeres of a linear plasmid were attached, indicating a bi-directional replication mode for pWTY27. As for rolling-circle plasmids, a single traA gene and a clt sequence (covering 16 bp within traA and its adjacent 159 bp) on pWTY27 were required for plasmid transfer. TraA recognized and bound specifically to the two regions of the clt sequence, one containing all the four DC1 of 7 bp (TGACACC) and one DC2 (CCCGCCC) and most of IC1, and another covering two DC2 and part of IC1, suggesting formation of a high-ordered DNA-protein complex. Conclusions This work (i) isolates a widespread Streptomyces strain Y27 and sequences its indigenous theta-type plasmid pWTY27; (ii) identifies the replication and conjugation loci of pWTY27 and; (iii) characterizes the binding sequences of the RepA and TraA proteins. PMID:23134842

Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

PubMed

Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

2013-05-01

Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

Construction of a novel shuttle vector for use in Gluconobacter oxydans.

PubMed

Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming

2010-11-01

A shuttle vector pZL1 which can replicate both in Gluconobacter oxydans and Escherichia coli was constructed based on G. oxydans DSM2003 cryptic plasmid pGOX3, a homology of G. oxydans 621H pGOX3, and E. coli cloning vector pUC18. It was found to be stably maintained in G. oxydans during the serial subcultures in the absence of antibiotic pressure for 144 h. With pGOX3 as the reference sample, the relative copy number of pZL1 in G. oxydans is 13 determined by real-time fluorescence quantitative PCR (qPCR). The copy number of pZL1 is much higher than pBBR1MCS5 in E. coli. The vector pZL1 contains six commonly used restriction endonuclease sites, HindIII, SalI, XbaI, BamHI, SmaI, KpnI, and SacI, and is easy to manipulate in molecular biology experiments. The shuttle vector was used to express a reporter protein wasabi successfully in G. oxydans DSM2003 under the control of the tufB promoter.

[Cloning and gene expression in lactic acid bacteria].

PubMed

Bondarenko, V M; Beliavskaia, V A

2000-01-01

The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.

Plasmid vectors for Xylella fastidiosa utilizing a toxin-antitoxin system for plasmid stability in the absence of antibiotic selection

USDA-ARS?s Scientific Manuscript database

The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacte...

The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

NASA Technical Reports Server (NTRS)

Ludwig, D. L.; Bruschi, C. V.

1991-01-01

The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

Characterization of the replication region of the Bacillus subtilis plasmid pLS20: a novel type of replicon.

PubMed Central

Meijer, W J; de Boer, A J; van Tongeren, S; Venema, G; Bron, S

1995-01-01

A 3.1 kb fragment of the large (approximately 55 kb) Bacillus subtilis plasmid pLS20 containing all the information for autonomous replication was cloned and sequenced. In contrast to the parental plasmid, derived minireplicons were unstably maintained. Using deletion analysis the fragment essential and sufficient for replication was delineated to 1.1 kb. This 1.1 kb fragment is located between two divergently transcribed genes, denoted orfA and orfB, neither of which is required for replication. orfA shows homology to the B.subtilis chromosomal genes rapA (spoOL, gsiA) and rapB (spoOP). The 1.1 kb fragment, which is characterized by the presence of several regions of dyad symmetry, contains no open reading frames of more than 85 codons and shows no similarity with other known plasmid replicons. The structural organization of the pLS20 minimal replicon is entirely different from that of typical rolling circle plasmids from Gram-positive bacteria. The pLS20 minireplicons replicate in polA5 and recA4 B.subtilis strains. Taken together, these results strongly suggest that pLS20 belongs to a new class of theta replicons. PMID:7667098

Phylogeny of replication initiator protein TrfA reveals a highly divergent clade of incompatibility group P1 plasmids

USDA-ARS?s Scientific Manuscript database

Incompatibility group P-1 (incP-1) includes broad host range plasmids of Gram negative bacteria and are classified into five subgroups (alpha, beta, gamma, delta, and epsilon). The incP-1 replication module consists of the trfA gene, encoding the replication initiator protein TrfA, and the origin o...

PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids

PubMed Central

Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua

2011-01-01

The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

8-Methoxypsoralen photoinduced plasmid-chromosome recombination in Saccharomyces cerevisiae using a centromeric vector.

PubMed Central

Meira, L B; Henriques, J A; Magaña-Schwencke, N

1995-01-01

The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218

Successful Establishment of Plasmids R1 and pMV158 in a New Host Requires the Relief of the Transcriptional Repression of Their Essential rep Genes

PubMed Central

Ruiz-Masó, José Á.; Luengo, Luis M.; Moreno-Córdoba, Inmaculada; Díaz-Orejas, Ramón; del Solar, Gloria

2017-01-01

Although differing in size, encoded traits, host range, and replication mechanism, both narrow-host-range theta-type conjugative enterobacterial plasmid R1 and promiscuous rolling-circle-type mobilizable streptococcal plasmid pMV158 encode a transcriptional repressor protein, namely CopB in R1 and CopG in pMV158, involved in replication control. The gene encoding CopB or CopG is cotranscribed with a downstream gene that encodes the replication initiator Rep protein of the corresponding plasmid. However, whereas CopG is an auto-repressor that inhibits transcription of the entire copG-repB operon, CopB is expressed constitutively and represses a second, downstream promoter that directs transcription of repA. As a consequence of the distinct regulatory pathways implied by CopB and CopG, these repressor proteins play a different role in control of plasmid replication during the steady state: while CopB has an auxiliary role by keeping repressed the regulated promoter whenever the plasmid copy number is above a low threshold, CopG plays a primary role by acting coordinately with RNAII. Here, we have studied the role of the regulatory circuit mediated by these transcriptional repressors during the establishment of these two plasmids in a new host cell, and found that excess Cop repressor molecules in the recipient cell result in a severe decrease in the frequency and/or the velocity of appearance of transformant colonies for the cognate plasmid but not for unrelated plasmids. Using the pMV158 replicon as a model system, together with highly sensitive real-time qPCR and inverse PCR methods, we have also analyzed the effect of CopG on the kinetics of repopulation of the plasmid in Streptococcus pneumoniae. We show that, whereas in the absence of CopG pMV158 repopulation occurs mainly during the first 45 min following plasmid transfer, the presence of the transcriptional repressor in the recipient cell severely impairs the replicon repopulation and makes the plasmid replicate at approximately the same rate as the chromosome at any time after transformation, which results in maximal plasmid loss rate in the absence of selection. Overall, these findings indicate that unrepressed activity of the Cop-regulated promoter is crucial for the successful colonization of the recipient bacterial cells by the plasmid. PMID:29250051

Plasmid Replicons from Pseudomonas Are Natural Chimeras of Functional, Exchangeable Modules

PubMed Central

Bardaji, Leire; Añorga, Maite; Ruiz-Masó, José A.; del Solar, Gloria; Murillo, Jesús

2017-01-01

Plasmids are a main factor for the evolution of bacteria through horizontal gene exchange, including the dissemination of pathogenicity genes, resistance to antibiotics and degradation of pollutants. Their capacity to duplicate is dependent on their replication determinants (replicon), which also define their bacterial host range and the inability to coexist with related replicons. We characterize a second replicon from the virulence plasmid pPsv48C, from Pseudomonas syringae pv. savastanoi, which appears to be a natural chimera between the gene encoding a newly described replication protein and a putative replication control region present in the widespread family of PFP virulence plasmids. We present extensive evidence of this type of chimerism in structurally similar replicons from species of Pseudomonas, including environmental bacteria as well as plant, animal and human pathogens. We establish that these replicons consist of two functional modules corresponding to putative control (REx-C module) and replication (REx-R module) regions. These modules are functionally separable, do not show specificity for each other, and are dynamically exchanged among replicons of four distinct plasmid families. Only the REx-C module displays strong incompatibility, which is overcome by a few nucleotide changes clustered in a stem-and-loop structure of a putative antisense RNA. Additionally, a REx-C module from pPsv48C conferred replication ability to a non-replicative chromosomal DNA region containing features associated to replicons. Thus, the organization of plasmid replicons as independent and exchangeable functional modules is likely facilitating rapid replicon evolution, fostering their diversification and survival, besides allowing the potential co-option of appropriate genes into novel replicons and the artificial construction of new replicon specificities. PMID:28243228

Detection of osteoclastic cell-cell fusion through retroviral vector packaging.

PubMed

Kondo, Takako; Ikeda, Kyoji; Matsuo, Koichi

2004-11-01

Cell-cell fusion generates multinucleated cells such as osteoclasts in bone, myotubes in muscle, and trophoblasts in placenta. Molecular details governing these fusion processes are still largely unknown. As a step toward identification of fusogenic genes, we tested the concept that retroviral vectors can be packaged as a result of cell-cell fusion. First, we introduced replication-deficient retroviral vectors expressing mCAT-1, which mediates fusogenic interaction with the retroviral envelope protein Env, into Chinese hamster ovary (CHO) cells to generate vector cells. Plasmids expressing virion proteins Gag, Pol, and Env were introduced into a separate culture of CHO cells to generate packaging cells. Co-culturing vector and packaging cells resulted in production of infectious retroviruses carrying the mCAT-1 gene as a consequence of cell-cell fusion. Second, we introduced a retroviral vector into primary osteoclast precursors and co-cultured them with established osteoclast precursor RAW264.7 cells, which turned out to harbor packaging activity. Packaged retroviral vector was detected in culture supernatants only where the osteoclast differentiation factor receptor activator for NF-kappaB ligand (RANKL) induced fusion between these two cell types. These data suggest that retrovirus production can occur as a result of cell-cell fusion. This provides a novel approach for isolating and characterizing fusogenic genes using retroviral expression vectors.

Crosstalk between vertical and horizontal gene transfer: plasmid replication control by a conjugative relaxase

PubMed Central

Lorenzo-Díaz, Fabián; Fernández-López, Cris; Lurz, Rudi

2017-01-01

Abstract Horizontal gene transfer is a key process in the evolution of bacteria and also represents a source of genetic variation in eukaryotes. Among elements participating in gene transfer, thousands of small (<10 kb) mobile bacterial plasmids that replicate by the rolling circle mechanism represent a driving force in the spread of antibiotic resistances. In general, these plasmids are built as genetic modules that encode a replicase, an antibiotic-resistance determinant, and a relaxase that participates in their conjugative mobilization. Further, they control their relatively high copy number (∼30 copies per genome equivalent) by antisense RNAs alone or combined with a repressor protein. We report here that the MobM conjugative relaxase encoded by the promiscuous plasmid pMV158 participates in regulation of the plasmid copy number by transcriptional repression of the antisense RNA, thus increasing the number of plasmid molecules ready to be horizontally transferred (mobilization) and/or vertically inherited (replication). This type of crosstalk between genetic modules involved in vertical and horizontal gene flow has not been reported before. PMID:28525572

Suppression of initiation defects of chromosome replication in Bacillus subtilis dnaA and oriC-deleted mutants by integration of a plasmid replicon into the chromosomes.

PubMed

Hassan, A K; Moriya, S; Ogura, M; Tanaka, T; Kawamura, F; Ogasawara, N

1997-04-01

We constructed Bacillus subtilis strains in which chromosome replication initiates from the minimal replicon of a plasmid isolated from Bacillus natto, independently of oriC. Integration of the replicon in either orientation at the proA locus (115 degrees on the genetic map) suppressed the temperature-sensitive phenotype caused by a mutation in dnaA, a gene required for initiation of replication from oriC. In addition, in a strain with the plasmid replicon integrated into the chromosome, we were able to delete sequences required for oriC function. These strains were viable but had a slower growth rate than the oriC+ strains. Marker frequency analysis revealed that both pyrD and metD, genes close to proA, showed the highest values among the markers (genes) measured, and those of other markers decreased symmetrically with distance from the site of the integration (proA). These results indicated that the integrated plasmid replicon operated as a new and sole origin of chromosome replication in these strains and that the mode of replication was bidirectional. Interestingly, these mutants produced anucleate cells at a high frequency (about 40% in exponential culture), and the distribution of chromosomes in the cells was irregular. A change in the site and mechanism (from oriC to a plasmid system) of initiation appears to have resulted in a drastic alteration in coordination between chromosome replication and chromosome partition or cell division.

Single inverted terminal repeats of the Junonia coenia Densovirus promotes somatic chromosomal integration of vector plasmids in insect cells and supports high efficiency expression

USDA-ARS?s Scientific Manuscript database

Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...

The Minimal Replicator of Epstein-Barr Virus oriP

PubMed Central

Yates, John L.; Camiolo, Sarah M.; Bashaw, Jacqueline M.

2000-01-01

oriP is a 1.7-kb region of the Epstein-Barr virus (EBV) chromosome that supports the replication and stable maintenance of plasmids in human cells. oriP contains two essential components, called the DS and the FR, both of which contain multiple binding sites for the EBV-encoded protein, EBNA-1. The DS appears to function as the replicator of oriP, while the FR acts in conjunction with EBNA-1 to prevent the loss of plasmids from proliferating cells. Because of EBNA-1's role in stabilizing plasmids through the FR, it has not been entirely clear to what extent EBNA-1 might be required for replication from oriP per se, and a recent study has questioned whether EBNA-1 has any direct role in replication. In the present study we found that plasmids carrying oriP required EBNA-1 to replicate efficiently even when assayed only 2 days after plasmids were introduced into the cell lines 143B and 293. Significantly, using 293 cells it was demonstrated that the plasmid-retention function of EBNA-1 and the FR did not contribute significantly to the accumulation of replicated plasmids, and the DS supported efficient EBNA-1-dependent replication in the absence of the FR. The DS contains two pairs of closely spaced EBNA-1 binding sites, and a previous study had shown that both sites within either pair are required for activity. However, it was unclear from previous work what additional sequences within the DS might be required. We found that each “half” of the DS, including a pair of closely spaced EBNA-1 binding sites, had significant replicator activity when the other half had been deleted. The only significant DNA sequences that the two halves of the DS share in common, other than EBNA-1 binding sites, is a 9-bp sequence that is present twice in the “left half” and once in the “right half.” These nonamer repeats, while not essential for activity, contributed significantly to the activity of each half of the DS. Two thymines occur at unique positions within EBNA-1 binding sites 1 and 4 at the DS and become sensitive to oxidation by permanganate when EBNA-1 binds, but mutation of each to the consensus base, adenine, actually improved the activity of each half of the DS slightly. In conclusion, the DS of oriP is an EBNA-1-dependent replicator, and its minimal active core appears to be simply two properly spaced EBNA-1 binding sites. PMID:10775587

Characterization of the 101-Kilobase-Pair Megaplasmid pKB1, Isolated from the Rubber-Degrading Bacterium Gordonia westfalica Kb1

PubMed Central

Bröker, Daniel; Arenskötter, Matthias; Legatzki, Antje; Nies, Dietrich H.; Steinbüchel, Alexander

2004-01-01

The complete sequence of the circular 101,016-bp megaplasmid pKB1 from the cis-1,4-polyisoprene-degrading bacterium Gordonia westfalica Kb1, which represents the first described extrachromosomal DNA of a member of this genus, was determined. Plasmid pKB1 harbors 105 open reading frames. The predicted products of 46 of these are significantly related to proteins of known function. Plasmid pKB1 is organized into three functional regions that are flanked by insertion sequence (IS) elements: (i) a replication and putative partitioning region, (ii) a putative metabolic region, and (iii) a large putative conjugative transfer region, which is interrupted by an additional IS element. Southern hybridization experiments revealed the presence of another copy of this conjugational transfer region on the bacterial chromosome. The origin of replication (oriV) of pKB1 was identified and used for construction of Escherichia coli-Gordonia shuttle vectors, which was also suitable for several other Gordonia species and related genera. The metabolic region included the heavy-metal resistance gene cadA, encoding a P-type ATPase. Expression of cadA in E. coli mediated resistance to cadmium, but not to zinc, and decreased the cellular content of cadmium in this host. When G. westfalica strain Kb1 was cured of plasmid pKB1, the resulting derivative strains exhibited slightly decreased cadmium resistance. Furthermore, they had lost the ability to use isoprene rubber as a sole source of carbon and energy, suggesting that genes essential for rubber degradation are encoded by pKB1. PMID:14679241

Kid cleaves specific mRNAs at UUACU sites to rescue the copy number of plasmid R1

PubMed Central

Pimentel, Belén; Madine, Mark A; de la Cueva-Méndez, Guillermo

2005-01-01

Stability and copy number of extra-chromosomal elements are tightly regulated in prokaryotes and eukaryotes. Toxin Kid and antitoxin Kis are the components of the parD stability system of prokaryotic plasmid R1 and they can also function in eukaryotes. In bacteria, Kid was thought to become active only in cells that lose plasmid R1 and to cleave exclusively host mRNAs at UA(A/C/U) trinucleotide sites to eliminate plasmid-free cells. Instead, we demonstrate here that Kid becomes active in plasmid-containing cells when plasmid copy number decreases, cleaving not only host- but also a specific plasmid-encoded mRNA at the longer and more specific target sequence UUACU. This specific cleavage by Kid inhibits bacterial growth and, at the same time, helps to restore the plasmid copy number. Kid targets a plasmid RNA that encodes a repressor of the synthesis of an R1 replication protein, resulting in increased plasmid DNA replication. This mechanism resembles that employed by some human herpesviruses to regulate viral amplification during infection. PMID:16163387

Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.

PubMed

Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng

2007-01-01

Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.

Dextransucrase Expression Is Concomitant with that of Replication and Maintenance Functions of the pMN1 Plasmid in Lactobacillus sakei MN1

PubMed Central

Nácher-Vázquez, Montserrat; Ruiz-Masó, José A.; Mohedano, María L.; del Solar, Gloria; Aznar, Rosa; López, Paloma

2017-01-01

The exopolysaccharide synthesized by Lactobacillus sakei MN1 is a dextran with antiviral and immunomodulatory properties of potential utility in aquaculture. In this work we have investigated the genetic basis of dextran production by this bacterium. Southern blot hybridization experiments demonstrated the plasmidic location of the dsrLS gene, which encodes the dextransucrase involved in dextran synthesis. DNA sequencing of the 11,126 kbp plasmid (pMN1) revealed that it belongs to a family which replicates by the theta mechanism, whose prototype is pUCL287. The plasmid comprises the origin of replication, repA, repB, and dsrLS genes, as well as seven open reading frames of uncharacterized function. Lb. sakei MN1 produces dextran when sucrose, but not glucose, is present in the growth medium. Therefore, plasmid copy number and stability, as well as dsrLS expression, were investigated in cultures grown in the presence of either sucrose or glucose. The results revealed that pMN1 is a stable low-copy-number plasmid in both conditions. Gene expression studies showed that dsrLS is constitutively expressed, irrespective of the carbon source present in the medium. Moreover, dsrLS is expressed from a monocistronic transcript as well as from a polycistronic repA-repB-orf1-dsrLS mRNA. To our knowledge, this is the first report of a plasmid-borne dextransucrase-encoding gene, as well as the first time that co-transcription of genes involved in plasmid maintenance and replication with a gene encoding an enzyme has been established. PMID:29209293

Improvement of a yeast self-excising integrative vector by prevention of expression leakage of the intronated Cre recombinase gene during plasmid maintenance in Escherichia coli.

PubMed

Agaphonov, Michael O

2017-12-01

The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Tightly-wound miniknot vectors for gene therapy: a potential improvement over supercoiled minicircle DNA.

PubMed

Tolmachov, Oleg E

2010-04-01

Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.

High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast

PubMed Central

Liachko, Ivan; Youngblood, Rachel A.; Keich, Uri; Dunham, Maitreya J.

2013-01-01

DNA replication origins are necessary for the duplication of genomes. In addition, plasmid-based expression systems require DNA replication origins to maintain plasmids efficiently. The yeast autonomously replicating sequence (ARS) assay has been a valuable tool in dissecting replication origin structure and function. However, the dearth of information on origins in diverse yeasts limits the availability of efficient replication origin modules to only a handful of species and restricts our understanding of origin function and evolution. To enable rapid study of origins, we have developed a sequencing-based suite of methods for comprehensively mapping and characterizing ARSs within a yeast genome. Our approach finely maps genomic inserts capable of supporting plasmid replication and uses massively parallel deep mutational scanning to define molecular determinants of ARS function with single-nucleotide resolution. In addition to providing unprecedented detail into origin structure, our data have allowed us to design short, synthetic DNA sequences that retain maximal ARS function. These methods can be readily applied to understand and modulate ARS function in diverse systems. PMID:23241746

Transformation of Saccharomyces cerevisiae and Schizosaccharomyces pombe with linear plasmids containing 2 micron sequences.

PubMed Central

Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P

1985-01-01

Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773

Replication and Transcription of Eukaryotic DNA in Esherichia coli

PubMed Central

Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

1974-01-01

Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

Plasmids as stochastic model systems

NASA Astrophysics Data System (ADS)

Paulsson, Johan

2003-05-01

Plasmids are self-replicating gene clusters present in on average 2-100 copies per bacterial cell. To reduce random fluctuations and thereby avoid extinction, they ubiquitously autoregulate their own synthesis using negative feedback loops. Here I use van Kampen's Ω-expansion for a two-dimensional model of negative feedback including plasmids and ther replication inhibitors. This analytically summarizes the standard perspective on replication control -- including the effects of sensitivity amplification, exponential time-delays and noisy signaling. I further review the two most common molecular sensitivity mechanisms: multistep control and cooperativity. Finally, I discuss more controversial sensitivity schemes, such as noise-enhanced sensitivity, the exploitation of small-number combinatorics and double-layered feedback loops to suppress noise in disordered environments.

Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oriS stimulate origin function.

PubMed

Wong, S W; Schaffer, P A

1991-05-01

Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.

Dynamics in copy numbers of five plasmids of a dairy Lactococcus lactis in dairy-related conditions including near-zero growth rates.

PubMed

van Mastrigt, Oscar; Lommers, Marcel M A N; de Vries, Yorick C; Abee, Tjakko; Smid, Eddy J

2018-03-23

Lactic acid bacteria can carry multiple plasmids affecting their performance in dairy fermentations. The expression of plasmid-encoded genes and the activity of the corresponding proteins is severely affected by changes in the number of plasmid copies. We studied the impact of growth rate on dynamics of plasmid copy numbers at high growth rates in chemostat cultures and down to near-zero growth rates in retentostat cultures. Five plasmids of the dairy strain Lactococcus lactis FM03-V1 were selected which varied in size (3 to 39 kb), in replication mechanism (theta or rolling-circle) and in putative (dairy-associated) functions. Copy numbers ranged from 1.5 to 40.5 and the copy number of theta-type replicating plasmids were negatively correlated to the plasmid size. Despite the extremely wide range of growth rates (0.0003 h -1 to 0.6 h -1 ), copy numbers of the five plasmids were stable and only slightly increased at near-zero growth rates showing that the plasmid replication rate was strictly controlled. One low-copy number plasmid, carrying a large exopolysaccharide gene cluster, was segregationally unstable during retentostat cultivations reflected in complete loss of the plasmid in one of the retentostat cultures. The copy number of the five plasmids was also hardly affected by varying the pH value, nutrient limitation or presence of citrate (maximum 2.2-fold) signifying the stability in copy number of the plasmids. Importance Lactococcus lactis is extensively used in starter cultures for dairy fermentations. Important traits for growth and survival of L. lactis in dairy fermentations are encoded by genes located on plasmids, such as genes involved in lactose and citrate metabolism, protein degradation and oligopeptide uptake and bacteriophage resistance. Because the number of plasmid copies could affect the expression of plasmid-encoded genes, it is important to know the factors that influence the plasmid copy numbers. We monitored plasmid copy numbers of L. lactis at near-zero growth rates, characteristic for cheese ripening. Moreover, we analysed the effect of pH, nutrient limitation and presence of citrate. This showed that plasmid copy numbers were stable giving insight into plasmid copy number dynamics in dairy fermentations. Copyright © 2018 American Society for Microbiology.

Characterization of a cryptic plasmid from an alpha-proteobacterial endosymbiont of Amoeba proteus.

PubMed

Park, Miey; Kim, Min-Soo; Lee, Kyung-Min; Hwang, Sue-Yun; Ahn, Tae In

2009-01-01

A new cryptic plasmid pAP3.9 was discovered in symbiotic alpha-proteobacteria present in the cytoplasm of Amoeba proteus. The plasmid is 3869bp with a GC content of 34.66% and contains replication origins for both double-strand (dso) and single-strand (sso). It has three putative ORFs encoding Mob, Rep and phosphoglycolate phosphatase (PGPase). The pAP3.9 plasmid appears to propagate by the conjugative rolling-circle replication (RCR), since it contains all required factors such as Rep, sso and dso. Mob and Rep showed highest similarities to those of the cryptic plasmid pBMYdx in Bacillus mycoides. The PGPase was homologous to that of Bacillus cereus and formed a clade with those of Bacillus sp. in molecular phylogeny. These results imply that the pAP3.9 plasmid evolved by the passage through Bacillus species. We hypothesize that the plasmid-encoded PGPase may have contributed to the establishment of bacterial symbiosis within the hostile environment of amoeba cytoplasm.

A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.

PubMed

Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei

2018-05-01

Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.

Plasmids in Gram negatives: molecular typing of resistance plasmids.

PubMed

Carattoli, Alessandra

2011-12-01

A plasmid is defined as a double stranded, circular DNA molecule capable of autonomous replication. By definition, plasmids do not carry genes essential for the growth of host cells under non-stressed conditions but they have systems which guarantee their autonomous replication also controlling the copy number and ensuring stable inheritance during cell division. Most of the plasmids confer positively selectable phenotypes by the presence of antimicrobial resistance genes. Plasmids evolve as an integral part of the bacterial genome, providing resistance genes that can be easily exchanged among bacteria of different origin and source by conjugation. A multidisciplinary approach is currently applied to study the acquisition and spread of antimicrobial resistance in clinically relevant bacterial pathogens and the established surveillance can be implemented by replicon typing of plasmids. Particular plasmid families are more frequently detected among Enterobacteriaceae and play a major role in the diffusion of specific resistance genes. For instance, IncFII, IncA/C, IncL/M, IncN and IncI1 plasmids carrying extended-spectrum beta-lactamase genes and acquired AmpC genes are currently considered to be "epidemic resistance plasmids", being worldwide detected in Enterobacteriaceae of different origin and sources. The recognition of successful plasmids is an essential first step to design intervention strategies preventing their spread. Copyright © 2011 Elsevier GmbH. All rights reserved.

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

PubMed

Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

2011-07-01

Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

PubMed

Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

2017-01-01

Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

Activation of a yeast replication origin near a double-stranded DNA break.

PubMed

Raghuraman, M K; Brewer, B J; Fangman, W L

1994-03-01

Irradiation in the G1 phase of the cell cycle delays the onset of DNA synthesis and transiently inhibits the activation of replication origins in mammalian cells. It has been suggested that this inhibition is the result of the loss of torsional tension in the DNA after it has been damaged. Because irradiation causes DNA damage at an undefined number of nonspecific sites in the genome, it is not known how cells respond to limited DNA damage, and how replication origins in the immediate vicinity of a damage site would behave. Using the sequence-specific HO endonuclease, we have created a defined double-stranded DNA break in a centromeric plasmid in G1-arrested cells of the yeast Saccharomyces cerevisiae. We show that replication does initiate at the origin on the cut plasmid, and that the plasmid replicates early in the S phase after linearization in vivo. These observations suggest that relaxation of a supercoiled DNA domain in yeast need not inactivate replication origins within that domain. Furthermore, these observations rule out the possibility that the late replication context associated with chromosomal termini is a consequence of DNA ends.

Identification and characterization of ARS-like sequences as putative origin(s) of replication in human malaria parasite Plasmodium falciparum.

PubMed

Agarwal, Meetu; Bhowmick, Krishanu; Shah, Kushal; Krishnamachari, Annangarachari; Dhar, Suman Kumar

2017-08-01

DNA replication is a fundamental process in genome maintenance, and initiates from several genomic sites (origins) in eukaryotes. In Saccharomyces cerevisiae, conserved sequences known as autonomously replicating sequences (ARSs) provide a landing pad for the origin recognition complex (ORC), leading to replication initiation. Although origins from higher eukaryotes share some common sequence features, the definitive genomic organization of these sites remains elusive. The human malaria parasite Plasmodium falciparum undergoes multiple rounds of DNA replication; therefore, control of initiation events is crucial to ensure proper replication. However, the sites of DNA replication initiation and the mechanism by which replication is initiated are poorly understood. Here, we have identified and characterized putative origins in P. falciparum by bioinformatics analyses and experimental approaches. An autocorrelation measure method was initially used to search for regions with marked fluctuation (dips) in the chromosome, which we hypothesized might contain potential origins. Indeed, S. cerevisiae ARS consensus sequences were found in dip regions. Several of these P. falciparum sequences were validated with chromatin immunoprecipitation-quantitative PCR, nascent strand abundance and a plasmid stability assay. Subsequently, the same sequences were used in yeast to confirm their potential as origins in vivo. Our results identify the presence of functional ARSs in P. falciparum and provide meaningful insights into replication origins in these deadly parasites. These data could be useful in designing transgenic vectors with improved stability for transfection in P. falciparum. © 2017 Federation of European Biochemical Societies.

DNA packaging by the Bacillus subtilis defective bacteriophage PBSX.

PubMed Central

Anderson, L M; Bott, K F

1985-01-01

Defective bacteriophage PBSX, a resident of all Bacillus subtilis 168 chromosomes, packages fragments of DNA from all portions of the host chromosome when induced by mitomycin C. In this study, the physical process for DNA packaging of both chromosomal and plasmid DNAs was examined. Discrete 13-kilobase (kb) lengths of DNA were packaged by wild-type phage, and the process was DNase I resistant and probably occurred by a head-filling mechanism. Genetically engineered isogenic host strains having a chloramphenicol resistance determinant integrated as a genetic flag at two different regions of the chromosome were used to monitor the packaging of specific chromosomal regions. No dramatic selectivity for these regions could be documented. If the wild-type strain 168 contains autonomously replicating plasmids, especially pC194, the mitomycin C induces an increase in size of resident plasmid DNA, which is then packaged as 13-kb pieces into phage heads. In strain RB1144, which lacks substantial portions of the PBSX resident phage region, mitomycin C treatment did not affect the structure of resident plasmids. Induction of PBSX started rolling circle replication on plasmids, which then became packaged as 13-kb fragments. This alteration or cannibalization of plasmid replication resulting from mitomycin C treatment requires for its function some DNA within the prophage deletion of strain RB1144. Images PMID:3923209

A Simple And Rapid Minicircle DNA Vector Manufacturing System

PubMed Central

Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

2010-01-01

Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

An oligonucleotide microarray to characterize multidrug resistant plasmids

USDA-ARS?s Scientific Manuscript database

Bacteria plasmids are fragments of extra-chromosomal double stranded deoxyribonucleic acid (DNA) that can contain a variety of genes beneficial to the host organism like antibiotic drug resistance. Many of the Enterobacteriaceae carry multiple drug resistance (MDR) genes on large plasmids of replic...

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Engineered Saccharomyces cerevisiae strain for improved xylose utilization with a three-plasmid SUMO yeast expression system

USDA-ARS?s Scientific Manuscript database

A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...

SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.

PubMed

Schwartz, Matthew L; Jorgensen, Erik M

2016-04-01

In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.

The repABC plasmids with quorum-regulated transfer systems in members of the Rhizobiales divide into two structurally and separately evolving groups

DOE PAGES

Wetzel, Margaret E.; Olsen, Gary J.; Chakravartty, Vandana; ...

2015-11-19

The large repABC plasmids of the order Rhizobiales with Class I quorum-regulated conjugative transfer systems often define the nature of the bacterium that harbors them. These otherwise diverse plasmids contain a core of highly conserved genes for replication and conjugation raising the question of their evolutionary relationships. In an analysis of 18 such plasmids these elements fall into two organizational classes, Group I and Group II, based on the sites at which cargo DNA is located. Cladograms constructed from proteins of the transfer and quorum-sensing components indicated that those of the Group I plasmids, while coevolving, have diverged from thosemore » coevolving proteins of the Group II plasmids. Moreover, within these groups the phylogenies of the proteins usually occupy similar, if not identical, tree topologies. Remarkably, such relationships were not seen among proteins of the replication system; although RepA and RepB coevolve, RepC does not. Nor do the replication proteins coevolve with the proteins of the transfer and quorum-sensing systems. Functional analysis was mostly consistent with phylogenies. TraR activated promoters from plasmids within its group, but not between groups and dimerized with TraR proteins from within but not between groups. However, oriT sequences, which are highly conserved, were processed by the transfer system of plasmids regardless of group. Here, we conclude that these plasmids diverged into two classes based on the locations at which cargo DNA is inserted, that the quorum-sensing and transfer functions are coevolving within but not between the two groups, and that this divergent evolution extends to function.« less

Construction of an easy-to-use CRISPR-Cas9 system by patching a newly designed EXIT circuit.

PubMed

Tang, Qiang; Lou, Chunbo; Liu, Shuang-Jiang

2017-01-01

Plasmid-borne genetic editing tools, including the widely used CRISPR-Cas9 system, have greatly facilitated bacterial programming to obtain novel functionalities. However, the lack of effective post-editing plasmid elimination methods impedes follow-up genetic manipulation or application. Conventional strategies including exposure to physical and chemical treatments, or exploiting temperature-sensitive replication origins have several drawbacks (e.g., they are limited for efficiency and are time-consuming). Therefore, the demand is apparent for easy and rapid elimination of the tool plasmids from their bacterial hosts after genetic manipulation. To bridge this gap, we designed a novel EXIT circuit with the homing endonuclease, which can be exploited for rapid and efficient elimination of various plasmids with diverse replication origins. As a proof of concept, we validated the EXIT circuit in Escherichia coli by harnessing homing endonuclease I- Sce I and its cleavage site. When integrated into multiple plasmids with different origins, the EXIT circuit allowed them to be eliminated from the host cells, simultaneously. By combining the widely used plasmid-borne CRISPR-Cas9 system and the EXIT circuit, we constructed an easy-to-use CRISPR-Cas9 system that eliminated the Cas9- and the single-guide RNA (sgRNA)-encoding plasmids in one-step. Within 3 days, we successfully constructed an atrazine-degrading E. coli strain, thus further demonstrating the advantage of this new CRISPR-Cas9 system for bacterial genome editing. Our novel EXIT circuit, which exploits the homing endonuclease I- Sce I, enables plasmid(s) with different replication origins to be eliminated from their host cells rapidly and efficiently. We also developed an easy-to-use CRISPR-Cas9 system with the EXIT circuit, and this new system can be widely applied to bacterial genome editing.

The repABC plasmids with quorum-regulated transfer systems in members of the Rhizobiales divide into two structurally and separately evolving groups

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wetzel, Margaret E.; Olsen, Gary J.; Chakravartty, Vandana

The large repABC plasmids of the order Rhizobiales with Class I quorum-regulated conjugative transfer systems often define the nature of the bacterium that harbors them. These otherwise diverse plasmids contain a core of highly conserved genes for replication and conjugation raising the question of their evolutionary relationships. In an analysis of 18 such plasmids these elements fall into two organizational classes, Group I and Group II, based on the sites at which cargo DNA is located. Cladograms constructed from proteins of the transfer and quorum-sensing components indicated that those of the Group I plasmids, while coevolving, have diverged from thosemore » coevolving proteins of the Group II plasmids. Moreover, within these groups the phylogenies of the proteins usually occupy similar, if not identical, tree topologies. Remarkably, such relationships were not seen among proteins of the replication system; although RepA and RepB coevolve, RepC does not. Nor do the replication proteins coevolve with the proteins of the transfer and quorum-sensing systems. Functional analysis was mostly consistent with phylogenies. TraR activated promoters from plasmids within its group, but not between groups and dimerized with TraR proteins from within but not between groups. However, oriT sequences, which are highly conserved, were processed by the transfer system of plasmids regardless of group. Here, we conclude that these plasmids diverged into two classes based on the locations at which cargo DNA is inserted, that the quorum-sensing and transfer functions are coevolving within but not between the two groups, and that this divergent evolution extends to function.« less

A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.

PubMed

Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya

2014-03-01

Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.

Preclinical development of BCG.HIVA2auxo.int, harboring an integrative expression vector, for a HIV-TB Pediatric vaccine. Enhancement of stability and specific HIV-1 T-cell immunity.

PubMed

Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan

2017-08-03

One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.

Development of a chromosome-plasmid balanced lethal system for Lactobacillus acidophilus with thyA gene as selective marker.

PubMed

Fu, X; Xu, J G

2000-01-01

A chromosome-plasmid balanced lethal gene delivery system for Lactobacillus acidophilus based on the thyA gene was developed. The selected L. acidophilus DOM La strain carries a mutated thyA gene and has an obligate requirement for thymidine. This strain can be used as a host for the constructed shuttle vector pFXL03, lacking antibiotic-resistant markers but having the wild-type thyA gene from L. casei which complements the thyA chromosomal mutation. The vector also contains the replicon region from plasmid pUC19 and that of the Lactococcus plasmid pWV01, which allows the transfer between Escherichia coli, L. casei and L. acidophilus. Eight unique restriction sites (i.e., PstI, HindIII, SphI, SalI, AccI, XbaI, KpnI and SacI) are available for cloning. After 40-time transfers in modified MRS medium, no plasmid loss was observed. The vector pFXL03 is potentially useful as a food-grade vaccine delivery system for L. acidophilus.

Characterization of Halomonas sp. ZM3 isolated from the Zelazny Most post-flotation waste reservoir, with a special focus on its mobile DNA

PubMed Central

2013-01-01

Background Halomonas sp. ZM3 was isolated from Zelazny Most post-flotation mineral waste repository (Poland), which is highly contaminated with heavy metals and various organic compounds. Mobile DNA of the strain (i.e. plasmids and transposons) were analyzed in order to identify genetic information enabling adaptation of the bacterium to the harsh environmental conditions. Results The analysis revealed that ZM3 carries plasmid pZM3H1 (31,370 bp), whose replication system may be considered as an archetype of a novel subgroup of IncU-like replicons. pZM3H1 is a narrow host range, mobilizable plasmid (encodes a relaxase of the MOBV family) containing mercury resistance operon (mer) and czcD genes (mediate resistance to zinc and cobalt), which are part of a large truncated Tn3 family transposon. Further analysis demonstrated that the phenotypes determined by the pZM3H1 resistance cassette are highly dependent on the host strain. In another strand of the study, the trap plasmid pMAT1 was employed to identify functional transposable elements of Halomonas sp. ZM3. Using the sacB positive selection strategy two insertion sequences were identified: ISHsp1 - representing IS5 group of IS5 family and ISHsp2 - a distinct member of the IS630 family. Conclusions This study provides the first detailed description of mobile DNA in a member of the family Halomonadaceae. The identified IncU plasmid pZM3H1 confers resistance phenotypes enabling adaptation of the host strain to the Zelazny Most environment. The extended comparative analysis has shed light on the distribution of related IncU plasmids among bacteria, which, in many cases, reflects the frequency and direction of horizontal gene transfer events. Our results also identify plasmid-encoded modules, which may form the basis of novel shuttle vectors, specific for this group of halophilic bacteria. PMID:23497212

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

Requirements for rapid plasmid ColE1 copy number adjustments: a mathematical model of inhibition modes and RNA turnover rates.

PubMed

Paulsson, J; Nordström, K; Ehrenberg, M

1998-01-01

The random distribution of ColE1 plasmids between the daughter cells at cell division introduces large copy number variations. Statistic variation associated with limited copy number in single cells also causes fluctuations to emerge spontaneously during the cell cycle. Efficient replication control out of steady state is therefore important to tame such stochastic effects of small numbers. In the present model, the dynamic features of copy number control are divided into two parts: first, how sharply the replication frequency per plasmid responds to changes in the concentration of the plasmid-coded inhibitor, RNA I, and second, how tightly RNA I and plasmid concentrations are coupled. Single (hyperbolic)- and multiple (exponential)-step inhibition mechanisms are compared out of steady state and it is shown how the response in replication frequency depends on the mode of inhibition. For both mechanisms, sensitivity of inhibition is "bought" at the expense of a rapid turnover of a replication preprimer, RNA II. Conventional, single-step, inhibition kinetics gives a sloppy replication control even at high RNA II turnover rates, whereas multiple-step inhibition has the potential of working with unlimited precision. When plasmid concentration changes rapidly, RNA I must be degraded rapidly to be "up to date" with the change. Adjustment to steady state is drastically impaired when the turnover rate constants of RNA I decrease below certain thresholds, but is basically unaffected for a corresponding increase. Several features of copy number control that are shown to be crucial for the understanding of ColE1-type plasmids still remain to be experimentally characterized. It is shown how steady-state properties reflect dynamics at the heart of regulation and therefore can be used to discriminate between fundamentally different copy number control mechanisms. The experimental tests of the predictions made require carefully planned assays, and some suggestions for suitable experiments arise naturally from the present work. It is also discussed how the presence of the Rom protein may affect dynamic qualities of copy number control. Copyright 1998 Academic Press.

Inhibition of hepatitis B virus replication via HBV DNA cleavage by Cas9 from Staphylococcus aureus.

PubMed

Liu, Yu; Zhao, Miaoxian; Gong, Mingxing; Xu, Ying; Xie, Cantao; Deng, Haohui; Li, Xueying; Wu, Hongkai; Wang, Zhanhui

2018-04-01

Chronic hepatitis B virus (HBV) infection is difficult to cure due to the presence of covalently closed circular DNA (cccDNA). Accumulating evidence indicates that the CRISPR/Cas9 system effectively disrupts HBV genome, including cccDNA, in vitro and in vivo. However, efficient delivery of CRISPR/Cas9 system to the liver or hepatocytes using an adeno-associated virus (AAV) vector remains challenging due to the large size of Cas9 from Streptococcus pyogenes (Sp). The recently identified Cas9 protein from Staphylococcus aureus (Sa) is smaller than SpCas9 and thus is able to be packaged into the AAV vector. To examine the efficacy of SaCas9 system on HBV genome destruction, we designed 5 guide RNAs (gRNAs) that targeted different HBV genotypes, 3 of which were shown to be effective. The SaCas9 system significantly reduced HBV antigen expression, as well as pgRNA and cccDNA levels, in Huh7, HepG2.2.15 and HepAD38 cells. The dual expression of gRNAs/SaCas9 in these cell lines resulted in more efficient HBV genome cleavage. In the mouse model, hydrodynamic injection of gRNA/SaCas9 plasmids resulted in significantly lower levels of HBV protein expression. We also delivered the SaCas9 system into mice with persistent HBV replication using an AAV vector. Both the AAV vector and the mRNA of Cas9 could be detected in the C3H mouse liver cells. Decreased hepatitis B surface antigen (HBsAg), HBV DNA and pgRNA levels were observed when a higher titer of AAV was injected, although this decrease was not significantly different from the control. In summary, the SaCas9 system accurately and efficiently targeted the HBV genome and inhibited HBV replication both in vitro and in vivo. The system was delivered by an AAV vector and maybe used as a novel therapeutic strategy against chronic HBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

Replication initiator protein RepE of mini-F plasmid: functional differentiation between monomers (initiator) and dimers (autogenous repressor).

PubMed Central

Ishiai, M; Wada, C; Kawasaki, Y; Yura, T

1994-01-01

Replication of mini-F plasmid requires the plasmid-encoded RepE initiator protein and several host factors including DnaJ, DnaK, and GrpE, heat shock proteins of Escherichia coli. The RepE protein plays a crucial role in replication and exhibits two major functions: initiation of replication from the origin, ori2, and autogenous repression of repE transcription. One of the mini-F plasmid mutants that can replicate in the dnaJ-defective host produces an altered RepE (RepE54) with a markedly enhanced initiator activity but little or no repressor activity. RepE54 has been purified from cell extracts primarily in monomeric form, unlike the wild-type RepE that is recovered in dimeric form. Gel-retardation assays revealed that RepE54 monomers bind to ori2 (direct repeats) with a very high efficiency but hardly bind to the repE operator (inverted repeat), in accordance with the properties of RepE54 in vivo. Furthermore, the treatment of wild-type RepE dimers with protein denaturants enhanced their binding to ori2 but reduced binding to the operator: RepE dimers were partially converted to monomers, and the ori2 binding activity was uniquely associated with monomers. These results strongly suggest that RepE monomers represent an active form by binding to ori2 to initiate replication, whereas dimers act as an autogenous repressor by binding to the operator. We propose that RepE is structurally and functionally differentiated and that monomerization of RepE dimers, presumably mediated by heat shock protein(s), activates the initiator function and participates in regulation of mini-F DNA replication. Images PMID:8170998

Change in the plasmid copy number in acetic acid bacteria in response to growth phase and acetic acid concentration.

PubMed

Akasaka, Naoki; Astuti, Wiwik; Ishii, Yuri; Hidese, Ryota; Sakoda, Hisao; Fujiwara, Shinsuke

2015-06-01

Plasmids pGE1 (2.5 kb), pGE2 (7.2 kb), and pGE3 (5.5 kb) were isolated from Gluconacetobacter europaeus KGMA0119, and sequence analyses revealed they harbored 3, 8, and 4 genes, respectively. Plasmid copy numbers (PCNs) were determined by real-time quantitative PCR at different stages of bacterial growth. When KGMA0119 was cultured in medium containing 0.4% ethanol and 0.5% acetic acid, PCN of pGE1 increased from 7 copies/genome in the logarithmic phase to a maximum of 12 copies/genome at the beginning of the stationary phase, before decreasing to 4 copies/genome in the late stationary phase. PCNs for pGE2 and pGE3 were maintained at 1-3 copies/genome during all phases of growth. Under a higher concentration of ethanol (3.2%) the PCN for pGE1 was slightly lower in all the growth stages, and those of pGE2 and pGE3 were unchanged. In the presence of 1.0% acetic acid, PCNs were higher for pGE1 (10 copies/genome) and pGE3 (6 copies/genome) during the logarithmic phase. Numbers for pGE2 did not change, indicating that pGE1 and pGE3 increase their PCNs in response to acetic acid. Plasmids pBE2 and pBE3 were constructed by ligating linearized pGE2 and pGE3 into pBR322. Both plasmids were replicable in Escherichia coli, Acetobacter pasteurianus and G. europaeus, highlighting their suitability as vectors for acetic acid bacteria. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.

PubMed

Brandenburger, A; Russell, S

1996-10-01

MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

Community-wide plasmid gene mobilization and selection

PubMed Central

Sentchilo, Vladimir; Mayer, Antonia P; Guy, Lionel; Miyazaki, Ryo; Green Tringe, Susannah; Barry, Kerrie; Malfatti, Stephanie; Goessmann, Alexander; Robinson-Rechavi, Marc; van der Meer, Jan R

2013-01-01

Plasmids have long been recognized as an important driver of DNA exchange and genetic innovation in prokaryotes. The success of plasmids has been attributed to their independent replication from the host's chromosome and their frequent self-transfer. It is thought that plasmids accumulate, rearrange and distribute nonessential genes, which may provide an advantage for host proliferation under selective conditions. In order to test this hypothesis independently of biases from culture selection, we study the plasmid metagenome from microbial communities in two activated sludge systems, one of which receives mostly household and the other chemical industry wastewater. We find that plasmids from activated sludge microbial communities carry among the largest proportion of unknown gene pools so far detected in metagenomic DNA, confirming their presumed role of DNA innovators. At a system level both plasmid metagenomes were dominated by functions associated with replication and transposition, and contained a wide variety of antibiotic and heavy metal resistances. Plasmid families were very different in the two metagenomes and grouped in deep-branching new families compared with known plasmid replicons. A number of abundant plasmid replicons could be completely assembled directly from the metagenome, providing insight in plasmid composition without culturing bias. Functionally, the two metagenomes strongly differed in several ways, including a greater abundance of genes for carbohydrate metabolism in the industrial and of general defense factors in the household activated sludge plasmid metagenome. This suggests that plasmids not only contribute to the adaptation of single individual prokaryotic species, but of the prokaryotic community as a whole under local selective conditions. PMID:23407308

Persistence of transferable extended-spectrum-β-lactamase resistance in the absence of antibiotic pressure.

PubMed

Cottell, Jennifer L; Webber, Mark A; Piddock, Laura J V

2012-09-01

The treatment of infections caused by antibiotic-resistant bacteria is one of the great challenges faced by clinicians in the 21st century. Antibiotic resistance genes are often transferred between bacteria by mobile genetic vectors called plasmids. It is commonly believed that removal of antibiotic pressure will reduce the numbers of antibiotic-resistant bacteria due to the perception that carriage of resistance imposes a fitness cost on the bacterium. This study investigated the ability of the plasmid pCT, a globally distributed plasmid that carries an extended-spectrum-β-lactamase (ESBL) resistance gene (bla(CTX-M-14)), to persist and disseminate in the absence of antibiotic pressure. We investigated key attributes in plasmid success, including conjugation frequencies, bacterial-host growth rates, ability to cause infection, and impact on the fitness of host strains. We also determined the contribution of the bla(CTX-M-14) gene itself to the biology of the plasmid and host bacterium. Carriage of pCT was found to impose no detectable fitness cost on various bacterial hosts. An absence of antibiotic pressure and inactivation of the antibiotic resistance gene also had no effect on plasmid persistence, conjugation frequency, or bacterial-host biology. In conclusion, plasmids such as pCT have evolved to impose little impact on host strains. Therefore, the persistence of antibiotic resistance genes and their vectors is to be expected in the absence of antibiotic selective pressure regardless of antibiotic stewardship. Other means to reduce plasmid stability are needed to prevent the persistence of these vectors and the antibiotic resistance genes they carry.

An adenovirus prime/plasmid boost strategy for induction of equipotent immune responses to two dengue virus serotypes.

PubMed

Khanam, Saima; Rajendra, Pilankatta; Khanna, Navin; Swaminathan, Sathyamangalam

2007-02-15

Dengue is a public health problem of global significance for which there is neither an effective antiviral therapy nor a preventive vaccine. It is a mosquito-borne viral disease, caused by dengue (DEN) viruses, which are members of the Flaviviridae family. There are four closely related serotypes, DEN-1, DEN-2, DEN-3 and DEN-4, each of which is capable of causing disease. As immunity to any one serotype can potentially sensitize an individual to severe disease during exposure to a heterologous serotype, the general consensus is that an effective vaccine should be tetravalent, that is, it must be capable of affording protection against all four serotypes. The current strategy of creating tetravalent vaccine formulations by mixing together four monovalent live attenuated vaccine viruses has revealed the phenomenon of viral interference leading to the manifestation of immune responses biased towards a single serotype. This work stems from the emergence of (i) the DEN virus envelope (E) domain III (EDIII) as the most important region of the molecule from a vaccine perspective and (ii) the adenovirus (Ad) as a promising vaccine vector platform. We describe the construction of a recombinant, replication-defective Ad (rAd) vector encoding a chimeric antigen made of in-frame linked EDIIIs of DEN virus serotypes 2 and 4. Using this rAd vector, in conjunction with a plasmid vector encoding the same chimeric bivalent antigen, in a prime-boost strategy, we show that it is possible to elicit equipotent neutralizing and T cell responses specific to both DEN serotypes 2 and 4. Our data support the hypothesis that a DEN vaccine targeting more than one serotype may be based on a single DNA-based vector to circumvent viral interference. This work lays the foundation for developing a single Ad vector encoding EDIIIs of all four DEN serotypes to evoke a balanced immune response against each one of them. Thus, this work has implications for the development of safe and effective tetravalent dengue vaccines.

Identification of facultatively heterotrophic, N/sub 2/-fixing cyanobacteria able to receive plasmid vectors from Escherichia coli by conjugation. [Anabaena spp; Nostoc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, E.; Wolk, C.P.

1985-06-01

Plasmid vectors transferable by conjugation from Escherichia coli to obligately photoautotrophic strains of Anabaena spp. are also transferred to and maintained in heterotrophic, filamentous cyanobacteria of the genus Nostoc. These organisms can be used for the genetic analysis of oxygenic photosynthesis, chromatic adaptation, nitrogen fixation, and heterocyst development.

Isolation of a conjugative F-like plasmid from a multidrug-resistant Escherichia coli strain CM6 using tandem shock wave-mediated transformation.

PubMed

Soto-Alonso, G; Cruz-Medina, J A; Caballero-Pérez, J; Arvizu-Hernández, I; Ávalos-Esparza, L M; Cruz-Hernández, A; Romero-Gómez, S; Rodríguez, A L; Pastrana-Martínez, X; Fernández, F; Loske, A M; Campos-Guillén, J

2015-07-01

Genetic characterization of plasmids from bacterial strains provides insight about multidrug resistance. Ten wild type Escherichia coli (E. coli) strains isolated from cow fecal samples were characterized by their antibiotic resistance profile, plasmid patterns and three different identification methods. From one of the strains, a fertility factor-like plasmid was replicated using tandem shock wave-mediated transformation. Underwater shock waves with a positive pressure peak of up to approximately 40 MPa, followed by a pressure trough of approximately -19 MPa were generated using an experimental piezoelectric shock wave source. Three different shock wave energies and a fixed delay of 750 μs were used to study the relationship between energy and transformation efficiency (TE), as well as the influence of shock wave energy on the integrity of the plasmid. Our results showed that the mean shock wave-mediated TE and the integrity of the large plasmid (~70 kb) were reduced significantly at the energy levels tested. The sequencing analysis of the plasmid revealed a high identity to the pHK17a plasmid, including the replication system, which was similar to the plasmid incompatibility group FII. It also showed that it carried an extended spectrum beta-lactamase gene, ctx-m-14. Furthermore, diverse genes for the conjugative mechanism were identified. Our results may be helpful in improving methodologies for conjugative plasmid transfer and directly selecting the most interesting plasmids from environmental samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

pLS010 plasmid vector

DOEpatents

Lacks, Sanford A.; Balganesh, Tanjore S.

1988-01-01

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

The rolling-circle melting-pot model for porcine circovirus DNA replication

USDA-ARS?s Scientific Manuscript database

A stem-loop structure, formed by a pair of inverted repeats during DNA replication, is a conserved feature at the origin of DNA replication (Ori) among plant and animal viruses, bacteriophages and plasmids that replicate their genomes via the rolling-circle replication (RCR) mechanism. Porcine circo...

Characterization and Comparative Overview of Complete Sequences of the First Plasmids of Pandoraea across Clinical and Non-clinical Strains

PubMed Central

Yong, Delicia; Tee, Kok Keng; Yin, Wai-Fong; Chan, Kok-Gan

2016-01-01

To date, information on plasmid analysis in Pandoraea spp. is scarce. To address the gap of knowledge on this, the complete sequences of eight plasmids from Pandoraea spp. namely Pandoraea faecigallinarum DSM 23572T (pPF72-1, pPF72-2), Pandoraea oxalativorans DSM 23570T (pPO70-1, pPO70-2, pPO70-3, pPO70-4), Pandoraea vervacti NS15 (pPV15) and Pandoraea apista DSM 16535T (pPA35) were studied for the first time in this study. The information on plasmid sequences in Pandoraea spp. is useful as the sequences did not match any known plasmid sequence deposited in public databases. Replication genes were not identified in some plasmids, a situation that has led to the possibility of host interaction involvement. Some plasmids were also void of par genes and intriguingly, repA gene was also not discovered in these plasmids. This further leads to the hypothesis of host-plasmid interaction. Plasmid stabilization/stability protein-encoding genes were observed in some plasmids but were not established for participating in plasmid segregation. Toxin-antitoxin systems MazEF, VapBC, RelBE, YgiT-MqsR, HigBA, and ParDE were identified across the plasmids and their presence would improve plasmid maintenance. Conjugation genes were identified portraying the conjugation ability amongst Pandoraea plasmids. Additionally, we found a shared region amongst some of the plasmids that consists of conjugation genes. The identification of genes involved in replication, segregation, toxin-antitoxin systems and conjugation, would aid the design of drugs to prevent the survival or transmission of plasmids carrying pathogenic properties. Additionally, genes conferring virulence and antibiotic resistance were identified amongst the plasmids. The observed features in the plasmids shed light on the Pandoraea spp. as opportunistic pathogens. PMID:27790203

Properties of new Escherichia coli Hfr strains constructed by integration of pSC101-derived conjugative plasmids.

PubMed Central

François, V; Conter, A; Louarn, J M

1990-01-01

Conjugative temperature-sensitive plasmids were derived from pSC101. These plasmids are useful in genetic analysis for two reasons: (i) they render possible the construction of new Hfr lines by plasmid integration at predetermined chromosomal loci via Tn10 inverse transposition, and (ii) the Hfr characters are transducible via bacteriophage P1. We also showed that replication from pSC101 origin is deleterious for the plasmid-chromosome fusion. PMID:2155201

Orderly Replication and Segregation of the Four Replicons of Burkholderia cenocepacia J2315

PubMed Central

Kamgoué, Alain; Murray, Heath; Pasta, Franck

2016-01-01

Bacterial genomes typically consist of a single chromosome and, optionally, one or more plasmids. But whole-genome sequencing reveals about ten per-cent of them to be multipartite, with additional replicons which by size and indispensability are considered secondary chromosomes. This raises the questions of how their replication and partition is managed without compromising genome stability and of how such genomes arose. Vibrio cholerae, with a 1 Mb replicon in addition to its 3 Mb chromosome, is the only species for which maintenance of a multipartite genome has been investigated. In this study we have explored the more complex genome of Burkholderia cenocepacia (strain J2315). It comprises an extra replicon (c2) of 3.21 Mb, comparable in size to the3.87Mb main chromosome (c1), another extra replicon(c3) of 0.87 Mb and a plasmid of 0.09 Mb. The replication origin of c1 is typically chromosomal and those of c2 and c3 are plasmid-like; all are replicated bidirectionally. Fluorescence microscopy of tagged origins indicates that all initiate replication at mid-cell and segregate towards the cell quarter positions sequentially, c1-c2-p1/c3. c2 segregation is as well-phased with the cell cycle as c1, implying that this plasmid-like origin has become subject to regulation not typical of plasmids; in contrast, c3 segregates more randomly through the cycle. Disruption of individual Par systems by deletion of parAB or by addition of parS sites showed each Par system to govern the positioning of its own replicon only. Inactivation of c1, c2 and c3 Par systems not only reduced growth rate, generated anucleate cells and compromised viability but influenced processes beyond replicon partition, notably regulation of replication, chromosome condensation and cell size determination. In particular, the absence of the c1 ParA protein altered replication of all three chromosomes, suggesting that the partition system of the main chromosome is a major participant in the choreography of the cell cycle. PMID:27428258

The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells

PubMed Central

Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni

2014-01-01

Summary The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications. PMID:25541598

The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells.

PubMed

Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni

2014-10-01

The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications.

Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

A CI-Independent Form of Replicative Inhibition: Turn Off of Early Replication of Bacteriophage Lambda

PubMed Central

Hayes, Sidney; Horbay, Monique A.; Hayes, Connie

2012-01-01

Several earlier studies have described an unusual exclusion phenotype exhibited by cells with plasmids carrying a portion of the replication region of phage lambda. Cells exhibiting this inhibition phenotype (IP) prevent the plating of homo-immune and hybrid hetero-immune lambdoid phages. We have attempted to define aspects of IP, and show that it is directed to repλ phages. IP was observed in cells with plasmids containing a λ DNA fragment including oop, encoding a short OOP micro RNA, and part of the lambda origin of replication, oriλ, defined by iteron sequences ITN1-4 and an adjacent high AT-rich sequence. Transcription of the intact oop sequence from its promoter, pO is required for IP, as are iterons ITN3–4, but not the high AT-rich portion of oriλ. The results suggest that IP silencing is directed to theta mode replication initiation from an infecting repλ genome, or an induced repλ prophage. Phage mutations suppressing IP, i.e., Sip, map within, or adjacent to cro or in O, or both. Our results for plasmid based IP suggest the hypothesis that there is a natural mechanism for silencing early theta-mode replication initiation, i.e. the buildup of λ genomes with oop + oriλ+ sequence. PMID:22590552

Attenuation of Replication-Competent Adenovirus Serotype 26 Vaccines by Vectorization

PubMed Central

Maxfield, Lori F.; Abbink, Peter; Stephenson, Kathryn E.; Borducchi, Erica N.; Ng'ang'a, David; Kirilova, Marinela M.; Paulino, Noelix; Boyd, Michael; Shabram, Paul; Ruan, Qian; Patel, Mayank

2015-01-01

Replication-competent adenovirus (rcAd)-based vaccine vectors may theoretically provide immunological advantages over replication-incompetent Ad vectors, but they also raise additional potential clinical and regulatory issues. We produced replication-competent Ad serotype 26 (rcAd26) vectors by adding the E1 region back into a replication-incompetent Ad26 vector backbone with the E3 or E3/E4 regions deleted. We assessed the effect of vectorization on the replicative capacity of the rcAd26 vaccines. Attenuation occurred in a stepwise fashion, with E3 deletion, E4 deletion, and human immunodeficiency virus type 1 (HIV-1) envelope (Env) gene insertion all contributing to reduced replicative capacity compared to that with the wild-type Ad26 vector. The rcAd26 vector with E3 and E4 deleted and containing the Env transgene exhibited 2.7- to 4.4-log-lower replicative capacity than that of the wild-type Ad26 in vitro. This rcAd26 vector is currently being evaluated in a phase 1 clinical trial. Attenuation as a result of vectorization and transgene insertion has implications for the clinical development of replication-competent vaccine vectors. PMID:26376928

Attenuation of Replication-Competent Adenovirus Serotype 26 Vaccines by Vectorization.

PubMed

Maxfield, Lori F; Abbink, Peter; Stephenson, Kathryn E; Borducchi, Erica N; Ng'ang'a, David; Kirilova, Marinela M; Paulino, Noelix; Boyd, Michael; Shabram, Paul; Ruan, Qian; Patel, Mayank; Barouch, Dan H

2015-11-01

Replication-competent adenovirus (rcAd)-based vaccine vectors may theoretically provide immunological advantages over replication-incompetent Ad vectors, but they also raise additional potential clinical and regulatory issues. We produced replication-competent Ad serotype 26 (rcAd26) vectors by adding the E1 region back into a replication-incompetent Ad26 vector backbone with the E3 or E3/E4 regions deleted. We assessed the effect of vectorization on the replicative capacity of the rcAd26 vaccines. Attenuation occurred in a stepwise fashion, with E3 deletion, E4 deletion, and human immunodeficiency virus type 1 (HIV-1) envelope (Env) gene insertion all contributing to reduced replicative capacity compared to that with the wild-type Ad26 vector. The rcAd26 vector with E3 and E4 deleted and containing the Env transgene exhibited 2.7- to 4.4-log-lower replicative capacity than that of the wild-type Ad26 in vitro. This rcAd26 vector is currently being evaluated in a phase 1 clinical trial. Attenuation as a result of vectorization and transgene insertion has implications for the clinical development of replication-competent vaccine vectors. Copyright © 2015, Maxfield et al.

New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.

PubMed

Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel

2016-03-01

Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.

Physical Characterization of Gemini Surfactant-Based Synthetic Vectors for the Delivery of Linear Covalently Closed (LCC) DNA Ministrings

PubMed Central

Sum, Chi Hong; Nafissi, Nafiseh; Slavcev, Roderick A.; Wettig, Shawn

2015-01-01

In combination with novel linear covalently closed (LCC) DNA minivectors, referred to as DNA ministrings, a gemini surfactant-based synthetic vector for gene delivery has been shown to exhibit enhanced delivery and bioavailability while offering a heightened safety profile. Due to topological differences from conventional circular covalently closed (CCC) plasmid DNA vectors, the linear topology of LCC DNA ministrings may present differences with regards to DNA interaction and the physicochemical properties influencing DNA-surfactant interactions in the formulation of lipoplexed particles. In this study, N,N-bis(dimethylhexadecyl)-α,ω-propanediammonium(16-3-16)gemini-based synthetic vectors, incorporating either CCC plasmid or LCC DNA ministrings, were characterized and compared with respect to particle size, zeta potential, DNA encapsulation, DNase sensitivity, and in vitro transgene delivery efficacy. Through comparative analysis, differences between CCC plasmid DNA and LCC DNA ministrings led to variations in the physical properties of the resulting lipoplexes after complexation with 16-3-16 gemini surfactants. Despite the size disparities between the plasmid DNA vectors (CCC) and DNA ministrings (LCC), differences in DNA topology resulted in the generation of lipoplexes of comparable particle sizes. The capacity for ministring (LCC) derived lipoplexes to undergo complete counterion release during lipoplex formation contributed to improved DNA encapsulation, protection from DNase degradation, and in vitro transgene delivery. PMID:26561857

Phage Lambda P Protein: Trans-Activation, Inhibition Phenotypes and their Suppression

PubMed Central

Hayes, Sidney; Erker, Craig; Horbay, Monique A.; Marciniuk, Kristen; Wang, Wen; Hayes, Connie

2013-01-01

The initiation of bacteriophage λ replication depends upon interactions between the oriλ DNA site, phage proteins O and P, and E. coli host replication proteins. P exhibits a high affinity for DnaB, the major replicative helicase for unwinding double stranded DNA. The concept of P-lethality relates to the hypothesis that P can sequester DnaB and in turn prevent cellular replication initiation from oriC. Alternatively, it was suggested that P-lethality does not involve an interaction between P and DnaB, but is targeted to DnaA. P-lethality is assessed by examining host cells for transformation by ColE1-type plasmids that can express P, and the absence of transformants is attributed to a lethal effect of P expression. The plasmid we employed enabled conditional expression of P, where under permissive conditions, cells were efficiently transformed. We observed that ColE1 replication and plasmid establishment upon transformation is extremely sensitive to P, and distinguish this effect from P-lethality directed to cells. We show that alleles of dnaB protect the variant cells from P expression. P-dependent cellular filamentation arose in ΔrecA or lexA[Ind-] cells, defective for SOS induction. Replication propagation and restart could represent additional targets for P interference of E. coli replication, beyond the oriC-dependent initiation step. PMID:23389467

Roles of the 2 microns gene products in stable maintenance of the 2 microns plasmid of Saccharomyces cerevisiae.

PubMed Central

Reynolds, A E; Murray, A W; Szostak, J W

1987-01-01

We have examined the replication and segregation of the Saccharomyces cerevisiae 2 microns circle. The amplification of the plasmid at low copy numbers requires site-specific recombination between the 2 microns inverted repeat sequences catalyzed by the plasmid-encoded FLP gene. No other 2 microns gene products are required. The overexpression of FLP in a strain carrying endogenous 2 microns leads to uncontrolled plasmid replication, longer cell cycles, and cell death. Two different assays show that the level of Flp activity decreases with increasing 2 microns copy number. This regulation requires the products of the REP1 and REP2 genes. These gene products also act together to ensure that 2 microns molecules are randomly segregated between mother and daughter cells at cell division. Images PMID:3316982

A novel dual vector coexpressing PhiX174 lysis E gene and staphylococcal nuclease A gene on the basis of lambda promoter pR and pL, respectively.

PubMed

Fu, Lixia; Lu, Chengping

2013-06-01

Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

PubMed

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

pLS101 plasmid vector

DOEpatents

Lacks, S.A.; Balganesh, T.S.

1985-02-19

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

Insensitivity of chromosome I and the cell cycle to blockage of replication and segregation of Vibrio cholerae chromosome II.

PubMed

Kadoya, Ryosuke; Chattoraj, Dhruba K

2012-01-01

Vibrio cholerae has two chromosomes (chrI and chrII) whose replication and segregation are under different genetic controls. The region covering the replication origin of chrI resembles that of the Escherichia coli chromosome, and both origins are under control of the highly conserved initiator, DnaA. The origin region of chrII resembles that of plasmids that have iterated initiator-binding sites (iterons) and is under control of the chrII-specific initiator, RctB. Both chrI and chrII encode chromosome-specific orthologs of plasmid partitioning proteins, ParA and ParB. Here, we have interfered with chrII replication, segregation, or both, using extra copies of sites that titrate RctB or ParB. Under these conditions, replication and segregation of chrI remain unaffected for at least 1 cell cycle. In this respect, chrI behaves similarly to the E. coli chromosome when plasmid maintenance is disturbed in the same cell. Apparently, no checkpoint exists to block cell division before the crippled chromosome is lost by a failure to replicate or to segregate. Whether blocking chrI replication can affect chrII replication remains to be tested. Chromosome replication, chromosome segregation, and cell division are the three main events of the cell cycle. They occur in an orderly fashion once per cell cycle. How the sequence of events is controlled is only beginning to be answered in bacteria. The finding of bacteria that possess more than one chromosome raises the important question: how are different chromosomes coordinated in their replication and segregation? It appears that in the evolution of the two-chromosome genome of V. cholerae, either the secondary chromosome adapted to the main chromosome to ensure its maintenance or it is maintained independently, as are bacterial plasmids. An understanding of chromosome coordination is expected to bear on the evolutionary process of chromosome acquisition and on the efficacy of possible strategies for selective elimination of a pathogen by targeting a specific chromosome.

Construction of small plasmid vectors for use in genetic improvement of the extremely acidophilic Acidithiobacillus caldus.

PubMed

Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang

2013-10-01

The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Modulation of an ultraviolet mutational hotspot in a shuttle vector Xeroderma cells.

PubMed Central

Seetharam, S; Seidman, M M

1991-01-01

Ultraviolet mutagenesis of the shuttle vector plasmid pZ189 in Xeroderma Pigmentosum cells yields a mutational pattern marked by hotspots at photoproduct sites on both strands of the supF marker gene. In order to test the influence of strand orientation on the appearance of hotspots the mutagenesis study was repeated on a vector with the supF gene in the inverted orientation. We recovered a pattern the same as that in the earlier work and conclude that the nature of the DNA polymerase involved in the replication of specific strands is not a primary determinant of hotspot occurrence in this system. One of the hotspots lies in an 8 base palindrome while the corresponding site on the other strand was not a hotspot. These results were obtained with calcium phosphate transfection of the UV treated vector. When DEAE dextran was used as a transfection agent both sites in the palindrome were hotspots. In a mixing experiment the calcium phosphate pattern was recovered. Our data suggest that the sequence determinants of mutational probability at these two sites lie outside the 8 bases of the palindrome and that mutagenesis at one, but not the other, site is sensitive to perturbation of cellular calcium levels. PMID:2027767

Generation of recombinant rotaviruses expressing fluorescent proteins using an optimized reverse genetics system.

PubMed

Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki

2018-04-18

An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.

High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

PubMed Central

Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.

2016-01-01

The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid partitioning and suggest underlying biological roles shared by such elements. PMID:26865697

Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

PubMed

Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

2012-01-01

TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

DNASU plasmid and PSI:Biology-Materials repositories: resources to accelerate biological research

PubMed Central

Seiler, Catherine Y.; Park, Jin G.; Sharma, Amit; Hunter, Preston; Surapaneni, Padmini; Sedillo, Casey; Field, James; Algar, Rhys; Price, Andrea; Steel, Jason; Throop, Andrea; Fiacco, Michael; LaBaer, Joshua

2014-01-01

The mission of the DNASU Plasmid Repository is to accelerate research by providing high-quality, annotated plasmid samples and online plasmid resources to the research community through the curated DNASU database, website and repository (http://dnasu.asu.edu or http://dnasu.org). The collection includes plasmids from grant-funded, high-throughput cloning projects performed in our laboratory, plasmids from external researchers, and large collections from consortia such as the ORFeome Collaboration and the NIGMS-funded Protein Structure Initiative: Biology (PSI:Biology). Through DNASU, researchers can search for and access detailed information about each plasmid such as the full length gene insert sequence, vector information, associated publications, and links to external resources that provide additional protein annotations and experimental protocols. Plasmids can be requested directly through the DNASU website. DNASU and the PSI:Biology-Materials Repositories were previously described in the 2010 NAR Database Issue (Cormier, C.Y., Mohr, S.E., Zuo, D., Hu, Y., Rolfs, A., Kramer, J., Taycher, E., Kelley, F., Fiacco, M., Turnbull, G. et al. (2010) Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community. Nucleic Acids Res., 38, D743–D749.). In this update we will describe the plasmid collection and highlight the new features in the website redesign, including new browse/search options, plasmid annotations and a dynamic vector mapping feature that was developed in collaboration with LabGenius. Overall, these plasmid resources continue to enable research with the goal of elucidating the role of proteins in both normal biological processes and disease. PMID:24225319

Homology between Escherichia coli plasmids ColE1 and p15A.

PubMed Central

Bird, R E

1981-01-01

The location and extent of the homology between plasmids ColE1 and p15A were determined by analysis of heteroduplexes formed between them as well as with a related plasmid, pBR322, and by hybridization of radioactive deoxyribonucleic acids to restriction fragments of p15A and ColE1. The homology between the plasmids contained the entire region of ColE1 required for its replication as well as an additional 400 base pairs downstream from the origin of replication. This region on p15A, which was 980 +/- 43 base pairs, started at 0.1 of the molecular length from one end formed by cleavage with the restriction endonuclease BglI and extended to 0.54 of the molecular length from the same end. Restriction cleavage maps for the enzymes BglI, HpaI, HaeII, HaeIII, and HincII are also presented. Images PMID:6259130

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

Precise determination, cross-recognition, and functional analysis of the double-strand origins of the rolling-circle replication plasmids in haloarchaea.

PubMed

Zhou, Ligang; Zhou, Meixian; Sun, Chaomin; Han, Jing; Lu, Qiuhe; Zhou, Jian; Xiang, Hua

2008-08-01

The precise nick site in the double-strand origin (DSO) of pZMX201, a 1,668-bp rolling-circle replication (RCR) plasmid from the haloarchaeon Natrinema sp. CX2021, was determined by electron microscopy and DSO mapping. In this plasmid, DSO nicking occurred between residues C404 and G405 within a heptanucleotide sequence (TCTC/GGC) located in the stem region of an imperfect hairpin structure. This nick site sequence was conserved among the haloarchaeal RCR plasmids, including pNB101, suggesting that the DSO nick site might be the same for all members of this plasmid family. Interestingly, the DSOs of pZMX201 and pNB101 were found to be cross-recognized in RCR initiation and termination in a hybrid plasmid system. Mutation analysis of the DSO from pZMX201 (DSO(Z)) in this hybrid plasmid system revealed that: (i) the nucleotides in the middle of the conserved TCTCGGC sequence play more-important roles in the initiation and termination process; (ii) the left half of the hairpin structure is required for initiation but not for termination; and (iii) a 36-bp sequence containing TCTCGGC and the downstream sequence is essential and sufficient for termination. In conclusion, these haloarchaeal plasmids, with novel features that are different from the characteristics of both single-stranded DNA phages and bacterial RCR plasmids, might serve as a good model for studying the evolution of RCR replicons.

A checkpoint control orchestrates the replication of the two chromosomes of Vibrio cholerae

PubMed Central

Val, Marie-Eve; Marbouty, Martial; de Lemos Martins, Francisco; Kennedy, Sean P.; Kemble, Harry; Bland, Michael J.; Possoz, Christophe; Koszul, Romain; Skovgaard, Ole; Mazel, Didier

2016-01-01

Bacteria with multiple chromosomes represent up to 10% of all bacterial species. Unlike eukaryotes, these bacteria use chromosome-specific initiators for their replication. In all cases investigated, the machineries for secondary chromosome replication initiation are of plasmid origin. One of the important differences between plasmids and chromosomes is that the latter replicate during a defined period of the cell cycle, ensuring a single round of replication per cell. Vibrio cholerae carries two circular chromosomes, Chr1 and Chr2, which are replicated in a well-orchestrated manner with the cell cycle and coordinated in such a way that replication termination occurs at the same time. However, the mechanism coordinating this synchrony remains speculative. We investigated this mechanism and revealed that initiation of Chr2 replication is triggered by the replication of a 150-bp locus positioned on Chr1, called crtS. This crtS replication–mediated Chr2 replication initiation mechanism explains how the two chromosomes communicate to coordinate their replication. Our study reveals a new checkpoint control mechanism in bacteria, and highlights possible functional interactions mediated by contacts between two chromosomes, an unprecedented observation in bacteria. PMID:27152358

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

Toxin Kid uncouples DNA replication and cell division to enforce retention of plasmid R1 in Escherichia coli cells.

PubMed

Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A; Agu, Chukwuma A; Wang, Xindan; Bernal, Juan A; Sherratt, David J; de la Cueva-Méndez, Guillermo

2014-02-18

Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid-bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs.

Toxin Kid uncouples DNA replication and cell division to enforce retention of plasmid R1 in Escherichia coli cells

PubMed Central

Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A.; Agu, Chukwuma A.; Wang, Xindan; Bernal, Juan A.; Sherratt, David J.; de la Cueva-Méndez, Guillermo

2014-01-01

Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid–bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs. PMID:24449860

Survey of Navy Funded Marine Mammal Research and Studies FY 00-01

DTIC Science & Technology

2001-05-10

protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

The Role of Clonal Interference in the Evolutionary Dynamics of Plasmid-Host Adaptation

PubMed Central

Hughes, Julie M.; Lohman, Brian K.; Deckert, Gail E.; Nichols, Eric P.; Settles, Matt; Abdo, Zaid; Top, Eva M.

2012-01-01

ABSTRACT Promiscuous plasmids replicate in a wide range of bacteria and therefore play a key role in the dissemination of various host-beneficial traits, including antibiotic resistance. Despite the medical relevance, little is known about the evolutionary dynamics through which drug resistance plasmids adapt to new hosts and thereby persist in the absence of antibiotics. We previously showed that the incompatibility group P-1 (IncP-1) minireplicon pMS0506 drastically improved its stability in novel host Shewanella oneidensis MR-1 after 1,000 generations under antibiotic selection for the plasmid. The only mutations found were those affecting the N terminus of the plasmid replication initiation protein TrfA1. Our aim in this study was to gain insight into the dynamics of plasmid evolution. Changes in stability and genotype frequencies of pMS0506 were monitored in evolving populations of MR-1 (pMS0506). Genotypes were determined by sequencing trfA1 amplicons from individual clones and by 454 pyrosequencing of whole plasmids from entire populations. Stability of pMS0506 drastically improved by generation 200. Many evolved plasmid genotypes with point mutations as well as in-frame and frameshift deletions and duplications in trfA1 were observed in all lineages with both sequencing methods. Strikingly, multiple genotypes were simultaneously present at high frequencies (>10%) in each population. Their relative abundances changed over time, but after 1,000 generations only one or two genotypes dominated the populations. This suggests that hosts with different plasmid genotypes were competing with each other, thus affecting the evolutionary trajectory. Plasmids can thus rapidly improve their stability, and clonal interference plays a significant role in plasmid-host adaptation dynamics. PMID:22761390

Prereplicative complexes assembled in vitro support origin-dependent and independent DNA replication

PubMed Central

On, Kin Fan; Beuron, Fabienne; Frith, David; Snijders, Ambrosius P; Morris, Edward P; Diffley, John F X

2014-01-01

Eukaryotic DNA replication initiates from multiple replication origins. To ensure each origin fires just once per cell cycle, initiation is divided into two biochemically discrete steps: the Mcm2-7 helicase is first loaded into prereplicative complexes (pre-RCs) as an inactive double hexamer by the origin recognition complex (ORC), Cdt1 and Cdc6; the helicase is then activated by a set of “firing factors.” Here, we show that plasmids containing pre-RCs assembled with purified proteins support complete and semi-conservative replication in extracts from budding yeast cells overexpressing firing factors. Replication requires cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK). DDK phosphorylation of Mcm2-7 does not by itself promote separation of the double hexamer, but is required for the recruitment of firing factors and replisome components in the extract. Plasmid replication does not require a functional replication origin; however, in the presence of competitor DNA and limiting ORC concentrations, replication becomes origin-dependent in this system. These experiments indicate that Mcm2-7 double hexamers can be precursors of replication and provide insight into the nature of eukaryotic DNA replication origins. PMID:24566989

Generation of Marker- and/or Backbone-Free Transgenic Wheat Plants via Agrobacterium-Mediated Transformation.

PubMed

Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin

2016-01-01

Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae.

PubMed

Gritz, L; Davies, J

1983-11-01

The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

Expression of recombinant organophosphorus hydrolase in the original producer of the enzyme, Sphingobium fuliginis ATCC 27551.

PubMed

Nakayama, Kosuke; Ohmori, Takeshi; Ishikawa, Satoshi; Iwata, Natsumi; Seto, Yasuo; Kawahara, Kazuyoshi

2016-05-01

The plasmid encoding His-tagged organophosphorus hydrolase (OPH) cloned from Sphingobium fuliginis was modified to be transferred back to this bacterium. The replication function of S. amiense plasmid was inserted at downstream of OPH gene, and S. fuliginis was transformed with this plasmid. The transformant produced larger amount of active OPH with His-tag than E. coli.

[Experimental study of human umbilical cord blood derived stromal cells transfected with recombinant adenoviral vector co-expressing VCAM-1 and GFP].

PubMed

Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu

2008-06-01

This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.

Rational plasmid design and bioprocess optimization to enhance recombinant adeno-associated virus (AAV) productivity in mammalian cells.

PubMed

Emmerling, Verena V; Pegel, Antje; Milian, Ernest G; Venereo-Sanchez, Alina; Kunz, Marion; Wegele, Jessica; Kamen, Amine A; Kochanek, Stefan; Hoerer, Markus

2016-02-01

Viral vectors used for gene and oncolytic therapy belong to the most promising biological products for future therapeutics. Clinical success of recombinant adeno-associated virus (rAAV) based therapies raises considerable demand for viral vectors, which cannot be met by current manufacturing strategies. Addressing existing bottlenecks, we improved a plasmid system termed rep/cap split packaging and designed a minimal plasmid encoding adenoviral helper function. Plasmid modifications led to a 12-fold increase in rAAV vector titers compared to the widely used pDG standard system. Evaluation of different production approaches revealed superiority of processes based on anchorage- and serum-dependent HEK293T cells, exhibiting about 15-fold higher specific and volumetric productivity compared to well-established suspension cells cultivated in serum-free medium. As for most other viral vectors, classical stirred-tank bioreactor production is thus still not capable of providing drug product of sufficient amount. We show that manufacturing strategies employing classical surface-providing culture systems can be successfully transferred to the new fully-controlled, single-use bioreactor system Integrity(TM) iCELLis(TM) . In summary, we demonstrate substantial bioprocess optimizations leading to more efficient and scalable production processes suggesting a promising way for flexible large-scale rAAV manufacturing. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The evolution of heart gene delivery vectors.

PubMed

Wasala, Nalinda B; Shin, Jin-Hong; Duan, Dongsheng

2011-10-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. Copyright © 2011 John Wiley & Sons, Ltd.

The evolution of heart gene delivery vectors

PubMed Central

Wasala, Nalinda B.; Shin, Jin-Hong; Duan, Dongsheng

2012-01-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. PMID:21837689

Development and Host Compatibility of Plasmids for Two Important Ruminant Pathogens, Mycoplasma bovis and Mycoplasma agalactiae

PubMed Central

Sharma, Shukriti; Citti, Chistine; Sagné, Eveline; Marenda, Marc S.

2015-01-01

Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae. PMID:25746296

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Intramolecular transposition by a synthetic IS50 (Tn5) derivative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomcsanyi, T.; Phadnis, S.H.; Berg, D.E.

1990-11-01

We report the formation of deletions and inversions by intramolecular transposition of Tn5-derived mobile elements. The synthetic transposons used contained the IS50 O and I end segments and the transposase gene, a contraselectable gene encoding sucrose sensitivity (sacB), antibiotic resistance genes, and a plasmid replication origin. Both deletions and inversions were associated with loss of a 300-bp segment that is designated the vector because it is outside of the transposon. Deletions were severalfold more frequent than inversions, perhaps reflecting constraints on DNA twisting or abortive transposition. Restriction and DNA sequence analyses showed that both types of rearrangements extended from onemore » transposon end to many different sites in target DNA. In the case of inversions, transposition generated 9-bp direct repeats of target sequences.« less

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE PAGES

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...

2018-02-01

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

The Composite 259-kb Plasmid of Martelella mediterranea DSM 17316T–A Natural Replicon with Functional RepABC Modules from Rhodobacteraceae and Rhizobiaceae

PubMed Central

Bartling, Pascal; Brinkmann, Henner; Bunk, Boyke; Overmann, Jörg; Göker, Markus; Petersen, Jörn

2017-01-01

A multipartite genome organization with a chromosome and many extrachromosomal replicons (ECRs) is characteristic for Alphaproteobacteria. The best investigated ECRs of terrestrial rhizobia are the symbiotic plasmids for legume root nodulation and the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens. RepABC plasmids represent the most abundant alphaproteobacterial replicon type. The currently known homologous replication modules of rhizobia and Rhodobacteraceae are phylogenetically distinct. In this study, we surveyed type-strain genomes from the One Thousand Microbial Genomes (KMG-I) project and identified a roseobacter-specific RepABC-type operon in the draft genome of the marine rhizobium Martelella mediterranea DSM 17316T. PacBio genome sequencing demonstrated the presence of three circular ECRs with sizes of 593, 259, and 170-kb. The rhodobacteral RepABC module is located together with a rhizobial equivalent on the intermediate sized plasmid pMM259, which likely originated in the fusion of a pre-existing rhizobial ECR with a conjugated roseobacter plasmid. Further evidence for horizontal gene transfer (HGT) is given by the presence of a roseobacter-specific type IV secretion system on the 259-kb plasmid and the rhodobacteracean origin of 62% of the genes on this plasmid. Functionality tests documented that the genuine rhizobial RepABC module from the Martelella 259-kb plasmid is only maintained in A. tumefaciens C58 (Rhizobiaceae) but not in Phaeobacter inhibens DSM 17395 (Rhodobacteraceae). Unexpectedly, the roseobacter-like replication system is functional and stably maintained in both host strains, thus providing evidence for a broader host range than previously proposed. In conclusion, pMM259 is the first example of a natural plasmid that likely mediates genetic exchange between roseobacters and rhizobia. PMID:28983283

Archaeal Extrachromosomal Genetic Elements

PubMed Central

Wang, Haina; Peng, Nan; Shah, Shiraz A.

2015-01-01

SUMMARY Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes, such as spindles, rods, filaments, spheres, head-tails, bottles, and droplets, and some of these new viruses have been classified into one order, 10 families, and 16 genera. Investigation of model archaeal viruses has yielded important insights into mechanisms underlining various steps in the viral life cycle, including infection, DNA replication and transcription, and virion egression. Many of these mechanisms are unprecedented for any known bacterial or eukaryal viruses. Studies of plasmids isolated from different archaeal hosts have also revealed a striking diversity in gene content and innovation in replication strategies. Highly divergent replication proteins are identified in both viral and plasmid genomes. Genomic studies of archaeal ECEs have revealed a modular sequence structure in which modules of DNA sequence are exchangeable within, as well as among, plasmid families and probably also between viruses and plasmids. In particular, it has been suggested that ECE-host interactions have shaped the coevolution of ECEs and their archaeal hosts. Furthermore, archaeal hosts have developed defense systems, including the innate restriction-modification (R-M) system and the adaptive CRISPR (clustered regularly interspaced short palindromic repeats) system, to restrict invasive plasmids and viruses. Together, these interactions permit a delicate balance between ECEs and their hosts, which is vitally important for maintaining an innovative gene reservoir carried by ECEs. In conclusion, while research on archaeal ECEs has just started to unravel the molecular biology of these genetic entities and their interactions with archaeal hosts, it is expected to accelerate in the next decade. PMID:25694123

Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

PubMed

Zakian, V A; Brewer, B J; Fangman, W L

1979-08-01

Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA molecule is identical to that which controls the initiation of chromosomal DNA.

Engineering new mycobacterial vaccine design for HIV–TB pediatric vaccine vectored by lysine auxotroph of BCG

PubMed Central

Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan

2014-01-01

In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961

Design of a Retrovirus-Derived Vector for Expression and Transduction of Exogenous Genes in Mammalian Cells

PubMed Central

Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard

1983-01-01

We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426

Host control of plasmid replication: requirement for the sigma factor sigma 32 in transcription of mini-F replication initiator gene.

PubMed Central

Wada, C; Imai, M; Yura, T

1987-01-01

Replication of F factor or mini-F plasmid is strongly inhibited in the rpoH (htpR) mutants of Escherichia coli deficient in the sigma factor (sigma 32) known to be required for heat shock gene expression. Transcription of the mini-F repE gene encoding a replication initiator protein (E protein) was examined by operon fusion and by direct determination of repE mRNA. The synthesis rate and the level of repE mRNA were found to increase transiently upon temperature upshift (30 degrees C to 42 degrees C) in wild-type cells but to decrease rapidly in the rpoH mutants. Thus sigma 32 appeared to be directly involved in transcription of repE whose product, E protein, in turn activates DNA replication from the mini-F ori2 region. This scheme of host-controlled plasmid replication is further supported by the analysis of transcription in vitro: RNA synthesis can be initiated from the repE promoter by a minor form of RNA polymerase containing sigma 32 but not by the major polymerase containing the normal sigma factor sigma 70. The sigma 32-mediated transcription from the repE promoter is strongly inhibited by the E protein. We conclude that transcription of the mini-F repE gene is mediated by the host transcription factor sigma 32 and is negatively controlled by its own product. Images PMID:2447584

Molecular transformation, gene cloning, and gene expression systems for filamentous fungi

USGS Publications Warehouse

Gold, Scott E.; Duick, John W.; Redman, Regina S.; Rodriguez, Rusty J.

2001-01-01

This chapter discusses the molecular transformation, gene cloning, and gene expression systems for filamentous fungi. Molecular transformation involves the movement of discrete amounts of DNA into cells, the expression of genes on the transported DNA, and the sustainable replication of the transforming DNA. The ability to transform fungi is dependent on the stable replication and expression of genes located on the transforming DNA. Three phenomena observed in bacteria, that is, competence, plasmids, and restriction enzymes to facilitate cloning, were responsible for the development of molecular transformation in fungi. Initial transformation success with filamentous fungi, involving the complementation of auxotrophic mutants by exposure to sheared genomic DNA or RNA from wt isolates, occurred with low transformation efficiencies. In addition, it was difficult to retrieve complementing DNA fragments and isolate genes of interest. This prompted the development of transformation vectors and methods to increase efficiencies. The physiological studies performed with fungi indicated that the cell wall could be removed to generate protoplasts. It was evident that protoplasts could be transformed with significantly greater efficiencies than walled cells.

An infectious recombinant equine arteritis virus expressing green fluorescent protein from its replicase gene.

PubMed

van den Born, Erwin; Posthuma, Clara C; Knoops, Kèvin; Snijder, Eric J

2007-04-01

Thus far, systems developed for heterologous gene expression from the genomes of nidoviruses (arteriviruses and coronaviruses) have relied mainly on the translation of foreign genes from subgenomic mRNAs, whose synthesis is a key feature of the nidovirus life cycle. In general, such expression vectors often suffered from relatively low and unpredictable expression levels, as well as genome instability. In an attempt to circumvent these disadvantages, the possibility to express a foreign gene [encoding enhanced green fluorescent protein (eGFP)] from within the nidovirus replicase gene, which encodes two large polyproteins that are processed proteolytically into the non-structural proteins (nsps) required for viral RNA synthesis, has now been explored. A viable recombinant of the arterivirus Equine arteritis virus, EAV-GFP2, was obtained, which contained the eGFP insert at the site specifying the junction between the two most N-proximal replicase-cleavage products, nsp1 and nsp2. EAV-GFP2 replication could be launched by transfection of cells with either in vitro-generated RNA transcripts or a DNA launch plasmid. EAV-GFP2 displayed growth characteristics similar to those of the wild-type virus and was found to maintain the insert stably for at least eight passages. It is proposed that EAV-GFP2 has potential for arterivirus vector development and as a tool in inhibitor screening. It can also be used for fundamental studies into EAV replication, which was illustrated by the fact that the eGFP signal of EAV-GFP2, which largely originated from an eGFP-nsp2 fusion protein, could be used to monitor the formation of the membrane-bound EAV replication complex in real time.

Function of BRCA1 at a DNA Replication Origin

DTIC Science & Technology

2004-07-01

origin of Epstein-Barr Virus DNA replication (Ori P). OriP replicates once and only once per cell cycle in synchrony with the cellular genome, and is...modifications, and to investigate its function at OriP in DNA replication and plasmid maintenance. We propose that these studies will provide valuable...information concerning the function of OriP at replication origins and in the control of DNA replication initiation and genome stability.

Agroinfection as an alternative to insects for infecting plants with beet western yellows luteovirus.

PubMed Central

Leiser, R M; Ziegler-Graff, V; Reutenauer, A; Herrbach, E; Lemaire, O; Guilley, H; Richards, K; Jonard, G

1992-01-01

Beet western yellows luteovirus, like other luteoviruses, cannot be transmitted to host plants by mechanical inoculation but requires an aphid vector, a feature that has heretofore presented a serious obstacle to the study of such viruses. In this paper we describe use of agroinfection to infect hosts with beet western yellows virus without recourse to aphids. Agroinfection is a procedure for introducing a plant virus into a host via Agrobacterium tumefaciens harboring a Ti plasmid, which can efficiently transfer a portion of the plasmid (T-DNA) to plant cells near a wound. The viral genome must be inserted into the T-DNA in such a way that it can escape and begin autonomous replication, a requirement that has, so far, limited agroinfection to pathogens with a circular genome. We have cloned cDNA corresponding to the complete beet western yellows virus RNA genome between the cauliflower mosaic virus 35S promoter and the nopaline synthase transcription termination signal. In one construct, a self-cleaving (ribozyme) sequence was included so as to produce a transcript in planta with a 3' extremity almost identical to natural viral RNA. When inoculated mechanically to host plants, the naked plasmid DNA was not infectious but, when introduced into T-DNA and agroinfected to plants, both the construct with and without the ribozyme produced an infection. This approach should be applicable to virtually any plant virus with a linear plus-strand RNA genome. Images PMID:1409615

Anti-tumor function of double-promoter regulated adenovirus carrying SEA gene, in the treatment of bladder cancer.

PubMed

Hu, Jianpeng; Xuan, Xujun; Han, Conghui; Hao, Lin; Zhang, Peiying; Chen, Meng; He, Houguang; Fan, Tao; Dong, Binzheng

2012-03-01

To construct an adenovirus carrying SEA gene and regulated by telomerase reverse transcriptase (hTERT) and hypoxia-inducible factor (HIF) promoters and investigate its anti-tumor function in vitro, as well as its role in lymphocyte production. hTERT and HIF genes were cloned into adenovirus E1A and E1B shuttle plasmids. The control vector for SEA gene expression is under the regulation of CMV and SV40 promoters. Double regulation was obtained through homologous recombination. The positive clones of replicable adenovirus H2-SEA-Ad were selected by plaque assay. The adenovirus was purified, titrated, and DNA was verified by PCR. The obtained virus was used to infect EJ bladder tumor cells and the SEA Mrna, and protein expression was measured by RT-PCR, western blot, and immunofluorescence microscopy, respectively. Co-culture of lymphocytes and tumor cells was observed dynamically under microscope. The construction of shuttle plasmid p315-CSS-SEA was confirmed by PCR and DNA sequencing. Insertion of superantigen SEA gene in adenovirus (H2-SEA-Ad.SEA) was obtained by homologous recombination. In lymphocytes and tumor cell co-culture, the number of viable tumor cells in test groups was significantly lower than that in control group after 12, 24, and 48 h of treatment. Production of interleukin-2, interleukin-4, and tumor necrosis factor were higher in test groups than in control group. Expression of SEA gene in bladder tumor cells by adenoviral vector caused reduced tumor cell proliferation, as well as stimulation of inflammatory cytokine productions in co-cultures with lymphocytes.

Description of two new plasmids isolated from Francisella philomiragia strains and construction of shuttle vectors for the study of Francisella tularensis.

PubMed

Le Pihive, E; Blaha, D; Chenavas, S; Thibault, F; Vidal, D; Valade, E

2009-11-01

Francisella tularensis is the causative agent of tularemia, a zoonotic disease often transmitted to humans by infected animals. The lack of useful specific genetic tools has long hampered the study of F. tularensis subspecies. We identified and characterized two new plasmids, pF242 and pF243, isolated from Francisella philomiragia strains ATCC 25016 and ATCC 25017, respectively. Sequence analysis revealed that pF242 and pF243 are closely related to pC194 and pFNL10 plasmids, respectively. Two generations of pF242- and pF243-based shuttle vectors, harboring several antibiotic resistance markers, were developed. We used the first generation to compare transformation efficiencies in two virulent F. tularensis subspecies. We found that electroporation was more efficient than cryotransformation: almost all vectors tested were successfully introduced by electroporation into Francisella strains with a high level of efficiency. The second generation of shuttle vectors, containing a multiple cloning site and/or gfp gene downstream of Francisella groES promotor, was used for GFP production in F. tularensis. The development of new shuttle vectors offers new perspectives in the genetic manipulation of F. tularensis, helping to elucidate the mechanisms underlying its virulence.

Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli.

PubMed

Thomason, Lynn C; Costantino, Nina; Court, Donald L

2016-09-13

Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.

Novel RepA-MCM proteins encoded in plasmids pTAU4, pORA1 and pTIK4 from Sulfolobus neozealandicus

PubMed Central

Greve, Bo; Jensen, Susanne; Phan, Hoa; Brügger, Kim; Zillig, Wolfram; She, Qunxin; Garrett, Roger A.

2005-01-01

Three plasmids isolated from the crenarchaeal thermoacidophile Sulfolobus neozealandicus were characterized. Plasmids pTAU4 (7,192 bp), pORA1 (9,689 bp) and pTIK4 (13,638 bp) show unusual properties that distinguish them from previously characterized cryptic plasmids of the genus Sulfolobus. Plasmids pORA1 and pTIK4 encode RepA proteins, only the former of which carries the novel polymerase–primase domain of other known Sulfolobus plasmids. Plasmid pTAU4 encodes a mini-chromosome maintenance protein homolog and no RepA protein; the implications for DNA replication are considered. Plasmid pORA1 is the first Sulfolobus plasmid to be characterized that does not encode the otherwise highly conserved DNA-binding PlrA protein. Another encoded protein appears to be specific for the New Zealand plasmids. The three plasmids should provide useful model systems for functional studies of these important crenarchaeal proteins. PMID:15876565

Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

PubMed Central

Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

2012-01-01

We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

Development of canine herpesvirus based antifertility vaccines for foxes using bacterial artificial chromosomes.

PubMed

Strive, Tanja; Hardy, Christopher M; French, Nigel; Wright, John D; Nagaraja, Nitin; Reubel, Gerhard H

2006-02-13

Using bacterial artificial chromosome (BAC) technology, a canine herpesvirus (CHV)-based recombinant vaccine vector was produced for the development of an antifertility vaccine for foxes. Infectious viruses were recovered following transfection of canid cells with a BAC plasmid carrying the complete CHV genome. In vitro growth characteristics of BAC-derived viruses were similar to that of wildtype (wt)-CHV. Two recombinant antigens, fox zona pellucida protein subunit 3 (fZPC) and enhanced green fluorescent protein (EGFP) as control antigen, were inserted into thymidine kinase (TK) locus of the CHV genome and shown to be efficiently expressed in vitro. Inoculation of foxes with transgenic CHVs induced CHV specific antibodies, but was innocuous and failed to elicit transgene-specific antibody responses. Infectious virus or viral DNA was not detected in mucosal secretions or tissues of vaccinated foxes. The CHV-BAC system proved to be a quick and reliable method to manipulate the CHV genome. It will help to readily apply changes in the vector design in order to improve virus replication in vivo.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.

PubMed

Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A

2008-01-01

Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.

Characterization of the Basic Replicon of Rhodococcus Plasmid pSOX and Development of a Rhodococcus-Escherichia coli Shuttle Vector†

PubMed Central

Denis-Larose, Claude; Bergeron, Hélène; Labbé, Diane; Greer, Charles W.; Hawari, Jalal; Grossman, Matthew J.; Sankey, Bruce M.; Lau, Peter C. K.

1998-01-01

The replication region of a 100-kb desulfurization plasmid (pSOX) from Rhodococcus sp. strain X309 was localized to a 4-kb KpnI fragment, and its sequence was determined. The amino acid sequence of one of the predicted open reading frames (ORFs) was related to the putative replication (Rep) protein sequences of the mycobacterial pLR7 family of plasmids. Three of the five predicted ORF products were identified by radiolabelling with the Escherichia coli T7 polymerase/promoter system. In E. coli, the Rep protein of pSOX was apparently synthesized in a shortened form, 21.3 kDa instead of the predicted 41.3 kDa, as a result of an internal initiation. This situation is reminescent of that for some bacterial Rep proteins. A shuttle plasmid was constructed with the pSOX origin, pBluescript II KS−, and the chloramphenicol resistance (Cmr) gene from pRF29. This new shuttle plasmid was used to demonstrate expression of the Bacillus subtilis sacB gene in a strain of Rhodococcus, rendering it sensitive to the presence of sucrose. PMID:9797291

A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.

PubMed

Hassan, Sally; Keshavarz-Moore, Eli; Ward, John

2016-09-01

With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.

Multiple determinants controlling activation of yeast replication origins late in S phase.

PubMed

Friedman, K L; Diller, J D; Ferguson, B M; Nyland, S V; Brewer, B J; Fangman, W L

1996-07-01

Analysis of a 131-kb segment of the left arm of yeast chromosome XIV beginning 157 kb from the telomere reveals four highly active origins of replication that initiate replication late in S phase. Previous work has shown that telomeres act as determinants for late origin activation. However, at least two of the chromosome XIV origins maintain their late activation time when located on large circular plasmids, indicating that late replication is independent of telomeres. Analysis of the replication time of plasmid derivatives containing varying amounts of chromosome XIV DNA show that a minimum of three chromosomal elements, distinct from each tested origin, contribute to late activation time. These late determinants are functionally equivalent, because duplication of one set of contributing sequences can compensate for the removal of another set. Furthermore, insertion of an origin that is normally early activated into this domain results in a shift to late activation, suggesting that the chromosome XIV origins are not unique in their ability to respond to the late determinants.

Mobilization Function of the pBHR1 Plasmid, a Derivative of the Broad-Host-Range Plasmid pBBR1

PubMed Central

Szpirer, Cédric Y.; Faelen, Michel; Couturier, Martine

2001-01-01

The pBHR1 plasmid is a derivative of the small (2.6-kb), mobilizable broad-host-range plasmid pBBR1, which was isolated from the gram-negative bacterium Bordetella bronchiseptica (R. Antoine and C. Locht, Mol. Microbiol. 6:1785–1799, 1992). Plasmid pBBR1 consists of two functional cassettes and presents sequence similarities with the transfer origins of several plasmids and mobilizable transposons from gram-positive bacteria. We show that the Mob protein specifically recognizes a 52-bp sequence which contains, in addition to the transfer origin, the promoter of the mob gene. We demonstrate that this gene is autoregulated. The binding of the Mob protein to the 52-bp sequence could thus allow the formation of a protein-DNA complex with a double function: relaxosome formation and mob gene regulation. We show that the Mob protein is a relaxase, and we located the nic site position in vitro. After sequence alignment, the position of the nic site of pBBR1 corresponds with those of the nick sites of the Bacteroides mobilizable transposon Tn4555 and the streptococcal plasmid pMV158. The oriT of the latter is characteristic of a family of mobilizable plasmids that are found in gram-positive bacteria and that replicate by the rolling-circle mechanism. Plasmid pBBR1 thus appears to be a new member of this group, even though it resides in gram-negative bacteria and does not replicate via a rolling-circle mechanism. In addition, we identified two amino acids of the Mob protein necessary for its activity, and we discuss their involvement in the mobilization mechanism. PMID:11222611

Herpesvirus papio contains a plasmid origin of replication that acts in cis interspecies with an Epstein-Barr virus trans-acting function.

PubMed Central

Pesano, R L; Pagano, J S

1986-01-01

Herpesvirus papio (HVP) and Epstein-Barr virus (EBV) are closely related biologically and biochemically; lymphoblastoid cells infected with either virus contain episomal viral DNA. The putative origin of replication for EBV plasmids (oriP) has been assigned to a 1,790-base-pair fragment (cis) in the short unique region of the genome which requires a viral function supplied in trans from elsewhere in the genome (J. Yates, N. Warren, D. Reisman, and B. Sugden, Proc. Natl. Acad. Sci. USA 81:3806-3810, 1984). We report here the identification of the putative origin of replication (cis) in HVP; we assigned it to the HVP EcoRI K fragment. The results indicate that the HVP replication process requires both a cis and a trans-acting function, analogous to that found in EBV. Images PMID:3023667

Horizontal gene transfer and antibiotic resistance plasmids in multi-drug resistant Salmonella enterica serovars

USDA-ARS?s Scientific Manuscript database

Antibiotic resistant foodborne pathogens pose serious public health concerns and increase the burden of disease treatment. Antibiotic resistance genes can reside on the bacterial chromosome or on other self-replicating DNA molecules such as plasmids. The resistance genes/DNA can be transferred int...

Integration of replication-defective R68.45-like plasmids into the Pseudomonas aeruginosa chromosome.

PubMed

Reimmann, C; Rella, M; Haas, D

1988-06-01

R68.45 and other similar broad-host-range (IncP) plasmids carrying a tandem repeat of the 2.1 kb insertion element IS21 mobilize the chromosome of many different Gram-negative bacteria. To analyse the structure of R68.45-chromosome cointegrates, whose involvement in the mobilization process had been postulated previously, we selected for the stable integration of R68.45-like plasmids into the Pseudomonas aeruginosa chromosome. Two plasmids were chosen: pME28, a transfer-deficient, mobilizable RP1 derivative with an inactive replication control (trfA) gene, and pME487, an R68.45 derivative with a trfA(ts) mutation causing temperature-sensitive replication. Chromosomally integrated pME28 and pME487 were found to be flanked by single IS21 elements. This structure is in agreement with a 'cut-and-paste' mode of R68.45 transposition. pME28 and pME487 showed a low specificity of insertion but rarely (less than 0.1%) induced auxotrophic mutations. Hfr (high-frequency-of-recombination) donors of P. aeruginosa could be obtained by chromosomal integration of pME487 or pME28; in the latter case, the transfer functions lacking from pME28 had to be provided in trans on an autonomous plasmid. Hfr donors gave higher conjugational linkage and transferred longer stretches of the P. aeruginosa chromosome than did R68.45 donors. This suggests that the integration of R68.45 into the donor chromosome is short-lived in P. aeruginosa.

Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

Fusion and Compatibility of Camphor and Octane Plasmids in Pseudomonas

PubMed Central

Chou, George I. N.; Katz, Dvorah; Gunsalus, I. C.

1974-01-01

The octane (OCT) plasmid in Pseudomonas putida derived from the ω-hydroxylase-carrying strain of Coon and coworkers is transferable to the camphor (CAM) plasmid-bearing strain by conjugation or by transduction. While the majority of the Cam +Oct+ exconjugants segregate Cam+ or Oct+ cells, exconjugants with stable Cam +Oct+ phenotype (CAM-OCT) can be detected at a low frequency. The transductants are all of the CAM-OCT phenotype. In the stable Cam +Oct+ strains, the OCT plasmid resembles the CAM plasmid with respect to curing by mitomycin C, transfer in conjugation, and reaction to ts (temperature-sensitive) mutation specifically affecting CAM plasmid replication. Therefore, it is suggested that certain regions of homology exist between the CAM and OCT plasmids that enable them to recombine to form a single plasmid, and to overcome the incompatibility barrier that prevents their coexisting. PMID:4527812

The cost of copy number in a selfish genetic element: the 2-μm plasmid of Saccharomyces cerevisiae.

PubMed

Harrison, Ellie; Koufopanou, V; Burt, A; MacLean, R C

2012-11-01

Many autonomously replicating genetic elements exist as multiple copies within the cell. The copy number of these elements is often assumed to have important fitness consequences for both element and host, yet the forces shaping its evolution are not well understood. The 2 μm is a multicopy plasmid of Saccharomyces yeasts, encoding just four genes that are solely involved in plasmid replication. One simple model for the fitness relationship between yeasts and 2 μm is that plasmid copy number evolves as a trade-off between selection for increased vertical transmission, favouring high copy number, and selection for decreased virulence, favouring low copy number. To test this model, we experimentally manipulated the copy number of the plasmid and directly measured the fitness cost, in terms of growth rate reduction, associated with high plasmid copy number. We find that the fitness burden imposed by the 2 μm increases with plasmid copy number, such that each copy imposes a fitness burden of 0.17% (± 0.008%), greatly exceeding the cost expected for it to be stably maintained in yeast populations. Our results demonstrate the crucial importance of copy number in the evolution of yeast per 2 μm associations and pave the way for future studies examining how selection can shape the cost of multicopy elements. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

Comparative genomics of the pIPO2/pSB102 family of environmental plasmids: sequence, evolution, and ecology of pTer331 isolated from Collimonas fungivorans Ter331.

PubMed

Mela, Francesca; Fritsche, Kathrin; Boersma, Hidde; van Elsas, Jan D; Bartels, Daniela; Meyer, Folker; de Boer, Wietse; van Veen, Johannes A; Leveau, Johan H J

2008-10-01

Plasmid pTer331 from the bacterium Collimonas fungivorans Ter331 is a new member of the pIPO2/pSB102 family of environmental plasmids. The 40 457-bp sequence of pTer331 codes for 44 putative ORFs, most of which represent genes involved in replication, partitioning and transfer of the plasmid. We confirmed that pTer331 is stably maintained in its native host. Deletion analysis identified a mini-replicon capable of replicating autonomously in Escherichia coli and Pseudomonas putida. Furthermore, plasmid pTer331 was able to mobilize and retromobilize IncQ plasmid pSM1890 at typical rates of 10(-4) and 10(-8), respectively. Analysis of the 91% DNA sequence identity between pTer331 and pIPO2 revealed functional conservation of coding sequences, the deletion of DNA fragments flanked by short direct repeats (DR), and sequence preservation of long DRs. In addition, we experimentally established that pTer331 has no obvious contribution in several of the phenotypes that are characteristic of its host C. fungivorans Ter331, including the ability to efficiently colonize plant roots. Based on our findings, we hypothesize that cryptic plasmids such as pTer331 and pIPO2 might not confer an individual advantage to bacteria, but, due to their broad-host-range and ability to retromobilize, benefit bacterial populations by accelerating the intracommunal dissemination of the mobile gene pool.

[Construction and expression analysis of the zebrafish heart-specific transgenetic vector based on Tol2 transposable element].

PubMed

Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun

2010-02-01

In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.

Strategies and approaches in plasmidome studies-uncovering plasmid diversity disregarding of linear elements?

PubMed

Dib, Julián R; Wagenknecht, Martin; Farías, María E; Meinhardt, Friedhelm

2015-01-01

The term plasmid was originally coined for circular, extrachromosomal genetic elements. Today, plasmids are widely recognized not only as important factors facilitating genome restructuring but also as vehicles for the dissemination of beneficial characters within bacterial communities. Plasmid diversity has been uncovered by means of culture-dependent or -independent approaches, such as endogenous or exogenous plasmid isolation as well as PCR-based detection or transposon-aided capture, respectively. High-throughput-sequencing made possible to cover total plasmid populations in a given environment, i.e., the plasmidome, and allowed to address the quality and significance of self-replicating genetic elements. Since such efforts were and still are rather restricted to circular molecules, here we put equal emphasis on the linear plasmids which-despite their frequent occurrence in a large number of bacteria-are largely neglected in prevalent plasmidome conceptions.

Complementation of Conjugation Functions of Streptomyces lividans Plasmid pIJ101 by the Related Streptomyces Plasmid pSB24.2

PubMed Central

Pettis, Gregg S.; Prakash, Shubha

1999-01-01

A database search revealed extensive sequence similarity between Streptomyces lividans plasmid pIJ101 and Streptomyces plasmid pSB24.2, which is a deletion derivative of Streptomyces cyanogenus plasmid pSB24.1. The high degree of relatedness between the two plasmids allowed the construction of a genetic map of pSB24.2, consisting of putative transfer and replication loci. Two pSB24.2 loci, namely, the cis-acting locus for transfer (clt) and the transfer-associated korB gene, were shown to be capable of complementing the pIJ101 clt and korB functions, respectively, a result that is consistent with the notion that pIJ101 and the parental plasmid pSB24.1 encode highly similar, if not identical, conjugation systems. PMID:10419972

Plasmid DNA Delivery: Nanotopography Matters.

PubMed

Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong

2017-12-20

Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.

[Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

PubMed

Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

2016-01-01

Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus

PubMed Central

Rodriguez, Michelle D.; Paul, Zubin; Wood, Charles E.; Rice, Kelly C.; Triplett, Eric W.

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus. These three reporter plasmids are available through BEI Resources. PMID:29312199

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus.

PubMed

Rodriguez, Michelle D; Paul, Zubin; Wood, Charles E; Rice, Kelly C; Triplett, Eric W

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus . These three reporter plasmids are available through BEI Resources.

Methods for Gene Transfer to the Central Nervous System

PubMed Central

Kantor, Boris; Bailey, Rachel M.; Wimberly, Keon; Kalburgi, Sahana N.; Gray, Steven J.

2015-01-01

Gene transfer is an increasingly utilized approach for research and clinical applications involving the central nervous system (CNS). Vectors for gene transfer can be as simple as an unmodified plasmid, but more commonly involve complex modifications to viruses to make them suitable gene delivery vehicles. This chapter will explain how tools for CNS gene transfer have been derived from naturally occurring viruses. The current capabilities of plasmid, retroviral, adeno-associated virus, adenovirus, and herpes simplex virus vectors for CNS gene delivery will be described. These include both focal and global CNS gene transfer strategies, with short- or long-term gene expression. As is described in this chapter, an important aspect of any vector is the cis-acting regulatory elements incorporated into the vector genome that control when, where, and how the transgene is expressed. PMID:25311922

Enhanced Eradication of Lymphoma by Tumor-Specific Cytotoxic T Cells Secreting an Engineered Tumor-Specific Immunotoxin

DTIC Science & Technology

2008-06-01

verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus

Cell Cycle Dependent Regulation of Human Progesterone Receptor in Breast Cancer

DTIC Science & Technology

2004-10-01

wt PR or S400A PR (0.01-1.0 [tg each), CDK2 (ljig), and PRE-2x-TATA-luc reporter plasmid (lig) along with Renilla plasmid (10ng) as a control for...8 hours prior to treatment. Cells were collected following treatment with 10 nM R5020 or ETOH vehicle control for 18 hrs. Luciferase and renilla ...reporter, a renilla reporter construct as a transfection control, either wt PR-B or S400A mutant PR-B, and control parental vector or a vector encoding an

Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli

PubMed Central

Jacobus, Ana Paula; Gross, Jeferson

2015-01-01

PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.

PubMed

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

PubMed Central

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1991-03-26

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.

The Function of Herpes Simplex Virus Genes: A Primer for Genetic Engineering of Novel Vectors

NASA Astrophysics Data System (ADS)

Roizman, Bernard

1996-10-01

Herpes simplex virus vectors are being developed for delivery and expression of human genes to the central nervous system, selective destruction of cancer cells, and as carriers for genes encoding antigens that induce protective immunity against infectious agents. Vectors constructed to meet these objectives must differ from wild-type virus with respect to host range, reactivation from latency, and expression of viral genes. The vectors currently being developed are (i) helper free amplicons, (ii) replication defective viruses, and (iii) genetically engineered replication competent viruses with restricted host range. Whereas the former two types of vectors require stable, continuous cell lines expressing viral genes for their replication, the replication competent viruses will replicate on approved primary human cell strains.

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice.

PubMed

Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter

2014-11-01

Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

PubMed

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

Characterization of pLAC1, a cryptic plasmid isolated from Lactobacillus acidipiscis and comparative analysis with its related plasmids.

PubMed

Asteri, Ioanna-Areti; Papadimitriou, Konstantinos; Boutou, Effrossyni; Anastasiou, Rania; Pot, Bruno; Vorgias, Constantinos E; Tsakalidou, Effie

2010-07-15

The pLAC1 plasmid of Lactobacillus acidipiscis ACA-DC 1533, a strain isolated from traditional Kopanisti cheese, was characterised. Nucleotide sequence analysis revealed a circular molecule of 3478bp with a G+C content of 37.2%. Ab initio annotation indicated four putative open reading frames (orfs). orf1 and orf4 were found to encode a replication initiation protein (Rep) and a mobilization protein (Mob), respectively. The deduced products of orf2 and orf3 revealed no significant homology to other known proteins. However, in silico examination of the plasmid sequence supported the existence of a novel operon that includes rep, orf2 and orf3 in pLAC1 and that this operon is highly conserved also in plasmids pLB925A02, pSMA23, pLC88 and pC7. RT-PCR experiments allowed us to verify that these three genes are co-transcribed as a single polycistronic mRNA species. Furthermore, phylogenetic analysis of pLAC1 Rep and Mob proteins demonstrated that they may have derived from different plasmid origins, suggesting that pLAC1 is a product of a modular evolution process. Comparative analysis of full length nucleotide sequences of pLAC1 and related Lactobacillus plasmids showed that pLAC1 shares a very similar replication backbone with pLB925A02, pSMA23 and pLC88. In contrast, mob of pLAC1 was almost identical with the respective gene of plasmids pLAB1000, pLB4 and pPB1. These findings lead to the conclusion that pLAC1 acquired mob probably via an ancestral recombination event. Our overall work highlights the importance of characterizing plasmids deriving from non-starter 'wild' isolates in order to better appreciate plasmid divergence and evolution of lactic acid bacteria. 2010 Elsevier B.V. All rights reserved.

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Evidence that compatibility of closely related replicons in Clostridium perfringens depends on linkage to parMRC-like partitioning systems of different subfamilies.

PubMed

Watts, Thomas D; Johanesen, Priscilla A; Lyras, Dena; Rood, Julian I; Adams, Vicki

2017-05-01

Clostridium perfringens produces an extensive repertoire of toxins and extracellular enzymes, many of which are intimately involved in the progression of disease and are encoded by genes on conjugative plasmids. In addition, many C. perfringens strains can carry up to five of these conjugative toxin or antimicrobial resistance plasmids, each of which has a similar 35kb backbone. This conserved backbone includes the tcp conjugation locus and the central control region (CCR), which encodes genes involved in plasmid regulation, replication and partitioning, including a parMRC partitioning locus. Most conjugative plasmids in C. perfringens have a conserved replication protein, raising questions as to how multiple, closely related plasmids are maintained within a single strain. Bioinformatics analysis has highlighted the presence of at least 10 different parMRC partitioning system families (parMRC A-J ) in these plasmids, with differences in amino acid sequence identity between each ParM family ranging from 15% to 54%. No two plasmids that encode genes belonging to the same partitioning family have been observed in a single strain, suggesting that these families represent the basis for plasmid incompatibility. In an attempt to validate the proposed parMRC incompatibility groups, genetically marked C. perfringens plasmids encoding identical parMRC C or parMRC D homologues or different combinations of parMRC A , parMRC C and parMRC D family homologues were introduced into a single strain via conjugation. The stability of each plasmid was determined using an incompatibility assay in which the plasmid profile of each strain was monitored over the course of two days in the absence of direct selection. The results showed that plasmids with identical parMRC C or parMRC D homologues were incompatible and could not coexist in the absence of external selection. By contrast, plasmids that encoded different parMRC homologues were compatible and could coexist in the same cell in the absence of selection, with the exception of strains housing parMRC C and parMRC D combinations, which showed a minor incompatibility phenotype. In conclusion, we have provided the first direct evidence of plasmid incompatibility in Clostridium spp. and have shown experimentally that the compatibility of conjugative C. perfringens plasmids correlates with the presence of parMRC-like partitioning systems of different phylogenetic subfamilies. Copyright © 2017 Elsevier Inc. All rights reserved.

SV40 T antigen alone drives karyotype instability that precedes neoplastic transformation of human diploid fibroblasts.

PubMed

Ray, F A; Peabody, D S; Cooper, J L; Cram, L S; Kraemer, P M

1990-01-01

To define the role of SV40 large T antigen in the transformation and immortalization of human cells, we have constructed a plasmid lacking most of the unique coding sequences of small t antigen as well as the SV40 origin of replication. The promoter for T antigen, which lies within the origin of replication, was deleted and replaced by the Rous sarcoma virus promoter. This minimal construct was co-electroporated into normal human fibroblasts of neonatal origin along with a plasmid containing the neomycin resistance gene (neo). Three G418-resistant, T antigen-positive clones were expanded and compared to three T antigen-positive clones that received the pSV3neo plasmid (capable of expressing large and small T proteins and having two origins of replication). Autonomous replication of plasmid DNA was observed in all three clones that received pSV3neo but not in any of the three origin minus clones. Immediately after clonal expansion, several parameters of neoplastic transformation were assayed. Low percentages of cells in T antigen-positive populations were anchorage independent or capable of forming colonies in 1% fetal bovine serum. The T antigen-positive clones generally exhibited an extended lifespan in culture but rarely became immortalized. Large numbers of dead cells were continually generated in all T antigen-positive, pre-crisis populations. Ninety-nine percent of all T antigen-positive cells had numerical or structural chromosome aberrations. Control cells that received the neo gene did not have an extended life span, did not have noticeable numbers of dead cells, and did not exhibit karyotype instability. We suggest that the role of T antigen protein in the transformation process is to generate genetic hypervariability, leading to various consequences including neoplastic transformation and cell death.

A novel bicistronic sensor vector for detecting caspase-3 activation.

PubMed

Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah

2015-01-01

Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1987-08-28

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

Plasmid-Encoded Tetracycline Efflux Pump Protein Alters Bacterial Stress Responses and Ecological Fitness of Acinetobacter oleivorans

PubMed Central

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538

Plasmid-encoded tetracycline efflux pump protein alters bacterial stress responses and ecological fitness of Acinetobacter oleivorans.

PubMed

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

Novel Minicircle Vector for Gene Therapy in Murine Myocardial Infarction

PubMed Central

Huang, Mei; Chen, ZhiYing; Hu, Shijun; Jia, Fangjun; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Kay, Mark A.; Wu, Joseph C.

2011-01-01

Background Conventional plasmids for gene therapy produce low-level and short-term gene expression. In this study, we develop a novel non-viral vector which robustly and persistently expresses the hypoxia inducible factor-1 alpha (HIF-1α) therapeutic gene in the heart, leading to functional benefits following myocardial infarction (MI). Methods and Results We first created minicircles carrying double fusion (MC-DF) reporter gene consisting of firefly luciferase and enhanced green fluorescent protein (Fluc-eGFP) for noninvasive measurement of transfection efficiency. Mouse C2C12 myoblasts and normal FVB mice were used for in vitro and in vivo confirmation, respectively. Bioluminescence imaging (BLI) showed stable minicircle gene expression in the heart for >12 weeks and the activity level was 5.6±1.2 fold stronger than regular plasmid at day 4 (P<0.01). Next, we created minicircles carrying hypoxia inducible factor-1 alpha (MC-HIF-1α) therapeutic gene for treatment of MI. Adult FVB mice underwent LAD ligation and were injected intramyocardially with (1) MC-HIF-1α, (2) regular plasmid carrying HIF-1α (PL-HIF-1α) as positive control, and (3) PBS as negative control (n=10/group). Echocardiographic study showed a significantly greater improvement of left ventricular ejection fraction (LVEF) in the minicircle group (51.3%±3.6%) compared to regular plasmid group (42.3%±4.1%) and saline group (30.5%±2.8%) at week 4 (P<0.05 for both). Histology demonstrated increased neoangiogenesis in both treatment groups. Finally, Western blot showed minicircles express >50% higher HIF-1α level than regular plasmid. Conclusion Taken together, this is the first study to demonstrate that minicircles can significantly improve transfection efficiency, duration of transgene expression, and cardiac contractility. Given the serious drawbacks associated with most viral vectors, we believe this novel non-viral vector can be of great value for cardiac gene therapy protocols. PMID:19752373

[Construction and function identification of luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR].

PubMed

Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min

2016-01-01

This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.

Transformation in fungi.

PubMed Central

Fincham, J R

1989-01-01

Transformation with exogenous deoxyribonucleic acid (DNA) now appears to be possible with all fungal species, or at least all that can be grown in culture. This field of research is at present dominated by Saccharomyces cerevisiae and two filamentous members of the class Ascomycetes, Aspergillus nidulans and Neurospora crassa, with substantial contributions also from fission yeast (Schizosaccharomyces pombe) and another filamentous member of the class Ascomycetes, Podospora anserina. However, transformation has been demonstrated, and will no doubt be extensively used, in representatives of most of the main fungal classes, including Phycomycetes, Basidiomycetes (the order Agaricales and Ustilago species), and a number of the Fungi Imperfecti. The list includes a number of plant pathogens, and transformation is likely to become important in the analysis of the molecular basis of pathogenicity. Transformation may be maintained either by using an autonomously replicating plasmid as a vehicle for the transforming DNA or through integration of the DNA into the chromosomes. In S. cerevisiae and other yeasts, a variety of autonomously replicating plasmids have been used successfully, some of them designed for use as shuttle vectors for Escherichia coli as well as for yeast transformation. Suitable plasmids are not yet available for use in filamentous fungi, in which stable transformation is dependent on chromosomal integration. In Saccharomyces cerevisiae, integration of transforming DNA is virtually always by homology; in filamentous fungi, in contrast, it occurs just as frequently at nonhomologous (ectopic) chromosomal sites. The main importance of transformation in fungi at present is in connection with gene cloning and the analysis of gene function. The most advanced work is being done with S. cerevisiae, in which the virtual restriction of stable DNA integration to homologous chromosome loci enables gene disruption and gene replacement to be carried out with greater precision and efficiency than is possible in other species that show a high proportion of DNA integration events at nonhomologous (ectopic) sites. With a little more trouble, however, the methodology pioneered for S. cerevisiae can be applied to other fungi too. Transformation of fungi with DNA constructs designed for high gene expression and efficient secretion of gene products appears to have great commercial potential. PMID:2651864

A vector based on the SV40 origin of replication and chromosomal S/MARs replicates episomally in CHO cells.

PubMed Central

Piechaczek, C; Fetzer, C; Baiker, A; Bode, J; Lipps, H J

1999-01-01

We have developed an episomal replicating expression vector in which the SV40 gene coding for the large T-antigen was replaced by chromosomal scaffold/matrix attached regions. Southern analysis as well as vector rescue experiments in CHO cells and in Escherichia coli demonstrate that the vector replicates episomally in CHO cells. It occurs in a very low copy number in the cells and is stably maintained over more than 100 generations without selection pressure. PMID:9862961

Epstein-Barr virus nuclear antigen-1 is highly colocalized with interphase chromatin and its newly replicated regions in particular.

PubMed

Ito, Sayuri; Gotoh, Eisuke; Ozawa, Shigeru; Yanagi, Kazuo

2002-10-01

Epstein-Barr virus (EBV) nuclear antigen-1 (EBNA-1), which binds to both the EBV origin of replication (oriP) and metaphase chromosomes, is essential for the replication/retention and segregation/partition of oriP-containing plasmids. Here the chromosomal localization of EBNA-1 fused to green fluorescent protein (GFP-EBNA-1) is examined by confocal microscopy combined with a 'premature chromosome condensation' (PCC) procedure. Analyses show that GFP-EBNA-1 expressed in living cells that lack oriP plasmids is associated with cellular chromatin that has been condensed rapidly by the PCC procedure into identifiable forms that are unique to each phase of interphase as well as metaphase chromosomes. Studies of cellular chromosomal DNAs labelled with BrdU or Cy3-dUTP indicate that GFP-EBNA-1 colocalizes highly with the labelled, newly replicated regions of interphase chromatin in cells. These results suggest that EBNA-1 is associated not only with cellular metaphase chromosomes but also with condensing chromatin/chromosomes and probably with interphase chromatin, especially with its newly replicated regions.

A single EBV-based vector for stable episomal maintenance and expression of GFP in human embryonic stem cells.

PubMed

Thyagarajan, Bhaskar; Scheyhing, Kelly; Xue, Haipeng; Fontes, Andrew; Chesnut, Jon; Rao, Mahendra; Lakshmipathy, Uma

2009-03-01

Stable expression of transgenes in stem cells has been a challenge due to the nonavailability of efficient transfection methods and the inability of transgenes to support sustained gene expression. Several methods have been reported to stably modify both embryonic and adult stem cells. These methods rely on integration of the transgene into the genome of the host cell, which could result in an expression pattern dependent on the number of integrations and the genomic locus of integration. To overcome this issue, site-specific integration methods mediated by integrase, adeno-associated virus or via homologous recombination have been used to generate stable human embryonic stem cell (hESC) lines. In this study, we describe a vector that is maintained episomally in hESCs. The vector used in this study is based on components derived from the Epstein-Barr virus, containing the Epstein-Barr virus nuclear antigen 1 expression cassette and the OriP origin of replication. The vector also expresses the drug-resistance marker gene hygromycin, which allows for selection and long-term maintenance of cells harboring the plasmid. Using this vector system, we show sustained expression of green fluorescent protein in undifferentiated hESCs and their differentiating embryoid bodies. In addition, the stable hESC clones show comparable expression with and without drug selection. Consistent with this observation, bulk-transfected adipose tissue-derived mesenchymal stem cells showed persistent marker gene expression as they differentiate into adipocytes, osteoblasts and chondroblasts. Episomal vectors offer a fast and efficient method to create hESC reporter lines, which in turn allows one to test the effect of overexpression of various genes on stem cell growth, proliferation and differentiation.

Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

USDA-ARS?s Scientific Manuscript database

A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

DNA Replication During Conjugal Transfer of R1162

DTIC Science & Technology

2002-01-01

transport out of the cell. This idea is stimulated by the similarity between the intermediates of single-stranded phage DNA replication and conjugative...the tra gene clusters ( Miele et al., 1991). The protein is not required for replication of the plasmid, and it seems to be dispensable for transfer...donor, in order to reattach to the transport mechanism prior to the start of a new round of transfer. Rolling circle replication itself might also be

The ability of a collagen/calcium phosphate scaffold to act as its own vector for gene delivery and to promote bone formation via transfection with VEGF(165).

PubMed

Keeney, Michael; van den Beucken, Jeroen J J P; van der Kraan, Peter M; Jansen, John A; Pandit, Abhay

2010-04-01

Collagen/calcium phosphate scaffolds have been used for bone reconstruction due to their inherent similarities to the bone extracellular matrix. Calcium phosphate alone has also been used as a non-viral vector for gene delivery. The aim of this study was to determine the capability of a collagen/calcium phosphate scaffold to deliver naked plasmid DNA and mediate transfection in vivo. The second goal of the study was to deliver a plasmid encoding vascular endothelial growth factor(165) (pVEGF(165)) to promote angiogenesis, and hence bone formation, in a mouse intra-femoral model. The delivery of naked plasmid DNA resulted in a 7.6-fold increase in mRNA levels of beta-Galactosidase compared to the delivery of plasmid DNA complexed with a partially degraded PAMAM dendrimer (dPAMAM) in a subcutaneous murine model. When implanted in a muirne intra-femoral model, the delivery of pVEGF(165) resulted in a 2-fold increase in bone volume at the defect site relative to control scaffolds without pVEGF(165). It was concluded that a collagen/calcium phosphate scaffold can mediate transfection without the use of additional transfection vectors and can promote bone formation in a mouse model via the delivery of pVEGF(165). 2009 Elsevier Ltd. All rights reserved.

Cell-Penetrating Peptide-Mediated Delivery of Cas9 Protein and Guide RNA for Genome Editing.

PubMed

Suresh, Bharathi; Ramakrishna, Suresh; Kim, Hyongbum

2017-01-01

The clustered, regularly interspaced, short palindromic repeat (CRISPR)-associated (Cas) system represents an efficient tool for genome editing. It consists of two components: the Cas9 protein and a guide RNA. To date, delivery of these two components has been achieved using either plasmid or viral vectors or direct delivery of protein and RNA. Plasmid- and virus-free direct delivery of Cas9 protein and guide RNA has several advantages over the conventional plasmid-mediated approach. Direct delivery results in shorter exposure time at the cellular level, which in turn leads to lower toxicity and fewer off-target mutations with reduced host immune responses, whereas plasmid- or viral vector-mediated delivery can result in uncontrolled integration of the vector sequence into the host genome and unwanted immune responses. Cell-penetrating peptide (CPP), a peptide that has an intrinsic ability to translocate across cell membranes, has been adopted as a means of achieving efficient Cas9 protein and guide RNA delivery. We developed a method for treating human cell lines with CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs that leads to endogenous gene disruption. Here we describe a protocol for preparing an efficient CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs, as well as treatment methods to achieve safe genome editing in human cell lines.

Construction of a Schizosaccharomyces pombe gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.

PubMed

Beach, D; Piper, M; Nurse, P

1982-01-01

A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.

Genetic organization of plasmid pXF51 from the plant pathogen Xylella fastidiosa.

PubMed

Marques, M V; da Silva, A M; Gomes, S L

2001-05-01

The sequence of plasmid pXF51 from the plant pathogen Xylella fastidiosa, the causal agent of citrus variegated chlorosis, has been analyzed. This plasmid codes for 65 open reading frames (ORFs), organized into four main regions, containing genes related to replication, mobilization, and conjugative transfer. Twenty-five ORFs have no counterparts in the public sequence databases, and 7 are similar to conserved hypothetical proteins from other bacteria. A pXF51 incompatibility group has not been determined, as we could not find a typical replication origin. One cluster of conjugation-related genes (trb) seems to be incomplete in pXF51, and a copy of this sequence is found in the chromosome, suggesting it was generated by a duplication event. A second cluster (tra) contains all genes necessary for conjugation transfer to occur, showing a conserved organization with other conjugative plasmids. An identifiable origin of transfer similar to oriT from IncP plasmids is found adjacent to genes encoding two mobilization proteins. None of the ORFs with putative assigned function could be predicted as having a role in pathogenesis, except for a virulence-associated protein D homolog. These results indicate that even though pXF51 appears not to have a direct role in Xylella pathogenesis, it is a conjugative plasmid that could be important for lateral gene transfer in this bacterium. This property may be of great importance for future development of transformation techniques in X. fastidiosa.

EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

PubMed

Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

2017-07-21

Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

PubMed

Rogers, Elizabeth E; Stenger, Drake C

2012-01-01

A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.

A Conjugative 38 kB Plasmid Is Present in Multiple Subspecies of Xylella fastidiosa

PubMed Central

Rogers, Elizabeth E.; Stenger, Drake C.

2012-01-01

A ∼38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19th century. PMID:23251694

Liposomal lipid and plasmid DNA delivery to B16/BL6 tumors after intraperitoneal administration of cationic liposome DNA aggregates.

PubMed

Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B

1999-05-01

The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.

Antibody-mediated targeting of replication-competent retroviral vectors.

PubMed

Tai, Chien-Kuo; Logg, Christopher R; Park, Jinha M; Anderson, W French; Press, Michael F; Kasahara, Noriyuki

2003-05-20

Replication-competent murine leukemia virus (MLV) vectors can be engineered to achieve high efficiency gene transfer to solid tumors in vivo and tumor-restricted replication, however their safety can be further enhanced by redirecting tropism of the virus envelope. We have therefore tested the targeting capability and replicative stability of ecotropic and amphotropic replication-competent retrovirus (RCR) vectors containing two tandem repeats from the immunoglobulin G-binding domain of Staphylococcal protein A inserted into the proline-rich "hinge" region of the envelope, which enables modular use of antibodies of various specificities for vector targeting. The modified envelopes were efficiently expressed and incorporated into virions, were capable of capturing monoclonal anti-HER2 antibodies, and mediated efficient binding of the virus-antibody complex to HER2-positive target cells. While infectivity was markedly reduced by pseudotyping with targeted envelopes alone, coexpression of wild-type envelope rescued efficient cellular entry. Both ecotropic and amphotropic RCR vector/anti-HER2 antibody complexes achieved significant enhancement of transduction on murine target cells overexpressing HER2, which could be competed by preincubation with excess free antibodies. Interestingly, HER2-expressing human breast cancer cells did not show enhancement of transduction despite efficient antibody-mediated cell surface binding, suggesting that target cell-specific parameters markedly affect the efficiency of post-binding entry processes. Serial replication of targeted vectors resulted in selection of Z domain deletion variants, but reduction of the overall size of the vector genome enhanced its stability. Application of antibody-mediated targeting to the initial localization of replication-competent virus vectors to tumor sites will thus require optimized target selection and vector design.

A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

PubMed Central

Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

2010-01-01

Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

The selfish yeast plasmid uses the nuclear motor Kip1p but not Cin8p for its localization and equal segregation.

PubMed

Cui, Hong; Ghosh, Santanu K; Jayaram, Makkuni

2009-04-20

The 2 micron plasmid of Saccharomyces cerevisiae uses the Kip1 motor, but not the functionally redundant Cin8 motor, for its precise nuclear localization and equal segregation. The timing and lifetime of Kip1p association with the plasmid partitioning locus STB are consistent with Kip1p being an authentic component of the plasmid partitioning complex. Kip1-STB association is not blocked by disassembling the mitotic spindle. Lack of Kip1p disrupts recruitment of the cohesin complex at STB and cohesion of replicated plasmid molecules. Colocalization of a 2 micron reporter plasmid with Kip1p in close proximity to the spindle pole body is reminiscent of that of a CEN reporter plasmid. Absence of Kip1p displaces the plasmid from this nuclear address, where it has the potential to tether to a chromosome or poach chromosome segregation factors. Exploiting Kip1p, which is subsidiary to Cin8p for chromosome segregation, to direct itself to a "partitioning center" represents yet another facet of the benign parasitism of the yeast plasmid.

Facile Recovery of Individual High-Molecular-Weight, Low-Copy-Number Natural Plasmids for Genomic Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, L.E.; Detter, C,; Barrie, K.

2006-06-01

Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less

Cyanobacterium sp. host cell and vector for production of chemical compounds in cyanobacterial cultures

DOEpatents

Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan

2014-09-30

A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.

Cyanobacterium sp. host cell and vector for production of chemical compounds in Cyanobacterial cultures

DOEpatents

Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan

2016-04-19

A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.

Replicating viral vector platform exploits alarmin signals for potent CD8+ T cell-mediated tumour immunotherapy

PubMed Central

Kallert, Sandra M.; Darbre, Stephanie; Bonilla, Weldy V.; Kreutzfeldt, Mario; Page, Nicolas; Müller, Philipp; Kreuzaler, Matthias; Lu, Min; Favre, Stéphanie; Kreppel, Florian; Löhning, Max; Luther, Sanjiv A.; Zippelius, Alfred; Merkler, Doron; Pinschewer, Daniel D.

2017-01-01

Viral infections lead to alarmin release and elicit potent cytotoxic effector T lymphocyte (CTLeff) responses. Conversely, the induction of protective tumour-specific CTLeff and their recruitment into the tumour remain challenging tasks. Here we show that lymphocytic choriomeningitis virus (LCMV) can be engineered to serve as a replication competent, stably-attenuated immunotherapy vector (artLCMV). artLCMV delivers tumour-associated antigens to dendritic cells for efficient CTL priming. Unlike replication-deficient vectors, artLCMV targets also lymphoid tissue stroma cells expressing the alarmin interleukin-33. By triggering interleukin-33 signals, artLCMV elicits CTLeff responses of higher magnitude and functionality than those induced by replication-deficient vectors. Superior anti-tumour efficacy of artLCMV immunotherapy depends on interleukin-33 signalling, and a massive CTLeff influx triggers an inflammatory conversion of the tumour microenvironment. Our observations suggest that replicating viral delivery systems can release alarmins for improved anti-tumour efficacy. These mechanistic insights may outweigh safety concerns around replicating viral vectors in cancer immunotherapy. PMID:28548102

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

Identification of Essential Genetic Baculoviral Elements for Recombinant Protein Expression by Transactivation in Sf21 Insect Cells.

PubMed

Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop

2016-01-01

The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.

Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

PubMed Central

Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

2015-01-01

The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

Factors affecting the efficient transformation of Colletotrichum species

USGS Publications Warehouse

Redman, Regina S.; Rodriguez, Rusty J.

1994-01-01

Factors affecting the efficient transformation of Colletotrichum species. Experimental Mycology, 18, 230-246. Twelve isolates representing four species of Colletotrichum were transformed either by enhanced protoplast, restriction enzyme-mediated integration (REMI), or electroporation-mediated protocols. The enhanced protoplast transformation protocol resulted in 100- and 50-fold increases in the transformation efficiencies of Colletotrichum lindemuthianum and C. magna , respectively. REMI transformation involved the use of Hin dIII and vector DNA linearized with HindIII to increase the number of integration events and potential gene disruptions in the fungal genome. Combining the enhanced protoplast and the REMI protocols resulted in a 22-fold increase in the number of hygromycin/nystatin-resistant mutants in C. lindemuthianum . Electroporation-mediated transformation was performed on mycelial fragments and spores of four Colletotrichum species, resulting in efficiencies of up to 1000 transformants/μg DNA. The pHA1.3 vector which confers hygromycin resistance contains telomeric sequences from Fusarium oxysporum , transforms by autonomous replication and genomic integration, and was essential for elevated transformation efficiencies of 100 to 10,000 transformants/μg DNA. Modifications of pHA1.3 occurred during bacterial amplification and post fungal transformation resulting in plasmids capable of significantly elevated transformation efficiencies in C. lindemuthianum.

Designer diatom episomes delivered by bacterial conjugation

DOE PAGES

Karas, Bogumil J.; Diner, Rachel E.; Lefebvre, Stephane C.; ...

2015-04-21

Eukaryotic microalgae hold great promise for the bioproduction of fuels and higher value chemicals. However, compared with model genetic organisms such as Escherichia coli and Saccharomyces cerevisiae, characterization of the complex biology and biochemistry of algae and strain improvement has been hampered by the inefficient genetic tools. To date, many algal species are transformable only via particle bombardment, and the introduced DNA is integrated randomly into the nuclear genome. Here we describe the first nuclear episomal vector for diatoms and a plasmid delivery method via conjugation from Escherichia coli to the diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana. We identify amore » yeast-derived sequence that enables stable episome replication in these diatoms even in the absence of antibiotic selection and show that episomes are maintained as closed circles at copy number equivalent to native chromosomes. This highly efficient genetic system facilitates high-throughput functional characterization of algal genes and accelerates molecular phytoplankton research.« less

Chromosomal Organization of Rrna Operons in Bacillus Subtilis

PubMed Central

Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

1988-01-01

Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

Designer diatom episomes delivered by bacterial conjugation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karas, Bogumil J.; Diner, Rachel E.; Lefebvre, Stephane C.

Eukaryotic microalgae hold great promise for the bioproduction of fuels and higher value chemicals. However, compared with model genetic organisms such as Escherichia coli and Saccharomyces cerevisiae, characterization of the complex biology and biochemistry of algae and strain improvement has been hampered by the inefficient genetic tools. To date, many algal species are transformable only via particle bombardment, and the introduced DNA is integrated randomly into the nuclear genome. Here we describe the first nuclear episomal vector for diatoms and a plasmid delivery method via conjugation from Escherichia coli to the diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana. We identify amore » yeast-derived sequence that enables stable episome replication in these diatoms even in the absence of antibiotic selection and show that episomes are maintained as closed circles at copy number equivalent to native chromosomes. This highly efficient genetic system facilitates high-throughput functional characterization of algal genes and accelerates molecular phytoplankton research.« less

Characterization of new plasmids from methylotrophic bacteria.

PubMed

Brenner, V; Holubová, I; Benada, O; Hubácek, J

1991-07-01

Several tens of methanol-utilizing bacterial strains isolated from soil were screened for the presence of plasmids. From the obligate methylotroph Methylomonas sp. strain R103a plasmid pIH36 (36 kb) was isolated and its restriction map was constructed. In pink-pigmented facultative methylotrophs (PPFM), belonging to the genus Methylobacterium four plasmids were detected: plasmids pIB200 (200 kb) and pIB14 (14 kb) in the strain R15d and plasmids pWU14 (14 kb) and pWU7 (7.8 kb) in the strain M17. Because of the small size and the presence of several unique REN sites (HindIII, EcoRI, NcoI), plasmid pWU7 was chosen for the construction of a vector for cloning in methylotrophs. Cointegrates pKWU7A and pKWU7B were formed between pWU7 and the E. coli plasmid pK19 Kmr, which were checked for conjugative transfer from E. coli into the methylotrophic host.

Linear Streptomyces plasmids form superhelical circles through interactions between their terminal proteins

PubMed Central

Tsai, Hsiu-Hui; Huang, Chih-Hung; Tessmer, Ingrid; Erie, Dorothy A.; Chen, Carton W.

2011-01-01

Linear chromosomes and linear plasmids of Streptomyces possess covalently bound terminal proteins (TPs) at the 5′ ends of their telomeres. These TPs are proposed to act as primers for DNA synthesis that patches the single-stranded gaps at the 3′ ends during replication. Most (‘archetypal’) Streptomyces TPs (designated Tpg) are highly conserved in size and sequence. In addition, there are a number of atypical TPs with heterologous sequences and sizes, one of which is Tpc that caps SCP1 plasmid of Streptomyces coelicolor. Interactions between the TPs on the linear Streptomyces replicons have been suggested by electrophoretic behaviors of TP-capped DNA and circular genetic maps of Streptomyces chromosomes. Using chemical cross-linking, we demonstrated intramolecular and intermolecular interactions in vivo between Tpgs, between Tpcs and between Tpg and Tpc. Interactions between the chromosomal and plasmid telomeres were also detected in vivo. The intramolecular telomere interactions produced negative superhelicity in the linear DNA, which was relaxed by topoisomerase I. Such intramolecular association between the TPs poses a post-replicational complication in the formation of a pseudo-dimeric structure that requires resolution by exchanging TPs or DNA. PMID:21109537

HSV Recombinant Vectors for Gene Therapy

PubMed Central

Manservigi, Roberto; Argnani, Rafaela; Marconi, Peggy

2010-01-01

The very deep knowledge acquired on the genetics and molecular biology of herpes simplex virus (HSV), has allowed the development of potential replication-competent and replication-defective vectors for several applications in human healthcare. These include delivery and expression of human genes to cells of the nervous systems, selective destruction of cancer cells, prophylaxis against infection with HSV or other infectious diseases, and targeted infection to specific tissues or organs. Replication-defective recombinant vectors are non-toxic gene transfer tools that preserve most of the neurotropic features of wild type HSV-1, particularly the ability to express genes after having established latent infections, and are thus proficient candidates for therapeutic gene transfer settings in neurons. A replication-defective HSV vector for the treatment of pain has recently entered in phase 1 clinical trial. Replication-competent (oncolytic) vectors are becoming a suitable and powerful tool to eradicate brain tumours due to their ability to replicate and spread only within the tumour mass, and have reached phase II/III clinical trials in some cases. The progress in understanding the host immune response induced by the vector is also improving the use of HSV as a vaccine vector against both HSV infection and other pathogens. This review briefly summarizes the obstacle encountered in the delivery of HSV vectors and examines the various strategies developed or proposed to overcome such challenges. PMID:20835362

Optimal source coding, removable noise elimination, and natural coordinate system construction for general vector sources using replicator neural networks

NASA Astrophysics Data System (ADS)

Hecht-Nielsen, Robert

1997-04-01

A new universal one-chart smooth manifold model for vector information sources is introduced. Natural coordinates (a particular type of chart) for such data manifolds are then defined. Uniformly quantized natural coordinates form an optimal vector quantization code for a general vector source. Replicator neural networks (a specialized type of multilayer perceptron with three hidden layers) are the introduced. As properly configured examples of replicator networks approach minimum mean squared error (e.g., via training and architecture adjustment using randomly chosen vectors from the source), these networks automatically develop a mapping which, in the limit, produces natural coordinates for arbitrary source vectors. The new concept of removable noise (a noise model applicable to a wide variety of real-world noise processes) is then discussed. Replicator neural networks, when configured to approach minimum mean squared reconstruction error (e.g., via training and architecture adjustment on randomly chosen examples from a vector source, each with randomly chosen additive removable noise contamination), in the limit eliminate removable noise and produce natural coordinates for the data vector portions of the noise-corrupted source vectors. Consideration regarding selection of the dimension of a data manifold source model and the training/configuration of replicator neural networks are discussed.

Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

PubMed Central

Bii, Victor M.; Trobridge, Grant D.

2016-01-01

Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127

Modeling Ebola Virus Genome Replication and Transcription with Minigenome Systems.

PubMed

Cressey, Tessa; Brauburger, Kristina; Mühlberger, Elke

2017-01-01

In this chapter, we describe the minigenome system for Ebola virus (EBOV), which reconstitutes EBOV polymerase activity in cells and can be used to model viral genome replication and transcription. This protocol comprises all steps including cell culture, plasmid preparation, transfection, and luciferase reporter assay readout.

Insulated hsp70B' promoter: stringent heat-inducible activity in replication-deficient, but not replication-competent adenoviruses.

PubMed

Rohmer, Stanimira; Mainka, Astrid; Knippertz, Ilka; Hesse, Andrea; Nettelbeck, Dirk M

2008-04-01

Key to the realization of gene therapy is the development of efficient and targeted gene transfer vectors. Therapeutic gene transfer by replication-deficient or more recently by conditionally replication-competent/oncolytic adenoviruses has shown much promise. For specific applications, however, it will be advantageous to provide vectors that allow for external control of gene expression. The efficient cellular heat shock system in combination with available technology for focused and controlled hyperthermia suggests heat-regulated transcription control as a promising tool for this purpose. We investigated the feasibility of a short fragment of the human hsp70B' promoter, with and without upstream insulator elements, for the regulation of transgene expression by replication-deficient or oncolytic adenoviruses. Two novel adenoviral vectors with an insulated hsp70B' promoter were developed and showed stringent heat-inducible gene expression with induction ratios up to 8000-fold. In contrast, regulation of gene expression from the hsp70B' promoter without insulation was suboptimal. In replication-competent/oncolytic adenoviruses regulation of the hsp70B' promoter was lost specifically during late replication in permissive cells and could not be restored by the insulators. We developed novel adenovirus gene transfer vectors that feature improved and stringent regulation of transgene expression from the hsp70B' promoter using promoter insulation. These vectors have potential for gene therapy applications that benefit from external modulation of therapeutic gene expression or for combination therapy with hyperthermia. Furthermore, our study reveals that vector replication can deregulate inserted cellular promoters, an observation which is of relevance for the development of replication-competent/oncolytic gene transfer vectors. (c) 2008 John Wiley & Sons, Ltd.

Inhibition of adenovirus 5 replication in COS-1 cells by antisense RNAs against the viral E1a region.

PubMed

Miroshnichenko, O I; Ponomareva, T I; Tikchonenko, T I

1989-12-07

To study the effect of antisense E1a RNA (asRNA) on adenovirus development, two types of adenovirus 5 E1a antisense constructs have been engineered. One was complementary to the viral DNA region [nucleotide (nt) positions 500-720] regulated by the metallothionein-I promoter, and the other was complementary to the DNA regions (nt positions 630-1570) under control of the long terminal repeat Moloney mouse leukosis virus promoter. Both asRNA constructs were cloned into a plasmid containing the simian virus 40 origin of replication, the gene controlling geneticin (G418) resistance (G418R), and other regulatory elements. The COS-1 cells, which contained up to 100 copies of the engineered plasmids, synthesized antiviral asRNAs, which provided 71 to over 95% inhibition of adenoviral replication, in comparison to the control cells not synthesizing asRNAs.

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

Bacterial plasmid transfer under space flight conditions: The Mobilisatsia experience

NASA Astrophysics Data System (ADS)

de Boever, P.; Ilyin, V.; Mahillon, J.; Mergeay, M.

Background Microorganisms are subject to a genetic evolution which may lead to the capacity to colonize new environments and to cause infections Central players in this evolutionary process are mobile genetic elements phages plasmids and transposons The latter help to mobilize and reorganize genes be it within a given genome intragenomic mobility or between bacterial cells intercellular mobility Confined environment and space flight related factors such as microgravity and cosmic radiation may influence the frequency with which mobile genetic elements are exchanged between microorganisms Aim Within the frame of the Mobilisatsia experiment a triparental microbial plasmid transfer was promoted aboard the International Space Station ISS The efficiency of the plasmid exchange process was compared with a synchronously performed ground control experiment An experiment was carried out with well-characterized Gram-negative test strains and one experiment was done with Gram-positive test strains Results The experiment took place during the Soyouz Mission 8 to the ISS from April 19th until April 30th 2004 Liquid cultures of the bacterial strains Cupriavidus metallidurans AE815 final recipient Escherichia coli CM1962 carrying a mobilisable vector with a nickel-resistance marker and E coli CM140 carrying the Broad Host Range plasmid RP4 for the Gram-negative experiment and Bacillus thuringiensis Bti AND931 carrying the conjugative plasmid pXO16 Bti 4Q7 with mobilisable vector pC194 carrying a resistance to chloramphenicol and Bti GBJ002

Pyrococcus furiosus strains and methods of using same

DOEpatents

Lipscomb, Gina L; Farkas, Joel Andrew; Adams, Michael W. W.; Westpheling, Janet

2015-01-06

Provided herein are methods for transforming a Pyrococcus furiosus with a polynucleotide. In one embodiment, the method includes contacting a P. furiosus with a polynucleotide under conditions suitable for uptake of the polynucleotide by the P. furiosus, and identifying transformants at a frequency of, for instance, at least 10.sup.3 transformants per microgram DNA. Also provided are isolated Pyrococcus furiosus having the characteristics of Pyrococcus furiosus COM1, and plasmids that include an origin of replication that functions in a Pyrococcus furiosus. The plasmid is stable in a recipient P. furiosus without selection for more than 100 generations and is structurally unchanged after replication in P. furiosus for more than 100 generations.

Quantifying Limits on Replication, Death, and Quiescence of Mycobacterium tuberculosis in Mice

PubMed Central

McDaniel, Margaret M.; Krishna, Nitin; Handagama, Winode G.; Eda, Shigetoshi; Ganusov, Vitaly V.

2016-01-01

When an individual is exposed to Mycobacterium tuberculosis (Mtb) three outcomes are possible: bacterial clearance, active disease, or latent infection. It is generally believed that most individuals exposed to Mtb become latently infected and carry the mycobacteria for life. How Mtb is maintained during this latent infection remains largely unknown. During an Mtb infection in mice, there is a phase of rapid increase in bacterial numbers in the murine lungs within the first 3 weeks, and then bacterial numbers either stabilize or increase slowly over the period of many months. It has been debated whether the relatively constant numbers of bacteria in the chronic infection result from latent (dormant, quiescent), non-replicating bacteria, or whether the observed Mtb cell numbers are due to balance between rapid replication and death. A recent study of mice, infected with a Mtb strain carrying an unstable plasmid, showed that during the chronic phase, Mtb was replicating at significant rates. Using experimental data from this study and mathematical modeling we investigated the limits of the rates of bacterial replication, death, and quiescence during Mtb infection of mice. First, we found that to explain the data the rates of bacterial replication and death could not be constant and had to decrease with time since infection unless there were large changes in plasmid segregation probability over time. While a decrease in the rate of Mtb replication with time since infection was expected due to depletion of host's resources, a decrease in the Mtb death rate was counterintuitive since Mtb-specific immune response, appearing in the lungs 3–4 weeks after infection, should increase removal of bacteria. Interestingly, we found no significant correlation between estimated rates of Mtb replication and death suggesting the decline in these rates was driven by independent mechanisms. Second, we found that the data could not be explained by assuming that bacteria do not die, suggesting that some removal of bacteria from lungs of these mice had to occur even though the total bacterial counts in these mice always increased over time. Third and finally, we showed that to explain the data the majority of bacterial cells (at least ~60%) must be replicating in the chronic phase of infection further challenging widespread belief of nonreplicating Mtb in latency. Our predictions were robust to some changes in the structure of the model, for example, when the loss of plasmid-bearing cells was mainly due to high fitness cost of the plasmid. Further studies should determine if more mechanistic models for Mtb dynamics are also able to accurately explain these data. PMID:27379030

[Construction of the superantigen SEA transfected laryngocarcinoma cells].

PubMed

Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua

2013-04-01

To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.

Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

PubMed

Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika

2013-01-01

Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

Construction of a food-grade cloning vector for Lactobacillus plantarum and its utilization in a food model.

PubMed

Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

2012-01-01

The development of Lactobacillus plantarum to be used in starter cultures in the food industry has been limited because of the lack of a food-grade cloning vector for the bacterium. In this study, the plasmid pFLP1 was constructed by joining 2 DNA fragments derived from food-approved organisms. The 5.2-kb BamHI/KpnI DNA fragment of pRV566 containing the theta-type replicon of Lactobacillus sakei was ligated to the BamHI/KpnI DNA fragment of a 2.9-kb lactococcal cadmium resistance determinant amplified from pND918. The 8.1-kb newly constructed plasmid could transform L. plantarum N014, a bacteriocin-producing bacteria originally isolated from nham, a traditional Thai fermented sausage. The resulting transformant, L. plantarum N014-FLP, and its parent strain were shown to be very similar in growth rate and bacteriocin activity. In addition, the plasmid was very stable in its host bacteria under nonselective pressure for 100 generations in MRS medium and for 5 days in a nham model. These results suggest that pFLP1 is a potential food-grade cloning vector for L. plantarum.

Random mutagenesis by error-prone pol plasmid replication in Escherichia coli.

PubMed

Alexander, David L; Lilly, Joshua; Hernandez, Jaime; Romsdahl, Jillian; Troll, Christopher J; Camps, Manel

2014-01-01

Directed evolution is an approach that mimics natural evolution in the laboratory with the goal of modifying existing enzymatic activities or of generating new ones. The identification of mutants with desired properties involves the generation of genetic diversity coupled with a functional selection or screen. Genetic diversity can be generated using PCR or using in vivo methods such as chemical mutagenesis or error-prone replication of the desired sequence in a mutator strain. In vivo mutagenesis methods facilitate iterative selection because they do not require cloning, but generally produce a low mutation density with mutations not restricted to specific genes or areas within a gene. For this reason, this approach is typically used to generate new biochemical properties when large numbers of mutants can be screened or selected. Here we describe protocols for an advanced in vivo mutagenesis method that is based on error-prone replication of a ColE1 plasmid bearing the gene of interest. Compared to other in vivo mutagenesis methods, this plasmid-targeted approach allows increased mutation loads and facilitates iterative selection approaches. We also describe the mutation spectrum for this mutagenesis methodology in detail, and, using cycle 3 GFP as a target for mutagenesis, we illustrate the phenotypic diversity that can be generated using our method. In sum, error-prone Pol I replication is a mutagenesis method that is ideally suited for the evolution of new biochemical activities when a functional selection is available.

pTcGW plasmid vectors 1.1 version: a versatile tool for Trypanosoma cruzi gene characterisation

PubMed Central

Kugeratski, Fernanda G; Batista, Michel; Inoue, Alexandre Haruo; Ramos, Bruno Dias; Krieger, Marco Aurelio; Marchini/, Fabricio K

2015-01-01

The functional characterisation of thousands of Trypanosoma cruzi genes remains a challenge. Reverse genetics approaches compatible with high-throughput cloning strategies can provide the tool needed to tackle this challenge. We previously published the pTcGW platform, composed by plasmid vectors carrying different options of N-terminal fusion tags based on Gateway® technology. Here, we present an improved 1.1 version of pTcGW vectors, which is characterised by a fully flexible structure allowing an easy customisation of each element of the vectors in a single cloning step. Additionally, both N and C-terminal fusions are available with new tag options for protein complexes purification. Three of the newly created vectors were successfully used to determine the cellular localisation of four T. cruzi proteins. The 1.1 version of pTcGW platform can be used in a variety of assays, such as protein overexpression, identification of protein-protein interaction and protein localisation. This powerful and versatile tool allows adding valuable functional information to T. cruzi genes and is freely available for scientific community. PMID:26200713

The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

PubMed Central

Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

2013-01-01

IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

PubMed

Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

2011-12-01

The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

Method: low-cost delivery of the cotton leaf crumple virus-induced gene silencing system

PubMed Central

2012-01-01

Background We previously developed a virus-induced gene silencing (VIGS) vector for cotton from the bipartite geminivirusCotton leaf crumple virus (CLCrV). The original CLCrV VIGS vector was designed for biolistic delivery by a gene gun. This prerequisite limited the use of the system to labs with access to biolistic equipment. Here we describe the adaptation of this system for delivery by Agrobacterium (Agrobacterium tumefaciens). We also describe the construction of two low-cost particle inflow guns. Results The biolistic CLCrV vector was transferred into two Agrobacterium binary plasmids. Agroinoculation of the binary plasmids into cotton resulted in silencing and GFP expression comparable to the biolistic vector. Two homemade low-cost gene guns were used to successfully inoculate cotton (G. hirsutum) and N. benthamiana with either the CLCrV VIGS vector or the Tomato golden mosaic virus (TGMV) VIGS vector respectively. Conclusions These innovations extend the versatility of CLCrV-based VIGS for analyzing gene function in cotton. The two low-cost gene guns make VIGS experiments affordable for both research and teaching labs by providing a working alternative to expensive commercial gene guns. PMID:22853641

The Heteroaryldihydropyrimidine Bay 38-7690 Induces Hepatitis B Virus Core Protein Aggregates Associated with Promyelocytic Leukemia Nuclear Bodies in Infected Cells.

PubMed

Huber, Andrew D; Wolf, Jennifer J; Liu, Dandan; Gres, Anna T; Tang, Jing; Boschert, Kelsey N; Puray-Chavez, Maritza N; Pineda, Dallas L; Laughlin, Thomas G; Coonrod, Emily M; Yang, Qiongying; Ji, Juan; Kirby, Karen A; Wang, Zhengqiang; Sarafianos, Stefan G

2018-04-25

Heteroaryldihydropyrimidines (HAPs) are compounds that inhibit hepatitis B virus (HBV) replication by modulating viral capsid assembly. While their biophysical effects on capsid assembly in vitro have been previously studied, the effect of HAP treatment on capsid protein (Cp) in individual HBV-infected cells remains unknown. We report here that the HAP Bay 38-7690 promotes aggregation of recombinant Cp in vitro and causes a time- and dose-dependent decrease of Cp in infected cells, consistent with previously studied HAPs. Interestingly, immunofluorescence analysis showed Cp aggregating in nuclear foci of Bay 38-7690-treated infected cells in a time- and dose-dependent manner. We found these foci to be associated with promyelocytic leukemia (PML) nuclear bodies (NBs), which are structures that affect many cellular functions, including DNA damage response, transcription, apoptosis, and antiviral responses. Cp aggregation is not an artifact of the cell system used, as it is observed in HBV-expressing HepAD38 cells, in HepG2 cells transfected with an HBV-expressing plasmid, and in HepG2-NTCP cells infected with HBV. Use of a Cp overexpression vector without HBV sequences shows that aggregation is independent of viral replication, and use of an HBV-expressing plasmid harboring a HAP resistance mutation in Cp abrogated the aggregation, demonstrating that the effect is due to direct compound-Cp interactions. These studies provide novel insight into the effects of HAP-based treatment at a single-cell level. IMPORTANCE Despite the availability of effective vaccines and treatments, HBV remains a significant global health concern, with more than 240 million individuals chronically infected. Current treatments are highly effective at controlling viral replication and disease progression but rarely cure infections. Therefore, much emphasis is being placed on finding therapeutics with new drug targets, such as viral gene expression, covalently closed circular DNA formation and stability, capsid formation, and host immune modulators, with the ultimate goal of an HBV cure. Understanding the mechanisms by which novel antiviral agents act will be imperative for the development of curative HBV therapies. Copyright © 2018 Huber et al.

[The induction of neovascularization in chorioallantoic membrane of chicken embryos transfected by a recombinant plasmid containing human angiogenin gene].

PubMed

Avdeeva, S V; Khaĭdarova, N V; Logunov, D Iu; Neugodova, G L; Sevast'ianova, G A; Tarantul, V Z; Naroditskiĭ, B S

2003-01-01

A method was elaborated to evaluate the biological activity of expression products of gene in the plasmid vectors, which are crucial for the synthesis of growth factor of blood vessels. It was proven as possible that the chrioallantonic membrane (CAM) of chicken's embryos could be transfected by recombinant plasmids containing both the reporter and target genes. The efficiency of CAM transfection was assessed by a plasmid carrying the reporter gene of green fluorescent protein (GFP). Finally, it was demonstrated that, at an infiltration of the recombinant plasmid containing the human angiogenine gene, its expression products induce the neovascularization in the CAM cells of chicken's embryos and stimulate an accretion in vessels of the 1st, 2nd and 3d orders.

Live, attenuated Salmonella typhimurium vectoring Campylobacter antigens.

PubMed

Sizemore, Donata R; Warner, Beth; Lawrence, Julie; Jones, Amy; Killeen, Kevin P

2006-05-01

We describe the evaluation of three live, attenuated deltaphoP/Q Salmonella enteric serovar Typhimurium strains expressing PEB1 minus its signal sequence (PEB1-ss) from three different plasmids: a pBR-based asd plasmid, an arabinose-based runaway plasmid, which each expressed PEB1-ss in the bacterial cytosol, and a PEB1::HlyA fusion plasmid that directs secretion of PEB1-ss into the extracellular milieu. Serum IgG responses specific for PEB1-ss were induced by pBR-derived and runaway plasmids, with 100 and 90% seroconversion, respectively, at a 1:500 dilution of anti-sera as measured by Western blot analysis, while the PEB1-ss::HlyA fusion plasmid induced serum IgG in only 20% of the mice. Although significant levels of anti-PEB serum IgG were induced, no protection against oral Campylobacter jejuni challenge was observed.

Engineering HSV-1 vectors for gene therapy.

PubMed

Goins, William F; Huang, Shaohua; Cohen, Justus B; Glorioso, Joseph C

2014-01-01

Virus vectors have been employed as gene transfer vehicles for various preclinical and clinical gene therapy applications, and with the approval of Glybera (alipogene tiparvovec) as the first gene therapy product as a standard medical treatment (Yla-Herttuala, Mol Ther 20: 1831-1832, 2013), gene therapy has reached the status of being a part of standard patient care. Replication-competent herpes simplex virus (HSV) vectors that replicate specifically in actively dividing tumor cells have been used in Phase I-III human trials in patients with glioblastoma multiforme, a fatal form of brain cancer, and in malignant melanoma. In fact, T-VEC (talimogene laherparepvec, formerly known as OncoVex GM-CSF) displayed efficacy in a recent Phase III trial when compared to standard GM-CSF treatment alone (Andtbacka et al. J Clin Oncol 31: sLBA9008, 2013) and may soon become the second FDA-approved gene therapy product used in standard patient care. In addition to the replication-competent oncolytic HSV vectors like T-VEC, replication-defective HSV vectors have been employed in Phase I-II human trials and have been explored as delivery vehicles for disorders such as pain, neuropathy, and other neurodegenerative conditions. Research during the last decade on the development of HSV vectors has resulted in the engineering of recombinant vectors that are totally replication defective, nontoxic, and capable of long-term transgene expression in neurons. This chapter describes methods for the construction of recombinant genomic HSV vectors based on the HSV-1 replication-defective vector backbones, steps in their purification, and their small-scale production for use in cell culture experiments as well as preclinical animal studies.

Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

PubMed

Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

2010-01-01

Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

[Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

PubMed

Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

2013-04-01

This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

The selfish yeast plasmid uses the nuclear motor Kip1p but not Cin8p for its localization and equal segregation

PubMed Central

Cui, Hong; Ghosh, Santanu K.

2009-01-01

The 2 micron plasmid of Saccharomyces cerevisiae uses the Kip1 motor, but not the functionally redundant Cin8 motor, for its precise nuclear localization and equal segregation. The timing and lifetime of Kip1p association with the plasmid partitioning locus STB are consistent with Kip1p being an authentic component of the plasmid partitioning complex. Kip1–STB association is not blocked by disassembling the mitotic spindle. Lack of Kip1p disrupts recruitment of the cohesin complex at STB and cohesion of replicated plasmid molecules. Colocalization of a 2 micron reporter plasmid with Kip1p in close proximity to the spindle pole body is reminiscent of that of a CEN reporter plasmid. Absence of Kip1p displaces the plasmid from this nuclear address, where it has the potential to tether to a chromosome or poach chromosome segregation factors. Exploiting Kip1p, which is subsidiary to Cin8p for chromosome segregation, to direct itself to a “partitioning center” represents yet another facet of the benign parasitism of the yeast plasmid. PMID:19364922

Generation of HIV-1 based bi-cistronic lentiviral vectors for stable gene expression and live cell imaging.

PubMed

Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N

2012-10-01

The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.

Electrotransfer of Plasmid Vector DNA into Muscle

NASA Astrophysics Data System (ADS)

Miyazaki, Satsuki; Miyazaki, Jun-Ichi

Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

Conformational plasticity of RepB, the replication initiator protein of promiscuous streptococcal plasmid pMV158

PubMed Central

Boer, D. Roeland; Ruiz-Masó, José Angel; Rueda, Manuel; Petoukhov, Maxim V.; Machón, Cristina; Svergun, Dmitri I.; Orozco, Modesto; del Solar, Gloria; Coll, Miquel

2016-01-01

DNA replication initiation is a vital and tightly regulated step in all replicons and requires an initiator factor that specifically recognizes the DNA replication origin and starts replication. RepB from the promiscuous streptococcal plasmid pMV158 is a hexameric ring protein evolutionary related to viral initiators. Here we explore the conformational plasticity of the RepB hexamer by i) SAXS, ii) sedimentation experiments, iii) molecular simulations and iv) X-ray crystallography. Combining these techniques, we derive an estimate of the conformational ensemble in solution showing that the C-terminal oligomerisation domains of the protein form a rigid cylindrical scaffold to which the N-terminal DNA-binding/catalytic domains are attached as highly flexible appendages, featuring multiple orientations. In addition, we show that the hinge region connecting both domains plays a pivotal role in the observed plasticity. Sequence comparisons and a literature survey show that this hinge region could exists in other initiators, suggesting that it is a common, crucial structural element for DNA binding and manipulation. PMID:26875695

Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.

PubMed

Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina

2011-12-01

Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. © 2011 New York Academy of Sciences.

Conjugal properties of the Sinorhizobium meliloti plasmid mobilome.

PubMed

Pistorio, Mariano; Giusti, María A; Del Papa, María F; Draghi, Walter O; Lozano, Mauricio J; Tejerizo, Gonzalo Torres; Lagares, Antonio

2008-09-01

The biology and biochemistry of plasmid transfer in soil bacteria is currently under active investigation because of its central role in prokaryote adaptation and evolution. In this work, we examined the conjugal properties of the cryptic plasmids present in a collection of the N(2)-fixing legume-symbiont Sinorhizobium meliloti. The study was performed on 65 S. meliloti isolates recovered from 25 humic soils of Argentina, which were grouped into 22 plasmid-profile types [i.e. plasmid operational taxonomic units (OTUs)]. The cumulative Shannon index calculated for the observed plasmid profiles showed a clear saturation plateau, thus indicating an adequate representation of the S. meliloti plasmid-profile types in the isolates studied. The results show that isolates of nearly 14% of the plasmid OTUs hosted transmissible plasmids and that isolates of 29% of the plasmid OTUs were able to retransfer the previously characterized mobilizable-cryptic plasmid pSmeLPU88b to a third recipient strain. It is noteworthy that isolates belonging to 14% of the plasmid OTUs proved to be refractory to the entrance of the model plasmid pSmeLPU88b, suggesting either the presence of surface exclusion phenomena or the occurrence of restriction incompatibility with the incoming replicon. Incompatibility for replication between resident plasmids and plasmid pSmeLPU88b was observed in c. 20% of the OTUs. The results reported here reveal a widespread compatibility among the conjugal functions of the cryptic plasmids in S. meliloti, and this fact, together with the observed high proportion of existing donor genotypes, points to the extrachromosomal compartment of the species as being an extremely active plasmid mobilome.

Essential and Dispensable Virus-Encoded Replication Elements Revealed by Efforts To Develop Hypoviruses as Gene Expression Vectors

PubMed Central

Suzuki, Nobuhiro; Geletka, Lynn M.; Nuss, Donald L.

2000-01-01

We have investigated whether hypoviruses, viral agents responsible for virulence attenuation (hypovirulence) of the chestnut blight fungus Cryphonectria parasitica, could serve as gene expression vectors. The infectious cDNA clone of the prototypic hypovirus CHV1-EP713 was modified to generate 20 different vector candidates. Although transient expression was achieved for a subset of vectors that contained the green fluorescent protein gene from Aequorea victoria, long-term expression (past day 8) was not observed for any vector construct. Analysis of viral RNAs recovered from transfected fungal colonies revealed that the foreign genes were readily deleted from the replicating virus, although small portions of foreign sequences were retained by some vectors after months of replication. However, the results of vector viability and progeny characterization provided unexpected new insights into essential and dispensable elements of hypovirus replication. The N-terminal portion (codons 1 to 24) of the 5′-proximal open reading frame (ORF), ORF A, was found to be required for virus replication, while the remaining 598 codons of this ORF were completely dispensable. Substantial alterations were tolerated in the pentanucleotide UAAUG that contains the ORF A termination codon and the overlapping putative initiation codon of the second of the two hypovirus ORFs, ORF B. Replication competence was maintained following either a frameshift mutation that caused a two-codon extension of ORF A or a modification that produced a single-ORF genomic organization. These results are discussed in terms of determinants of hypovirus replication, the potential utility of hypoviruses as gene expression vectors, and possible mechanisms by which hypoviruses recognize and delete foreign sequences. PMID:10906211

Gene Amplification by PCR and Subcloning into a GFP-Fusion Plasmid Expression Vector as a Molecular Biology Laboratory Course

ERIC Educational Resources Information Center

Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.

2004-01-01

A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…

A chimeric protein composed of NuMA fused to the DNA binding domain of LANA is sufficient for the ori-P-dependent DNA replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohsaki, Eriko; Ueda, Keiji, E-mail: kueda@virus.me

The Kaposi's sarcoma-associated herpesvirus (KSHV) genome is stably maintained in KSHV-infected PEL cell lines during cell division. We previously showed that accumulation of LANA in the nuclear matrix fraction could be important for the latent DNA replication, and that the functional significance of LANA should be its recruitment of ori-P to the nuclear matrix. Here, we investigated whether the forced localization of the LANA-DNA binding domain (DBD) to the nuclear matrix facilitated ori-P-containing plasmid replication. We demonstrated that chimeric proteins constructed by fusion of LANA DBD with the nuclear mitotic apparatus protein (NuMA), which is one of the components ofmore » the nuclear matrix, could bind with ori-P and enhance replication of an ori-P-containing plasmid, compared with that in the presence of DBD alone. These results further suggested that the ori-P recruitment to the nuclear matrix through the binding with DBD is important for latent viral DNA replication. - Highlights: •KSHV replication in latency depends on LANA localization to the nuclear matrix. •LANA DBD was fused with NuMA, a nuclear matrix protein, at the N- and C-terminus. •NuMA-DBD was in the nuclear matrix and supported the ori-P dependent replication. •LANA in the nuclear matrix should be important for the KSHV replication in latency.« less

Sequence analysis of the lactococcal plasmid pNP40: a mobile replicon for coping with environmental hazards.

PubMed

O'Driscoll, Jonathan; Glynn, Frances; Fitzgerald, Gerald F; van Sinderen, Douwe

2006-09-01

The conjugative lactococcal plasmid pNP40, identified in Lactococcus lactis subsp. diacetylactis DRC3, possesses a potent complement of bacteriophage resistance systems, which has stimulated its application as a fitness-improving, food-grade genetic element for industrial starter cultures. The complete sequence of this plasmid allowed the mapping of previously known functions including replication, conjugation, bacteriocin resistance, heavy metal tolerance, and bacteriophage resistance. In addition, functions for cold shock adaptation and DNA damage repair were identified, further confirming pNP40's contribution to environmental stress protection. A plasmid cointegration event appears to have been part of the evolution of pNP40, resulting in a "stockpiling" of bacteriophage resistance systems.

Distribution of small native plasmids in Streptococcus pyogenes in India.

PubMed

Bergmann, René; Nerlich, Andreas; Chhatwal, Gursharan S; Nitsche-Schmitz, D Patric

2014-05-01

Complete characterization of a Streptococcus pyogenes population from a defined geographic region comprises information on the plasmids that circulate in these bacteria. Therefore, we determined the distribution of small plasmids (<5kb) in a collection of 279 S. pyogenes isolates from India, where diversity of strains and incidence rates of S. pyogenes infections are high. The collection comprised 77 emm-types. For plasmid detection and discrimination, we developed PCRs for different plasmid replication initiation protein genes, the putative repressor gene copG and bacteriocin genes dysA and scnM57. Plasmid distribution was limited to 13 emm-types. Co-detection analysis using aforementioned PCRs revealed four distinct plasmid sub-types, two of which were previously unknown. Representative plasmids pA852 and pA996 of the two uncharacterized plasmid sub-types were sequenced. These two plasmids could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. The majority of small plasmids found in India belonged to the two newly characterized sub-types, with pA852- and pA996-like plasmids amounting to 42% and 22% of all detected plasmids, respectively. None of the detected plasmids coded for a known antibiotic resistance gene. Instead, all of the four plasmid sub-types carried known or potential bacteriocin genes. These genes may have influence on the evolutionary success of certain S. pyogenes genotypes. Notably, pA852-like plasmids were found in all isolates of the most prevalent emm-type 11.0. Together, a priori fitness of this genotype and increased fitness due to the acquired plasmids may have rendered type emm11.0 successful and caused the prevalence of pA852-like plasmids in India. Copyright © 2013 Elsevier GmbH. All rights reserved.

Identification and characterization of plasmids from the western aster yellows mycoplasmalike organism.

PubMed Central

Kuske, C R; Kirkpatrick, B C

1990-01-01

Supercoiled double-stranded DNA molecules (plasmids) were isolated from plants infected with three laboratory strains of western aster yellows mycoplasma-like organism (AY-MLO) by using cesium chloride-ethidium bromide density gradients. Southern blot analysis, using plasmids from the severe strain of AY-MLO (SAY-MLO) as the probe, identified at least four plasmids in celery, aster, and periwinkle plants and in Macrosteles severini leafhopper vectors infected with either the dwarf AY-MLO, Tulelake AY-MLO, or SAY-MLO strain. Plasmids were also detected in two California field isolates of AY-MLO but not in plants infected with the beet leafhopper-transmitted virescence agent, western X, or elm yellows MLOs. SAY-MLO plasmids were 5.2, 4.9, 3.4, and 1.7 kilobase pairs in size. Plasmids isolated from dwarf AY- and Tulelake AY-MLOs were 7.4, 5.1, 3.5, and 1.7 kilobase pairs in size. No evidence was obtained for integration of SAY-MLO plasmids into the MLO chromosome. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 FIG. 5 PMID:2307660

Bacteriophage T7 RNA polymerase-based expression in Pichia pastoris.

PubMed

Hobl, Birgit; Hock, Björn; Schneck, Sandra; Fischer, Reinhard; Mack, Matthias

2013-11-01

A novel Pichia pastoris expression vector (pEZT7) for the production of recombinant proteins employing prokaryotic bacteriophage T7 RNA polymerase (T7 RNAP) (EC 2.7.7.6) and the corresponding promoter pT7 was constructed. The gene for T7 RNAP was stably introduced into the P. pastoris chromosome 2 under control of the (endogenous) constitutive P. pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter (pGAP). The gene product T7 RNAP was engineered to contain a nuclear localization signal, which directed recombinant T7 RNAP to the P. pastoris nucleus. To promote translation of uncapped T7 RNAP derived transcripts, the internal ribosomal entry site from hepatitis C virus (HCV-IRES) was inserted directly upstream of the multiple cloning site of pEZT7. A P. pastoris autonomous replicating sequence (PARS1) was integrated into pEZT7 enabling propagation and recovery of plasmids from P. pastoris. Rapid amplification of 5' complementary DNA ends (5' RACE) experiments employing the test plasmid pEZT7-EGFP revealed that transcripts indeed initiated at pT7. HCV-IRES mediated translation of the latter mRNAs, however, was not observed. Surprisingly, HCV-IRES and the reverse complement of PARS1 (PARS1rc) were both found to display significant promoter activity as shown by 5' RACE. Copyright © 2013 Elsevier Inc. All rights reserved.

Induction of homologous recombination in Saccharomyces cerevisiae.

PubMed

Simon, J R; Moore, P D

1988-09-01

We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.

Preparation of Double-Stranded (Replicative Form) Bacteriophage M13 DNA.

PubMed

Green, Michael R; Sambrook, Joseph

2017-11-01

The double-stranded, closed-circular, replicative form (RF) of M13 DNA is present in high copy numbers in infected cells, and its physical characteristics are essentially identical to those of closed-circular plasmid DNAs. Any of the methods commonly used to purify plasmid DNA can therefore be used to isolate M13 RF DNA. This protocol describes the isolation of M13 RF DNA by alkaline lysis from small volumes (1-2 mL) of infected bacterial cultures. The yield of DNA (1-4 mg, depending on the size of the M13 clone) is more than enough for most purposes in molecular cloning. However, should more DNA be needed, the procedure can easily be scaled up. © 2017 Cold Spring Harbor Laboratory Press.

Development of transgenic strains for the biological control of the Mexican fruit fly, Anastrepha ludens

USDA-ARS?s Scientific Manuscript database

The Mexican fruit fly, Anastrepha ludens, is a highly significant agricultural pest species that has been genetically transformed with a piggyBac¬-based transposon vector system using independent vector and transposase helper plasmids. Estimated germ-line transformation frequencies were approximate...

Transformation of Saccharomyces cerevisiae with UV-irradiated single-stranded plasmid.

PubMed

Zgaga, Z

1991-08-01

UV-irradiated single-stranded replicative plasmids were used to transform different yeast strains. The low doses of UV used in this study (10-75 J/m2) caused a significant decrease in the transforming efficiency of plasmid DNA in the Rad+ strain, while they had no effect on transformation with double-stranded plasmids of comparable size. Neither the rev3 mutation, nor the rad18 or rad52 mutations influenced the efficiency of transformation with irradiated single-stranded plasmid. However, it was found to be decreased in the double rev3 rad52 mutant. Extracellular irradiation of plasmid that contains both URA3 and LEU2 genes (psLU) gave rise to up to 5% Leu- transformants among selected Ura+ ones in the repair-proficient strain. Induction of Leu- transformants was dose-dependent and only partially depressed in the rev3 mutant. These results suggest that both mutagenic and recombinational repair processes operate on UV-damaged single-stranded DNA in yeast.

Absence of Mutagenic Activity of Hycanthone in Serratia marcescens,

DTIC Science & Technology

1986-05-29

repair system but is enhanced by the plasmid pKMl01, which mediates the inducible error-prone repair system. Hycanthone, like proflavin , .1...enhanced by the plasmid pKM10, which mediates the inducible error-prone repair system. Hycanthone, like proflavin , intercalates between the stacked bases...Roth (1974) lave suggested that proflavin , which has a planar triple ring structure similar to hycanthone, interacts with DNA, which upon replication

Cloning of Pf3, a filamentous bacteriophage of Pseudomonas aeruginosa, into the pBD214 vector of Bacillus subtilis.

PubMed Central

Putterman, D G; Gryczan, T J; Dubnau, D; Day, L A

1983-01-01

The genome of Pf3, a filamentous single-stranded DNA bacteriophage of Pseudomonas aeruginosa (a gram-negative organism) was cloned into pBD214, a plasmid cloning vector of Bacillus subtilis (a gram-positive organism). Cloning in the gram-positive organism was done to avoid anticipated lethal effects. The entire Pf3 genome was inserted in each orientation at a unique Bc/I site within a thymidylate synthetase gene (from B. subtilis phage beta 22) on the plasmid. Additional clones were made by inserting EcoRI fragments of Pf3 DNA into a unique EcoRI site within this gene. Images PMID:6306273

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Mechanisms of Evolution in High-Consequence Drug Resistance Plasmids

PubMed Central

He, Susu; Chandler, Michael; Varani, Alessandro M.; Hickman, Alison B.; Dekker, John P.

2016-01-01

ABSTRACT The dissemination of resistance among bacteria has been facilitated by the fact that resistance genes are usually located on a diverse and evolving set of transmissible plasmids. However, the mechanisms generating diversity and enabling adaptation within highly successful resistance plasmids have remained obscure, despite their profound clinical significance. To understand these mechanisms, we have performed a detailed analysis of the mobilome (the entire mobile genetic element content) of a set of previously sequenced carbapenemase-producing Enterobacteriaceae (CPE) from the National Institutes of Health Clinical Center. This analysis revealed that plasmid reorganizations occurring in the natural context of colonization of human hosts were overwhelmingly driven by genetic rearrangements carried out by replicative transposons working in concert with the process of homologous recombination. A more complete understanding of the molecular mechanisms and evolutionary forces driving rearrangements in resistance plasmids may lead to fundamentally new strategies to address the problem of antibiotic resistance. PMID:27923922

Expression Plasmids for Use in Candida glabrata

PubMed Central

Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

2013-01-01

We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

Replicating Single-Cycle Adenovirus Vectors Generate Amplified Influenza Vaccine Responses.

PubMed

Crosby, Catherine M; Matchett, William E; Anguiano-Zarate, Stephanie S; Parks, Christopher A; Weaver, Eric A; Pease, Larry R; Webby, Richard J; Barry, Michael A

2017-01-15

Head-to-head comparisons of conventional influenza vaccines with adenovirus (Ad) gene-based vaccines demonstrated that these viral vectors can mediate more potent protection against influenza virus infection in animal models. In most cases, Ad vaccines are engineered to be replication-defective (RD-Ad) vectors. In contrast, replication-competent Ad (RC-Ad) vaccines are markedly more potent but risk causing adenovirus diseases in vaccine recipients and health care workers. To harness antigen gene replication but avoid production of infectious virions, we developed "single-cycle" adenovirus (SC-Ad) vectors. Previous work demonstrated that SC-Ads amplify transgene expression 100-fold and produce markedly stronger and more persistent immune responses than RD-Ad vectors in Syrian hamsters and rhesus macaques. To test them as potential vaccines, we engineered RD and SC versions of adenovirus serotype 6 (Ad6) to express the hemagglutinin (HA) gene from influenza A/PR/8/34 virus. We show here that it takes approximately 33 times less SC-Ad6 than RD-Ad6 to produce equal amounts of HA antigen in vitro SC-Ad produced markedly higher HA binding and hemagglutination inhibition (HAI) titers than RD-Ad in Syrian hamsters. SC-Ad-vaccinated cotton rats had markedly lower influenza titers than RD-Ad-vaccinated animals after challenge with influenza A/PR/8/34 virus. These data suggest that SC-Ads may be more potent vaccine platforms than conventional RD-Ad vectors and may have utility as "needle-free" mucosal vaccines. Most adenovirus vaccines that are being tested are replication-defective adenoviruses (RD-Ads). This work describes testing newer single-cycle adenovirus (SC-Ad) vectors that replicate transgenes to amplify protein production and immune responses. We show that SC-Ads generate markedly more influenza virus hemagglutinin protein and require substantially less vector to generate the same immune responses as RD-Ad vectors. SC-Ads therefore hold promise to be more potent vectors and vaccines than current RD-Ad vectors. Copyright © 2017 Crosby et al.

Autonomous replication and addition of telomerelike sequences to DNA microinjected into Paramecium tetraurelia macronuclei.

PubMed Central

Gilley, D; Preer, J R; Aufderheide, K J; Polisky, B

1988-01-01

Paramecium tetraurelia can be transformed by microinjection of cloned serotype A gene sequences into the macronucleus. Transformants are detected by their ability to express serotype A surface antigen from the injected templates. After injection, the DNA is converted from a supercoiled form to a linear form by cleavage at nonrandom sites. The linear form appears to replicate autonomously as a unit-length molecule and is present in transformants at high copy number. The injected DNA is further processed by the addition of paramecium-type telomeric sequences to the termini of the linear DNA. To examine the fate of injected linear DNA molecules, plasmid pSA14SB DNA containing the A gene was cleaved into two linear pieces, a 14-kilobase (kb) piece containing the A gene and flanking sequences and a 2.2-kb piece consisting of the procaryotic vector. In transformants expressing the A gene, we observed that two linear DNA species were present which correspond to the two species injected. Both species had Paramecium telomerelike sequences added to their termini. For the 2.2-kb DNA, we show that the site of addition of the telomerelike sequences is directly at one terminus and within one nucleotide of the other terminus. These results indicate that injected procaryotic DNA is capable of autonomous replication in Paramecium macronuclei and that telomeric addition in the macronucleus does not require specific recognition sequences. Images PMID:3211128

Multiple Antibiotic Resistance Plasmids Allow Scalable,
PCR-Mediated DNA Manipulation and Near-Zero Background Cloning

PubMed Central

Arnak, Remigiusz; Altun, Burcin; Tosato, Valentina

2016-01-01

Summary We have constructed two plasmids that can be used for cloning as templates for PCR- -based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418) and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications. PMID:27956856

Plasmid Vectors and Molecular Building Blocks for the Development of Genetic Manipulation Tools for Trypanosoma cruzi

PubMed Central

Bouvier, León A.; Cámara, María de los Milagros; Canepa, Gaspar E.; Miranda, Mariana R.; Pereira, Claudio A.

2013-01-01

The post genomic era revealed the need for developing better performing, easier to use and more sophisticated genetic manipulation tools for the study of Trypanosoma cruzi, the etiological agent of Chagas disease. In this work a series of plasmids that allow genetic manipulation of this protozoan parasite were developed. First of all we focused on useful tools to establish selection strategies for different strains and which can be employed as expression vectors. On the other hand molecular building blocks in the form of diverse selectable markers, modifiable fluorescent protein and epitope-tag coding sequences were produced. Both types of modules were harboured in backbone molecules conceived to offer multiple construction and sub-cloning strategies. These can be used to confer new properties to already available genetic manipulation tools or as starting points for whole novel designs. The performance of each plasmid and building block was determined independently. For illustration purposes, some simple direct practical applications were conducted. PMID:24205392

Sequence of Two Plasmids from Clostridium perfringens Chicken Necrotic Enteritis Isolates and Comparison with C. perfringens Conjugative Plasmids

PubMed Central

Parreira, Valeria R.; Costa, Marcio; Eikmeyer, Felix; Blom, Jochen; Prescott, John F.

2012-01-01

Twenty-six isolates of Clostridium perfringens of different MLST types from chickens with necrotic enteritis (NE) (15 netB-positive) or from healthy chickens (6 netB-positive, 5 netB-negative) were found to contain 1–4 large plasmids, with most netB-positive isolates containing 3 large and variably sized plasmids which were more numerous and larger than plasmids in netB-negative isolates. NetB and cpb2 were found on different plasmids consistent with previous studies. The pathogenicity locus NELoc1, which includes netB, was largely conserved in these plasmids whereas NeLoc3, present in the cpb2 containing plasmids, was less well conserved. A netB-positive and a cpb2-positive plasmid were likely to be conjugative, and the plasmids were completely sequenced. Both plasmids possessed the intact tcp conjugative region characteristic of C. perfringens conjugative plasmids. Comparative genomic analysis of nine CpCPs, including the two plasmids described here, showed extensive gene rearrangements including pathogenicity locus and accessory gene insertions around rather than within the backbone region. The pattern that emerges from this analysis is that the major toxin-containing regions of the variety of virulence-associated CpCPs are organized as complex pathogenicity loci. How these different but related CpCPs can co-exist in the same host has been an unanswered question. Analysis of the replication-partition region of these plasmids suggests that this region controls plasmid incompatibility, and that CpCPs can be grouped into at least four incompatibility groups. PMID:23189158

Sequence of two plasmids from Clostridium perfringens chicken necrotic enteritis isolates and comparison with C. perfringens conjugative plasmids.

PubMed

Parreira, Valeria R; Costa, Marcio; Eikmeyer, Felix; Blom, Jochen; Prescott, John F

2012-01-01

Twenty-six isolates of Clostridium perfringens of different MLST types from chickens with necrotic enteritis (NE) (15 netB-positive) or from healthy chickens (6 netB-positive, 5 netB-negative) were found to contain 1-4 large plasmids, with most netB-positive isolates containing 3 large and variably sized plasmids which were more numerous and larger than plasmids in netB-negative isolates. NetB and cpb2 were found on different plasmids consistent with previous studies. The pathogenicity locus NELoc1, which includes netB, was largely conserved in these plasmids whereas NeLoc3, present in the cpb2 containing plasmids, was less well conserved. A netB-positive and a cpb2-positive plasmid were likely to be conjugative, and the plasmids were completely sequenced. Both plasmids possessed the intact tcp conjugative region characteristic of C. perfringens conjugative plasmids. Comparative genomic analysis of nine CpCPs, including the two plasmids described here, showed extensive gene rearrangements including pathogenicity locus and accessory gene insertions around rather than within the backbone region. The pattern that emerges from this analysis is that the major toxin-containing regions of the variety of virulence-associated CpCPs are organized as complex pathogenicity loci. How these different but related CpCPs can co-exist in the same host has been an unanswered question. Analysis of the replication-partition region of these plasmids suggests that this region controls plasmid incompatibility, and that CpCPs can be grouped into at least four incompatibility groups.

Detection of human cytomegalovirus DNA replication in non-permissive Vero and 293 cells.

PubMed

Ellsmore, Victoria; Reid, G Gordon; Stow, Nigel D

2003-03-01

Human cytomegalovirus (HCMV) displays an exceptionally restricted host range in tissue culture with human fibroblasts being the principal fully permissive system. Nevertheless, immediate early (IE) proteins are expressed following infection of many non-permissive cell types of human, simian and murine origin, and viral origin-dependent DNA synthesis has been reconstituted by transfection of plasmids into Vero cells, a non-permissive line from African green monkey. We have examined the accumulation of HCMV strain AD169 DNA, and the replication of transfected HCMV origin-containing plasmids, in infected Vero and human embryonic kidney 293 cells, which were previously reported to express the major IE protein in a small proportion of infected cells but to be non-permissive for viral DNA synthesis. In Vero cells accumulation of origin-containing plasmid but not viral DNA occurred, whilst in 293 cells both DNAs accumulated. Immunofluorescence experiments indicated that following infection with 3 p.f.u. per cell, a small fraction of both cell types expressed the UL44 DNA replication protein. Neither cell line, however, supported the generation of infectious progeny virus. These results suggest that IE proteins expressed in Vero and 293 cells can induce the synthesis of early proteins capable of functioning in viral DNA replication, but there is a failure in later events on the pathway to infectious virus production. This provides further support for transfected Vero cells being a valid system in which to study HCMV DNA synthesis, and suggests that 293 cells may also prove useful in similar experiments.

Genetic modification of bone-marrow mesenchymal stem cells and hematopoietic cells with human coagulation factor IX-expressing plasmids.

PubMed

Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram

2016-05-01

Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

Development of a Reverse Genetic System for Infectious Salmon Anemia Virus: Rescue of Recombinant Fluorescent Virus by Using Salmon Internal Transcribed Spacer Region 1 as a Novel Promoter

PubMed Central

Toro-Ascuy, Daniela; Tambley, Carolina; Beltran, Carolina; Mascayano, Carolina; Sandoval, Nicolas; Olivares, Eduardo; Medina, Rafael A.; Spencer, Eugenio

2014-01-01

Infectious salmon anemia (ISA) is a serious disease of marine-farmed Atlantic salmon (Salmo salar) caused by ISA virus (ISAV), belonging to the genus Isavirus, family Orthomyxoviridae. There is an urgent need to understand the virulence factors and pathogenic mechanisms of ISAV and to develop new vaccine approaches. Using a recombinant molecular biology approach, we report the development of a plasmid-based reverse genetic system for ISAV, which includes the use of a novel fish promoter, the Atlantic salmon internal transcribed spacer region 1 (ITS-1). Salmon cells cotransfected with pSS-URG-based vectors expressing the eight viral RNA segments and four cytomegalovirus (CMV)-based vectors that express the four proteins of the ISAV ribonucleoprotein complex allowed the generation of infectious recombinant ISAV (rISAV). We generated three recombinant viruses, wild-type rISAV901_09 and rISAVrS6-NotI-HPR containing a NotI restriction site and rISAVS6/EGFP-HPR harboring the open reading frame of enhanced green fluorescent protein (EGFP), both within the highly polymorphic region (HPR) of segment 6. All rescued viruses showed replication activity and cytopathic effect in Atlantic salmon kidney-infected cells. The fluorescent recombinant viruses also showed a characteristic cytopathic effect in salmon cells, and the viruses replicated to a titer of 6.5 × 105 PFU/ml, similar to that of the wild-type virus. This novel reverse genetics system offers a powerful tool to study the molecular biology of ISAV and to develop a new generation of ISAV vaccines to prevent and mitigate ISAV infection, which has had a profound effect on the salmon industry. PMID:25480750

The antiretrovirus drug 3'-azido-3'-deoxythymidine increases the retrovirus mutation rate.

PubMed Central

Julias, J G; Kim, T; Arnold, G; Pathak, V K

1997-01-01

It was previously observed that the nucleoside analog 5-azacytidine increased the spleen necrosis virus (SNV) mutation rate 13-fold in one cycle of retrovirus replication (V. K. Pathak and H. M. Temin, J. Virol. 66:3093-3100, 1992). Based on this observation, we hypothesized that nucleoside analogs used as antiviral drugs may also increase retrovirus mutation rates. We sought to determine if 3'-azido-3'-deoxythymidine (AZT), the primary treatment for human immunodeficiency virus type 1 (HIV-1) infection, increases the retrovirus mutation rate. Two assays were used to determine the effects of AZT on retrovirus mutation rates. The strategy of the first assay involved measuring the in vivo rate of inactivation of the lacZ gene in one replication cycle of SNV- and murine leukemia virus-based retroviral vectors. We observed 7- and 10-fold increases in the SNV mutant frequency following treatment of target cells with 0.1 and 0.5 microM AZT, respectively. The murine leukemia virus mutant frequency increased two- and threefold following treatment of target cells with 0.5 and 1.0 microM AZT, respectively. The second assay used an SNV-based shuttle vector containing the lacZ alpha gene. Proviruses were recovered as plasmids in Escherichia coli, and the rate of inactivation of lacZ alpha was measured. The results indicated that treatment of target cells increased the overall mutation rate two- to threefold. DNA sequence analysis of mutant proviruses indicated that AZT increased both the deletion and substitution rates. These results suggest that AZT treatment of HIV-1 infection may increase the degree of viral variation and alter virus evolution or pathogenesis. PMID:9151812

Mucosal immunization with recombinant adenoviral vectors expressing murine gammaherpesvirus-68 genes M2 and M3 can reduce latent viral load.

PubMed

Hoegh-Petersen, Mette; Thomsen, Allan R; Christensen, Jan P; Holst, Peter J

2009-11-12

Gammaherpesviruses establish life-long latent infections in their hosts. If the host becomes immunosuppressed, these viruses may reactivate and cause severe disease, and even in immunocompetent individuals the gammaherpesviruses are presumed to have an oncogenic potential. Murine gammaherpesvirus-68 (MHV-68) is a member of the Gammaherpesvirinae subfamily and represents a useful murine model for this category of infections, in which new vaccination strategies may initially be evaluated. Two attenuated variants of MHV-68 have successfully been used as vaccines, but the oncogenic potential of the gammaherpesvirinae speaks against using a similar approach in humans. DNA immunization with plasmids encoding the MHV-68 genes M2 or M3 caused a reduction in either acute or early latent viral load, respectively, but neither immunization had an effect at times later than 14 days post-infection. Adenovirus-based vaccines are substantially more immunogenic than DNA vaccines and can be applied to induce mucosal immunity. Here we show that a significant reduction of the late viral load in the spleens, at 60 days post-infection, was achieved when immunizing mice both intranasally and subcutaneously with adenoviral vectors encoding both M2 and M3. Additionally we show that M3 immunization prevented the usual development of virus-induced splenomegaly at 2-3 weeks post-infection. This is the first time that immunization with a non-replicating vaccine has lead to a significantly reduced viral load at time points beyond 14 days post-infection, and thus demonstrates that a non-replicating vaccine may successfully be employed to reduce the viral burden during chronic gammaherpesvirus infection.

The vector homology problem in diagnostic nucleic acid hybridization of clinical specimens.

PubMed Central

Ambinder, R F; Charache, P; Staal, S; Wright, P; Forman, M; Hayward, S D; Hayward, G S

1986-01-01

Nucleic acid hybridization techniques using cloned probes are finding application in assays of clinical specimens in research and diagnostic laboratories. The probes that we and others have used are recombinant plasmids composed of viral inserts and bacterial plasmid vectors such as pBR322. We suspected that there was material homologous to pBR322 present in many clinical samples. because hybridization occurred in samples which lacked evidence of virus by other techniques. If the presence of this vector-homologous material was unrecognized, hybridization in the test sample might erroneously be interpreted as indicating the presence of viral sequences. In this paper we demonstrate specific hybridization of labeled pBR322 DNA with DNA from various clinical samples. Evidence is presented that nonspecific probe trapping could not account for this phenomenon. In mixing experiments, it is shown that contamination of clinical samples with bacteria would explain such a result. Approaches tested to circumvent this problem included the use of isolated insert probes, alternate cloning vectors, and cold competitor pBR322 DNA in prehybridization and hybridization mixes. None proved entirely satisfactory. We therefore emphasize that it is essential that all hybridization detection systems use a control probe of the vector alone in order to demonstrate the absence of material with vector homology in the specimen tested. Images PMID:3013928

Hybrid Adeno-Associated Viral Vectors Utilizing Transposase-Mediated Somatic Integration for Stable Transgene Expression in Human Cells

PubMed Central

Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja

2013-01-01

Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154

Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community

PubMed Central

Cormier, Catherine Y.; Mohr, Stephanie E.; Zuo, Dongmei; Hu, Yanhui; Rolfs, Andreas; Kramer, Jason; Taycher, Elena; Kelley, Fontina; Fiacco, Michael; Turnbull, Greggory; LaBaer, Joshua

2010-01-01

The Protein Structure Initiative Material Repository (PSI-MR; http://psimr.asu.edu) provides centralized storage and distribution for the protein expression plasmids created by PSI researchers. These plasmids are a resource that allows the research community to dissect the biological function of proteins whose structures have been identified by the PSI. The plasmid annotation, which includes the full length sequence, vector information and associated publications, is stored in a freely available, searchable database called DNASU (http://dnasu.asu.edu). Each PSI plasmid is also linked to a variety of additional resources, which facilitates cross-referencing of a particular plasmid to protein annotations and experimental data. Plasmid samples can be requested directly through the website. We have also developed a novel strategy to avoid the most common concern encountered when distributing plasmids namely, the complexity of material transfer agreement (MTA) processing and the resulting delays this causes. The Expedited Process MTA, in which we created a network of institutions that agree to the terms of transfer in advance of a material request, eliminates these delays. Our hope is that by creating a repository of expression-ready plasmids and expediting the process for receiving these plasmids, we will help accelerate the accessibility and pace of scientific discovery. PMID:19906724

Structural similarity and distribution of small cryptic plasmids of Lactobacillus curvatus and L. sake.

PubMed

Vogel, R F; Lohmann, M; Weller, A N; Hugas, M; Hammes, W P

1991-11-15

Plasmid profiles of strains of Lactobacillus curvatus and L. sake isolated from meat or sauerkraut were analysed to investigate plasmid homology and distribution in relation to the ecology of these organisms in fermenting foods. A hybridisation probe was constructed by cloning of pLc2, a cryptic, 2.6-kbp plasmid from L. curvatus LTH683, into the Escherichia coli plasmid pRV50. In Southern hybridisations with the digoxygenine labeled pLc2 probe, pLc2-related small plasmids were frequently detected in meat-borne strains of L. casei subsp. pseudoplantarum, L. curvatus, L. sake, L. alimentarius, L. farciminis and L. halotolerans and in L. curvatus and L. sake isolated from sauerkraut. Among 27 Lactobacillus type strains originally isolated from habitats other than meat this type of homology was detected only with plasmids of L. buchneri and L. mali. Restriction-enzyme mapping of six small cryptic plasmids from L. curvatus and L. sake revealed strong structural homology but no similarity to previously characterized plasmids of lactobacilli. The presence of a variable region in addition to a conserved one and the occurrence of deletions during cloning of pLc2 suggest that vectors derived from these plasmids are likely to be structurally unstable.

Identification of pOENI-1 and Related Plasmids in Oenococcus oeni Strains Performing the Malolactic Fermentation in Wine

PubMed Central

Favier, Marion; Bilhère, Eric; Lonvaud-Funel, Aline; Moine, Virginie; Lucas, Patrick M.

2012-01-01

Plasmids in lactic acid bacteria occasionally confer adaptive advantages improving the growth and behaviour of their host cells. They are often associated to starter cultures used in the food industry and could be a signature of their superiority. Oenococcus oeni is the main lactic acid bacteria species encountered in wine. It performs the malolactic fermentation that occurs in most wines after alcoholic fermentation and contributes to their quality and stability. Industrial O. oeni starters may be used to better control malolactic fermentation. Starters are selected empirically by virtue of their fermentation kinetics and capacity to survive in wine. This study was initiated with the aim to determine whether O. oeni contains plasmids of technological interest. Screening of 11 starters and 33 laboratory strains revealed two closely related plasmids, named pOENI-1 (18.3-kb) and pOENI-1v2 (21.9-kb). Sequence analyses indicate that they use the theta mode of replication, carry genes of maintenance and replication and two genes possibly involved in wine adaptation encoding a predicted sulphite exporter (tauE) and a NADH:flavin oxidoreductase of the old yellow enzyme family (oye). Interestingly, pOENI-1 and pOENI-1v2 were detected only in four strains, but this included three industrial starters. PCR screenings also revealed that tauE is present in six of the 11 starters, being probably inserted in the chromosome of some strains. Microvinification assays performed using strains with and without plasmids did not disclose significant differences of survival in wine or fermentation kinetics. However, analyses of 95 wines at different phases of winemaking showed that strains carrying the plasmids or the genes tauE and oye were predominant during spontaneous malolactic fermentation. Taken together, the results revealed a family of related plasmids associated with industrial starters and indigenous strains performing spontaneous malolactic fermentation that possibly contribute to the technological performance of strains in wine. PMID:23139835

The Origin of Mutants Under Selection: How Natural Selection Mimics Mutagenesis (Adaptive Mutation)

PubMed Central

Maisnier-Patin, Sophie; Roth, John R.

2015-01-01

Selection detects mutants but does not cause mutations. Contrary to this dictum, Cairns and Foster plated a leaky lac mutant of Escherichia coli on lactose medium and saw revertant (Lac+) colonies accumulate with time above a nongrowing lawn. This result suggested that bacteria might mutagenize their own genome when growth is blocked. However, this conclusion is suspect in the light of recent evidence that revertant colonies are initiated by preexisting cells with multiple copies the conjugative F′lac plasmid, which carries the lac mutation. Some plated cells have multiple copies of the simple F′lac plasmid. This provides sufficient LacZ activity to support plasmid replication but not cell division. In nongrowing cells, repeated plasmid replication increases the likelihood of a reversion event. Reversion to lac+ triggers exponential cell growth leading to a stable Lac+ revertant colony. In 10% of these plated cells, the high-copy plasmid includes an internal tandem lac duplication, which provides even more LacZ activity—sufficient to support slow growth and formation of an unstable Lac+ colony. Cells with multiple copies of the F′lac plasmid have an increased mutation rate, because the plasmid encodes the error-prone (mutagenic) DNA polymerase, DinB. Without DinB, unstable and stable Lac+ revertant types form in equal numbers and both types arise with no mutagenesis. Amplification and selection are central to behavior of the Cairns–Foster system, whereas mutagenesis is a system-specific side effect or artifact caused by coamplification of dinB with lac. Study of this system has revealed several broadly applicable principles. In all populations, gene duplications are frequent stable genetic polymorphisms, common near-neutral mutant alleles can gain a positive phenotype when amplified under selection, and natural selection can operate without cell division when variability is generated by overreplication of local genome subregions. PMID:26134316

Fate of plasmids containing Mu DNA: chromosome association and mobilization.

PubMed

Bialy, H; Waggoner, B T; Pato, M L

1980-01-01

The fluorescent dye, diamidinophenylindole-dihydrochloride (DAPI) can be added to CsCl gradients to enhance the density resolution of DNA species, independent of their topological configurations. When Proteus mirabilis and Escherichia coli strains carrying an RP4::Mucts plasmid were examined with the use of such a technique, it was found that after thermal induction of the prophage essentially al of the plasmid DNA became associated with the chromosome. This quantitative association is detergent-RNase- and pronase-resistant and dependent on the expression of Mu genes. The association is temporally, and probably functionally, correlated with the onset of Mu DNA replication. Genetic studies with F'::mini Mu plasmids indicate that some of the association results in stable Hfr formation, and does not require the product of Mu gene B.

Yeast cohesin complex embraces 2 micron plasmid sisters in a tri-linked catenane complex

PubMed Central

Ghosh, Santanu K.; Huang, Chu-Chun; Hajra, Sujata; Jayaram, Makkuni

2010-01-01

Sister chromatid cohesion, crucial for faithful segregation of replicated chromosomes in eukaryotes, is mediated by the multi-subunit protein complex cohesin. The Saccharomyces cerevisiae plasmid 2 micron circle mimics chromosomes in assembling cohesin at its partitioning locus. The plasmid is a multi-copy selfish DNA element that resides in the nucleus and propagates itself stably, presumably with assistance from cohesin. In metaphase cell lysates, or fractions enriched for their cohesed state by sedimentation, plasmid molecules are trapped topologically by the protein ring formed by cohesin. They can be released from cohesin’s embrace either by linearizing the DNA or by cleaving a cohesin subunit. Assays using two distinctly tagged cohesin molecules argue against the hand-cuff (an associated pair of monomeric cohesin rings) or the bracelet (a dimeric cohesin ring) model as responsible for establishing plasmid cohesion. Our cumulative results most easily fit a model in which a single monomeric cohesin ring, rather than a series of such rings, conjoins a pair of sister plasmids. These features of plasmid cohesion account for its sister-to-sister mode of segregation by cohesin disassembly during anaphase. The mechanistic similarities of cohesion between mini-chromosome sisters and 2 micron plasmid sisters suggest a potential kinship between the plasmid partitioning locus and centromeres. PMID:19920123

Increasing the Efficacy of Oncolytic Adenovirus Vectors

PubMed Central

Toth, Karoly; Wold, William S. M.

2010-01-01

Oncolytic adenovirus (Ad) vectors present a new modality to treat cancer. These vectors attack tumors via replicating in and killing cancer cells. Upon completion of the vector replication cycle, the infected tumor cell lyses and releases progeny virions that are capable of infecting neighboring tumor cells. Repeated cycles of vector replication and cell lysis can destroy the tumor. Numerous Ad vectors have been generated and tested, some of them reaching human clinical trials. In 2005, the first oncolytic Ad was approved for the treatment of head-and-neck cancer by the Chinese FDA. Oncolytic Ads have been proven to be safe, with no serious adverse effects reported even when high doses of the vector were injected intravenously. The vectors demonstrated modest anti-tumor effect when applied as a single agent; their efficacy improved when they were combined with another modality. The efficacy of oncolytic Ads can be improved using various approaches, including vector design, delivery techniques, and ancillary treatment, which will be discussed in this review. PMID:21994711

Construction of a Food Grade Recombinant Bacillus subtilis Based on Replicative Plasmids with an Auxotrophic Marker for Biotransformation of d-Fructose to d-Allulose.

PubMed

He, Weiwei; Mu, Wanmeng; Jiang, Bo; Yan, Xin; Zhang, Tao

2016-04-27

A food grade recombinant Bacillus subtilis that produces d-psicose 3-epimerase (DPEase; EC 5.1.3.30) was constructed by transforming a replicative multicopy plasmid with a d-alanine racemase gene marker into B. subtilis 1A751 with the d-alanine racemase gene knocked out. The DPEase was expressed in B. subtilis without antibiotic resistance genes and without adding antibiotics during fermentation. Whole cells of the food grade recombinant B. subtilis were used to biotransform d-fructose to d-allulose. The two tandem promoters, including the HpaII and P43 promoters, increased expression levels compared to the use of one promoter, HpaII. For large-scale d-allulose production, the optimal enzyme dose was 40 enzyme activity units of dry cells per gram of d-fructose, which produced a 28.5% turnover yield in 60 min. The recombinant plasmid exhibited stability over 100 generations. This food grade recombinant B. subtilis may be used for large-scale d-allulose production in the food industry.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

[Construction and expression of a eukaryotic expression vector containing human CR2-Fc fusion protein].

PubMed

Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong

2014-01-01

To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.

Yeast Genetics and Biotechnological Applications

NASA Astrophysics Data System (ADS)

Mishra, Saroj; Baranwal, Richa

Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

Generation of Recombinant Modified Vaccinia Virus Ankara Encoding VP2, NS1, and VP7 Proteins of Bluetongue Virus.

PubMed

Marín-López, Alejandro; Ortego, Javier

2016-01-01

Modified Vaccinia Virus Ankara (MVA) is employed widely as an experimental vaccine vector for its lack of replication in mammalian cells and high expression level of foreign/heterologous genes. Recombinant MVAs (rMVAs) are used as platforms for protein production as well as vectors to generate vaccines against a high number of infectious diseases and other pathologies. The portrait of the virus combines desirable elements such as high-level biological safety, the ability to activate appropriate innate immune mediators upon vaccination, and the capacity to deliver substantial amounts of heterologous antigens. Recombinant MVAs encoding proteins of bluetongue virus (BTV), an Orbivirus that infects domestic and wild ruminants transmitted by biting midges of the Culicoides species, are excellent vaccine candidates against this virus. In this chapter we describe the methods for the generation of rMVAs encoding VP2, NS1, and VP7 proteins of bluetongue virus as a model example for orbiviruses. The protocols included cover the cloning of VP2, NS1, and VP7 BTV-4 genes in a transfer plasmid, the construction of recombinant MVAs, the titration of virus working stocks and the protein expression analysis by immunofluorescence and radiolabeling of rMVA infected cells as well as virus purification.

INGN 007, an oncolytic adenovirus vector, replicates in Syrian hamsters but not mice: comparison of biodistribution studies.

PubMed

Ying, B; Toth, K; Spencer, J F; Meyer, J; Tollefson, A E; Patra, D; Dhar, D; Shashkova, E V; Kuppuswamy, M; Doronin, K; Thomas, M A; Zumstein, L A; Wold, W S M; Lichtenstein, D L

2009-08-01

Preclinical biodistribution studies with INGN 007, an oncolytic adenovirus (Ad) vector, supporting an early stage clinical trial were conducted in Syrian hamsters, which are permissive for Ad replication, and mice, which are a standard model for assessing toxicity and biodistribution of replication-defective (RD) Ad vectors. Vector dissemination and pharmacokinetics following intravenous administration were examined by real-time PCR in nine tissues and blood at five time points spanning 1 year. Select organs were also examined for the presence of infectious vector/virus. INGN 007 (VRX-007), wild-type Ad5 and AdCMVpA (an RD vector) were compared in the hamster model, whereas only INGN 007 was examined in mice. DNA of all vectors was widely disseminated early after injection, but decayed rapidly in most organs. In the hamster model, DNA of INGN 007 and Ad5 was more abundant than that of the RD vector AdCMVpA at early times after injection, but similar levels were seen later. An increased level of INGN 007 and Ad5 DNA but not AdCMVpA DNA in certain organs early after injection, and the presence of infectious INGN 007 and Ad5 in lung and liver samples at early times after injection, strongly suggests that replication of INGN 007 and Ad5 occurred in several Syrian hamster organs. There was no evidence of INGN 007 replication in mice. In addition to providing important information about INGN 007, the results underscore the utility of the Syrian hamster as a permissive immunocompetent model for Ad5 pathogenesis and oncolytic Ad vectors.

Transfection of embryonated Muscovy duck eggs with a recombinant plasmid is suitable for rescue of infectious Muscovy duck parvovirus.

PubMed

Wang, Jianye; Huang, Yu; Ling, Jueyi; Wang, Zhixiang; Zhu, Guoqiang

2017-12-01

For members of the family Parvoviridae, rescue of infectious virus from recombinant plasmid is usually done in cultured cells. In this study, the whole genome of the pathogenic Muscovy duck parvovirus (MDPV) strain YY was cloned into the pBluescript II (SK) vector, generating recombinant plasmid pYY. With the aid of a transfection reagent, pYY plasmid was inoculated into 11-day-old embryonated Muscovy duck eggs via the chorioallantoic membrane route, resulting in the successful rescue of infectious virus and death of the embryos. The rescued virus exhibited pathogenicity in Muscovy ducklings similar to that of its parental strain, as evaluated based on the mortality rate. The results demonstrate that plasmid transfection in embryonated Muscovy duck eggs is a convenient and efficacious method for rescue of infectious MDPV in comparison to transfection of primary cells, which is somewhat time-consuming and laborious.

Adenovirus sequences required for replication in vivo.

PubMed Central

Wang, K; Pearson, G D

1985-01-01

We have studied the in vivo replication properties of plasmids carrying deletion mutations within cloned adenovirus terminal sequences. Deletion mapping located the adenovirus DNA replication origin entirely within the first 67 bp of the adenovirus inverted terminal repeat. This region could be further subdivided into two functional domains: a minimal replication origin and an adjacent auxillary region which boosted the efficiency of replication by more than 100-fold. The minimal origin occupies the first 18 to 21 bp and includes sequences conserved between all adenovirus serotypes. The adjacent auxillary region extends past nucleotide 36 but not past nucleotide 67 and contains the binding site for nuclear factor I. Images PMID:2991857

Advances in Non-Viral DNA Vectors for Gene Therapy

PubMed Central

Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

2017-01-01

Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR.

PubMed

D'Costa, Susan; Blouin, Veronique; Broucque, Frederic; Penaud-Budloo, Magalie; François, Achille; Perez, Irene C; Le Bec, Christine; Moullier, Philippe; Snyder, Richard O; Ayuso, Eduard

2016-01-01

Clinical trials using recombinant adeno-associated virus (rAAV) vectors have demonstrated efficacy and a good safety profile. Although the field is advancing quickly, vector analytics and harmonization of dosage units are still a limitation for commercialization. AAV reference standard materials (RSMs) can help ensure product safety by controlling the consistency of assays used to characterize rAAV stocks. The most widely utilized unit of vector dosing is based on the encapsidated vector genome. Quantitative polymerase chain reaction (qPCR) is now the most common method to titer vector genomes (vg); however, significant inter- and intralaboratory variations have been documented using this technique. Here, RSMs and rAAV stocks were titered on the basis of an inverted terminal repeats (ITRs) sequence-specific qPCR and we found an artificial increase in vg titers using a widely utilized approach. The PCR error was introduced by using single-cut linearized plasmid as the standard curve. This bias was eliminated using plasmid standards linearized just outside the ITR region on each end to facilitate the melting of the palindromic ITR sequences during PCR. This new "Free-ITR" qPCR delivers vg titers that are consistent with titers obtained with transgene-specific qPCR and could be used to normalize in-house product-specific AAV vector standards and controls to the rAAV RSMs. The free-ITR method, including well-characterized controls, will help to calibrate doses to compare preclinical and clinical data in the field.

Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation | Center for Cancer Research

Cancer.gov

Dubbed "Tom's T" by Dhruba Chattoraj, the unusually conserved thymine at position +7 in bacteriophage P1 plasmid RepA DNA binding sites rises above repressor and acceptor sequence logos. The T appears to represent base flipping prior to helix opening in this DNA replication initation protein.

Unusual genome complexity in Lactobacillus salivarius JCM1046.

PubMed

Raftis, Emma J; Forde, Brian M; Claesson, Marcus J; O'Toole, Paul W

2014-09-08

Lactobacillus salivarius strains are increasingly being exploited for their probiotic properties in humans and animals. Dissemination of antibiotic resistance genes among species with food or probiotic-association is undesirable and is often mediated by plasmids or integrative and conjugative elements. L. salivarius strains typically have multireplicon genomes including circular megaplasmids that encode strain-specific traits for intestinal survival and probiotic activity. Linear plasmids are less common in lactobacilli and show a very limited distribution in L. salivarius. Here we present experimental evidence that supports an unusually complex multireplicon genome structure in the porcine isolate L. salivarius JCM1046. JCM1046 harbours a 1.83 Mb chromosome, and four plasmids which constitute 20% of the genome. In addition to the known 219 kb repA-type megaplasmid pMP1046A, we identified and experimentally validated the topology of three additional replicons, the circular pMP1046B (129 kb), a linear plasmid pLMP1046 (101 kb) and pCTN1046 (33 kb) harbouring a conjugative transposon. pMP1046B harbours both plasmid-associated replication genes and paralogues of chromosomally encoded housekeeping and information-processing related genes, thus qualifying it as a putative chromid. pLMP1046 shares limited sequence homology or gene synteny with other L. salivarius plasmids, and its putative replication-associated protein is homologous to the RepA/E proteins found in the large circular megaplasmids of L. salivarius. Plasmid pCTN1046 harbours a single copy of an integrated conjugative transposon (Tn6224) which appears to be functionally intact and includes the tetracycline resistance gene tetM. Experimental validation of sequence assemblies and plasmid topology resolved the complex genome architecture of L. salivarius JCM1046. A high-coverage draft genome sequence would not have elucidated the genome complexity in this strain. Given the expanding use of L. salivarius as a probiotic, it is important to determine the genotypic and phenotypic organization of L. salivarius strains. The identification of Tn6224-like elements in this species has implications for strain selection for probiotic applications.

Transgene Expression and Host Cell Responses to Replication-Defective, Single-Cycle, and Replication-Competent Adenovirus Vectors.

PubMed

Crosby, Catherine M; Barry, Michael A

2017-02-18

Most adenovirus (Ad) vectors are E1 gene deleted replication defective (RD-Ad) vectors that deliver one transgene to the cell and all expression is based on that one gene. In contrast, E1-intact replication-competent Ad (RC-Ad) vectors replicate their DNA and their transgenes up to 10,000-fold, amplifying transgene expression markedly higher than RD-Ad vectors. While RC-Ad are more potent, they run the real risk of causing adenovirus infections in vector recipients and those that administer them. To gain the benefits of transgene amplification, but avoid the risk of Ad infections, we developed "single cycle" Ad (SC-Ad) vectors. SC-Ads amplify transgene expression and generated markedly stronger and more persistent immune responses than RD-Ad as expected. However, they also unexpectedly generated stronger immune responses than RC-Ad vectors. To explore the basis of this potency here, we compared gene expression and the cellular responses to infection to these vectors in vitro and in vivo. In vitro, in primary human lung epithelial cells, SC- and RC-Ad amplified their genomes more than 400-fold relative to RD-Ad with higher replication by SC-Ad. This replication translated into higher green fluorescent protein (GFP) expression for 48 h by SC- and RC-Ad than by RD-Ad. In vitro, in the absence of an immune system, RD-Ad expression became higher by 72 h coincident with cell death mediated by SC- and RC-Ad and release of transgene product from the dying cells. When the vectors were compared in human THP-1 Lucia- interferon-stimulated gene (ISG) cells, which are a human monocyte cell line that have been modified to quantify ISG activity, RC-Ad6 provoked significantly stronger ISG responses than RD- or SC-Ad. In mice, intravenous or intranasal injection produced up to 100-fold genome replication. Under these in vivo conditions in the presence of the immune system, luciferase expression by RC and SC-Ad was markedly higher than that by RD-Ad. In immunodeficient mice, SC-Ad drove stronger luciferase expression than RC- or RD-Ad. These data demonstrate better transgene expression by SC- and RC-Ad in vitro and in vivo than RD-Ad. This higher expression by the replicating vectors results in a peak of expression within 1 to 2 days followed by cell death of infected cells and release of transgene products. While SC- and RC-Ad expression were similar in mice and in Syrian hamsters, RC-Ad provoked much stronger ISG induction which may explain in part SC-Ad's ability to generate stronger and more persistent immune responses than RC-Ad in Ad permissive hamsters.

Structural and physiological studies of the Escherichia coli histidine operon inserted into plasmid vectors.

PubMed Central

Bruni, C B; Musti, A M; Frunzio, R; Blasi, F

1980-01-01

A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067

Ordering the mob: Insights into replicon and MOB typing schemes from analysis of a curated dataset of publicly available plasmids.

PubMed

Orlek, Alex; Phan, Hang; Sheppard, Anna E; Doumith, Michel; Ellington, Matthew; Peto, Tim; Crook, Derrick; Walker, A Sarah; Woodford, Neil; Anjum, Muna F; Stoesser, Nicole

2017-05-01

Plasmid typing can provide insights into the epidemiology and transmission of plasmid-mediated antibiotic resistance. The principal plasmid typing schemes are replicon typing and MOB typing, which utilize variation in replication loci and relaxase proteins respectively. Previous studies investigating the proportion of plasmids assigned a type by these schemes ('typeability') have yielded conflicting results; moreover, thousands of plasmid sequences have been added to NCBI in recent years, without consistent annotation to indicate which sequences represent complete plasmids. Here, a curated dataset of complete Enterobacteriaceae plasmids from NCBI was compiled, and used to assess the typeability and concordance of in silico replicon and MOB typing schemes. Concordance was assessed at hierarchical replicon type resolutions, from replicon family-level to plasmid multilocus sequence type (pMLST)-level, where available. We found that 85% and 65% of the curated plasmids could be replicon and MOB typed, respectively. Overall, plasmid size and the number of resistance genes were significant independent predictors of replicon and MOB typing success. We found some degree of non-concordance between replicon families and MOB types, which was only partly resolved when partitioning plasmids into finer-resolution groups (replicon and pMLST types). In some cases, non-concordance was attributed to ambiguous boundaries between MOBP and MOBQ types; in other cases, backbone mosaicism was considered a more plausible explanation. β-lactamase resistance genes tended not to show fidelity to a particular plasmid type, though some previously reported associations were supported. Overall, replicon and MOB typing schemes are likely to continue playing an important role in plasmid analysis, but their performance is constrained by the diverse and dynamic nature of plasmid genomes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Evolution and dynamics of megaplasmids with genome sizes larger than 100 kb in the Bacillus cereus group.

PubMed

Zheng, Jinshui; Peng, Donghai; Ruan, Lifang; Sun, Ming

2013-12-02

Plasmids play a crucial role in the evolution of bacterial genomes by mediating horizontal gene transfer. However, the origin and evolution of most plasmids remains unclear, especially for megaplasmids. Strains of the Bacillus cereus group contain up to 13 plasmids with genome sizes ranging from 2 kb to 600 kb, and thus can be used to study plasmid dynamics and evolution. This work studied the origin and evolution of 31 B. cereus group megaplasmids (>100 kb) focusing on the most conserved regions on plasmids, minireplicons. Sixty-five putative minireplicons were identified and classified to six types on the basis of proteins that are essential for replication. Twenty-nine of the 31 megaplasmids contained two or more minireplicons. Phylogenetic analysis of the protein sequences showed that different minireplicons on the same megaplasmid have different evolutionary histories. Therefore, we speculated that these megaplasmids are the results of fusion of smaller plasmids. All plasmids of a bacterial strain must be compatible. In megaplasmids of the B. cereus group, individual minireplicons of different megaplasmids in the same strain belong to different types or subtypes. Thus, the subtypes of each minireplicon they contain may determine the incompatibilities of megaplasmids. A broader analysis of all 1285 bacterial plasmids with putative known minireplicons whose complete genome sequences were available from GenBank revealed that 34% (443 plasmids) of the plasmids have two or more minireplicons. This indicates that plasmid fusion events are general among bacterial plasmids. Megaplasmids of B. cereus group are fusion of smaller plasmids, and the fusion of plasmids likely occurs frequently in the B. cereus group and in other bacterial taxa. Plasmid fusion may be one of the major mechanisms for formation of novel megaplasmids in the evolution of bacteria.

Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

PubMed Central

2014-01-01

Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

Single-cycle adenovirus vectors in the current vaccine landscape.

PubMed

Barry, Michael

2018-02-01

Traditional inactivated and protein vaccines generate strong antibodies, but struggle to generate T cell responses. Attenuated pathogen vaccines generate both, but risk causing the disease they aim to prevent. Newer gene-based vaccines drive both responses and avoid the risk of infection. While these replication-defective (RD) vaccines work well in small animals, they can be weak in humans because they do not replicate antigen genes like more potent replication-competent (RC) vaccines. RC vaccines generate substantially stronger immune responses, but also risk causing their own infections. To circumvent these problems, we developed single-cycle adenovirus (SC-Ad) vectors that amplify vaccine genes, but that avoid the risk of infection. This review will discuss these vectors and their prospects for use as vaccines. Areas covered: This review provides a background of different types of vaccines. The benefits of gene-based vaccines and their ability to replicate antigen genes are described. Adenovirus vectors are discussed and compared to other vaccine types. Replication-defective, single-cycle, and replication-competent Ad vaccines are compared. Expert commentary: The potential utility of these vaccines are discussed when used against infectious diseases and as cancer vaccines. We propose a move away from replication-defective vaccines towards more robust replication-competent or single-cycle vaccines.

Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp.

PubMed

Zhou, Jingxiang; Xue, Jiangdong; Wang, Qiuju; Zhu, Xia; Li, Xingwei; Lv, Wenliang; Zhang, Dongming

2014-06-01

In order to construct the recombinant plasmid of pIRES-ORF81, the nucleic acid isolated from Koi herpes virus-CJ (KHV-CJ) strains was used as a template to insert the ORF81 gene fragments amplified by PCR into the pIRES-neo, a kind of eukaryotic expression vector. Using Western blotting analysis, it was verified that ORF81 gene protein can be expressed correctly by pIRES-ORF81, after MFC cells were transfected. The recombinant plasmid pIRES-ORF81 was set into three immunization dose gradients: 1, 10, and 50 μg/carp. Empty plasmid group, PBS group, and blank control group were set simultaneously. Giving intramuscular injections to healthy carps with an average body mass of 246 ± 20 g, indirect ELISA was used to regularly determine antibody levels after three times immunization injection. Neutralizing antibodies were detected by neutralization assay. The results of inoculation tests showed that the pIRES-ORF81 recombinant plasmid can induce the production of carp-specific antibodies. The differences of immune effect between the three different doses of immune gradients were not significant (P > 0.05), but they can induce the production of neutralizing antibodies. After 25 d of inoculation, carp mortality of pIRES-neo empty vector treatment groups was 85%, while the carp mortality of eukaryotic expression recombinant plasmid pIRES-ORF81 injected with three different doses of immune gradients was 20, 17.5, and 12.5%, respectively. Differences in comparison to the control group were highly significant (P < 0.01). However, histopathological section of immunohistochemistry organization revealed no significant changes. It demonstrated that the DNA vaccine pIRES-ORF81 constructed in the experiment displayed a good protective effect against KHV, which had the potential to industrial applications.

Rev-binding aptamer and CMV promoter act as decoys to inhibit HIV replication.

PubMed

Konopka, K; Lee, N S; Rossi, J; Düzgüneş, N

2000-09-19

We examined whether the antiviral effect of an HIV-1 Rev-binding aptamer [RBE(apt)] could be enhanced by a ribozyme directed against the HIV-1 env gene, and whether the antiviral activity was affected by different promoters. The efficacy of the aptamer and ribozyme DNAs was tested in HeLa cells co-transfected with the HIV-1 proviral clones, HXBDeltaBgl or pNL4-3, using transferrin-lipoplexes. The RBE(apt) and anti-env ribozyme genes were inserted into the pTZU6+27 plasmid, or constructed under the control of the human cytomegalovirus (CMV) or Rous sarcoma virus (RSV) promoters. The parental vector plasmids were used as controls. Co-transfection of the pTZU6+27 RBE(apt) plasmid with HXBDeltaBgl, or pNL4-3, at a weight ratio of 5:1, inhibited p24 production by 70 and 45%, respectively. The RSV RBE(apt) plasmid co-transfected with either HIV clone, at the same weight ratio, reduced viral production by 88%. The addition of the anti-env ribozyme to the RSV RBE(apt) did not enhance its antiviral activity. When the constructs were under the control of the CMV promoter, the expression of the HIV plasmids was very low and was independent of the presence of the RBE(apt). Thus, the effect of the RBE(apt) was strongly dependent on the promoter of the tested construct. The anti-HIV activity of the CMV RBE(apt) construct was non-specific, because co-transfection with either pCMV. SPORT-betagal or pCMVlacZ significantly suppressed HIV production from the HIV proviral clones. The reduction in p24 could not be attributed to the non-specific toxicity of the transfection procedure. Transfection of acutely HIV-infected HeLa-CD4 cells with pCMV.SPORT-betagal reduced the p24 level by 35%, while the expression of the U6 RBE(apt) did not affect p24 production. The suppression of HIV production from the HIV proviral clones by the CMV promoter constructs in the co-transfection assays may be explained by competition for transcription factors (TFs) between HIV and CMV promoters. This observation points to the potential for misleading results in co-transfections involving CMV constructs and HIV.

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat

Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficientmore » in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.« less

Testing plasmid stability of Escherichia coli using the Continuously Operated Shaken BIOreactor System.

PubMed

Sieben, Michaela; Steinhorn, Gregor; Müller, Carsten; Fuchs, Simone; Ann Chin, Laura; Regestein, Lars; Büchs, Jochen

2016-11-01

Plasmids are common vectors to genetically manipulate Escherichia coli or other microorganisms. They are easy to use and considerable experience has accumulated on their application in heterologous protein production. However, plasmids can be lost during cell growth, if no selection pressure like, e.g., antibiotics is used, hampering the production of the desired protein and endangering the economic success of a biotechnological production process. Thus, in this study the Continuously Operated Shaken BIOreactor System (COSBIOS) is applied as a tool for fast parallel testing of strain stability and operation conditions and to evaluate measures to counter such plasmid loss. In specific, by applying various ampicillin concentrations, the lowest effective ampicillin dosage is investigated to secure plasmid stability while lowering adverse ecological effects. A significant difference was found in the growth rates of plasmid-bearing and plasmid-free cells. The undesired plasmid-free cells grew 30% faster than the desired plasmid-bearing cells. During the testing of plasmid stability without antibiotics, the population fraction of plasmid-bearing cells rapidly decreased in continuous culture to zero within the first 48 h. An initial single dosage of ampicillin did not prevent plasmid loss. By contrast, a continuous application of a low dosage of 10 µg/mL ampicillin in the feed medium maintained plasmid stability in the culture. Consequently, the COSBIOS is an apt reactor system for measuring plasmid stability and evaluating methods to enhance this stability. Hence, decreased production of heterologous protein can be prevented. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1418-1425, 2016. © 2016 American Institute of Chemical Engineers.

Replication-Competent Controlled Herpes Simplex Virus

PubMed Central

Bloom, David C.; Feller, Joyce; McAnany, Peterjon; Vilaboa, Nuria

2015-01-01

ABSTRACT We present the development and characterization of a replication-competent controlled herpes simplex virus 1 (HSV-1). Replication-essential ICP4 and ICP8 genes of HSV-1 wild-type strain 17syn+ were brought under the control of a dually responsive gene switch. The gene switch comprises (i) a transactivator that is activated by a narrow class of antiprogestins, including mifepristone and ulipristal, and whose expression is mediated by a promoter cassette that comprises an HSP70B promoter and a transactivator-responsive promoter and (ii) transactivator-responsive promoters that drive the ICP4 and ICP8 genes. Single-step growth experiments in different cell lines demonstrated that replication of the recombinant virus, HSV-GS3, is strictly dependent on an activating treatment consisting of administration of a supraphysiological heat dose in the presence of an antiprogestin. The replication-competent controlled virus replicates with an efficiency approaching that of the wild-type virus from which it was derived. Essentially no replication occurs in the absence of activating treatment or if HSV-GS3-infected cells are exposed only to heat or antiprogestin. These findings were corroborated by measurements of amounts of viral DNA and transcripts of the regulated ICP4 gene and the glycoprotein C (gC) late gene, which was not regulated. Similar findings were made in experiments with a mouse footpad infection model. IMPORTANCE The alphaherpesviruses have long been considered vectors for recombinant vaccines and oncolytic therapies. The traditional approach uses vector backbones containing attenuating mutations that restrict replication to ensure safety. The shortcoming of this approach is that the attenuating mutations tend to limit both the immune presentation and oncolytic properties of these vectors. HSV-GS3 represents a novel type of vector that, when activated, replicates with the efficiency of a nonattenuated virus and whose safety is derived from deliberate, stringent regulation of multiple replication-essential genes. By directing activating heat to the region of virus administration, replication is strictly confined to infected cells within this region. The requirement for antiprogestin provides an additional level of safety, ensuring that virus replication cannot be triggered inadvertently. Replication-competent controlled vectors such as HSV-GS3 may have the potential to be superior to conventional attenuated HSV vaccine and oncolytic vectors without sacrificing safety. PMID:26269179

Amplified and persistent immune responses generated by single-cycle replicating adenovirus vaccines.

PubMed

Crosby, Catherine M; Nehete, Pramod; Sastry, K Jagannadha; Barry, Michael A

2015-01-01

Replication-competent adenoviral (RC-Ad) vectors generate exceptionally strong gene-based vaccine responses by amplifying the antigen transgenes they carry. While they are potent, they also risk causing adenovirus infections. More common replication-defective Ad (RD-Ad) vectors with deletions of E1 avoid this risk but do not replicate their transgene and generate markedly weaker vaccine responses. To amplify vaccine transgenes while avoiding production of infectious progeny viruses, we engineered "single-cycle" adenovirus (SC-Ad) vectors by deleting the gene for IIIa capsid cement protein of lower-seroprevalence adenovirus serotype 6. In mouse, human, hamster, and macaque cells, SC-Ad6 still replicated its genome but prevented genome packaging and virion maturation. When used for mucosal intranasal immunization of Syrian hamsters, both SC-Ad and RC-Ad expressed transgenes at levels hundreds of times higher than that of RD-Ad. Surprisingly, SC-Ad, but not RC-Ad, generated higher levels of transgene-specific antibody than RD-Ad, which notably climbed in serum and vaginal wash samples over 12 weeks after single mucosal immunization. When RD-Ad and SC-Ad were tested by single sublingual immunization in rhesus macaques, SC-Ad generated higher gamma interferon (IFN-γ) responses and higher transgene-specific serum antibody levels. These data suggest that SC-Ad vectors may have utility as mucosal vaccines. This work illustrates the utility of our recently developed single-cycle adenovirus (SC-Ad6) vector as a new vaccine platform. Replication-defective (RD-Ad6) vectors produce low levels of transgene protein, which leads to minimal antibody responses in vivo. This study shows that replicating SC-Ad6 produces higher levels of luciferase and induces higher levels of green fluorescent protein (GFP)-specific antibodies than RD in a permissive Syrian hamster model. Surprisingly, although a replication-competent (RC-Ad6) vector produces more luciferase than SC-Ad6, it does not elicit comparable levels of anti-GFP antibodies in permissive hamsters. When tested in the larger rhesus macaque model, SC-Ad6 induces higher transgene-specific antibody and T cell responses. Together, these data suggest that SC-Ad6 could be a more effective platform for developing vaccines against more relevant antigens. This could be especially beneficial for developing vaccines for pathogens for which traditional replication-defective adenovirus vectors have not been effective. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Generation of a non-transmissive Borna disease virus vector lacking both matrix and glycoprotein genes.

PubMed

Fujino, Kan; Yamamoto, Yusuke; Daito, Takuji; Makino, Akiko; Honda, Tomoyuki; Tomonaga, Keizo

2017-09-01

Borna disease virus (BoDV), a prototype of mammalian bornavirus, is a non-segmented, negative strand RNA virus that often causes severe neurological disorders in infected animals, including horses and sheep. Unique among animal RNA viruses, BoDV transcribes and replicates non-cytopathically in the cell nucleus, leading to establishment of long-lasting persistent infection. This striking feature of BoDV indicates its potential as an RNA virus vector system. It has previously been demonstrated by our team that recombinant BoDV (rBoDV) lacking an envelope glycoprotein (G) gene develops persistent infections in transduced cells without loss of the viral genome. In this study, a novel non-transmissive rBoDV, rBoDV ΔMG, which lacks both matrix (M) and G genes in the genome, is reported. rBoDV-ΔMG expressing green fluorescence protein (GFP), rBoDV ΔMG-GFP, was efficiently generated in Vero/MG cells stably expressing both BoDV M and G proteins. Infection with rBoDV ΔMG-GFP was persistently maintained in the parent Vero cells without propagation within cell culture. The optimal ratio of M and G for efficient viral particle production by transient transfection of M and G expression plasmids into cells persistently infected with rBoDV ΔMG-GFP was also demonstrated. These findings indicate that the rBoDV ΔMG-based BoDV vector may provide an extremely safe virus vector system and could be a novel strategy for investigating the function of M and G proteins and the host range of bornaviruses. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Initiation at closely spaced replication origins in a yeast chromosome.

PubMed

Brewer, B J; Fangman, W L

1993-12-10

Replication of eukaryotic chromosomes involves initiation at origins spaced an average of 50 to 100 kilobase pairs. In yeast, potential origins can be recognized as autonomous replication sequences (ARSs) that allow maintenance of plasmids. However, there are more ARS elements than active chromosomal origins. The possibility was examined that close spacing of ARSs can lead to inactive origins. Two ARSs located 6.5 kilobase pairs apart can indeed interfere with each other. Replication is initiated from one or the other ARS with equal probability, but rarely (< 5%) from both ARSs on the same DNA molecule.

APOBEC3-mediated hypermutation of retroviral vectors produced from some retrovirus packaging cell lines.

PubMed

Miller, A D; Metzger, M J

2011-05-01

APOBEC3 proteins are packaged into retrovirus virions and can hypermutate retroviruses during reverse transcription. We found that HT-1080 human fibrosarcoma cells hypermutate retroviruses, and that the HT-1080 cell-derived FLYA13 retrovirus packaging cells also hypermutate a retrovirus vector produced using these cells. We found no hypermutation of the same vector produced by the mouse cell-derived packaging line PT67 or by human 293 cells transfected with the vector and retrovirus packaging plasmids. We expect that avoidance of vector hypermutation will be particularly important for vectors used in gene therapy, wherein mutant proteins might stimulate deleterious immune responses.

Genomics of high molecular weight plasmids isolated from an on-farm biopurification system.

PubMed

Martini, María C; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F

2016-06-20

The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities.

Comparison of immune responses to different foot-and-mouth disease genetically engineered vaccines in guinea pigs.

PubMed

Yao, Qingxia; Qian, Ping; Huang, Qinfeng; Cao, Yi; Chen, Huanchun

2008-01-01

The P12A3C gene from FMDV (serotype O) encoding the capsid precursor protein, and the highly immunogenic gene FHG, which encodes multiple epitopes of FMDV capsid proteins, were inserted into eukaryotic expression vectors to compare different candidate genetically engineered vaccines for foot-and-mouth disease (FMD). A modified live pseudorabies virus (MLPRV) was also used to deliver P12A3C. Guinea pigs were inoculated intramuscularly with the candidate vaccines to compare the ability to elicit immunity of the DNA vector and a live viral vector. An indirect enzyme-linked immunosorbent assay (iELISA), virus-neutralization test and lymphoproliferation assay were used to detect antibody and cellular responses. The group immunized with P12A3C delivered by MLPRV produced significantly greater antibody and cellular responses indicating that MLPRV has a greater ability to mediate exogenous gene delivery than the plasmid DNA vector. Comparison of the immune responses induced by P12A3C and FHG, which were both mediated by DNA plasmids, showed that FHG and P12A3C elicited similar cellular responses, while P12A3C induced higher antibody levels, suggesting that P12A3C is a more powerful immunogen than FHG. In challenge experiments, guinea pigs vaccinated with P12A3C delivered by MLPRV were protected fully from FMDV challenge, whereas guinea pigs vaccinated with P12A3C or FHG delivered by DNA plasmid were only protected partially. This study provides a basis for future construction of a genetically engineered vaccine for FMDV.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

The Tcp conjugation system of Clostridium perfringens.

PubMed

Wisniewski, Jessica A; Rood, Julian I

2017-05-01

The Gram-positive pathogen Clostridium perfringens possesses a family of large conjugative plasmids that is typified by the tetracycline resistance plasmid pCW3. Since these plasmids may carry antibiotic resistance genes or genes encoding extracellular or sporulation-associated toxins, the conjugative transfer of these plasmids appears to be important for the epidemiology of C. perfringens-mediated diseases. Sequence analysis of members of this plasmid family identified a highly conserved 35kb region that encodes proteins with various functions, including plasmid replication and partitioning. The tcp conjugation locus also was identified in this region, initially based on low-level amino acid sequence identity to conjugation proteins from the integrative conjugative element Tn916. Genetic studies confirmed that the tcp locus is required for conjugative transfer and combined with biochemical and structural analyses have led to the development of a functional model of the Tcp conjugation apparatus. This review summarises our current understanding of the Tcp conjugation system, which is now one of the best-characterized conjugation systems in Gram-positive bacteria. Copyright © 2017 Elsevier Inc. All rights reserved.

Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

PubMed

Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

2010-06-01

To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

PubMed Central

Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

2013-01-01

Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

Comparative symbiotic plasmid analysis indicates that symbiosis gene ancestor type affects plasmid genetic evolution.

PubMed

Wang, X; Zhao, L; Zhang, L; Wu, Y; Chou, M; Wei, G

2018-07-01

Rhizobial symbiotic plasmids play vital roles in mutualistic symbiosis with legume plants by executing the functions of nodulation and nitrogen fixation. To explore the gene composition and genetic constitution of rhizobial symbiotic plasmids, comparison analyses of 24 rhizobial symbiotic plasmids derived from four rhizobial genera was carried out. Results illustrated that rhizobial symbiotic plasmids had higher proportion of functional genes participating in amino acid transport and metabolism, replication; recombination and repair; carbohydrate transport and metabolism; energy production and conversion and transcription. Mesorhizobium amorphae CCNWGS0123 symbiotic plasmid - pM0123d had similar gene composition with pR899b and pSNGR234a. All symbiotic plasmids shared 13 orthologous genes, including five nod and eight nif/fix genes which participate in the rhizobia-legume symbiosis process. These plasmids contained nod genes from four ancestors and fix genes from six ancestors. The ancestral type of pM0123d nod genes was similar with that of Rhizobium etli plasmids, while the ancestral type of pM0123d fix genes was same as that of pM7653Rb. The phylogenetic trees constructed based on nodCIJ and fixABC displayed different topological structures mainly due to nodCIJ and fixABC ancestral type discordance. The study presents valuable insights into mosaic structures and the evolution of rhizobial symbiotic plasmids. This study compared 24 rhizobial symbiotic plasmids that included four genera and 11 species, illuminating the functional gene composition and symbiosis gene ancestor types of symbiotic plasmids from higher taxonomy. It provides valuable insights into mosaic structures and the evolution of symbiotic plasmids. © 2018 The Society for Applied Microbiology.

DNA sequence analysis of the composite plasmid pTC conferring virulence and antimicrobial resistance for porcine enterotoxigenic Escherichia coli.

PubMed

Fekete, Péter Z; Brzuszkiewicz, Elzbieta; Blum-Oehler, Gabriele; Olasz, Ferenc; Szabó, Mónika; Gottschalk, Gerhard; Hacker, Jörg; Nagy, Béla

2012-01-01

In this study the plasmid pTC, a 90 kb self-conjugative virulence plasmid of the porcine enterotoxigenic Escherichia coli (ETEC) strain EC2173 encoding the STa and STb heat-stable enterotoxins and tetracycline resistance, has been sequenced in two steps. As a result we identified five main distinct regions of pTC: (i) the maintenance region responsible for the extreme stability of the plasmid, (ii) the TSL (toxin-specific locus comprising the estA and estB genes) which is unique and characteristic for pTC, (iii) a Tn10 transposon, encoding tetracycline resistance, (iv) the tra (plasmid transfer) region, and (v) the colE1-like origin of replication. It is concluded that pTC is a self-transmissible composite plasmid harbouring antibiotic resistance and virulence genes. pTC belongs to a group of large conjugative E. coli plasmids represented by NR1 with a widespread tra backbone which might have evolved from a common ancestor. This is the first report of a completely sequenced animal ETEC virulence plasmid containing an antimicrobial resistance locus, thereby representing a selection advantage for spread of pathogenicity in the presence of antimicrobials leading to increased disease potential. Copyright © 2011. Published by Elsevier GmbH.

Tn5401, a new class II transposable element from Bacillus thuringiensis.

PubMed Central

Baum, J A

1994-01-01

A new class II (Tn3-like) transposable element, designated Tn5401, was recovered from a sporulation-deficient variant of Bacillus thuringiensis subsp. morrisoni EG2158 following its insertion into a recombinant plasmid. Sequence analysis of the insert revealed a 4,837-bp transposon with two large open reading frames, in the same orientation, encoding proteins of 36 kDa (306 residues) and 116 kDa (1,005 residues) and 53-bp terminal inverted repeats. The deduced amino acid sequence for the 36-kDa protein shows 24% sequence identity with the TnpI recombinase of the B. thuringiensis transposon Tn4430, a member of the phage integrase family of site-specific recombinases. The deduced amino acid sequence for the 116-kDa protein shows 42% sequence identity with the transposase of Tn3 but only 28% identity with the TnpA transposase of Tn4430. Two small open reading frames of unknown function, designated orf1 (85 residues) and orf2 (74 residues), were also identified. Southern blot analysis indicated that Tn5401, in contrast to Tn4430, is not commonly found among different subspecies of B. thuringiensis and is not typically associated with known insecticidal crystal protein genes. Transposition was studied with B. thuringiensis by using plasmid pEG922, a temperature-sensitive shuttle vector containing Tn5401. Tn5401 transposed to both chromosomal and plasmid target sites but displayed an apparent preference for plasmid sites. Transposition was replicative and resulted in the generation of a 5-bp duplication at the target site. Transcriptional start sites within Tn5401 were mapped by primer extension analysis. Two promoters, designated PL and PR, direct the transcription of orf1-orf2 and tnpI-tnpA, respectively, and are negatively regulated by TnpI. Sequence comparison of the promoter regions of Tn5401 and Tn4430 suggests that the conserved sequence element ATGTCCRCTAAY mediates TnpI binding and cointegrate resolution. The same element is contained within the 53-bp terminal inverted repeats, thus accounting for their unusual lengths and suggesting an additional role for TnpI in regulating Tn5401 transposition. Images PMID:7514590

INGN 007, an oncolytic adenovirus vector, replicates in Syrian hamsters but not mice: comparison of biodistribution studies

PubMed Central

Ying, B; Toth, K; Spencer, JF; Meyer, J; Tollefson, AE; Patra, D; Dhar, D; Shashkova, EV; Kuppuswamy, M; Doronin, K; Thomas, MA; Zumstein, LA; Wold, WSM; Lichtenstein, DL

2012-01-01

Preclinical biodistribution studies with INGN 007, an oncolytic adenovirus (Ad) vector, supporting an early stage clinical trial were conducted in Syrian hamsters, which are permissive for Ad replication, and mice, which are a standard model for assessing toxicity and biodistribution of replication-defective (RD) Ad vectors. Vector dissemination and pharmacokinetics following intravenous administration were examined by real-time PCR in nine tissues and blood at five time points spanning 1 year. Select organs were also examined for the presence of infectious vector/virus. INGN 007 (VRX-007), wild-type Ad5 and AdCMVpA (an RD vector) were compared in the hamster model, whereas only INGN 007 was examined in mice. DNA of all vectors was widely disseminated early after injection, but decayed rapidly in most organs. In the hamster model, DNA of INGN 007 and Ad5 was more abundant than that of the RD vector AdCMVpA at early times after injection, but similar levels were seen later. An increased level of INGN 007 and Ad5 DNA but not AdCMVpA DNA in certain organs early after injection, and the presence of infectious INGN 007 and Ad5 in lung and liver samples at early times after injection, strongly suggests that replication of INGN 007 and Ad5 occurred in several Syrian hamster organs. There was no evidence of INGN 007 replication in mice. In addition to providing important information about INGN 007, the results underscore the utility of the Syrian hamster as a permissive immunocompetent model for Ad5 pathogenesis and oncolytic Ad vectors. PMID:19197322

An acute toxicology study with INGN 007, an oncolytic adenovirus vector, in mice and permissive Syrian hamsters; comparisons with wild-type Ad5 and a replication-defective adenovirus vector

PubMed Central

Lichtenstein, DL; Spencer, JF; Doronin, K; Patra, D; Meyer, JM; Shashkova, EV; Kuppuswamy, M; Dhar, D; Thomas, MA; Tollefson, AE; Zumstein, LA; Wold, WSM; Toth, K

2012-01-01

Oncolytic (replication-competent) adenoviruses as anticancer agents provide new, promising tools to fight cancer. In support of a Phase I clinical trial, here we report safety data with INGN 007 (VRX-007), an oncolytic adenovirus with increased anti-tumor efficacy due to overexpression of the adenovirus-encoded ADP protein. Wild-type adenovirus type 5 (Ad5) and a replication-defective version of Ad5 were also studied as controls. A parallel study investigating the biodistribution of these viruses is described elsewhere in this issue. The toxicology experiments were conducted in two species, the Syrian hamster, which is permissive for INGN 007 and Ad5 replication and the poorly permissive mouse. The studies demonstrated that the safety profile of INGN 007 is similar to Ad5. Both viruses caused transient liver damage upon intravenous injection that resolved by 28 days post-infection. The No-Observable-Adverse-Effect-Level (NOAEL) for INGN 007 in hamsters was 3 × 1010 viral particles per kg. In hamsters, the replication-defective vector caused less toxicity, indicating that replication of Ad vectors in the host is an important factor in pathogenesis. With mice, INGN 007 and Ad5 caused toxicity comparable to the replication-defective adenovirus vector. Partially based on these results, the FDA granted permission to enter into a Phase I clinical trial with INGN 007. PMID:19197324

An acute toxicology study with INGN 007, an oncolytic adenovirus vector, in mice and permissive Syrian hamsters; comparisons with wild-type Ad5 and a replication-defective adenovirus vector.

PubMed

Lichtenstein, D L; Spencer, J F; Doronin, K; Patra, D; Meyer, J M; Shashkova, E V; Kuppuswamy, M; Dhar, D; Thomas, M A; Tollefson, A E; Zumstein, L A; Wold, W S M; Toth, K

2009-08-01

Oncolytic (replication-competent) adenoviruses as anticancer agents provide new, promising tools to fight cancer. In support of a Phase I clinical trial, here we report safety data with INGN 007 (VRX-007), an oncolytic adenovirus with increased anti-tumor efficacy due to overexpression of the adenovirus-encoded ADP protein. Wild-type adenovirus type 5 (Ad5) and a replication-defective version of Ad5 were also studied as controls. A parallel study investigating the biodistribution of these viruses is described elsewhere in this issue. The toxicology experiments were conducted in two species, the Syrian hamster, which is permissive for INGN 007 and Ad5 replication and the poorly permissive mouse. The studies demonstrated that the safety profile of INGN 007 is similar to Ad5. Both viruses caused transient liver damage upon intravenous injection that resolved by 28 days post-infection. The No-Observable-Adverse-Effect-Level (NOAEL) for INGN 007 in hamsters was 3 x 10(10) viral particles per kg. In hamsters, the replication-defective vector caused less toxicity, indicating that replication of Ad vectors in the host is an important factor in pathogenesis. With mice, INGN 007 and Ad5 caused toxicity comparable to the replication-defective adenovirus vector. Partially based on these results, the FDA granted permission to enter into a Phase I clinical trial with INGN 007.

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae

DOEpatents

Lacks, Sanford A.

1990-01-01

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae

DOEpatents

Lacks, S.A.

1990-10-02

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.

Tissue-specific, tumor-selective, replication-competent adenovirus vector for cancer gene therapy.

PubMed

Doronin, K; Kuppuswamy, M; Toth, K; Tollefson, A E; Krajcsi, P; Krougliak, V; Wold, W S

2001-04-01

We have previously described two replication-competent adenovirus vectors, named KD1 and KD3, for potential use in cancer gene therapy. KD1 and KD3 have two small deletions in the E1A gene that restrict efficient replication of these vectors to human cancer cell lines. These vectors also have increased capacity to lyse cells and spread from cell to cell because they overexpress the adenovirus death protein, an adenovirus protein required for efficient cell lysis and release of adenovirus from the cell. We now describe a new vector, named KD1-SPB, which is the KD1 vector with the E4 promoter replaced by the promoter for surfactant protein B (SPB). SPB promoter activity is restricted in the adult to type II alveolar epithelial cells and bronchial epithelial cells. Because KD1-SPB has the E1A mutations, it should replicate within and destroy only alveolar and bronchial cancer cells. We show that KD1-SPB replicates, lyses cells, and spreads from cell to cell as well as does KD1 in H441 cells, a human cancer cell line where the SPB promoter is active. KD1-SPB replicates, lyses cells, and spreads only poorly in Hep3B liver cancer cells. Replication was determined by expression of the E4ORF3 protein, viral DNA accumulation, fiber synthesis, and virus yield. Cell lysis and vector spread were measured by lactate dehydrogenase release and a "vector spread" assay. In addition to Hep3B cells, KD1-SPB also did not express E4ORF3 in HT29.14S (colon), HeLa (cervix), KB (nasopharynx), or LNCaP (prostate) cancer cell lines, in which the SPB promoter is not expected to be active. Following injection into H441 or Hep3B tumors growing in nude mice, KD1-SPB caused a three- to fourfold suppression of growth of H441 tumors, similar to that seen with KD1. KD1-SPB had only a minimal effect on the growth of Hep3B tumors, whereas KD1 again caused a three- to fourfold suppression. These results establish that the adenovirus E4 promoter can be replaced by a tissue-specific promoter in a replication-competent vector. The vector has three engineered safety features: the tissue-specific promoter, the mutations in E1A that preclude efficient replication in nondividing cells, and a deletion of the E3 genes which shield the virus from attack by the immune system. KD1-SPB may have use in treating human lung cancers in which the SPB promoter is active.

Introduction to the ultrasound targeted microbubble destruction technique.

PubMed

Walton, Chad B; Anderson, Cynthia D; Boulay, Rachel; Shohet, Ralph V

2011-06-12

In UTMD, bioactive molecules, such as negatively charged plasmid DNA vectors encoding a gene of interest, are added to the cationic shells of lipid microbubble contrast agents. In mice these vector-carrying microbubbles can be administered intravenously or directly to the left ventricle of the heart. In larger animals they can also be infused through an intracoronary catheter. The subsequent delivery from the circulation to a target organ occurs by acoustic cavitation at a resonant frequency of the microbubbles. It seems likely that the mechanical energy generated by the microbubble destruction results in transient pore formation in or between the endothelial cells of the microvasculature of the targeted region. As a result of this sonoporation effect, the transfection efficiency into and across the endothelial cells is enhanced, and transgene-encoding vectors are deposited into the surrounding tissue. Plasmid DNA remaining in the circulation is rapidly degraded by nucleases in the blood, which further reduces the likelihood of delivery to non-sonicated tissues and leads to highly specific target-organ transfection.

[Experimental study on human periodontal ligament cells transfected with human amelogenin gene].

PubMed

Yu, Guang; Shu, Rong; Sun, Ying; Cheng, Lan; Song, Zhong-Chen; Zhang, Xiu-Li

2008-02-01

To construct the recombinant lentiviral vector of human amelogenin gene, infect human periodontal ligament cells with the recombinant lentivirus, and evaluate the feasibility of applying modified PDLCs as seeds for a further periodontal reconstruction. The mature peptide of hAm cDNA was cloned and linked into the vector plasmid, the recombinant plasmid FUAmW was confirmed by double enzyme digestion and sequence analysis. Recombinant lentivirus was prepared from 293T cells by polytheylenimine (PEI)-mediated transient cotransfection. The hPDLCs and 293T cells were infected with the generated lentivirus. The infection efficiency was analysed by detection of green fluorescence protein (GFP) with fluorescent microscope and flow cytometer 72 hours later. The expression of hAm gene was detected by reverse transcription polymerase chain reaction (RT-PCR). The sequence of inserted fragment in recombinant plasmid was identical to the hAm sequence reported in Genebank. Green fluorescence was visible under fluorescent microscope, FCM assay showed that positive percentage was 69.46% and 33.99% in 293T and hPDLCs, respectively. The targeted gene was obtained in the experimental groups by RT-PCR. The recombinan lentiviral vector of hAm gene is constructed successfully and it could be transfected into cultured hPDLCs. hAm gene and seed cells may be used for further study in the fields periodontal tissue engineering. Supported by National Natural Science Foundation of China (Grant No. 30672315).

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

Construction of promoter-probe shuttle vectors for Escherichia coli and corynebacteria on the basis of promoterless alpha-amylase gene.

PubMed

Ugorcáková, J; Bukovská, G; Timko, J

2000-01-01

We constructed new promoter-probe vectors for E. coli and corynebacteria based on the promoterless alpha-amylase gene originating from Bacillus subtilis. Vectors pJUPAE1 and pJUPAE2 are suitable for isolation of transcriptionally active fragments from plasmids, phages or genomic DNA. alpha-Amylase activity can be easily visually detected on agar plates containing a chromogenic substrate, or by direct measurement of alpha-amylase activity.

Phage display vectors for in vivo recombination of immunoglobulin heavy and light chain genes to make large combinatorial libraries.

PubMed

Tsurushita, N; Fu, H; Warren, C

1996-06-12

New phage display vectors for in vivo recombination of immunoglobulin (Ig) heavy (VH) and light (VL) chain variable genes, to make single-chain Fv fragments (scFv), were constructed. The VH and VL genes of monoclonal antibody (mAb) EP-5C7, which binds to both human E- and P-selectin, were cloned into a pUC19-derived plasmid vector, pCW93, and a pACYC184-derived phagemid vector, pCW99, respectively. Upon induction of Cre recombinase (phage P1 recombinase), the VH and VL genes were efficiently recombined into the same plasmid via the two loxP sites (phage P1 recombination sites), one located downstream from a VH gene in pCW93 and another upstream from a VL gene in pCW99. In the resulting phagemid, the loxP sequence also encodes a polypeptide linker connecting the VH and VL domains to form a scFv of EP-5C7. Whether expressed on the phage surface or as a soluble form, the EP-5C7 scFv showed specific binding to human E- and P-selectin. This phagemid vector system provides a way to recombine VH and VL gene libraries efficiently in vivo to make extremely large Ig combinatorial libraries.

Analysis of point mutations in an ultraviolet-irradiated shuttle vector plasmid propagated in cells from Japanese xeroderma pigmentosum patients in complementation groups A and F

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagi, T.; Tatsumi-Miyajima, J.; Sato, M.

1991-06-15

To assess the contribution to mutagenesis by human DNA repair defects, a UV-treated shuttle vector plasmid, pZ189, was passed through fibroblasts derived from Japanese xeroderma pigmentosum (XP) patients in two different DNA repair complementation groups (A and F). Patients with XP have clinical and cellular UV hypersensitivity, increased frequency of skin cancer, and defects in DNA repair. The XP DNA repair defects represented by complementation groups A (XP-A) and F (XP-F) are more common in Japan than in Europe or the United States. In comparison to results with DNA repair-proficient human cells (W138-VA13), UV-treated pZ189 passed through the XP-A (XP2OS(SV))more » or XP-F (XP2YO(SV)) cells showed fewer surviving plasmids (XP-A less than XP-F) and a higher frequency of mutated plasmids (XP-A greater than XP-F). Base sequence analysis of more than 200 mutated plasmids showed the major type of base substitution mutation to be the G:C----A:T transition with all three cell lines. The XP-A and XP-F cells revealed a higher frequency of G:C----A:T transitions and a lower frequency of transversions among plasmids with single or tandem mutations and a lower frequency of plasmids with multiple point mutations compared to the normal line. The spectrum of mutations in pZ189 with the XP-A cells was similar to that with the XP-F cells. Seventy-six to 91% of the single base substitution mutations occurred at G:C base pairs in which the 5{prime}-neighboring base of the cytosine was thymine or cytosine. These studies indicate that the DNA repair defects in Japanese XP patients in complementation groups A and F result in different frequencies of plasmid survival and mutagenesis but in similar types of mutagenic abnormalities despite marked differences in clinical features.« less

Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

PubMed Central

Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2016-01-01

The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

PubMed

Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

2015-01-01

Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

Characterization of a Large Antibiotic Resistance Plasmid Found in Enteropathogenic Escherichia coli Strain B171 and Its Relatedness to Plasmids of Diverse E. coli and Shigella Strains.

PubMed

Hazen, Tracy H; Michalski, Jane; Nagaraj, Sushma; Okeke, Iruka N; Rasko, David A

2017-09-01

Enteropathogenic Escherichia coli (EPEC) is a leading cause of severe infantile diarrhea in developing countries. Previous research has focused on the diversity of the EPEC virulence plasmid, whereas less is known regarding the genetic content and distribution of antibiotic resistance plasmids carried by EPEC. A previous study demonstrated that in addition to the virulence plasmid, reference EPEC strain B171 harbors a second, larger plasmid that confers antibiotic resistance. To further understand the genetic diversity and dissemination of antibiotic resistance plasmids among EPEC strains, we describe the complete sequence of an antibiotic resistance plasmid from EPEC strain B171. The resistance plasmid, pB171_90, has a completed sequence length of 90,229 bp, a GC content of 54.55%, and carries protein-encoding genes involved in conjugative transfer, resistance to tetracycline ( tetA ), sulfonamides ( sulI ), and mercury, as well as several virulence-associated genes, including the transcriptional regulator hha and the putative calcium sequestration inhibitor ( csi ). In silico detection of the pB171_90 genes among 4,798 publicly available E. coli genome assemblies indicates that the unique genes of pB171_90 ( csi and traI ) are primarily restricted to genomes identified as EPEC or enterotoxigenic E. coli However, conserved regions of the pB171_90 plasmid containing genes involved in replication, stability, and antibiotic resistance were identified among diverse E. coli pathotypes. Interestingly, pB171_90 also exhibited significant similarity with a sequenced plasmid from Shigella dysenteriae type I. Our findings demonstrate the mosaic nature of EPEC antibiotic resistance plasmids and highlight the need for additional sequence-based characterization of antibiotic resistance plasmids harbored by pathogenic E. coli . Copyright © 2017 American Society for Microbiology.

Genetic and Physiological Studies of Bacillus Anthracis Related to Development of An Improved Vaccine

DTIC Science & Technology

1988-07-01

to replicate at all in B. anthracis. Such mutants al currently being tested as vehicles for transposon mutagenesis in B. anthracis. B. subtilis ( natto ...subtilis ( natto ) 3335 harbors a plasmid, pLS20, which encodes functions responsible for conjugal transfer of plasmids among genetically re- lated and...Cultures were grown for 16 hours in BHI broth supplemented with 0.1% glycerol, o- in LG broth for B. subtilis natto . After cell pellets were suspended in

Assembling the bacterial segrosome.

PubMed

Hayes, Finbarr; Barillà, Daniela

2006-05-01

Genome segregation in prokaryotes is a highly ordered process that integrates with DNA replication, cytokinesis and other fundamental facets of the bacterial cell cycle. The segrosome is the nucleoprotein complex that mediates DNA segregation in bacteria, its assembly and organization is best understood for plasmid partition. The recent elucidation of structures of the ParB plasmid segregation protein bound to centromeric DNA, and of the tertiary structures of other segregation proteins, are key milestones in the path to deciphering the molecular basis of bacterial DNA segregation.

Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.

PubMed

Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M

1985-10-30

A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.

Selfish restriction modification genes: resistance of a resident R/M plasmid to displacement by an incompatible plasmid mediated by host killing.

PubMed

Naito, Y; Naito, T; Kobayashi, I

1998-01-01

Previous work from this laboratory demonstrated that plasmids carrying a type II restriction-modification gene complex are not easily lost from their bacterial host because plasmid-free segregant cells are killed through chromosome cleavage. Here, we have followed the course of events that takes place when an Escherichia coli rec BC sbcA strain carrying a plasmid coding for the PaeR7I restriction-modification (R/M) gene complex is transformed by a plasmid with an identical origin of replication. The number of transformants that appeared was far fewer than with the restriction-minus (r-) control. Most of the transformants were very small. After prolonged incubation, the number and the size of the colonies increased, but this increase never attained the level of the r- control. Most of the transformed colonies retained the drug-resistance of the resident, r+ m+ plasmid. These results indicate that post-segregational host killing occurs when a plasmid bearing an R/M gene complex is displaced by an incompatible plasmid. Such cell killing eliminates the competitor plasmid along with the host and, thus, would allow persistence of the R/M plasmid in the neighboring, clonal host cells in nature. This phenomenon is reminiscent of mammalian apoptosis and other forms of altruistic cell death strategy against infection. This type of resistance to displacement was also studied in a wild type Escherichia coli strain that was normal for homologous recombination (rec+). A number of differences between the recBC sbcA strain and the rec+ strain were observed and these will be discussed.

Evolution and comparative genomics of pAQU-like conjugative plasmids in Vibrio species.

PubMed

Li, Ruichao; Ye, Lianwei; Wong, Marcus Ho Yin; Zheng, Zhiwei; Chan, Edward Wai Chi; Chen, Sheng

2017-09-01

To investigate a set of MDR conjugative plasmids found in Vibrio species and characterize the underlying evolution process. pAQU-type plasmids from Vibrio species were sequenced using both Illumina and PacBio platforms. Bioinformatics tools were utilized to analyse the typical MDR regions and core genes in the plasmids. The nine pAQU-type plasmids ranged from ∼160 to 206 kb in size and were found to harbour as many as 111 core genes encoding conjugative, replication and maintenance functions. Eight plasmids were found to carry a typical MDR region, which contained various accessory and resistance genes, including ISCR1-blaPER-1-bearing complex class 1 integrons, ISCR2-floR, ISCR2-tet(D)-tetR-ISCR2, qnrVC6, a Tn10-like structure and others associated with mobile elements. Comparison between a plasmid without resistance genes and different MDR plasmids showed that integration of different mobile elements, such as IS26, ISCR1, ISCR2, IS10 and IS6100, into the plasmid backbone was the key mechanism by which foreign resistance genes were acquired during the evolution process. This study identified pAQU-type plasmids as emerging MDR conjugative plasmids among important pathogens from different origins in Asia. These findings suggest that aquatic bacteria constitute a major reservoir of resistance genes, which may be transmissible to other human pathogens during food production and processing. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

PubMed

Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

2017-01-01

Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.

Biophysical characterization of an integrin-targeted lipopolyplex gene delivery vector.

PubMed

Mustapa, M Firouz Mohd; Bell, Paul C; Hurley, Christopher A; Nicol, Alastair; Guénin, Erwann; Sarkar, Supti; Writer, Michele J; Barker, Susie E; Wong, John B; Pilkington-Miksa, Michael A; Papahadjopoulos-Sternberg, Brigitte; Shamlou, Parviz Ayazi; Hailes, Helen C; Hart, Stephen L; Zicha, Daniel; Tabor, Alethea B

2007-11-13

Nonviral gene delivery vectors now show good therapeutic potential: however, detailed characterization of the composition and macromolecular organization of such particles remains a challenge. This paper describes experiments to elucidate the structure of a ternary, targeted, lipopolyplex synthetic vector, the LID complex. This consists of a lipid component, Lipofectin (L) (1:1 DOTMA:DOPE), plasmid DNA (D), and a dual-function, cationic peptide component (I) containing DNA condensation and integrin-targeting sequences. Fluorophore-labeled lipid, peptide, and DNA components were used to formulate the vector, and the stoichiometry of the particles was established by fluorescence correlation spectroscopy (FCS). The size of the complex was measured by FCS, and the sizes of LID, L, LD, and ID complexes were measured by dynamic light scattering (DLS). Fluorescence quenching experiments and freeze-fracture electron microscopy were then used to demonstrate the arrangement of the lipid, peptide, and DNA components within the complex. These experiments showed that the cationic portion of the peptide, I, interacts with the plasmid DNA, resulting in a tightly condensed DNA-peptide inner core; this is surrounded by a disordered lipid layer, from which the integrin-targeting sequence of the peptide partially protrudes.

CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) for Near-Perfect Selective Transformation

NASA Technical Reports Server (NTRS)

Rothschild, Lynn J.; Greenberg, Daniel T.; Takahashi, Jack R.; Thompson, Kirsten A.; Maheshwari, Akshay J.; Kent, Ryan E.; McCutcheon, Griffin; Shih, Joseph D.; Calvet, Charles; Devlin, Tyler D.;

Genetic transformation of the plant pathogens Phytophthora capsici and Phytophthora parasitica.

PubMed Central

Bailey, A M; Mena, G L; Herrera-Estrella, L

1991-01-01

Phytophthora capsici and P.parasitica were transformed to hygromycin B resistance using plasmids pCM54 and pHL1, which contain the bacterial hygromycin B phosphotransferase gene (hph) fused to promoter elements of the Ustilago maydis heat shock hsp70 gene. Enzymes Driselase and Novozyme 234 were used to generate protoplasts which were then transformed following exposure to plasmid DNA and polyethylene glycol 6000. Transformation frequencies of over 500 transformants per micrograms of DNA per 1 x 10(6) protoplasts were obtained. Plasmid pCM54 appears to be transmitted in Phytophthora spp. as an extra-chromosomal element through replication, as shown by Southern blot hybridization and by the loss of plasmid methylation. In addition, transformed strains retained their capacity of infecting Serrano pepper seedlings and Mc. Intosh apple fruits, the host plants for P.capsici and P.parasitica, respectively. Images PMID:1651483

Identification and Application of Plasmids Suitable for Transfer of Foreign DNA to Members of the Genus Gordonia

PubMed Central

Arenskötter, Matthias; Baumeister, Dirk; Kalscheuer, Rainer; Steinbüchel, Alexander

2003-01-01

Gene transfer systems for Gordonia polyisoprenivorans strains VH2 and Y2K based on electroporation and conjugation, respectively, were established. Several parameters were optimized, resulting in transformation efficiencies of >4 × 105 CFU/μg of plasmid DNA. In contrast to most previously described electroporation protocols, the highest efficiencies were obtained by applying a heat shock after the intrinsic electroporation. Under these conditions, transfer and autonomous replication of plasmid pNC9503 was also demonstrated to proceed in G. alkanivorans DSM44187, G. nitida DSM44499T, G. rubropertincta DSM43197T, G. rubropertincta DSM46038, and G. terrae DSM43249T. Conjugational plasmid DNA transfer to G. polyisoprenivorans resulted in transfer frequencies of up to 5 × 10−6 of the recipient cells. Recombinant strains capable of polyhydroxyalkanoate synthesis from alkanes were constructed. PMID:12902293

Facile Construction of Random Gene Mutagenesis Library for Directed Evolution Without the Use of Restriction Enzyme in Escherichia coli.

PubMed

Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival

2016-09-01

A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multiple point mutations in a shuttle vector propagated in human cells: evidence for an error-prone DNA polymerase activity.

PubMed

Seidman, M M; Bredberg, A; Seetharam, S; Kraemer, K H

1987-07-01

Mutagenesis was studied at the DNA-sequence level in human fibroblast and lymphoid cells by use of a shuttle vector plasmid, pZ189, containing a suppressor tRNA marker gene. In a series of experiments, 62 plasmids were recovered that had two to six base substitutions in the 160-base-pair marker gene. Approximately 20-30% of the mutant plasmids that were recovered after passing ultraviolet-treated pZ189 through a repair-proficient human fibroblast line contained these multiple mutations. In contrast, passage of ultraviolet-treated pZ189 through an excision-repair-deficient (xeroderma pigmentosum) line yielded only 2% multiple base substitution mutants. Introducing a single-strand nick in otherwise unmodified pZ189 adjacent to the marker, followed by passage through the xeroderma pigmentosum cells, resulted in about 66% multiple base substitution mutants. The multiple mutations were found in a 160-base-pair region containing the marker gene but were rarely found in an adjacent 170-base-pair region. Passing ultraviolet-treated or nicked pZ189 through a repair-proficient human B-cell line also yielded multiple base substitution mutations in 20-33% of the mutant plasmids. An explanation for these multiple mutations is that they were generated by an error-prone polymerase while filling gaps. These mutations share many of the properties displayed by mutations in the immunoglobulin hypervariable regions.

Application of methylation in improving plasmid transformation into Helicobacter pylori.

PubMed

Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

2018-05-23

Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

Development of nonhuman adenoviruses as vaccine vectors

PubMed Central

Bangari, Dinesh S.; Mittal, Suresh K.

2006-01-01

Human adenoviral (HAd) vectors have demonstrated great potential as vaccine vectors. Preclinical and clinical studies have demonstrated the feasibility of vector design, robust antigen expression and protective immunity using this system. However, clinical use of adenoviral vectors for vaccine purposes is anticipated to be limited by vector immunity that is either preexisting or develops rapidly following the first inoculation with adenoviral vectors. Vector immunity inactivates the vector particles and rapidly removes the transduced cells, thereby limiting the duration of transgene expression. Due to strong vector immunity, subsequent use of the same vector is usually less efficient. In order to circumvent this limitation, nonhuman adenoviral vectors have been proposed as alternative vectors. In addition to eluding HAd immunity, these vectors possess most of the attractive features of HAd vectors. Several replication-competent or replication-defective nonhuman adenoviral vectors have been developed and investigated for their potential as vaccine delivery vectors. Here, we review recent advances in the design and characterization of various nonhuman adenoviral vectors, and discuss their potential applications for human and animal vaccination. PMID:16297508

Transfer of Herb-Resistance Plasmid From Escherichia coli to Staphylococcus aureus Residing in the Human Urinary Tract

PubMed Central

Tong, Yan Qing; Xin, Bing; Zhu, Li

2014-01-01

Background: Plasmid transfer among bacteria provides a means for dissemination of resistance. Plasmid Analysis has made it possible to track plasmids that induce resistance in bacterial population. Objectives: To screen the presence of herb-resistance plasmid in Escherichia coli strains and determine the transferability of this resistance plasmid directly from E. coli to the Gram-positive, Staphylococcus aureus. Materials and Methods: The donor strain E. coli CP9 and recipient strain S. aureus RN450RF were isolated from UTI patients. E. coli CP9 was highly resistant to herbal concoction. Isolates of S. aureus RN450RF were fully susceptible. Total plasmid DNA was prepared and transferred into E. coli DH5α. Transconjugants were selected on agar plates containing serial dilutions of herbal concoction. Resistance plasmid was transferred to susceptible S. aureus RN450RFin triple replicas. The mating experiments were repeated twice. Results: The identified 45 kb herb-resistance plasmid could be transferred from E. coli CP9 isolates to E. coli DH5α. As a consequence E. coli DH5α transconjugant MIC increased from 0.0125 g/mL to 0.25 g/mL. The plasmid was easily transferred from E. coli CP9 strain to S. aureus RN450RF with a mean transfer rate of 1×10-2 transconjugants/recipient. The E. coli donor and the S. aureus RN450RF transconjugant contained a plasmid of the same size, which was absent in the recipient before mating. Susceptibility testing showed that the S. aureus RN450RF transconjugant was resistant to herbal concoction. Conclusions: E. coli herb-resistance plasmid can replicate and be expressed in S. aureus. PMID:25147679

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

PubMed

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

NYVAC vector modified by C7L viral gene insertion improves T cell immune responses and effectiveness against leishmaniasis.

PubMed

Sánchez-Sampedro, L; Mejías-Pérez, E; S Sorzano, Carlos Óscar; Nájera, J L; Esteban, M

2016-07-15

The NYVAC poxvirus vector is used as vaccine candidate for HIV and other diseases, although there is only limited experimental information on its immunogenicity and effectiveness for use against human pathogens. Here we defined the selective advantage of NYVAC vectors in a mouse model by comparing the immune responses and protection induced by vectors that express the LACK (Leishmania-activated C-kinase antigen), alone or with insertion of the viral host range gene C7L that allows the virus to replicate in human cells. Using DNA prime/virus boost protocols, we show that replication-competent NYVAC-LACK that expresses C7L (NYVAC-LACK-C7L) induced higher-magnitude polyfunctional CD8(+) and CD4(+) primary adaptive and effector memory T cell responses (IFNγ, TNFα, IL-2, CD107a) to LACK antigen than non-replicating NYVAC-LACK. Compared to NYVAC-LACK, the NYVAC-LACK-C7L-induced CD8(+) T cell population also showed higher proliferation when stimulated with LACK antigen. After a challenge by subcutaneous Leishmania major metacyclic promastigotes, NYVAC-LACK-C7L-vaccinated mouse groups showed greater protection than the NYVAC-LACK-vaccinated group. Our results indicate that the type and potency of immune responses induced by LACK-expressing NYVAC vectors is improved by insertion of the C7L gene, and that a replication-competent vector as a vaccine renders greater protection against a human pathogen than a non-replicating vector. Copyright © 2016 Elsevier B.V. All rights reserved.

Efficient and sustained IGF-1 expression in the adipose tissue-derived stem cells mediated via a lentiviral vector.

PubMed

Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao

2015-02-01

The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.

Therapeutic Benefits and Adverse Effects of Combined Proangiogenic Gene Therapy in Mouse Critical Leg Ischemia.

PubMed

Lebas, Benoît; Galley, Julien; Renaud-Gabardos, Edith; Pujol, Françoise; Lenfant, Françoise; Garmy-Susini, Barbara; Chaufour, Xavier; Prats, Anne-Catherine

2017-04-01

Critical leg ischemia (CLI) represents the ultimate stage of peripheral arterial disease. Despite current surgery advances, patients with CLI have limited therapeutic options. Therapeutic angiogenesis thus appears as a powerful approach, aiming to stimulate vessel formation by angiogenic molecules administration. In this context, combined gene therapy has been proved to be the most efficient. The present study aims to compare, in a preclinical mouse model, the therapeutic benefit of a combination of 2 angiogenic factors fibroblast growth factor 2 (FGF2) and Cyr61 using plasmid and viral vectors, able to generate short- or long-term transgene expression in the leg, respectively. Two therapeutic genes, FGF2 and Cyr61, were introduced into internal ribosome entry site-based expression vectors (FGFiCyr) allowing co-expression of the 2 transgenes. The proangiogenic plasmid pC-FGFiCyr was assessed by intramuscular administration followed by electrotransfer into ischemic legs. To generate long-term transgene expression, the FGFiCyr bicistronic cassette was introduced into an adenoassociated virus-derived vector (rAAV). The rAAV treatment was performed either before or immediately after surgery. Therapeutic effects were analyzed by laser Doppler imaging, clinical score, and angiography. The plasmid pC-FGFiCyr improved revascularization, reperfusion, and clinical score. Surprisingly, when AAV-FGFiCyr was injected 21 or 28 days before surgery, the proangiogenic rAAV was drastically deleterious on all measured parameters. In contrast, when administrated shortly after surgery, AAV-FGFiCyr generated therapeutic benefits, with a significantly better clinical score than after treatment with the plasmid. Therapeutic effects of the angiogenic combination FGF2-Cyr61 is observed with short-term transgene expression, but the treatment is significantly more efficient when a long-term expression viral vector is used. However, the rAAV-FGFiCyr generated therapeutic benefit only when injected in an ischemic leg, whereas the same dose of rAAV exhibited deleterious effects when administrated to healthy animals. These data may contribute to the understanding of the moderate success of proangiogenic treatments in CLI gene therapy clinical assays. Copyright © 2016 Elsevier Inc. All rights reserved.

pHg/pSILBAγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihpRNA – triggering in the mycorrhizal fungus Laccaria bicolor

PubMed Central

Kemppainen, Minna J.; Pardo, Alejandro G.

2010-01-01

Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319

The RepA_N replicons of Gram-positive bacteria: a family of broadly distributed but narrow host range plasmids.

PubMed

Weaver, Keith E; Kwong, Stephen M; Firth, Neville; Francia, Maria Victoria

2009-03-01

The pheromone-responsive conjugative plasmids of Enterococcus faecalis and the multiresistance plasmids pSK1 and pSK41 of Staphylococcus aureus are among the best studied plasmids native to Gram-positive bacteria. Although these plasmids seem largely restricted to their native hosts, protein sequence comparison of their replication initiator proteins indicates that they are clearly related. Homology searches indicate that these replicons are representatives of a large family of plasmids and a few phage that are widespread among the low G+C Gram-positive bacteria. We propose to name this family the RepA_N family of replicons after the annotated conserved domain that the initiator protein contains. Detailed sequence comparisons indicate that the initiator protein phylogeny is largely congruent with that of the host, suggesting that the replicons have evolved along with their current hosts and that intergeneric transfer has been rare. However, related proteins were identified on chromosomal regions bearing characteristics indicative of ICE elements, and the phylogeny of these proteins displayed evidence of more frequent intergeneric transfer. Comparison of stability determinants associated with the RepA_N replicons suggests that they have a modular evolution as has been observed in other plasmid families.

Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks.

PubMed

Chen, Yuan-Jyue; Rao, Sundipta D; Seelig, Georg

2015-11-25

DNA nanotechnology requires large amounts of highly pure DNA as an engineering material. Plasmid DNA could meet this need since it is replicated with high fidelity, is readily amplified through bacterial culture and can be stored indefinitely in the form of bacterial glycerol stocks. However, the double-stranded nature of plasmid DNA has so far hindered its efficient use for construction of DNA nanostructures or devices that typically contain single-stranded or branched domains. In recent work, it was found that nicked double stranded DNA (ndsDNA) strand displacement gates could be sourced from plasmid DNA. The following is a protocol that details how these ndsDNA gates can be efficiently encoded in plasmids and can be derived from the plasmids through a small number of enzymatic processing steps. Also given is a protocol for testing ndsDNA gates using fluorescence kinetics measurements. NdsDNA gates can be used to implement arbitrary chemical reaction networks (CRNs) and thus provide a pathway towards the use of the CRN formalism as a prescriptive molecular programming language. To demonstrate this technology, a multi-step reaction cascade with catalytic kinetics is constructed. Further it is shown that plasmid-derived components perform better than identical components assembled from synthetic DNA.