[Construction of plant expression plasmid of chimera SBR-CT delta A1].
Mai, Sui; Ling, Junqi
2003-08-01
The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.
Survey of Navy Funded Marine Mammal Research and Studies FY 00-01
2001-05-10
protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to
Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.
2010-01-01
Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425
Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †
Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.
2008-01-01
The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685
In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.
Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A
2008-01-01
Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.
Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo
2015-01-01
To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.
Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae
Lacks, Sanford A.
1990-01-01
Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.
Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae
Lacks, S.A.
1990-10-02
Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1991-03-26
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1987-08-28
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.
2013-01-01
Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834
Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs
2013-08-20
Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.
Bacteriophage-based vectors for site-specific insertion of DNA in the chromosome of Corynebacteria.
Oram, Mark; Woolston, Joelle E; Jacobson, Andrew D; Holmes, Randall K; Oram, Diana M
2007-04-15
In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as beta. beta-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally encoded genes, is regulated by the DtxR protein in response to Fe(2+) levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the beta-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae DeltadtxR strain. Additionally, strains of beta-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for beta, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species.
Gritz, L; Davies, J
1983-11-01
The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.
2008-06-01
verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus
Cell Cycle Dependent Regulation of Human Progesterone Receptor in Breast Cancer
2004-10-01
wt PR or S400A PR (0.01-1.0 [tg each), CDK2 (ljig), and PRE-2x-TATA-luc reporter plasmid (lig) along with Renilla plasmid (10ng) as a control for...8 hours prior to treatment. Cells were collected following treatment with 10 nM R5020 or ETOH vehicle control for 18 hrs. Luciferase and renilla ...reporter, a renilla reporter construct as a transfection control, either wt PR-B or S400A mutant PR-B, and control parental vector or a vector encoding an
Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.
Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E
2009-11-20
In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.
Bacteriophage-based Vectors for Site-specific Insertion of DNA in the Chromosome of Corynebacteria
Oram, Mark; Woolston, Joelle E.; Jacobson, Andrew D.; Holmes, Randall K.; Oram, Diana M.
2007-01-01
In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as β. β-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally-encoded genes, is regulated by the DtxR protein in response to Fe2+ levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the β-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae ΔdtxR strain. Additionally, strains of β-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for β, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species. PMID:17275217
Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem
2017-12-16
To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).
Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus
Rodriguez, Michelle D.; Paul, Zubin; Wood, Charles E.; Rice, Kelly C.; Triplett, Eric W.
2017-01-01
Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus. These three reporter plasmids are available through BEI Resources. PMID:29312199
Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus.
Rodriguez, Michelle D; Paul, Zubin; Wood, Charles E; Rice, Kelly C; Triplett, Eric W
2017-01-01
Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus . These three reporter plasmids are available through BEI Resources.
Tagliavia, Marcello; Cuttitta, Angela
2016-01-01
High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.
Introduction to the ultrasound targeted microbubble destruction technique.
Walton, Chad B; Anderson, Cynthia D; Boulay, Rachel; Shohet, Ralph V
2011-06-12
In UTMD, bioactive molecules, such as negatively charged plasmid DNA vectors encoding a gene of interest, are added to the cationic shells of lipid microbubble contrast agents. In mice these vector-carrying microbubbles can be administered intravenously or directly to the left ventricle of the heart. In larger animals they can also be infused through an intracoronary catheter. The subsequent delivery from the circulation to a target organ occurs by acoustic cavitation at a resonant frequency of the microbubbles. It seems likely that the mechanical energy generated by the microbubble destruction results in transient pore formation in or between the endothelial cells of the microvasculature of the targeted region. As a result of this sonoporation effect, the transfection efficiency into and across the endothelial cells is enhanced, and transgene-encoding vectors are deposited into the surrounding tissue. Plasmid DNA remaining in the circulation is rapidly degraded by nucleases in the blood, which further reduces the likelihood of delivery to non-sonicated tissues and leads to highly specific target-organ transfection.
Shchelkunov, S N; Taranov, O S; Tregubchak, T V; Maksyutov, R A; Silkov, A N; Nesterov, A E; Sennikov, S V
2016-07-01
Wistar rats with collagen-induced arthritis were intramuscularly injected with the recombinant plasmid pcDNA/sTNF-BD encoding the sequence of the TNF-binding protein domain of variola virus CrmB protein (VARV sTNF-BD) or the pcDNA3.1 vector. Quantitative analysis showed that the histopathological changes in the hind-limb joints of rats were most severe in the animals injected with pcDNA3.1 and much less severe in the group of rats injected with pcDNA/sTNF-BD, which indicates that gene therapy of rheumatoid arthritis is promising in the case of local administration of plasmids governing the synthesis of VARV immunomodulatory proteins.
Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein
2017-01-01
Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.
Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi
2012-01-01
TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.
Schwartz, Matthew L; Jorgensen, Erik M
2016-04-01
In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.
Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.
2014-01-01
The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917
Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja
2017-01-01
Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.
Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V
2007-06-15
A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.
Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk
2013-01-01
As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077
[Construction and expression of recombinant human serum albumin-EPO fusion protein].
Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing
2011-05-01
OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.
Kyostio-Moore, Sirkka; Berthelette, Patricia; Cornell, Cathleen Sookdeo; Nambiar, Bindu; Figueiredo, Monica Dias
2018-05-01
OBJECTIVE To evaluate gene transfer of recombinant adeno-associated viral (rAAV) vectors with AAV2 or AAV5 capsid and encoding hyaluronic acid (HA) synthase-2 (HAS2) into joints of healthy dogs. ANIMALS 22 purpose-bred Beagles. PROCEDURES Plasmid expression cassettes encoding canine HAS2 (cHAS2) were assessed in vitro for concentration and molecular size of secreted HA. Thereafter, rAAV2-cHAS2 vectors at 3 concentrations and rAAV5-cHAS2 vectors at 1 concentration were each administered intra-articularly into the left stifle joint of 5 dogs; 2 dogs received PBS solution instead. Synovial fluid HA concentration and serum and synovial fluid titers of neutralizing antibodies against AAV capsids were measured at various points. Dogs were euthanized 28 days after treatment, and cartilage and synovium samples were collected for vector DNA and mRNA quantification and histologic examination. RESULTS Cell transfection with plasmids encoding cHAS2 resulted in an increase in production and secretion of HA in vitro. In vivo, the rAAV5-cHAS2 vector yielded uniform genome transfer and cHAS2 expression in collected synovium and cartilage samples. In contrast, rAAV2-cHAS2 vectors were detected inconsistently in synovium and cartilage samples and failed to produce clear dose-related responses. Histologic examination revealed minimal synovial inflammation in joints injected with rAAV vectors. Neutralizing antibodies against AAV capsids were detected in serum and synovial fluid samples from all vector-treated dogs. CONCLUSIONS AND CLINICAL RELEVANCE rAAV5-mediated transfer of the gene for cHAS2 into healthy joints of dogs by intra-articular injection appeared safe and resulted in vector-derived cHAS2 production by synoviocytes and chondrocytes. Whether this treatment may increase HA production by synoviocytes and chondrocytes in osteoarthritic joints remains to be determined.
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J
1983-11-30
The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.
Yao, Qingxia; Qian, Ping; Huang, Qinfeng; Cao, Yi; Chen, Huanchun
2008-01-01
The P12A3C gene from FMDV (serotype O) encoding the capsid precursor protein, and the highly immunogenic gene FHG, which encodes multiple epitopes of FMDV capsid proteins, were inserted into eukaryotic expression vectors to compare different candidate genetically engineered vaccines for foot-and-mouth disease (FMD). A modified live pseudorabies virus (MLPRV) was also used to deliver P12A3C. Guinea pigs were inoculated intramuscularly with the candidate vaccines to compare the ability to elicit immunity of the DNA vector and a live viral vector. An indirect enzyme-linked immunosorbent assay (iELISA), virus-neutralization test and lymphoproliferation assay were used to detect antibody and cellular responses. The group immunized with P12A3C delivered by MLPRV produced significantly greater antibody and cellular responses indicating that MLPRV has a greater ability to mediate exogenous gene delivery than the plasmid DNA vector. Comparison of the immune responses induced by P12A3C and FHG, which were both mediated by DNA plasmids, showed that FHG and P12A3C elicited similar cellular responses, while P12A3C induced higher antibody levels, suggesting that P12A3C is a more powerful immunogen than FHG. In challenge experiments, guinea pigs vaccinated with P12A3C delivered by MLPRV were protected fully from FMDV challenge, whereas guinea pigs vaccinated with P12A3C or FHG delivered by DNA plasmid were only protected partially. This study provides a basis for future construction of a genetically engineered vaccine for FMDV.
Adeno-associated virus vectors can be efficiently produced without helper virus.
Matsushita, T; Elliger, S; Elliger, C; Podsakoff, G; Villarreal, L; Kurtzman, G J; Iwaki, Y; Colosi, P
1998-07-01
The purpose of this work was to develop an efficient method for the production of adeno-associated virus (AAV) vectors in the absence of helper virus. The adenovirus regions that mediate AAV vector replication were identified and assembled into a helper plasmid. These included the VA, E2A and E4 regions. When this helper plasmid was cotransfected into 293 cells, along with plasmids encoding the AAV vector, and rep and cap genes, AAV vector was produced as efficiently as when using adenovirus infection as a source of help. CMV-driven constructs expressing the E4orf6 and the 72-M(r), E2A proteins were able to functionally replace the E4 and E2A regions, respectively. Therefore the minimum set of genes required to produce AAV helper activity equivalent to that provided by adenovirus infection consists of, or is a subset of, the following genes: the E4orf6 gene, the 72-M(r), E2A protein gene, the VA RNA genes and the E1 region. AAV vector preparations made with adenovirus and by the helper virus-free method were essentially indistinguishable with respect to particle density, particle to infectivity ratio, capsimer ratio and efficiency of muscle transduction in vivo. Only AAV vector preparations made by the helper virus-free method were not reactive with anti-adenovirus sera.
Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M
2003-05-01
Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.
Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel
1991-01-01
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.
CrpP Is a Novel Ciprofloxacin-Modifying Enzyme Encoded by the Pseudomonas aeruginosa pUM505 Plasmid.
Chávez-Jacobo, Víctor M; Hernández-Ramírez, Karen C; Romo-Rodríguez, Pamela; Pérez-Gallardo, Rocío Viridiana; Campos-García, Jesús; Gutiérrez-Corona, J Félix; García-Merinos, Juan Pablo; Meza-Carmen, Víctor; Silva-Sánchez, Jesús; Ramírez-Díaz, Martha I
2018-06-01
The pUM505 plasmid, isolated from a clinical Pseudomonas aeruginosa isolate, confers resistance to ciprofloxacin (CIP) when transferred into the standard P. aeruginosa strain PAO1. CIP is an antibiotic of the quinolone family that is used to treat P. aeruginosa infections. In silico analysis, performed to identify CIP resistance genes, revealed that the 65-amino-acid product encoded by the orf131 gene in pUM505 displays 40% amino acid identity to the Mycobacterium smegmatis aminoglycoside phosphotransferase (an enzyme that phosphorylates and inactivates aminoglycoside antibiotics). We cloned orf131 (renamed crpP , for c iprofloxacin r esistance p rotein, p lasmid encoded) into the pUCP20 shuttle vector. The resulting recombinant plasmid, pUC- crpP , conferred resistance to CIP on Escherichia coli strain J53-3, suggesting that this gene encodes a protein involved in CIP resistance. Using coupled enzymatic analysis, we determined that the activity of CrpP on CIP is ATP dependent, while little activity against norfloxacin was detected, suggesting that CIP may undergo phosphorylation. Using a recombinant His-tagged CrpP protein and liquid chromatography-tandem mass spectrometry, we also showed that CIP was phosphorylated prior to its degradation. Thus, our findings demonstrate that CrpP, encoded on the pUM505 plasmid, represents a new mechanism of CIP resistance in P. aeruginosa , which involves phosphorylation of the antibiotic. Copyright © 2018 American Society for Microbiology.
Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.
2007-01-01
While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779
Emmerling, Verena V; Pegel, Antje; Milian, Ernest G; Venereo-Sanchez, Alina; Kunz, Marion; Wegele, Jessica; Kamen, Amine A; Kochanek, Stefan; Hoerer, Markus
2016-02-01
Viral vectors used for gene and oncolytic therapy belong to the most promising biological products for future therapeutics. Clinical success of recombinant adeno-associated virus (rAAV) based therapies raises considerable demand for viral vectors, which cannot be met by current manufacturing strategies. Addressing existing bottlenecks, we improved a plasmid system termed rep/cap split packaging and designed a minimal plasmid encoding adenoviral helper function. Plasmid modifications led to a 12-fold increase in rAAV vector titers compared to the widely used pDG standard system. Evaluation of different production approaches revealed superiority of processes based on anchorage- and serum-dependent HEK293T cells, exhibiting about 15-fold higher specific and volumetric productivity compared to well-established suspension cells cultivated in serum-free medium. As for most other viral vectors, classical stirred-tank bioreactor production is thus still not capable of providing drug product of sufficient amount. We show that manufacturing strategies employing classical surface-providing culture systems can be successfully transferred to the new fully-controlled, single-use bioreactor system Integrity(TM) iCELLis(TM) . In summary, we demonstrate substantial bioprocess optimizations leading to more efficient and scalable production processes suggesting a promising way for flexible large-scale rAAV manufacturing. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gutiérrez, Jorge; Criado, Raquel; Martín, María; Herranz, Carmen; Cintas, Luis M.; Hernández, Pablo E.
2005-01-01
The gene encoding mature enterocin P (EntP), an antimicrobial peptide from Enterococcus faecium P13, was cloned into the pPICZαA expression vector to generate plasmid pJC31. This plasmid was integrated into the genome of P. pastoris X-33, and EntP was heterologously secreted from the recombinant P. pastoris X-33t1 derivative at a higher production and antagonistic activity than from E. faecium P13. PMID:15980385
Yin and Yang of Heparanase in Breast Cancer Initiation
2014-09-01
significance of heparanase in cancer metastasis and angiogenesis. Int J Biochem Cell Biol 38: 2018 -2039, 2006 2. Gotte M, Yip GW: Heparanase...Methods Plasmids. The C-terminus of the HPR1 gene (encoding amino acid 413-543) was cloned into a RCAS vector digested with a PacI and Cla I. An...contained a cleaved Pac I site. This fragment was directly ligated into Not I/PacI- digested RCAS-C. The following plasmid designated as RCAS-8C was used
The abundant extrachromosomal DNA content of the Spiroplasma citri GII3-3X genome
Saillard, Colette; Carle, Patricia; Duret-Nurbel, Sybille; Henri, Raphaël; Killiny, Nabil; Carrère, Sébastien; Gouzy, Jérome; Bové, Joseph-Marie; Renaudin, Joël; Foissac, Xavier
2008-01-01
Background Spiroplama citri, the causal agent of citrus stubborn disease, is a bacterium of the class Mollicutes and is transmitted by phloem-feeding leafhopper vectors. In order to characterize candidate genes potentially involved in spiroplasma transmission and pathogenicity, the genome of S. citri strain GII3-3X is currently being deciphered. Results Assembling 20,000 sequencing reads generated seven circular contigs, none of which fit the 1.8 Mb chromosome map or carried chromosomal markers. These contigs correspond to seven plasmids: pSci1 to pSci6, with sizes ranging from 12.9 to 35.3 kbp and pSciA of 7.8 kbp. Plasmids pSci were detected as multiple copies in strain GII3-3X. Plasmid copy numbers of pSci1-6, as deduced from sequencing coverage, were estimated at 10 to 14 copies per spiroplasma cell, representing 1.6 Mb of extrachromosomal DNA. Genes encoding proteins of the TrsE-TraE, Mob, TraD-TraG, and Soj-ParA protein families were predicted in most of the pSci sequences, in addition to members of 14 protein families of unknown function. Plasmid pSci6 encodes protein P32, a marker of insect transmissibility. Plasmids pSci1-5 code for eight different S. citri adhesion-related proteins (ScARPs) that are homologous to the previously described protein P89 and the S. kunkelii SkARP1. Conserved signal peptides and C-terminal transmembrane alpha helices were predicted in all ScARPs. The predicted surface-exposed N-terminal region possesses the following elements: (i) 6 to 8 repeats of 39 to 42 amino acids each (sarpin repeats), (ii) a central conserved region of 330 amino acids followed by (iii) a more variable domain of about 110 amino acids. The C-terminus, predicted to be cytoplasmic, consists of a 27 amino acid stretch enriched in arginine and lysine (KR) and an optional 23 amino acid stretch enriched in lysine, aspartate and glutamate (KDE). Plasmids pSci mainly present a linear increase of cumulative GC skew except in regions presenting conserved hairpin structures. Conclusion The genome of S. citri GII3-3X is characterized by abundant extrachromosomal elements. The pSci plasmids could not only be vertically inherited but also horizontally transmitted, as they encode proteins usually involved in DNA element partitioning and cell to cell DNA transfer. Because plasmids pSci1-5 encode surface proteins of the ScARP family and pSci6 was recently shown to confer insect transmissibility, diversity and abundance of S. citri plasmids may essentially aid the rapid adaptation of S. citri to more efficient transmission by different insect vectors and to various plant hosts. PMID:18442384
Synthesis and evaluation of cationic nanomicelles for in vitro and in vivo gene delivery
NASA Astrophysics Data System (ADS)
Mandke, Rhishikesh Subhash
The goal of proposed study was to contribute towards the development of a nano size, high efficiency and low toxicity non-viral polymeric vector for gene delivery in vitro and in vivo. A series of fatty acid grafted low-molecular-weight chitosan (N-acyl LMWCs) were synthesized, purified and characterized for their physicochemical properties using various analytical techniques such as infrared spectroscopy, elemental analysis and dynamic light scattering. The formulation parameters including pH, sonication duration, and filtration altered the physicochemical characteristics of N-acyl LMWC nanomicelles. The acyl chain length and degree of unsaturation in fatty acids also had an impact on the physicochemical properties and the transfection efficiency of nanomicelles. N-acyl LMWC nanomicelles showed efficient in vitro transfection as visualized and quantified using a reporter plasmid (encoding green fluorescent protein), and therapeutic plasmids (encoding for interleukin-4 and interleukin-10), respectively. The in vitro transfection efficiencies of N-acyl LMWCs with 18:1 and 18:2 grafts (oleic and linoleic acids) were comparable with FuGENERTM HD (marketed non-viral vector) but were ˜8-fold and 35-fold higher as compared to LMWC and naked DNA, respectively. The in vivo transfection efficiency of N-acyl LMWC to deliver plasmids individually encoding IL-4 and IL-10 as well as a bicistronic plasmid encoding both IL-4 and IL-10 was studied in a multiple, low-dose streptozotocin induced diabetic mouse model. The transfection efficiency of pDNA/N-acyl LMWC polyplexes injected via intramuscular route showed significant improvement (p<0.05) over passive (naked DNA) or positive (FuGENE HD) controls. Additionally, a sustained and efficient expression of IL-4 and IL-10 was observed, accompanied by a reduction in interferon-gamma (INF-gamma), and tumor necrosis factor-alpha (TNF-alpha) levels. The pancreas of pDNA/N-acyl LMWC polyplex treated animals exhibited protection from streptozotocin-induced insulitis and the delivery systems were biocompatible. Histological studies revealed that there were no signs of chronic inflammation at the injection site. The bicistronic plasmid exhibited significantly (p<0.05) greater expression of IL-4 and IL-10, and demonstrated the feasibility of bicistronic IL-4/IL-10 plasmid/N-acyl LMWC nanomicelles-based polyplexes as an efficient and biocompatible system for the prevention of autoimmune diabetes.
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Broad-spectrum anti-tumor and anti-metastatic DNA vaccine based on p62-encoding vector
Sherman, Michael Y.; Gabai, Vladimir; Kiselev, Oleg; Komissarov, Andrey; Grudinin, Mikhail; Shartukova, Maria; Romanovskaya-Romanko, Ekaterina A.; Kudryavets, Yuri; Bezdenezhnykh, Natalya; Lykhova, Oleksandra; Semesyuk, Nadiia; Concetti, Antonio; Tsyb, Anatoly; Filimonova, Marina; Makarchuk, Victoria; Yakubovsky, Raisa; Chursov, Andrey; Shcherbinina, Vita; Shneider, Alexander
2013-01-01
Autophagy plays an important role in neoplastic transformation of cells and in resistance of cancer cells to radio- and chemotherapy. p62 (SQSTM1) is a key component of autophagic machinery which is also involved in signal transduction. Although recent empirical observations demonstrated that p62 is overexpressed in variety of human tumors, a mechanism of p62 overexpression is not known. Here we report that the transformation of normal human mammary epithelial cells with diverse oncogenes (RAS, PIK3CA and Her2) causes marked accumulation of p62. Based on this result, we hypothesized that p62 may be a feasible candidate to be an anti-cancer DNA vaccine. Here we performed a preclinical study of a novel DNA vaccine encoding p62. Intramuscularly administered p62-encoding plasmid induced anti-p62 antibodies and exhibited strong antitumor activity in four models of allogeneic mouse tumors – B16 melanoma, Lewis lung carcinoma (LLC), S37 sarcoma, and Ca755 breast carcinoma. In mice challenged with Ca755 cells, p62 treatment had dual effect: inhibited tumor growth in some mice and prolonged life in those mice which developed tumor size similar to control. P62-encoding plasmid has demonstrated its potency both as a preventive and therapeutic vaccine. Importantly, p62 vaccination drastically suppressed metastasis formation: in B16 melanoma where tumor cells where injected intravenously, and in LLC and S37 sarcoma with spontaneous metastasis. Overall, we conclude that a p62-encoding vector(s) constitute(s) a novel, effective broad-spectrum antitumor and anti-metastatic vaccine feasible for further development and clinical trials. PMID:24121124
AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.
Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A
2017-06-01
Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.
Novel sull binary vectors enable an inexpensive foliar selection method in Arabidopsis
USDA-ARS?s Scientific Manuscript database
Sulfonamide resistance is conferred by the sulI gene found on many Enterobacteriaceae R plasmids and Tn21 type transposons. The sulI gene encodes a sulfonamide insensitive dihydropteroate synthase enzyme required for folate biosynthesis. Transformation of tobacco, potato or Arabidopsis using sulI as...
Plasmid-dependent methylotrophy in thermotolerant Bacillus methanolicus.
Brautaset, Trygve; Jakobsen M, Øyvind M; Flickinger, Michael C; Valla, Svein; Ellingsen, Trond E
2004-03-01
Bacillus methanolicus can efficiently utilize methanol as a sole carbon source and has an optimum growth temperature of 50 degrees C. With the exception of mannitol, no sugars have been reported to support rapid growth of this organism, which is classified as a restrictive methylotroph. Here we describe the DNA sequence and characterization of a 19,167-bp circular plasmid, designated pBM19, isolated from B. methanolicus MGA3. Sequence analysis of pBM19 demonstrated the presence of the methanol dehydrogenase gene, mdh, which is crucial for methanol consumption in this bacterium. In addition, five genes (pfk, encoding phosphofructokinase; rpe, encoding ribulose-5-phosphate 3-epimerase; tkt, encoding transketolase; glpX, encoding fructose-1,6-bisphosphatase; and fba, encoding fructose-1,6-bisphosphate aldolase) with deduced roles in methanol assimilation via the ribulose monophosphate pathway are encoded by pBM19. A shuttle vector, pTB1.9, harboring the pBM19 minimal replicon (repB and ori) was constructed and used to transform MGA3. Analysis of the resulting recombinant strain demonstrated that it was cured of pBM19 and was not able to grow on methanol. A pTB1.9 derivative harboring the complete mdh gene could not restore growth on methanol when it was introduced into the pBM19-cured strain, suggesting that additional pBM19 genes are required for consumption of this carbon source. Screening of 13 thermotolerant B. methanolicus wild-type strains showed that they all harbor plasmids similar to pBM19, and this is the first report describing plasmid-linked methylotrophy in any microorganism. Our findings should have an effect on future genetic manipulations of this organism, and they contribute to a new understanding of the biology of methylotrophs.
Plasmid-Dependent Methylotrophy in Thermotolerant Bacillus methanolicus
Brautaset, Trygve; Jakobsen, Øyvind M.; Flickinger, Michael C.; Valla, Svein; Ellingsen, Trond E.
2004-01-01
Bacillus methanolicus can efficiently utilize methanol as a sole carbon source and has an optimum growth temperature of 50°C. With the exception of mannitol, no sugars have been reported to support rapid growth of this organism, which is classified as a restrictive methylotroph. Here we describe the DNA sequence and characterization of a 19,167-bp circular plasmid, designated pBM19, isolated from B. methanolicus MGA3. Sequence analysis of pBM19 demonstrated the presence of the methanol dehydrogenase gene, mdh, which is crucial for methanol consumption in this bacterium. In addition, five genes (pfk, encoding phosphofructokinase; rpe, encoding ribulose-5-phosphate 3-epimerase; tkt, encoding transketolase; glpX, encoding fructose-1,6-bisphosphatase; and fba, encoding fructose-1,6-bisphosphate aldolase) with deduced roles in methanol assimilation via the ribulose monophosphate pathway are encoded by pBM19. A shuttle vector, pTB1.9, harboring the pBM19 minimal replicon (repB and ori) was constructed and used to transform MGA3. Analysis of the resulting recombinant strain demonstrated that it was cured of pBM19 and was not able to grow on methanol. A pTB1.9 derivative harboring the complete mdh gene could not restore growth on methanol when it was introduced into the pBM19-cured strain, suggesting that additional pBM19 genes are required for consumption of this carbon source. Screening of 13 thermotolerant B. methanolicus wild-type strains showed that they all harbor plasmids similar to pBM19, and this is the first report describing plasmid-linked methylotrophy in any microorganism. Our findings should have an effect on future genetic manipulations of this organism, and they contribute to a new understanding of the biology of methylotrophs. PMID:14973041
Maj, Anna; Dziewit, Lukasz; Czarnecki, Jakub; Wlodarczyk, Miroslawa; Baj, Jadwiga; Skrzypczyk, Grazyna; Giersz, Dorota; Bartosik, Dariusz
2013-01-01
Plasmids are components of many bacterial genomes. They enable the spread of a large pool of genetic information via lateral gene transfer. Many bacterial strains contain mega-sized replicons and these are particularly common in Alphaproteobacteria. Considerably less is known about smaller alphaproteobacterial plasmids. We analyzed the genomes of 14 such plasmids residing in 4 multireplicon carotenoid-producing strains of the genus Paracoccus (Alphaproteobacteria): P. aestuarii DSM 19484, P. haeundaensis LG P-21903, P. marcusii DSM 11574 and P. marcusii OS22. Comparative analyses revealed mosaic structures of the plasmids and recombinational shuffling of diverse genetic modules involved in (i) plasmid replication, (ii) stabilization (including toxin-antitoxin systems of the relBE/parDE, tad-ata, higBA, mazEF and toxBA families) and (iii) mobilization for conjugal transfer (encoding relaxases of the MobQ, MobP or MobV families). A common feature of the majority of the plasmids is the presence of AT-rich sequence islets (located downstream of exc1-like genes) containing genes, whose homologs are conserved in the chromosomes of many bacteria (encoding e.g. RelA/SpoT, SMC-like proteins and a retron-type reverse transcriptase). The results of this study have provided insight into the diversity and plasticity of plasmids of Paracoccus spp., and of the entire Alphaproteobacteria. Some of the identified plasmids contain replication systems not described previously in this class of bacteria. The composition of the plasmid genomes revealed frequent transfer of chromosomal genes into plasmids, which significantly enriches the pool of mobile DNA that can participate in lateral transfer. Many strains of Paracoccus spp. have great biotechnological potential, and the plasmid vectors constructed in this study will facilitate genetic studies of these bacteria. PMID:24260361
Cloning-independent plasmid construction for genetic studies in streptococci
Xie, Zhoujie; Qi, Fengxia; Merritt, Justin
2013-01-01
Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in E. coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5×103 – 2×105 CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli – Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. PMID:23673081
Cloning-independent plasmid construction for genetic studies in streptococci.
Xie, Zhoujie; Qi, Fengxia; Merritt, Justin
2013-08-01
Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in Escherichia coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5 × 10³ to 2 × 10⁵ CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli-Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. Copyright © 2013 Elsevier B.V. All rights reserved.
Yoneyama, T; Akatsuka, T; Miyamura, T
1988-08-01
The large BglII fragment (2.8 kilobases) of hepatitis B virus DNA including the transcription unit for the hepatitis B surface antigen (HBsAg) was inserted into a bovine papillomavirus vector containing the neomycin resistance gene. The recombinant DNA was transfected into mouse C127 cells. A stable transformed cell line (MS128) secreting a large amount of 22 nm HBsAg particles containing pre-S2 protein was established. The secreted HBsAg particles had the receptor for polymerized human serum albumin. Immunoprecipitation and Western blot analyses showed that HBsAg particles consisted of two major proteins of 22K and 26K encoded by the S gene and a minor protein of 35K encoded by the pre-S2 and S genes. Southern blot analysis revealed that the transfected plasmid was integrated into the host chromosomal DNA and that most of the plasmid sequences were present. These results suggest that the stable expression of the HBsAg in MS128 cells is related to the integrated state of the recombinant DNA.
Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J
2007-10-01
Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude of these responses was approximately one-half of that observed after intramuscular immunization with pgp120(h)(E). M. smegmatis and other nonpathogenic mycobacteria are promising candidate vectors for DNA vaccine delivery.
Top, E M; Maltseva, O V; Forney, L J
1996-01-01
The modular pathway for the metabolism of 2,4-dichlorophenoxyacetic acid (2,4-D) encoded on plasmid pJP4 of Alcaligenes eutrophus JMP134 appears to be an example in which two genes, tfdA and tfdB, have been recruited during the evolution of a catabolic pathway. The products of these genes act to convert 2,4-D to a chloro-substituted catechol that can be further metabolized by enzymes of a modified ortho-cleavage pathway encoded by tfdCDEF. Given that modified ortho-cleavage pathways are comparatively common and widely distributed among bacteria, we sought to determine if microbial populations in soil carry tfdA on plasmid vectors that lack tfdCDEF or tfdB. To capture such plasmids from soil populations, we used a recipient strain of A. eutrophus that was rifampin resistant and carried a derivative of plasmid pJP4 (called pBH501aE) in which the tfdA had been deleted. Upon mating with mixed bacterial populations from soil treated with 2,4-D, transconjugants that were resistant to rifampin yet able to grow on 2,4-D were obtained. Among the transconjugants obtained were clones that contained a ca. 75-kb plasmid, pEMT8. Bacterial hosts that carried this plasmid in addition to pBH501aE metabolized 2,4-D, whereas strains with only pEMT8 did not. Southern hybridization showed that pEMT8 encoded a gene with a low level of similarity to the tfdA gene from plasmid pJP4. Using oligonucleotide primers based on known tfdA sequences, we amplified a 330-bp fragment of the gene and determined that it was 77% similar to the tfdA gene of plasmid pJP4 and 94% similar to tfdA from Burkholderia sp. strain RASC. Plasmid pEMT8 lacked genes that exhibited significant levels of homology to tfdB and tfdCDEF. Moreover, cell extracts from A. eutrophus(pEMT8) cultures did not exhibit TfdB, TfdC, TfdD, and TfdE activities, whereas cell extracts from A. eutrophus(pEMT8)(pBH501aE) cultures did. These data suggest that pEMT8 encodes only tfdA and that this gene can effectively complement the tfdA deletion mutation of pBH501aE. PMID:8779586
A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1.
Fayed, Bahgat; Younger, Ellen; Taylor, Gabrielle; Smith, Margaret C M
2014-05-30
Integrating vectors based on the int/attP loci of temperate phages are convenient and used widely, particularly for cloning genes in Streptomyces spp. We have constructed and tested a novel integrating vector based on g27, encoding integrase, and attP site from the phage, SV1. This plasmid, pBF3 integrates efficiently in S. coelicolor and S. lividans but surprisingly fails to generate stable integrants in S. venezuelae, the natural host for phage SV1. pBF3 promises to be a useful addition to the range of integrating vectors currently available for Streptomyces molecular genetics.
Dong, Bo; Feng, Jing; Lin, Hai; Li, Lanxiang; Su, Dingding; Tu, Di; Zhu, Weijuan; Yang, Qing; Ren, Xiaofeng
2013-11-19
Porcine circovirus type 2 (PCV2) is associated with many kinds of diseases including postweaning multisystemic wasting syndrome (PMWS). It affects the immune system of swine and causes huge epidemic losses every year. In our previous study, we provided evidence that DNA plasmid bearing porcine IL-15 (pVAX-pIL-15) might serve as an immune enhancer for DNA plasmid encoding porcine reproductive and respiratory syndrome virus GP5 gene. In this study, PCV2 open reading frame (ORF)2 gene was cloned into the eukaryotic expression vector pVAX, resulting in the plasmid pVAX-PCV2-ORF2. Transient expression of the plasmid in BHK-21 cells could be detected using immunofluorescence assay. Experimental mice were divided into 5 groups and immunized with PBS, pVAX, pVAX-pIL-15, pVAX-PCV2-ORF2 or pVAX-pIL-15 plus pVAX-PCV2-ORF2. The results showed that the mice co-inoculated with pVAX-PCV2-ORF2 plus pVAX-pIL-15 had higher humoral and cellular immune responses than the others. In addition, DNA plasmid bearing PCV2 ORF2 gene had a protective effect against challenge with PCV2 in mice which could be promoted with the utilization of pIL-15. Copyright © 2013 Elsevier Ltd. All rights reserved.
Keeney, Michael; van den Beucken, Jeroen J J P; van der Kraan, Peter M; Jansen, John A; Pandit, Abhay
2010-04-01
Collagen/calcium phosphate scaffolds have been used for bone reconstruction due to their inherent similarities to the bone extracellular matrix. Calcium phosphate alone has also been used as a non-viral vector for gene delivery. The aim of this study was to determine the capability of a collagen/calcium phosphate scaffold to deliver naked plasmid DNA and mediate transfection in vivo. The second goal of the study was to deliver a plasmid encoding vascular endothelial growth factor(165) (pVEGF(165)) to promote angiogenesis, and hence bone formation, in a mouse intra-femoral model. The delivery of naked plasmid DNA resulted in a 7.6-fold increase in mRNA levels of beta-Galactosidase compared to the delivery of plasmid DNA complexed with a partially degraded PAMAM dendrimer (dPAMAM) in a subcutaneous murine model. When implanted in a muirne intra-femoral model, the delivery of pVEGF(165) resulted in a 2-fold increase in bone volume at the defect site relative to control scaffolds without pVEGF(165). It was concluded that a collagen/calcium phosphate scaffold can mediate transfection without the use of additional transfection vectors and can promote bone formation in a mouse model via the delivery of pVEGF(165). 2009 Elsevier Ltd. All rights reserved.
Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon
2015-01-01
A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882
Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.
Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi
2018-01-26
Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.
Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng
2008-01-01
To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stols, L.; Donnelly, M.I.; Kulkarni, G.
The malic enzyme gene of Ascaris suum was cloned into the vector pTRC99a in two forms encoding alternative amino-termini. The resulting plasmids, pMEA1 and pMEA2, were introduced into Escherichia coli NZN111, a strain that is unable to grow fermentatively because of inactivation of the genes encoding pyruvate dissimilation. Induction of pMEA1, which encodes the native animoterminus, gave better overexpression of malic enzyme, approx 12-fold compared to uninduced cells. Under the appropriate culture conditions, expression of malic enzyme allowed the fermentative dissimilation of glucose by NZN111. The major fermentation product formed in induced cultures was succinic acid.
Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa
2017-03-01
In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.
Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.
2004-01-01
We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966
Obaldia, Nicanor; Stockelman, Michael G; Otero, William; Cockrill, Jennifer A; Ganeshan, Harini; Abot, Esteban N; Zhang, Jianfeng; Limbach, Keith; Charoenvit, Yupin; Doolan, Denise L; Tang, De-Chu C; Richie, Thomas L
2017-04-01
Malaria is caused by parasites of the genus Plasmodium , which are transmitted to humans by the bites of Anopheles mosquitoes. After the elimination of Plasmodium falciparum , it is predicted that Plasmodium vivax will remain an important cause of morbidity and mortality outside Africa, stressing the importance of developing a vaccine against P. vivax malaria. In this study, we assessed the immunogenicity and protective efficacy of two P. vivax antigens, apical membrane antigen 1 (AMA1) and the 42-kDa C-terminal fragment of merozoite surface protein 1 (MSP1 42 ) in a plasmid recombinant DNA prime/adenoviral (Ad) vector boost regimen in Aotus monkeys. Groups of 4 to 5 monkeys were immunized with plasmid DNA alone, Ad alone, prime/boost regimens with each antigen, prime/boost regimens with both antigens, and empty vector controls and then subjected to blood-stage challenge. The heterologous immunization regimen with the antigen pair was more protective than either antigen alone or both antigens delivered with a single vaccine platform, on the basis of their ability to induce the longest prepatent period and the longest time to the peak level of parasitemia, the lowest peak and mean levels of parasitemia, the smallest area under the parasitemia curve, and the highest self-cure rate. Overall, prechallenge MSP1 42 antibody titers strongly correlated with a decreased parasite burden. Nevertheless, a significant proportion of immunized animals developed anemia. In conclusion, the P. vivax plasmid DNA/Ad serotype 5 vaccine encoding blood-stage parasite antigens AMA1 and MSP1 42 in a heterologous prime/boost immunization regimen provided significant protection against blood-stage challenge in Aotus monkeys, indicating the suitability of these antigens and this regimen for further development. Copyright © 2017 American Society for Microbiology.
Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc
2017-07-25
Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.
A novel bicistronic sensor vector for detecting caspase-3 activation.
Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah
2015-01-01
Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.
Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong
2015-01-01
A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bayne, M.L.; Cascieri, M.A.; Kelder, B.
1987-05-01
A synthetic gene encoding human insulin-like growth factor I (hIGF-I) was assembled and inserted into an expression vector containing the cytomegalovirus immediate early (CMV-IE) transcriptional regulatory region and portions of the bovine growth hormone gene. The recombinant plasmid encodes a 97 amino acid fusion protein containing the first 27 amino acids of the bovine growth hormone precursor and the 70 amino acids of hIGF-I. This plasmid, when transiently introduced into cultured mouse fibroblasts, directs synthesis of the fusion protein, subsequent proteolytic removal of the bovine growth hormone signal peptide, and secretion of hIGF-I into the culture medium. Conditioned medium frommore » transfected cells inhibits binding of /sup 125/I-labeled IGF-I to type I IGF receptors on human placental membranes and to acid-stable human serum carrier proteins. The recombinant hIGF-I produced is biologically active, as monitored by the stimulation of DNA synthesis in vascular smooth muscle cells.« less
Scarless genome editing and stable inducible expression vectors for Geobacter sulfurreducens
Chan, Chi Ho; Levar, Caleb E.; Zacharoff, Lori; ...
2015-08-07
Metal reduction by members of the Geobacteraceae is encoded by multiple gene clusters, and the study of extracellular electron transfer often requires biofilm development on surfaces. Genetic tools that utilize polar antibiotic cassette insertions limit mutant construction and complementation. In addition, unstable plasmids create metabolic burdens that slow growth, and the presence of antibiotics such as kanamycin can interfere with the rate and extent of Geobacter biofilm growth. We report here genetic system improvements for the model anaerobic metal-reducing bacterium Geobacter sulfurreducens. A motile strain of G. sulfurreducens was constructed by precise removal of a transposon interrupting the fgrM flagellarmore » regulator gene using SacB/sucrose counterselection, and Fe(III) citrate reduction was eliminated by deletion of the gene encoding the inner membrane cytochrome imcH. We also show that RK2-based plasmids were maintained in G. sulfurreducens for over 15 generations in the absence of antibiotic selection in contrast to unstable pBBR1 plasmids. Therefore, we engineered a series of new RK2 vectors containing native constitutive Geobacter promoters, and modified one of these promoters for VanR-dependent induction by the small aromatic carboxylic acid vanillate. Inducible plasmids fully complemented Δ imcH mutants for Fe(III) reduction, Mn(IV) oxide reduction, and growth on poised electrodes. A real-time, high-throughput Fe(III) citrate reduction assay is described that can screen numerous G. sulfurreducens strain constructs simultaneously and shows the sensitivity of imcH expression by the vanillate system. Lastly, these tools will enable more sophisticated genetic studies in G. sulfurreducens without polar insertion effects or need for multiple antibiotics.« less
Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J
1999-03-05
DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.
Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin
2010-02-01
This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.
Yamazaki, Tatsuya; Nagashima, Maria; Ninomiya, Daisuke; Ainai, Akira; Fujimoto, Akira; Ichimonji, Isao; Takagi, Hidekazu; Morita, Naoko; Murotani, Kenta; Hasegawa, Hideki; Chiba, Joe; Akashi-Takamura, Sachiko
2018-01-01
The influenza virus causes annual epidemics and occasional pandemics and is thus a major public health problem. Development of vaccines and antiviral drugs is essential for controlling influenza virus infection. We previously demonstrated the use of vectored immune-prophylaxis against influenza virus infection. We generated a plasmid encoding neutralizing IgG monoclonal antibodies (mAbs) against A/PR/8/34 influenza virus (IAV) hemagglutinin (HA). We then performed electroporation of the plasmid encoding neutralizing mAbs (EP) in mice muscles and succeeded in inducing the expression of neutralizing antibodies in mouse serum. This therapy has a prophylactic effect against lethal IAV infection in mice. In this study, we established a new method of passive immunotherapy after IAV infection. We performed hydrodynamic injection of the plasmid encoding neutralizing mAbs (HD) involving rapid injection of a large volume of plasmid-DNA solution into mice via the tail vein. HD could induce neutralizing antibodies in the serum and in several mucosal tissues more rapidly than in EP. We also showed that a single HD completely protected the mice even after infection with a lethal dose of IAV. We also established other isotypes of anti-HA antibody (IgA, IgM, IgD, and IgE) and showed that like anti-HA IgG, anti-HA IgA was also effective at combating upper respiratory tract IAV infection. Passive immunotherapy with HD could thus provide a new therapeutic strategy targeting influenza virus infection. PMID:29416543
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feyereisen-Koener, J.M.
Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.
Shang, Yonglei; Tesar, Devin; Hötzel, Isidro
2015-10-01
A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D
1982-01-01
An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675
Novel RepA-MCM proteins encoded in plasmids pTAU4, pORA1 and pTIK4 from Sulfolobus neozealandicus
Greve, Bo; Jensen, Susanne; Phan, Hoa; Brügger, Kim; Zillig, Wolfram; She, Qunxin; Garrett, Roger A.
2005-01-01
Three plasmids isolated from the crenarchaeal thermoacidophile Sulfolobus neozealandicus were characterized. Plasmids pTAU4 (7,192 bp), pORA1 (9,689 bp) and pTIK4 (13,638 bp) show unusual properties that distinguish them from previously characterized cryptic plasmids of the genus Sulfolobus. Plasmids pORA1 and pTIK4 encode RepA proteins, only the former of which carries the novel polymerase–primase domain of other known Sulfolobus plasmids. Plasmid pTAU4 encodes a mini-chromosome maintenance protein homolog and no RepA protein; the implications for DNA replication are considered. Plasmid pORA1 is the first Sulfolobus plasmid to be characterized that does not encode the otherwise highly conserved DNA-binding PlrA protein. Another encoded protein appears to be specific for the New Zealand plasmids. The three plasmids should provide useful model systems for functional studies of these important crenarchaeal proteins. PMID:15876565
Khanam, Saima; Rajendra, Pilankatta; Khanna, Navin; Swaminathan, Sathyamangalam
2007-02-15
Dengue is a public health problem of global significance for which there is neither an effective antiviral therapy nor a preventive vaccine. It is a mosquito-borne viral disease, caused by dengue (DEN) viruses, which are members of the Flaviviridae family. There are four closely related serotypes, DEN-1, DEN-2, DEN-3 and DEN-4, each of which is capable of causing disease. As immunity to any one serotype can potentially sensitize an individual to severe disease during exposure to a heterologous serotype, the general consensus is that an effective vaccine should be tetravalent, that is, it must be capable of affording protection against all four serotypes. The current strategy of creating tetravalent vaccine formulations by mixing together four monovalent live attenuated vaccine viruses has revealed the phenomenon of viral interference leading to the manifestation of immune responses biased towards a single serotype. This work stems from the emergence of (i) the DEN virus envelope (E) domain III (EDIII) as the most important region of the molecule from a vaccine perspective and (ii) the adenovirus (Ad) as a promising vaccine vector platform. We describe the construction of a recombinant, replication-defective Ad (rAd) vector encoding a chimeric antigen made of in-frame linked EDIIIs of DEN virus serotypes 2 and 4. Using this rAd vector, in conjunction with a plasmid vector encoding the same chimeric bivalent antigen, in a prime-boost strategy, we show that it is possible to elicit equipotent neutralizing and T cell responses specific to both DEN serotypes 2 and 4. Our data support the hypothesis that a DEN vaccine targeting more than one serotype may be based on a single DNA-based vector to circumvent viral interference. This work lays the foundation for developing a single Ad vector encoding EDIIIs of all four DEN serotypes to evoke a balanced immune response against each one of them. Thus, this work has implications for the development of safe and effective tetravalent dengue vaccines.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908
Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.
Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika
2013-01-01
Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.
Copy number variability of expression plasmids determined by cell sorting and Droplet Digital PCR.
Jahn, Michael; Vorpahl, Carsten; Hübschmann, Thomas; Harms, Hauke; Müller, Susann
2016-12-19
Plasmids are widely used for molecular cloning or production of proteins in laboratory and industrial settings. Constant modification has brought forth countless plasmid vectors whose characteristics in terms of average plasmid copy number (PCN) and stability are rarely known. The crucial factor determining the PCN is the replication system; most replication systems in use today belong to a small number of different classes and are available through repositories like the Standard European Vector Architecture (SEVA). In this study, the PCN was determined in a set of seven SEVA-based expression plasmids only differing in the replication system. The average PCN for all constructs was determined by Droplet Digital PCR and ranged between 2 and 40 per chromosome in the host organism Escherichia coli. Furthermore, a plasmid-encoded EGFP reporter protein served as a means to assess variability in reporter gene expression on the single cell level. Only cells with one type of plasmid (RSF1010 replication system) showed a high degree of heterogeneity with a clear bimodal distribution of EGFP intensity while the others showed a normal distribution. The heterogeneous RSF1010-carrying cell population and one normally distributed population (ColE1 replication system) were further analyzed by sorting cells of sub-populations selected according to EGFP intensity. For both plasmids, low and highly fluorescent sub-populations showed a remarkable difference in PCN, ranging from 9.2 to 123.4 for ColE1 and from 0.5 to 11.8 for RSF1010, respectively. The average PCN determined here for a set of standardized plasmids was generally at the lower end of previously reported ranges and not related to the degree of heterogeneity. Further characterization of a heterogeneous and a homogeneous population demonstrated considerable differences in the PCN of sub-populations. We therefore present direct molecular evidence that the average PCN does not represent the true number of plasmid molecules in individual cells.
Tsurushita, N; Fu, H; Warren, C
1996-06-12
New phage display vectors for in vivo recombination of immunoglobulin (Ig) heavy (VH) and light (VL) chain variable genes, to make single-chain Fv fragments (scFv), were constructed. The VH and VL genes of monoclonal antibody (mAb) EP-5C7, which binds to both human E- and P-selectin, were cloned into a pUC19-derived plasmid vector, pCW93, and a pACYC184-derived phagemid vector, pCW99, respectively. Upon induction of Cre recombinase (phage P1 recombinase), the VH and VL genes were efficiently recombined into the same plasmid via the two loxP sites (phage P1 recombination sites), one located downstream from a VH gene in pCW93 and another upstream from a VL gene in pCW99. In the resulting phagemid, the loxP sequence also encodes a polypeptide linker connecting the VH and VL domains to form a scFv of EP-5C7. Whether expressed on the phage surface or as a soluble form, the EP-5C7 scFv showed specific binding to human E- and P-selectin. This phagemid vector system provides a way to recombine VH and VL gene libraries efficiently in vivo to make extremely large Ig combinatorial libraries.
Zheng, Fengrong; Sun, Xiuqin; Wu, Xing'an; Liu, Hongzhan; Li, Jiye; Wu, Suqi; Zhang, Jinxing
2011-01-01
Here, we report the construction of a vaccine against lymphocystis disease virus (LCDV) using nucleic acid vaccination technology. A fragment of the major capsid protein encoding gene from an LCDV isolated from China (LCDV-cn) was cloned into an eukaryotic expression vector pEGFP-N2, yielding a recombinant plasmid pEGFP-N2-LCDV-cn0.6 kb. This plasmid was immediately expressed after liposomal transfer into the Japanese flounder embryo cell line. The recombinant plasmid was inoculated into Japanese flounder via two routes (intramuscular injection and hypodermic injection) at three doses (0.1, 5, and 15 μg), and then T-lymphopoiesis in different tissues and antibodies raised against LCDV were evaluated. The results indicated that this recombinant plasmid induced unique humoral or cell-mediated immune responses depending on the inoculation route and conferred immune protection. Furthermore, the humoral immune responses and protective effects were significantly increased at higher vaccine doses via the two injection routes. Plasmid pEGFP-N2-LCDV0.6 kb is therefore a promising vaccine candidate against LCDV in Japanese flounder. PMID:21789044
Zhang, Huang-Ge; Xie, Jinfu; Dmitriev, Igor; Kashentseva, Elena; Curiel, David T; Hsu, Hui-Chen; Mountz, John D
2002-12-01
Production of large quantities of recombinant adeno-associated virus (AAV) is difficult and not cost-effective. To overcome this problem, we have explored the feasibility of creating a recombinant AAV encoding a 6xHis tag on the VP3 capsid protein. We generated a plasmid vector containing a six-His (6xHis)-tagged AAV VP3. A second plasmid vector was generated that contained the full-length AAV capsid capable of producing VP1 and VP2, but not VP3 due to a mutation at position 2809 that encodes the start codon for VP3. These plasmids, necessary for production of AAV, were transfected into 293 cells to generate a 6xHis-tagged VP3mutant recombinant AAV. The 6xHis-tagged VP3 did not affect the formation of AAV virus, and the physical properties of the 6xHis-modified AAV were equivalent to those of wild-type particles. The 6xHis-tagged AAV did not affect the production titer of recombinant AAV and could be used to purify the recombinant AAV using an Ni-nitrilotriacetic acid column. Addition of the 6xHis tag did not alter the viral tropism compared to wild-type AAV. These observations demonstrate the feasibility of producing high-titer AAV containing a 6xHis-tagged AAV VP3 capsid protein and to utilize the 6xHis-tagged VP3 capsid to achieve high-affinity purification of this recombinant AAV.
Reverse Genetics for Mammalian Orthoreovirus.
Stuart, Johnasha D; Phillips, Matthew B; Boehme, Karl W
2017-01-01
Reverse genetics allows introduction of specific alterations into a viral genome. Studies performed with mutant viruses generated using reverse genetics approaches have contributed immeasurably to our understanding of viral replication and pathogenesis, and also have led to development of novel vaccines and virus-based vectors. Here, we describe the reverse genetics system that allows for production and recovery of mammalian orthoreovirus, a double-stranded (ds) RNA virus, from plasmids that encode the viral genome.
Jia, Fan; Gampala, Srinivas S.L.; Mittal, Amandeep; Luo, Qingjun; Rock, Christopher D.
2009-01-01
The 14,200 available full length Arabidopsis thaliana cDNAs in the Universal Plasmid System (UPS) donor vector pUNI51 should be applied broadly and efficiently to leverage a “functional map-space” of homologous plant genes. We have engineered Cre-lox UPS host acceptor vectors (pCR701- 705) with N-terminal epitope tags in frame with the loxH site and downstream from the maize Ubiquitin promoter for use in transient protoplast expression assays and particle bombardment transformation of monocots. As an example of the utility of these vectors, we recombined them with several Arabidopsis cDNAs encoding Ser/Thr protein phosphatase type 2C (PP2Cs) known from genetic studies or predicted by hierarchical clustering meta-analysis to be involved in ABA and stress responses. Our functional results in Zea mays mesophyll protoplasts on ABA-inducible expression effects on the Late Embryogenesis Abundant promoter ProEm:GUS reporter were consistent with predictions and resulted in identification of novel activities of some PP2Cs. Deployment of these vectors can facilitate functional genomics and proteomics and identification of novel gene activities. PMID:19499346
Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival
2016-09-01
A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Burbank, Lindsey P; Stenger, Drake C
2016-08-01
The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacterial genetics but there are only a limited number of plasmid vectors available that replicate in X. fastidiosa, and even fewer that are retained without antibiotic selection. Two plasmids are described here that show stable replication in X. fastidiosa and are effective for gene complementation both in vitro and in planta. Plasmid maintenance is facilitated by incorporation of the PemI/PemK plasmid addiction system, consisting of PemK, an endoribonuclease toxin, and its cognate antitoxin, PemI. Vector pXf20pemIK utilizes a native X. fastidiosa replication origin as well as a high-copy-number pUC origin for propagation in Escherichia coli cloning strains. Broad-host-range vector pBBR5pemIK is a medium- to low-copy-number plasmid based on the pBBR1 backbone. Both plasmids are maintained for extended periods of time in the absence of antibiotic selection, as well as up to 14 weeks in grapevine, without affecting bacterial fitness. These plasmids present an alternative to traditional complementation and expression vectors which rely on antibiotic selection for plasmid retention.
Zhou, Jingxiang; Xue, Jiangdong; Wang, Qiuju; Zhu, Xia; Li, Xingwei; Lv, Wenliang; Zhang, Dongming
2014-06-01
In order to construct the recombinant plasmid of pIRES-ORF81, the nucleic acid isolated from Koi herpes virus-CJ (KHV-CJ) strains was used as a template to insert the ORF81 gene fragments amplified by PCR into the pIRES-neo, a kind of eukaryotic expression vector. Using Western blotting analysis, it was verified that ORF81 gene protein can be expressed correctly by pIRES-ORF81, after MFC cells were transfected. The recombinant plasmid pIRES-ORF81 was set into three immunization dose gradients: 1, 10, and 50 μg/carp. Empty plasmid group, PBS group, and blank control group were set simultaneously. Giving intramuscular injections to healthy carps with an average body mass of 246 ± 20 g, indirect ELISA was used to regularly determine antibody levels after three times immunization injection. Neutralizing antibodies were detected by neutralization assay. The results of inoculation tests showed that the pIRES-ORF81 recombinant plasmid can induce the production of carp-specific antibodies. The differences of immune effect between the three different doses of immune gradients were not significant (P > 0.05), but they can induce the production of neutralizing antibodies. After 25 d of inoculation, carp mortality of pIRES-neo empty vector treatment groups was 85%, while the carp mortality of eukaryotic expression recombinant plasmid pIRES-ORF81 injected with three different doses of immune gradients was 20, 17.5, and 12.5%, respectively. Differences in comparison to the control group were highly significant (P < 0.01). However, histopathological section of immunohistochemistry organization revealed no significant changes. It demonstrated that the DNA vaccine pIRES-ORF81 constructed in the experiment displayed a good protective effect against KHV, which had the potential to industrial applications.
Novel “Superspreader” Bacteriophages Promote Horizontal Gene Transfer by Transformation
Bliskovsky, Valery V.; Malagon, Francisco; Baker, James D.; Prince, Jeffrey S.; Klaus, James S.; Adhya, Sankar L.
2017-01-01
ABSTRACT Bacteriophages infect an estimated 1023 to 1025 bacterial cells each second, many of which carry physiologically relevant plasmids (e.g., those encoding antibiotic resistance). However, even though phage-plasmid interactions occur on a massive scale and have potentially significant evolutionary, ecological, and biomedical implications, plasmid fate upon phage infection and lysis has not been investigated to date. Here we show that a subset of the natural lytic phage population, which we dub “superspreaders,” releases substantial amounts of intact, transformable plasmid DNA upon lysis, thereby promoting horizontal gene transfer by transformation. Two novel Escherichia coli phage superspreaders, SUSP1 and SUSP2, liberated four evolutionarily distinct plasmids with equal efficiency, including two close relatives of prominent antibiotic resistance vectors in natural environments. SUSP2 also mediated the extensive lateral transfer of antibiotic resistance in unbiased communities of soil bacteria from Maryland and Wyoming. Furthermore, the addition of SUSP2 to cocultures of kanamycin-resistant E. coli and kanamycin-sensitive Bacillus sp. bacteria resulted in roughly 1,000-fold more kanamycin-resistant Bacillus sp. bacteria than arose in phage-free controls. Unlike many other lytic phages, neither SUSP1 nor SUSP2 encodes homologs to known hydrolytic endonucleases, suggesting a simple potential mechanism underlying the superspreading phenotype. Consistent with this model, the deletion of endonuclease IV and the nucleoid-disrupting protein ndd from coliphage T4, a phage known to extensively degrade chromosomal DNA, significantly increased its ability to promote plasmid transformation. Taken together, our results suggest that phage superspreaders may play key roles in microbial evolution and ecology but should be avoided in phage therapy and other medical applications. PMID:28096488
Mealey, Robert H.; Leib, Steven R.; Littke, Matt H.; Wagner, Bettina; Horohov, David W.; McGuire, Travis C.
2009-01-01
Effective DNA-based vaccines against lentiviruses will likely induce CTL against conserved viral proteins. Equine infectious anemia virus (EIAV) infects horses worldwide, and serves as a useful model for lentiviral immune control. Although attenuated live EIAV vaccines have induced protective immune responses, DNA-based vaccines have not. In particular, DNA-based vaccines have had limited success in inducing CTL responses against intracellular pathogens in the horse. We hypothesized that priming with a codon-optimized plasmid encoding EIAV Gag p15/p26 with co-administration of a plasmid encoding an equine IL-2/IgG fusion protein as a molecular adjuvant, followed by boosting with a vaccinia vector expressing Gag p15/p26, would induce protective Gag-specific CTL responses. Although the regimen induced Gag-specific CTL in four of seven vaccinated horses, CTL were not detected until after the vaccinia boost, and protective effects were not observed in EIAV challenged vaccinates. Unexpectedly, vaccinates had significantly higher viral loads and more severe clinical disease, associated with the presence of vaccine-induced CTL. It was concluded that 1.) further optimization of the timing and route of DNA immunization was needed for efficient CTL priming in vivo, 2.) co-administration of the IL-2/IgG plasmid did not enhance CTL priming by the Gag p15/p26 plasmid, 3.) vaccinia vectors are useful for lentivirus-specific CTL induction in the horse, 4.) Gag-specific CTL alone are either insufficient or a more robust Gag-specific CTL response is needed to limit EIAV viremia and clinical disease, and 5.) CTL-inducing vaccines lacking envelope immunogens can result in lentiviral disease enhancement. Although the mechanisms for enhancement associated with this vaccine regimen remain to be elucidated, these results have important implications for development of lentivirus T cell vaccines. PMID:19368787
Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H
2010-06-01
To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.
Nawwab Al-Deen, F M; Selomulya, C; Kong, Y Y; Xiang, S D; Ma, C; Coppel, R L; Plebanski, M
2014-02-01
Dendritic cells (DC) targeting vaccines require high efficiency for uptake, followed by DC activation and maturation. We used magnetic vectors comprising polyethylenimine (PEI)-coated superparamagnetic iron oxide nanoparticles, with hyaluronic acid (HA) of different molecular weights (<10 and 900 kDa) to reduce cytotoxicity and to facilitate endocytosis of particles into DCs via specific surface receptors. DNA encoding Plasmodium yoelii merozoite surface protein 1-19 and a plasmid encoding yellow fluorescent gene were added to the magnetic complexes with various % charge ratios of HA: PEI. The presence of magnetic fields significantly enhanced DC transfection and maturation. Vectors containing a high-molecular-weight HA with 100% charge ratio of HA: PEI yielded a better transfection efficiency than others. This phenomenon was attributed to their longer molecular chains and higher mucoadhesive properties aiding DNA condensation and stability. Insights gained should improve the design of more effective DNA vaccine delivery systems.
An improved ternary vector system for Agrobacterium-mediated rapid maize transformation.
Anand, Ajith; Bass, Steven H; Wu, Emily; Wang, Ning; McBride, Kevin E; Annaluru, Narayana; Miller, Michael; Hua, Mo; Jones, Todd J
2018-05-01
A simple and versatile ternary vector system that utilizes improved accessory plasmids for rapid maize transformation is described. This system facilitates high-throughput vector construction and plant transformation. The super binary plasmid pSB1 is a mainstay of maize transformation. However, the large size of the base vector makes it challenging to clone, the process of co-integration is cumbersome and inefficient, and some Agrobacterium strains are known to give rise to spontaneous mutants resistant to tetracycline. These limitations present substantial barriers to high throughput vector construction. Here we describe a smaller, simpler and versatile ternary vector system for maize transformation that utilizes improved accessory plasmids requiring no co-integration step. In addition, the newly described accessory plasmids have restored virulence genes found to be defective in pSB1, as well as added virulence genes. Testing of different configurations of the accessory plasmids in combination with T-DNA binary vector as ternary vectors nearly doubles both the raw transformation frequency and the number of transformation events of usable quality in difficult-to-transform maize inbreds. The newly described ternary vectors enabled the development of a rapid maize transformation method for elite inbreds. This vector system facilitated screening different origins of replication on the accessory plasmid and T-DNA vector, and four combinations were identified that have high (86-103%) raw transformation frequency in an elite maize inbred.
Phagemid vectors for phage display: properties, characteristics and construction.
Qi, Huan; Lu, Haiqin; Qiu, Hua-Ji; Petrenko, Valery; Liu, Aihua
2012-03-30
Phagemids are filamentous-phage-derived vectors containing the replication origin of a plasmid. Phagemids usually encode no or only one kind of coat proteins. Other structural and functional proteins necessary to accomplish the life cycle of phagemid are provided by the helper phage. In addition, other elements such as molecular tags and selective markers are introduced into the phagemids to facilitate the subsequent operations, such as gene manipulation and protein purification. This review summarizes the elements of the phagemids and their corresponding functions. Finally, the possible trends and future direction to improve the characteristics of the phagemids are highlighted. Copyright © 2012 Elsevier Ltd. All rights reserved.
Frazer, LilyAnn Novak; O'Keefe, Raymond T
2007-09-01
The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.
Desomer, Jan; Dhaese, Patrick; Montagu, Marc Van
1990-01-01
The analysis of the virulence determinants of phytopathogenic Rhodococcus fascians has been hampered by the lack of a system for introducing exogenous DNA. We investigated the possibility of genetic transformation of R. fascians by high-voltage electroporation of intact bacterial cells in the presence of plasmid DNA. Electrotransformation in R. fascians D188 resulted in transformation frequencies ranging from 105/μg of DNA to 107/μg of DNA, depending on the DNA concentration. The effects of different electrical parameters and composition of electroporation medium on transformation efficiency are presented. By this transformation method, a cloning vector (pRF28) for R. fascians based on an indigenous 160-kilobase (chloramphenicol and cadmium resistance-encoding) plasmid pRF2 from strain NCPPB 1675 was developed. The origin of replication and the chloramphenicol resistance gene on pRF28 were used to construct cloning vectors that are capable of replication in R. fascians and Escherichia coli. The electroporation method presented was efficient enough to allow detection of the rare integration of replication-deficient pRF28 derivatives in the R. fascians D188 genome via either homologous or illegitimate recombination. Images PMID:16348290
Ultrashort laser pulse cell manipulation using nano- and micro- materials
NASA Astrophysics Data System (ADS)
Schomaker, Markus; Killian, Doreen; Willenbrock, Saskia; Diebold, Eric; Mazur, Eric; Bintig, Willem; Ngezahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo; Junghanß, Christian; Lubatschowski, Holger; Heisterkamp, Alexander
2010-08-01
The delivery of extra cellular molecules into cells is essential for cell manipulation. For this purpose genetic materials (DNA/RNA) or proteins have to overcome the impermeable cell membrane. To increase the delivery efficiency and cell viability of common methods different nano- and micro material based approaches were applied. To manipulate the cells, the membrane is in contact with the biocompatible material. Due to a field enhancement of the laser light at the material and the resulting effect the cell membrane gets perforated and extracellular molecules can diffuse into the cytoplasm. Membrane impermeable dyes, fluorescent labelled siRNA, as well as plasmid vectors encoded for GFP expression were used as an indicator for successful perforation or transfection, respectively. Dependent on the used material, perforation efficiencies over 90 % with a cell viability of about 80 % can be achieved. Additionally, we observed similar efficiencies for siRNA transfection. Due to the larger molecule size and the essential transport of the DNA into the nucleus cells are more difficult to transfect with GFP plasmid vectors. Proof of principle experiments show promising and adequate efficiencies by applying micro materials for plasmid vector transfection. For all methods a weakly focused fs laser beam is used to enable a high manipulation throughput for adherent and suspension cells. Furthermore, with these alternative optical manipulation methods it is possible to perforate the membrane of sensitive cell types such as primary and stem cells with a high viability.
Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J
2008-03-01
Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.
Kirkness, Ewen F; Haas, Brian J; Sun, Weilin; Braig, Henk R; Perotti, M Alejandra; Clark, John M; Lee, Si Hyeock; Robertson, Hugh M; Kennedy, Ryan C; Elhaik, Eran; Gerlach, Daniel; Kriventseva, Evgenia V; Elsik, Christine G; Graur, Dan; Hill, Catherine A; Veenstra, Jan A; Walenz, Brian; Tubío, José Manuel C; Ribeiro, José M C; Rozas, Julio; Johnston, J Spencer; Reese, Justin T; Popadic, Aleksandar; Tojo, Marta; Raoult, Didier; Reed, David L; Tomoyasu, Yoshinori; Kraus, Emily; Krause, Emily; Mittapalli, Omprakash; Margam, Venu M; Li, Hong-Mei; Meyer, Jason M; Johnson, Reed M; Romero-Severson, Jeanne; Vanzee, Janice Pagel; Alvarez-Ponce, David; Vieira, Filipe G; Aguadé, Montserrat; Guirao-Rico, Sara; Anzola, Juan M; Yoon, Kyong S; Strycharz, Joseph P; Unger, Maria F; Christley, Scott; Lobo, Neil F; Seufferheld, Manfredo J; Wang, Naikuan; Dasch, Gregory A; Struchiner, Claudio J; Madey, Greg; Hannick, Linda I; Bidwell, Shelby; Joardar, Vinita; Caler, Elisabet; Shao, Renfu; Barker, Stephen C; Cameron, Stephen; Bruggner, Robert V; Regier, Allison; Johnson, Justin; Viswanathan, Lakshmi; Utterback, Terry R; Sutton, Granger G; Lawson, Daniel; Waterhouse, Robert M; Venter, J Craig; Strausberg, Robert L; Berenbaum, May R; Collins, Frank H; Zdobnov, Evgeny M; Pittendrigh, Barry R
2010-07-06
As an obligatory parasite of humans, the body louse (Pediculus humanus humanus) is an important vector for human diseases, including epidemic typhus, relapsing fever, and trench fever. Here, we present genome sequences of the body louse and its primary bacterial endosymbiont Candidatus Riesia pediculicola. The body louse has the smallest known insect genome, spanning 108 Mb. Despite its status as an obligate parasite, it retains a remarkably complete basal insect repertoire of 10,773 protein-coding genes and 57 microRNAs. Representing hemimetabolous insects, the genome of the body louse thus provides a reference for studies of holometabolous insects. Compared with other insect genomes, the body louse genome contains significantly fewer genes associated with environmental sensing and response, including odorant and gustatory receptors and detoxifying enzymes. The unique architecture of the 18 minicircular mitochondrial chromosomes of the body louse may be linked to the loss of the gene encoding the mitochondrial single-stranded DNA binding protein. The genome of the obligatory louse endosymbiont Candidatus Riesia pediculicola encodes less than 600 genes on a short, linear chromosome and a circular plasmid. The plasmid harbors a unique arrangement of genes required for the synthesis of pantothenate, an essential vitamin deficient in the louse diet. The human body louse, its primary endosymbiont, and the bacterial pathogens that it vectors all possess genomes reduced in size compared with their free-living close relatives. Thus, the body louse genome project offers unique information and tools to use in advancing understanding of coevolution among vectors, symbionts, and pathogens.
Kirkness, Ewen F.; Haas, Brian J.; Sun, Weilin; Braig, Henk R.; Perotti, M. Alejandra; Clark, John M.; Lee, Si Hyeock; Robertson, Hugh M.; Kennedy, Ryan C.; Elhaik, Eran; Gerlach, Daniel; Kriventseva, Evgenia V.; Elsik, Christine G.; Graur, Dan; Hill, Catherine A.; Veenstra, Jan A.; Walenz, Brian; Tubío, José Manuel C.; Ribeiro, José M. C.; Rozas, Julio; Johnston, J. Spencer; Reese, Justin T.; Popadic, Aleksandar; Tojo, Marta; Raoult, Didier; Reed, David L.; Tomoyasu, Yoshinori; Kraus, Emily; Mittapalli, Omprakash; Margam, Venu M.; Li, Hong-Mei; Meyer, Jason M.; Johnson, Reed M.; Romero-Severson, Jeanne; VanZee, Janice Pagel; Alvarez-Ponce, David; Vieira, Filipe G.; Aguadé, Montserrat; Guirao-Rico, Sara; Anzola, Juan M.; Yoon, Kyong S.; Strycharz, Joseph P.; Unger, Maria F.; Christley, Scott; Lobo, Neil F.; Seufferheld, Manfredo J.; Wang, NaiKuan; Dasch, Gregory A.; Struchiner, Claudio J.; Madey, Greg; Hannick, Linda I.; Bidwell, Shelby; Joardar, Vinita; Caler, Elisabet; Shao, Renfu; Barker, Stephen C.; Cameron, Stephen; Bruggner, Robert V.; Regier, Allison; Johnson, Justin; Viswanathan, Lakshmi; Utterback, Terry R.; Sutton, Granger G.; Lawson, Daniel; Waterhouse, Robert M.; Venter, J. Craig; Strausberg, Robert L.; Collins, Frank H.; Zdobnov, Evgeny M.; Pittendrigh, Barry R.
2010-01-01
As an obligatory parasite of humans, the body louse (Pediculus humanus humanus) is an important vector for human diseases, including epidemic typhus, relapsing fever, and trench fever. Here, we present genome sequences of the body louse and its primary bacterial endosymbiont Candidatus Riesia pediculicola. The body louse has the smallest known insect genome, spanning 108 Mb. Despite its status as an obligate parasite, it retains a remarkably complete basal insect repertoire of 10,773 protein-coding genes and 57 microRNAs. Representing hemimetabolous insects, the genome of the body louse thus provides a reference for studies of holometabolous insects. Compared with other insect genomes, the body louse genome contains significantly fewer genes associated with environmental sensing and response, including odorant and gustatory receptors and detoxifying enzymes. The unique architecture of the 18 minicircular mitochondrial chromosomes of the body louse may be linked to the loss of the gene encoding the mitochondrial single-stranded DNA binding protein. The genome of the obligatory louse endosymbiont Candidatus Riesia pediculicola encodes less than 600 genes on a short, linear chromosome and a circular plasmid. The plasmid harbors a unique arrangement of genes required for the synthesis of pantothenate, an essential vitamin deficient in the louse diet. The human body louse, its primary endosymbiont, and the bacterial pathogens that it vectors all possess genomes reduced in size compared with their free-living close relatives. Thus, the body louse genome project offers unique information and tools to use in advancing understanding of coevolution among vectors, symbionts, and pathogens. PMID:20566863
[Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].
Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V
2010-01-01
The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.
2013-01-01
Background Halomonas sp. ZM3 was isolated from Zelazny Most post-flotation mineral waste repository (Poland), which is highly contaminated with heavy metals and various organic compounds. Mobile DNA of the strain (i.e. plasmids and transposons) were analyzed in order to identify genetic information enabling adaptation of the bacterium to the harsh environmental conditions. Results The analysis revealed that ZM3 carries plasmid pZM3H1 (31,370 bp), whose replication system may be considered as an archetype of a novel subgroup of IncU-like replicons. pZM3H1 is a narrow host range, mobilizable plasmid (encodes a relaxase of the MOBV family) containing mercury resistance operon (mer) and czcD genes (mediate resistance to zinc and cobalt), which are part of a large truncated Tn3 family transposon. Further analysis demonstrated that the phenotypes determined by the pZM3H1 resistance cassette are highly dependent on the host strain. In another strand of the study, the trap plasmid pMAT1 was employed to identify functional transposable elements of Halomonas sp. ZM3. Using the sacB positive selection strategy two insertion sequences were identified: ISHsp1 - representing IS5 group of IS5 family and ISHsp2 - a distinct member of the IS630 family. Conclusions This study provides the first detailed description of mobile DNA in a member of the family Halomonadaceae. The identified IncU plasmid pZM3H1 confers resistance phenotypes enabling adaptation of the host strain to the Zelazny Most environment. The extended comparative analysis has shed light on the distribution of related IncU plasmids among bacteria, which, in many cases, reflects the frequency and direction of horizontal gene transfer events. Our results also identify plasmid-encoded modules, which may form the basis of novel shuttle vectors, specific for this group of halophilic bacteria. PMID:23497212
Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.
Dad, A-B K; Ramakrishna, S; Song, M; Kim, H
2014-11-01
Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.
Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong
2003-02-01
To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.
Soler, Nicolas; Marguet, Evelyne; Cortez, Diego; Desnoues, Nicole; Keller, Jenny; van Tilbeurgh, Herman; Sezonov, Guennadi; Forterre, Patrick
2010-01-01
Thermococcales (phylum Euryarchaeota) are model organisms for physiological and molecular studies of hyperthermophiles. Here we describe three new plasmids from Thermococcales that could provide new tools and model systems for genetic and molecular studies in Archaea. The plasmids pTN2 from Thermococcus nautilus sp. 30-1 and pP12-1 from Pyrococcus sp. 12-1 belong to the same family. They have similar size (∼12 kb) and share six genes, including homologues of genes encoded by the virus PAV1 from Pyrococcus abyssi. The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales. Our analyses confirm that viruses and plasmids are evolutionary related and co-evolve with their hosts. Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism. The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase. This strengthens the idea that plasmids and viruses are a reservoir of novel protein families involved in DNA replication. PMID:20403814
O'Neill, M; Chen, A; Murray, N E
1997-12-23
Type II restriction and modification (R-M) genes have been described as selfish because they have been shown to impose selection for the maintenance of the plasmid that encodes them. In our experiments, the type I R-M system EcoKI does not behave in the same way. The genes specifying EcoKI are, however, normally residents of the chromosome and therefore our analyses were extended to monitor the deletion of chromosomal genes rather than loss of plasmid vector. If EcoKI were to behave in the same way as the plasmid-encoded type II R-M systems, the loss of the relevant chromosomal genes by mutation or recombination should lead to cell death because the cell would become deficient in modification enzyme and the bacterial chromosome would be vulnerable to the restriction endonuclease. Our data contradict this prediction; they reveal that functional type I R-M genes in the chromosome are readily replaced by mutant alleles and by alleles encoding a type I R-M system of different specificity. The acquisition of allelic genes conferring a new sequence specificity, but not the loss of the resident genes, is dependent on the product of an unlinked gene, one predicted [Prakash-Cheng, A., Chung, S. S. & Ryu, J. (1993) Mol. Gen. Genet. 241, 491-496] to be relevant to control of expression of the genes that encode EcoKI. Our evidence suggests that not all R-M systems are evolving as "selfish" units; rather, the diversity and distribution of the family of type I enzymes we have investigated require an alternative selective pressure.
Hong, Yang; Hondalus, Mary K
2008-10-01
Streptomyces PhiC31-based site-specific integration was used to transform the facultative intracellular pathogen Rhodococcus equi. The transformation efficiency of vectors incorporating the PhiC31 integrase and attP sites was comparable to that of replication plasmids using the same electroporation procedure. A single attB integration site was identified within an ORF encoding a pirin-like protein, which deviates slightly from the consensus sequence of Streptomyces attB sites. Vector integration was stably maintained in the R. equi chromosome for as many as 100 generations during unselected passage in vitro. In addition, integration does not appear to affect the replication of bacteria inside macrophages. Finally, this integration system was also used to successfully complement an R. equi mutant.
Plasmids encoding therapeutic agents
Keener, William K [Idaho Falls, ID
2007-08-07
Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.
Saccharomyces cerevisiae Shuttle vectors.
Gnügge, Robert; Rudolf, Fabian
2017-05-01
Yeast shuttle vectors are indispensable tools in yeast research. They enable cloning of defined DNA sequences in Escherichia coli and their direct transfer into Saccharomyces cerevisiae cells. There are three types of commonly used yeast shuttle vectors: centromeric plasmids, episomal plasmids and integrating plasmids. In this review, we discuss the different plasmid systems and their characteristic features. We focus on their segregational stability and copy number and indicate how to modify these properties. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Ultrasound-targeted hepatic delivery of factor IX in hemophiliac mice.
Anderson, C D; Moisyadi, S; Avelar, A; Walton, C B; Shohet, R V
2016-06-01
Ultrasound-targeted microbubble destruction (UTMD) was used to direct the delivery of plasmid and transposase-based vectors encoding human factor IX (hFIX) to the livers of hemophilia B (FIX-/-) mice. The DNA vectors were incorporated into cationic lipid microbubbles, injected intravenously, and transfected into hepatocytes by acoustic cavitation of the bubbles as they transited the liver. Ultrasound parameters were identified that produced transfection of hepatocytes in vivo without substantial damage or bleeding in the livers of the FIX-deficient mice. These mice were treated with a conventional expression plasmid, or one containing a piggyBac transposon construct, and hFIX levels in the plasma and liver were evaluated at multiple time points after UTMD. We detected hFIX in the plasma by western blotting from mice treated with either plasmid during the 12 days after UTMD, and in the hepatocytes of treated livers by immunofluorescence. Reductions in clotting time and improvements in the percentage of FIX activity were observed for both plasmids, conventional (4.15±1.98%), and transposon based (2.70±.75%), 4 to 5 days after UTMD compared with untreated FIX (-/-) control mice (0.92±0.78%) (P=0.001 and P=0.012, respectively). Reduced clotting times persisted for both plasmids 12 days after treatment (reflecting percentage FIX activity of 3.12±1.56%, P=0.02 and 3.08±0.10%, P=0.001, respectively). Clotting times from an additional set of mice treated with pmGENIE3-hFIX were evaluated for long-term effects and demonstrated a persistent reduction in average clotting time 160 days after a single treatment. These data suggest that UTMD could be a minimally invasive, nonviral approach to enhance hepatic FIX expression in patients with hemophilia.
Conlan, Sean; Thomas, Pamela J.; Deming, Clayton; Park, Morgan; Lau, Anna F.; Dekker, John P.; Snitkin, Evan S.; Clark, Tyson A.; Luong, Khai; Song, Yi; Tsai, Yu-Chih; Boitano, Matthew; Gupta, Jyoti; Brooks, Shelise Y.; Schmidt, Brian; Young, Alice C.; Thomas, James W.; Bouffard, Gerard G.; Blakesley, Robert W.; Mullikin, James C.; Korlach, Jonas; Henderson, David K.; Frank, Karen M.; Palmore, Tara N.; Segre, Julia A.
2014-01-01
Public health officials have raised concerns that plasmid transfer between Enterobacteriaceae species may spread resistance to carbapenems, an antibiotic class of last resort, thereby rendering common healthcare-associated infections nearly impossible to treat. We performed comprehensive surveillance and genomic sequencing to identify carbapenem-resistant Enterobacteriaceae in the NIH Clinical Center patient population and hospital environment in order to to articulate the diversity of carbapenemase-encoding plasmids and survey the mobility of and assess the mobility of these plasmids between bacterial species. We isolated a repertoire of carbapenemase-encoding Enterobacteriaceae, including multiple strains of Klebsiella pneumoniae, Klebsiella oxytoca, Escherichia coli, Enterobacter cloacae, Citrobacter freundii, and Pantoea species. Long-read genome sequencing with full end-to-end assembly revealed that these organisms carry the carbapenem-resistance genes on a wide array of plasmids. Klebsiella pneumoniae and Enterobacter cloacae isolated simultaneously from a single patient harbored two different carbapenemase-encoding plasmids, overriding the epidemiological scenario of plasmid transfer between organisms within this patient. We did, however, find evidence supporting horizontal transfer of carbapenemase-encoding plasmids between Klebsiella pneumoniae, Enterobacter cloacae and Citrobacter freundii in the hospital environment. Our comprehensive sequence data, with full plasmid identification, challenges assumptions about horizontal gene transfer events within patients and identified wider possible connections between patients and the hospital environment. In addition, we identified a new carbapenemase-encoding plasmid of potentially high clinical impact carried by Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae and Pantoea species, from unrelated patients and the hospital environment. PMID:25232178
Fernandes, Alinda R; Chari, Divya M
2016-09-28
Genetically engineered neural stem cell (NSC) transplant populations offer key benefits in regenerative neurology, for release of therapeutic biomolecules in ex vivo gene therapy. NSCs are 'hard-to-transfect' but amenable to 'magnetofection'. Despite the high clinical potential of this approach, the low and transient transfection associated with the large size of therapeutic DNA constructs is a critical barrier to translation. We demonstrate for the first time that DNA minicircles (small DNA vectors encoding essential gene expression components but devoid of a bacterial backbone, thereby reducing construct size versus conventional plasmids) deployed with magnetofection achieve the highest, safe non-viral DNA transfection levels (up to 54%) reported so far for primary NSCs. Minicircle-functionalized magnetic nanoparticle (MNP)-mediated gene delivery also resulted in sustained gene expression for up to four weeks. All daughter cell types of engineered NSCs (neurons, astrocytes and oligodendrocytes) were transfected (in contrast to conventional plasmids which usually yield transfected astrocytes only), offering advantages for targeted cell engineering. In addition to enhancing MNP functionality as gene delivery vectors, minicircle technology provides key benefits from safety/scale up perspectives. Therefore, we consider the proof-of-concept of fusion of technologies used here offers high potential as a clinically translatable genetic modification strategy for cell therapy. Copyright © 2016 Elsevier B.V. All rights reserved.
Folster, Jason P; Pecic, Gary; McCullough, Andre; Rickert, Regan; Whichard, Jean M
2011-12-01
Salmonella enterica is one of the most common bacterial causes of foodborne illness, and nontyphoidal Salmonella is estimated to cause ∼1.2 million illnesses in the United States each year. Plasmids are mobile genetic elements that play a critical role in the dissemination of antimicrobial resistance determinants. AmpC-type CMY β-lactamases (bla(CMY)) confer resistance to extended-spectrum cephalosporins and β-lactam/β-lactamase inhibitor combinations and are commonly plasmid-encoded. A variety of plasmids have been shown to encode CMY β-lactamases and certain plasmids may be associated with particular Salmonella serotypes or environmental sources. In this study, we characterized bla(CMY) β-lactamase-encoding plasmids among Salmonella isolates. Isolates of Salmonella from specimens collected from humans in 2007 were submitted to the Centers for Disease Control and Prevention National Antimicrobial Resistance Monitoring System laboratory for susceptibility testing. Three percent (65/2161) of Salmonella isolates displayed resistance to ceftriaxone (minimum inhibitory concentration [MIC] ≥4 mg/L) and amoxicillin/clavulanic acid (MIC ≥32 mg/L), a combination associated with the presence of a bla(CMY) mechanism of resistance. Sixty-four (98.5%) isolates were polymerase chain reaction-positive for bla(CMY) genes. Transformation and conjugation studies showed that 95% (61/64) of the bla(CMY) genes were plasmid-encoded. Most of the bla(CMY)-positive isolates were serotype Typhimurium, Newport, Heidelberg, and Agona. Forty-three plasmids were replicon type IncA/C, 15 IncI1, 2 contained multiple replicon loci, and 1 was untypeable. IncI1 plasmids conferred only the bla(CMY)-associated resistance phenotype, whereas IncA/C plasmids conferred additional multi-drug resistance (MDR) phenotypes to drugs such as chloramphenicol, sulfisoxazole, and tetracycline. Most of the IncI1 plasmids (12/15) were sequence type 12 by plasmid multi-locus sequence typing. CMY β-lactamase-encoding plasmids among human isolates of Salmonella in the United States tended to be large MDR IncA/C plasmids or single resistance determinant IncI1 plasmids. In general, IncI1 plasmids were identified among serotypes commonly associated with poultry, whereas IncA/C plasmids were more likely to be identified among cattle/beef-associated serotypes.
Diverse Broad-Host-Range Plasmids from Freshwater Carry Few Accessory Genes
Sen, Diya; Yano, Hirokazu; Bauer, Matthew L.; Rogers, Linda M.; Van der Auwera, Geraldine A.
2013-01-01
Broad-host-range self-transferable plasmids are known to facilitate bacterial adaptation by spreading genes between phylogenetically distinct hosts. These plasmids typically have a conserved backbone region and a variable accessory region that encodes host-beneficial traits. We do not know, however, how well plasmids that do not encode accessory functions can survive in nature. The goal of this study was to characterize the backbone and accessory gene content of plasmids that were captured from freshwater sources without selecting for a particular phenotype or cultivating their host. To do this, triparental matings were used such that the only required phenotype was the plasmid's ability to mobilize a nonconjugative plasmid. Based on complete genome sequences of 10 plasmids, only 5 carried identifiable accessory gene regions, and none carried antibiotic resistance genes. The plasmids belong to four known incompatibility groups (IncN, IncP-1, IncU, and IncW) and two potentially new groups. Eight of the plasmids were shown to have a broad host range, being able to transfer into alpha-, beta-, and gammaproteobacteria. Because of the absence of antibiotic resistance genes, we resampled one of the sites and compared the proportion of captured plasmids that conferred antibiotic resistance to their hosts with the proportion of such plasmids captured from the effluent of a local wastewater treatment plant. Few of the captured plasmids from either site encoded antibiotic resistance. A high diversity of plasmids that encode no or unknown accessory functions is thus readily found in freshwater habitats. The question remains how the plasmids persist in these microbial communities. PMID:24096417
MCR-1 and OXA-48 In Vivo Acquisition in KPC-Producing Escherichia coli after Colistin Treatment.
Beyrouthy, Racha; Robin, Frederic; Lessene, Aude; Lacombat, Igor; Dortet, Laurent; Naas, Thierry; Ponties, Valérie; Bonnet, Richard
2017-08-01
The spread of mcr-1 -encoding plasmids into carbapenem-resistant Enterobacteriaceae raises concerns about the emergence of untreatable bacteria. We report the acquisition of mcr-1 in a carbapenem-resistant Escherichia coli strain after a 3-week course of colistin in a patient repatriated to France from Portugal. Whole-genome sequencing revealed that the Klebsiella pneumoniae carbapenemase-producing E. coli strain acquired two plasmids, an IncL OXA-48-encoding plasmid and an IncX4 mcr-1 -encoding plasmid. This is the first report of mcr-1 in carbapenemase-encoding bacteria in France. Copyright © 2017 American Society for Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leong, JoAnn Ching
A prototype subunit vaccine to IHN virus is being developed by recombinant DNA techniques. The techniques involve the isolation and characterization of the glycoprotein gene, which encodes the viral protein responsible for inducing a protective immune response in fish. The viral glycoprotein gene has been cloned and a restriction map of the cloned gene has been prepared. Preliminary DNA sequence analysis of the cloned gene has been initiated so that manipulation of the gene for maximum expression in appropriate plasmid vectors is possible. A recombinant plasmid containing the viral gene inserted in the proper orientation adjacent to a very strongmore » lambda promoter and ribosome binding site has been constructed. Evaluation of this recombinant plasmid for gene expression is being conducted. Immunization trials with purified viral glycoprotein indicate that fish are protected against lethal doses of IHNV after immersion and intraperitoneal methods of immunization. In addition, cross protection immunization trials indicate that Type 2 and Type 1 IHN virus produce glycoproteins that are cross-protective.« less
Gene therapy approaches for spinal cord injury
NASA Astrophysics Data System (ADS)
Bright, Corinne
As the biomedical engineering field expands, combination technologies are demonstrating enormous potential for treating human disease. In particular, intersections between the rapidly developing fields of gene therapy and tissue engineering hold promise to achieve tissue regeneration. Nonviral gene therapy uses plasmid DNA to deliver therapeutic proteins in vivo for extended periods of time. Tissue engineering employs biomedical materials, such as polymers, to support the regrowth of injured tissue. In this thesis, a combination strategy to deliver genes and drugs in a polymeric scaffold was applied to a spinal cord injury model. In order to develop a platform technology to treat spinal cord injury, several nonviral gene delivery systems and polymeric scaffolds were evaluated in vitro and in vivo. Nonviral vector trafficking was evaluated in primary neuronal culture to develop an understanding of the barriers to gene transfer in neurons and their supporting glia. Although the most efficient gene carrier in vitro differed from the optimal gene carrier in vivo, confocal and electron microscopy of these nonviral vectors provided insights into the interaction of these vectors with the nucleus. A novel pathway for delivering nanoparticles into the nuclei of neurons and Schwann cells via vesicle trafficking was observed in this study. Reporter gene expression levels were evaluated after direct and remote delivery to the spinal cord, and the optimal nonviral vector, dose, and delivery strategy were applied to deliver the gene encoding the basic fibroblast growth factor (bFGF) to the spinal cord. An injectable and biocompatible gel, composed of the amphiphillic polymer poly(ethylene glycol)-poly(epsilon-caprolactone)-poly(ethylene glycol) (PEG-PCL-PEG) was evaluated as a drug and gene delivery system in vitro, and combined with the optimized nonviral gene delivery system to treat spinal cord injury. Plasmid DNA encoding the bFGF gene and the therapeutic NEP1--40 peptide were incorporated in the PEG-PCL-PEG gel and injected into a lesion transecting the main dorsomedial and minor ventral medial corticospinal tract (CST). The degree of collateralization of the transected CST was quantified as an indicator of the regenerative potential of these treatments. At one month post-injury, we observed the robust rostral collateralization of the CST tract in response to the bFGF plasmid-loaded gel. In conclusion, we hope that this platform technology can be applied to the sustained local delivery of other proteins for the treatment of spinal cord injury.
Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N
2013-01-01
Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.
Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.
Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A
1985-01-01
The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365
Isolation and characterization of novel mutations in the pSC101 origin that increase copy number
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.
pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less
Isolation and characterization of novel mutations in the pSC101 origin that increase copy number
Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.; ...
2018-01-25
pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less
Megaplasmids encode differing combinations of lantibiotics in Streptococcus salivarius.
Wescombe, Philip A; Burton, Jeremy P; Cadieux, Peter A; Klesse, Nikolai A; Hyink, Otto; Heng, Nicholas C K; Chilcott, Chris N; Reid, Gregor; Tagg, John R
2006-10-01
Streptococcus salivarius strains commonly produce bacteriocins as putative anti-competitor or signalling molecules. Here we report that bacteriocin production by the oral probiotic strain S. salivarius K12 is encoded by a large (ca. 190 kb) plasmid. Oral cavity transmission of the plasmid from strain K12 to a plasmid-negative variant of this bacterium was demonstrated in two subjects. Tests of additional S. salivarius strains showed large (up to ca. 220 kb) plasmids present in bacteriocin-producing isolates. Various combinations (up to 3 per plasmid) of loci encoding the known streptococcal lantibiotics salivaricin A, salivaricin B, streptin and SA-FF22 were localised to these plasmids. Since all bacteriocin-producing strains of S. salivarius tested to date appear to harbour plasmids, it appears that they may function as mobile repositories for bacteriocin loci, especially those of the lantibiotic class.
Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.
2017-01-01
We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chan, Chi Ho; Levar, Caleb E.; Zacharoff, Lori
Metal reduction by members of the Geobacteraceae is encoded by multiple gene clusters, and the study of extracellular electron transfer often requires biofilm development on surfaces. Genetic tools that utilize polar antibiotic cassette insertions limit mutant construction and complementation. In addition, unstable plasmids create metabolic burdens that slow growth, and the presence of antibiotics such as kanamycin can interfere with the rate and extent of Geobacter biofilm growth. We report here genetic system improvements for the model anaerobic metal-reducing bacterium Geobacter sulfurreducens. A motile strain of G. sulfurreducens was constructed by precise removal of a transposon interrupting the fgrM flagellarmore » regulator gene using SacB/sucrose counterselection, and Fe(III) citrate reduction was eliminated by deletion of the gene encoding the inner membrane cytochrome imcH. We also show that RK2-based plasmids were maintained in G. sulfurreducens for over 15 generations in the absence of antibiotic selection in contrast to unstable pBBR1 plasmids. Therefore, we engineered a series of new RK2 vectors containing native constitutive Geobacter promoters, and modified one of these promoters for VanR-dependent induction by the small aromatic carboxylic acid vanillate. Inducible plasmids fully complemented Δ imcH mutants for Fe(III) reduction, Mn(IV) oxide reduction, and growth on poised electrodes. A real-time, high-throughput Fe(III) citrate reduction assay is described that can screen numerous G. sulfurreducens strain constructs simultaneously and shows the sensitivity of imcH expression by the vanillate system. Lastly, these tools will enable more sophisticated genetic studies in G. sulfurreducens without polar insertion effects or need for multiple antibiotics.« less
Genetic transformation of tobacco NT1 cells with Agrobacterium tumefaciens.
Mayo, Kristin J; Gonzales, Barbara J; Mason, Hugh S
2006-01-01
This protocol is used to produce stably transformed tobacco (Nicotiana tabacum) NT1 cell lines, using Agrobacterium tumefaciens-mediated DNA delivery of a binary vector containing a gene encoding hepatitis B surface antigen and a gene encoding the kanamycin selection marker. The NT1 cultures, at the appropriate stage of growth, are inoculated with A. tumefaciens containing the binary vector. A 3-day cocultivation period follows, after which the cultures are rinsed and placed on solid selective medium. Transformed colonies ('calli') appear in approximately 4 weeks; they are subcultured until adequate material is obtained for analysis of antigen production. 'Elite' lines are selected based on antigen expression and growth characteristics. The time required for the procedure from preparation of the plant cell materials to callus development is approximately 5 weeks. Growth of selected calli to sufficient quantities for antigen screening may require 4-6 weeks beyond the initial selection. Creation of the plasmid constructs, transformation of the A. tumefaciens line, and ELISA and Bradford assays to assess protein production require additional time.
[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].
Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua
2013-02-01
To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.
Woloj, M; Tolmasky, M E; Roberts, M C; Crosa, J H
1986-01-01
Two multiresistant Klebsiella pneumoniae strains isolated from cerebrospinal fluid of human neonates were analyzed for their plasmid content. Two of the plasmids harbored by these strains, pJHCMW1 (11 kilobase pairs) and pJHCMW4 (75 kilobase pairs), carried genetic determinants for amikacin resistance. These plasmids also encoded resistance to kanamycin, tobramycin, and ampicillin which could be transferred to Escherichia coli by conjugation. Extracts from transconjugant derivatives carrying pJHCMW4 produced an acetyltransferase activity that acetylated all three aminoglycosides. Transconjugant derivatives carrying pJHCMW1 encoded both acetylating and phosphorylating activities. Southern blot hybridization analysis indicated considerable DNA homology between these two plasmids. Images PMID:3521478
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Fukuda, Akira; Usui, Masaru; Okubo, Torahiko; Tamura, Yutaka
2016-06-01
Houseflies are a mechanical vector for various types of bacteria, including antimicrobial-resistant bacteria (ARB). If the intestine of houseflies is a suitable site for the transfer of antimicrobial resistance genes (ARGs), houseflies could also serve as a biological vector for ARB. To clarify whether cephalosporin resistance genes are transferred efficiently in the housefly intestine, we compared with conjugation experiments in vivo (in the intestine) and in vitro by using Escherichia coli with eight combinations of four donor and two recipient strains harboring plasmid-mediated cephalosporin resistance genes and chromosomal-encoded rifampicin resistance genes, respectively. In the in vivo conjugation experiment, houseflies ingested donor strains for 6 hr and then recipient strains for 3 hr, and 24 hr later, the houseflies were surface sterilized and analyzed. In vitro conjugation experiments were conducted using the broth-mating method. In 3/8 combinations, the in vitro transfer frequency (Transconjugants/Donor) was ≥1.3 × 10(-4); the in vivo transfer rates of cephalosporin resistance genes ranged from 2.0 × 10(-4) to 5.7 × 10(-5). Moreover, cephalosporin resistance genes were transferred to other species of enteric bacteria of houseflies such as Achromobacter sp. and Pseudomonas fluorescens. These results suggest that houseflies are not only a mechanical vector for ARB but also a biological vector for the occurrence of new ARB through the horizontal transfer of ARGs in their intestine.
Sequential cloning of chromosomes
Lacks, Sanford A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.
Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D
1996-01-01
The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231
Recombinational inactivation of the gene encoding nitrate reductase in Aspergillus parasiticus.
Wu, T S; Linz, J E
1993-01-01
Functional disruption of the gene encoding nitrate reductase (niaD) in Aspergillus parasiticus was conducted by two strategies, one-step gene replacement and the integrative disruption. Plasmid pPN-1, in which an internal DNA fragment of the niaD gene was replaced by a functional gene encoding orotidine monophosphate decarboxylase (pyrG), was constructed. Plasmid pPN-1 was introduced in linear form into A. parasiticus CS10 (ver-1 wh-1 pyrG) by transformation. Approximately 25% of the uridine prototrophic transformants (pyrG+) were chlorate resistant (Chlr), demonstrating their inability to utilize nitrate as a sole nitrogen source. The genetic block in nitrate utilization was confirmed to occur in the niaD gene by the absence of growth of the A. parasiticus CS10 transformants on medium containing nitrate as the sole nitrogen source and the ability to grow on several alternative nitrogen sources. Southern hybridization analysis of Chlr transformants demonstrated that the resident niaD locus was replaced by the nonfunctional allele in pPN-1. To generate an integrative disruption vector (pSKPYRG), an internal fragment of the niaD gene was subcloned into a plasmid containing the pyrG gene as a selectable marker. Circular pSKPYRG was transformed into A. parasiticus CS10. Chlr pyrG+ transformants were screened for nitrate utilization and by Southern hybridization analysis. Integrative disruption of the genomic niaD gene occurred in less than 2% of the transformants. Three gene replacement disruption transformants and two integrative disruption transformants were tested for mitotic stability after growth under nonselective conditions. All five transformants were found to stably retain the Chlr phenotype after growth on nonselective medium.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8215371
[Cloning and gene expression in lactic acid bacteria].
Bondarenko, V M; Beliavskaia, V A
2000-01-01
The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.
Eppinger, Mark; Radnedge, Lyndsay; Andersen, Gary; Vietri, Nicholas; Severson, Grant; Mou, Sherry; Ravel, Jacques; Worsham, Patricia L
2012-01-01
Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium.
Eppinger, Mark; Radnedge, Lyndsay; Andersen, Gary; Vietri, Nicholas; Severson, Grant; Mou, Sherry; Ravel, Jacques; Worsham, Patricia L.
2012-01-01
Growing evidence suggests that the plasmid repertoire of Yersinia pestis is not restricted to the three classical virulence plasmids. The Java 9 strain of Y. pestis is a biovar Orientalis isolate obtained from a rat in Indonesia. Although it lacks the Y. pestis-specific plasmid pMT, which encodes the F1 capsule, it retains virulence in mouse and non-human primate animal models. While comparing diverse Y. pestis strains using subtractive hybridization, we identified sequences in Java 9 that were homologous to a Y. enterocolitica strain carrying the transposon Tn2502, which is known to encode arsenic resistance. Here we demonstrate that Java 9 exhibits high levels of arsenic and arsenite resistance mediated by a novel promiscuous class II transposon, named Tn2503. Arsenic resistance was self-transmissible from Java 9 to other Y. pestis strains via conjugation. Genomic analysis of the atypical plasmid inventory of Java 9 identified pCD and pPCP plasmids of atypical size and two previously uncharacterized cryptic plasmids. Unlike the Tn2502-mediated arsenic resistance encoded on the Y. enterocolitica virulence plasmid; the resistance loci in Java 9 are found on all four indigenous plasmids, including the two novel cryptic plasmids. This unique mobilome introduces more than 105 genes into the species gene pool. The majority of these are encoded by the two entirely novel self-transmissible plasmids, which show partial homology and synteny to other enterics. In contrast to the reductive evolution in Y. pestis, this study underlines the major impact of a dynamic mobilome and lateral acquisition in the genome evolution of the plague bacterium. PMID:22479347
Mehdizadeh Gohari, Iman; Kropinski, Andrew M; Weese, Scott J; Parreira, Valeria R; Whitehead, Ashley E; Boerlin, Patrick; Prescott, John F
2016-01-01
The recent discovery of a novel beta-pore-forming toxin, NetF, which is strongly associated with canine and foal necrotizing enteritis should improve our understanding of the role of type A Clostridium perfringens associated disease in these animals. The current study presents the complete genome sequence of two netF-positive strains, JFP55 and JFP838, which were recovered from cases of foal necrotizing enteritis and canine hemorrhagic gastroenteritis, respectively. Genome sequencing was done using Single Molecule, Real-Time (SMRT) technology-PacBio and Illumina Hiseq2000. The JFP55 and JFP838 genomes include a single 3.34 Mb and 3.53 Mb chromosome, respectively, and both genomes include five circular plasmids. Plasmid annotation revealed that three plasmids were shared by the two newly sequenced genomes, including a NetF/NetE toxins-encoding tcp-conjugative plasmid, a CPE/CPB2 toxins-encoding tcp-conjugative plasmid and a putative bacteriocin-encoding plasmid. The putative beta-pore-forming toxin genes, netF, netE and netG, were located in unique pathogenicity loci on tcp-conjugative plasmids. The C. perfringens JFP55 chromosome carries 2,825 protein-coding genes whereas the chromosome of JFP838 contains 3,014 protein-encoding genes. Comparison of these two chromosomes with three available reference C. perfringens chromosome sequences identified 48 (~247 kb) and 81 (~430 kb) regions unique to JFP55 and JFP838, respectively. Some of these divergent genomic regions in both chromosomes are phage- and plasmid-related segments. Sixteen of these unique chromosomal regions (~69 kb) were shared between the two isolates. Five of these shared regions formed a mosaic of plasmid-integrated segments, suggesting that these elements were acquired early in a clonal lineage of netF-positive C. perfringens strains. These results provide significant insight into the basis of canine and foal necrotizing enteritis and are the first to demonstrate that netF resides on a large and unique plasmid-encoded locus.
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
USDA-ARS?s Scientific Manuscript database
The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacte...
Liakopoulos, Apostolos; van der Goot, Jeanet; Bossers, Alex; Betts, Jonathan; Brouwer, Michael S M; Kant, Arie; Smith, Hilde; Ceccarelli, Daniela; Mevius, Dik
2018-05-16
The bla SHV-12 β-lactamase gene is one of the most prevalent genes conferring resistance to extended-spectrum β-lactams in Enterobacteriaceae disseminating within and between reservoirs, mostly via plasmid-mediated horizontal gene transfer. Yet, studies regarding the biology of plasmids encoding bla SHV-12 are very limited. In this study, we revealed the emergence of IncX3 plasmids alongside IncI1α/γ in bla SHV-12 in animal-related Escherichia coli isolates. Four representative bla SHV-12 -encoding IncX3 plasmids were selected for genome sequencing and further genetic and functional characterization. We report here the first complete sequences of IncX3 plasmids of animal origin and show that IncX3 plasmids exhibit remarkable synteny in their backbone, while the major differences lie in their bla SHV-12 -flanking region. Our findings indicate that plasmids of this subgroup are conjugative and highly stable, while they exert no fitness cost on their bacterial host. These favourable features might have contributed to the emergence of IncX3 amongst SHV-12-producing E. coli in the Netherlands, highlighting the epidemic potential of these plasmids.
Watts, Thomas D; Johanesen, Priscilla A; Lyras, Dena; Rood, Julian I; Adams, Vicki
2017-05-01
Clostridium perfringens produces an extensive repertoire of toxins and extracellular enzymes, many of which are intimately involved in the progression of disease and are encoded by genes on conjugative plasmids. In addition, many C. perfringens strains can carry up to five of these conjugative toxin or antimicrobial resistance plasmids, each of which has a similar 35kb backbone. This conserved backbone includes the tcp conjugation locus and the central control region (CCR), which encodes genes involved in plasmid regulation, replication and partitioning, including a parMRC partitioning locus. Most conjugative plasmids in C. perfringens have a conserved replication protein, raising questions as to how multiple, closely related plasmids are maintained within a single strain. Bioinformatics analysis has highlighted the presence of at least 10 different parMRC partitioning system families (parMRC A-J ) in these plasmids, with differences in amino acid sequence identity between each ParM family ranging from 15% to 54%. No two plasmids that encode genes belonging to the same partitioning family have been observed in a single strain, suggesting that these families represent the basis for plasmid incompatibility. In an attempt to validate the proposed parMRC incompatibility groups, genetically marked C. perfringens plasmids encoding identical parMRC C or parMRC D homologues or different combinations of parMRC A , parMRC C and parMRC D family homologues were introduced into a single strain via conjugation. The stability of each plasmid was determined using an incompatibility assay in which the plasmid profile of each strain was monitored over the course of two days in the absence of direct selection. The results showed that plasmids with identical parMRC C or parMRC D homologues were incompatible and could not coexist in the absence of external selection. By contrast, plasmids that encoded different parMRC homologues were compatible and could coexist in the same cell in the absence of selection, with the exception of strains housing parMRC C and parMRC D combinations, which showed a minor incompatibility phenotype. In conclusion, we have provided the first direct evidence of plasmid incompatibility in Clostridium spp. and have shown experimentally that the compatibility of conjugative C. perfringens plasmids correlates with the presence of parMRC-like partitioning systems of different phylogenetic subfamilies. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.
2014-01-01
Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120
Muraki, Yasushi; Washioka, Hiroshi; Sugawara, Kanetsu; Matsuzaki, Yoko; Takashita, Emi; Hongo, Seiji
2004-07-01
Influenza C virus-like particles (VLPs) have been generated from cloned cDNAs. A cDNA of the green fluorescent protein (GFP) gene in antisense orientation was flanked by the 5' and 3' non-coding regions of RNA segment 5 of the influenza C virus. The cDNA cassette was inserted between an RNA polymerase I promoter and terminator of the Pol I vector. This plasmid DNA was transfected into 293T cells together with plasmids encoding virus proteins of C/Ann Arbor/1/50 or C/Yamagata/1/88. Transfer of the supernatants of the transfected 293T cells to HMV-II cells resulted in GFP expression in the HMV-II cells. The quantification of the GFP-positive HMV-II cells indicated the presence of approximately 10(6) VLPs (ml supernatant)(-1). Cords 50-300 microm in length were observed on transfected 293T cells, although the cords were not observed when the plasmid for M1 protein of C/Ann Arbor/1/50 was replaced with that of C/Taylor/1233/47. A series of transfection experiments with plasmids encoding M1 mutants of C/Ann Arbor/1/50 or C/Taylor/1233/47 showed that an amino acid at residue 24 of the M1 protein is responsible for cord formation. This finding provides direct evidence for a previous hypothesis that M1 protein is involved in the formation of cord-like structures protruding from the C/Yamagata/1/88-infected cells. Evidence was obtained by electron microscopy that transfected cells bearing cords produced filamentous VLPs, suggesting the potential role of the M1 protein in determining the filamentous/spherical morphology of influenza C virus.
Bruffaerts, Nicolas; Pedersen, Lasse E.; Vandermeulen, Gaëlle; Préat, Véronique; Stockhofe-Zurwieden, Norbert; Huygen, Kris; Romano, Marta
2015-01-01
The only tuberculosis vaccine currently available, bacille Calmette-Guérin (BCG) is a poor inducer of CD8+ T cells, which are particularly important for the control of latent tuberculosis and protection against reactivation. As the induction of strong CD8+ T cell responses is a hallmark of DNA vaccines, a combination of BCG with plasmid DNA encoding a prototype TB antigen (Ag85A) was tested. As an alternative animal model, pigs were primed with BCG mixed with empty vector or codon-optimized pAg85A by the intradermal route and boosted with plasmid delivered by intramuscular electroporation. Control pigs received unformulated BCG. The BCG-pAg85A combination stimulated robust and sustained Ag85A specific antibody, lymphoproliferative, IL-6, IL-10 and IFN-γ responses. IgG1/IgG2 antibody isotype ratio reflected the Th1 helper type biased response. T lymphocyte responses against purified protein derivative of tuberculin (PPD) were induced in all (BCG) vaccinated animals, but responses were much stronger in BCG-pAg85A vaccinated pigs. Finally, Ag85A-specific IFN-γ producing CD8+ T cells were detected by intracellular cytokine staining and a synthetic peptide, spanning Ag85A131-150 and encompassing two regions with strong predicted SLA-1*0401/SLA-1*0801 binding affinity, was promiscuously recognized by 6/6 animals vaccinated with the BCG-pAg85A combination. Our study provides a proof of concept in a large mammalian species, for a new Th1 and CD8+ targeting tuberculosis vaccine, based on BCG-plasmid DNA co-administration. PMID:26172261
The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector
NASA Technical Reports Server (NTRS)
Ludwig, D. L.; Bruschi, C. V.
1991-01-01
The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A
1989-10-01
A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.
Sequential cloning of chromosomes
Lacks, S.A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.
Santos, Diego M; Carneiro, Marcia W; de Moura, Tatiana R; Fukutani, Kiyoshi; Clarencio, Jorge; Soto, Manuel; Espuelas, Socorro; Brodskyn, Claudia; Barral, Aldina; Barral-Netto, Manoel; de Oliveira, Camila I
2012-01-01
Vaccine development has been a priority in the fight against leishmaniases, which are vector-borne diseases caused by Leishmania protozoa. Among the different immunization strategies employed to date is inoculation of plasmid DNA coding for parasite antigens, which has a demonstrated ability to induce humoral and cellular immune responses. In this sense, inoculation of plasmid DNA encoding Leishmania kinetoplasmid membrane protein-11 (KMP-11) was able to confer protection against visceral leishmaniasis. However, recently the use of antigen delivery systems such as poly(lactic-co-glycolic acid) (PLGA) nanoparticles has also proven effective for eliciting protective immune responses. In the present work, we tested two immunization strategies with the goal of obtaining protection, in terms of lesion development and parasite load, against cutaneous leishmaniasis caused by L. braziliensis. One strategy involved immunization with plasmid DNA encoding L. infantum chagasi KMP-11. Alternatively, mice were primed with PLGA nanoparticles loaded with the recombinant plasmid DNA and boosted using PLGA nanoparticles loaded with recombinant KMP-11. Both immunization strategies elicited detectable cellular immune responses with the presence of both proinflammatory and anti-inflammatory cytokines; mice receiving the recombinant PLGA nanoparticle formulations also demonstrated anti-KMP-11 IgG1 and IgG2a. Mice were then challenged with L. braziliensis, in the presence of sand fly saliva. Lesion development was not inhibited following either immunization strategy. However, immunization with PLGA nanoparticles resulted in a more prominent reduction in parasite load at the infection site when compared with immunization using plasmid DNA alone. This effect was associated with a local increase in interferon-gamma and in tumor necrosis factor-alpha. Both immunization strategies also resulted in a lower parasite load in the draining lymph nodes, albeit not significantly. Our results encourage the pursuit of immunization strategies employing nanobased delivery systems for vaccine development against cutaneous leishmaniasis caused by L. braziliensis infection.
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M; Branger, Christine G; Tinge, Steven A; Curtiss, Roy
2010-06-01
A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal DeltaasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain chi9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/P(cro)) (P(R)), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC P(BAD) c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of beta-lactamase, and cloned into pYA4534 under the control of the P(trc) promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain chi9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route.
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M.; Branger, Christine G.; Tinge, Steven A.; Curtiss, Roy
2010-01-01
A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal ΔasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain χ9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/Pcro) (PR), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC PBAD c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of β-lactamase, and cloned into pYA4534 under the control of the Ptrc promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain χ9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route. PMID:20308296
PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids
Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua
2011-01-01
The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289
Toxin Plasmids of Clostridium perfringens
Li, Jihong; Adams, Vicki; Bannam, Trudi L.; Miyamoto, Kazuaki; Garcia, Jorge P.; Uzal, Francisco A.; Rood, Julian I.
2013-01-01
SUMMARY In both humans and animals, Clostridium perfringens is an important cause of histotoxic infections and diseases originating in the intestines, such as enteritis and enterotoxemia. The virulence of this Gram-positive, anaerobic bacterium is heavily dependent upon its prolific toxin-producing ability. Many of the ∼16 toxins produced by C. perfringens are encoded by large plasmids that range in size from ∼45 kb to ∼140 kb. These plasmid-encoded toxins are often closely associated with mobile elements. A C. perfringens strain can carry up to three different toxin plasmids, with a single plasmid carrying up to three distinct toxin genes. Molecular Koch's postulate analyses have established the importance of several plasmid-encoded toxins when C. perfringens disease strains cause enteritis or enterotoxemias. Many toxin plasmids are closely related, suggesting a common evolutionary origin. In particular, most toxin plasmids and some antibiotic resistance plasmids of C. perfringens share an ∼35-kb region containing a Tn916-related conjugation locus named tcp (transfer of clostridial plasmids). This tcp locus can mediate highly efficient conjugative transfer of these toxin or resistance plasmids. For example, conjugative transfer of a toxin plasmid from an infecting strain to C. perfringens normal intestinal flora strains may help to amplify and prolong an infection. Therefore, the presence of toxin genes on conjugative plasmids, particularly in association with insertion sequences that may mobilize these toxin genes, likely provides C. perfringens with considerable virulence plasticity and adaptability when it causes diseases originating in the gastrointestinal tract. PMID:23699255
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanungo, Jyotshna
RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less
A transposase strategy for creating libraries of circularly permuted proteins.
Mehta, Manan M; Liu, Shirley; Silberg, Jonathan J
2012-05-01
A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions.
A transposase strategy for creating libraries of circularly permuted proteins
Mehta, Manan M.; Liu, Shirley; Silberg, Jonathan J.
2012-01-01
A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions. PMID:22319214
Meira, L B; Henriques, J A; Magaña-Schwencke, N
1995-01-01
The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218
Khajanchi, Bijay K; Hasan, Nur A; Choi, Seon Young; Han, Jing; Zhao, Shaohua; Colwell, Rita R; Cerniglia, Carl E; Foley, Steven L
2017-08-02
The degree to which the chromosomal mediated iron acquisition system contributes to virulence of many bacterial pathogens is well defined. However, the functional roles of plasmid encoded iron acquisition systems, specifically Sit and aerobactin, have yet to be determined for Salmonella spp. In a recent study, Salmonella enterica strains isolated from different food sources were sequenced on the Illumina MiSeq platform and found to harbor the incompatibility group (Inc) FIB plasmid. In this study, we examined sequence diversity and the contribution of factors encoded on the IncFIB plasmid to the virulence of S. enterica. Whole genome sequences of seven S. enterica isolates were compared to genomes of serovars of S. enterica isolated from food, animal, and human sources. SeqSero analysis predicted that six strains were serovar Typhimurium and one was Heidelberg. Among the S. Typhimurium strains, single nucleotide polymorphism (SNP)-based phylogenetic analyses revealed that five of the isolates clustered as a single monophyletic S. Typhimurium subclade, while one of the other strains branched with S. Typhimurium from a bovine source. DNA sequence based phylogenetic diversity analyses showed that the IncFIB plasmid-encoded Sit and aerobactin iron acquisition systems are conserved among bacterial species including S. enterica. The IncFIB plasmid was transferred to an IncFIB plasmid deficient strain of S. enterica by conjugation. The transconjugant SE819::IncFIB persisted in human intestinal epithelial (Caco-2) cells at a higher rate than the recipient SE819. Genes of the Sit and aerobactin operons in the IncFIB plasmid were differentially expressed in iron-rich and iron-depleted growth media. Minimal sequence diversity was detected in the Sit and aerobactin operons in the IncFIB plasmids present among different bacterial species, including foodborne Salmonella strains. IncFIB plasmid encoded factors play a role during infection under low-iron conditions in host cells.
Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.
Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei
2018-01-01
Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.
Breau, Cathy; Cameron, D William; Desjardins, Marc; Lee, B Craig
2012-01-31
Chancroid, a sexually transmitted genital ulcer disease caused by the Gram-negative bacterium Haemophilus ducreyi, facilitates the acquisition and transmission of HIV. An effective vaccine against chancroid has not been developed. In this preliminary study, the gene encoding the H. ducreyi outer membrane hemoglobin receptor HgbA was cloned into the plasmid pTETnir15. The recombinant construct was introduced into the attenuated Salmonella typhimurium SL3261 strain and stable expression was induced in vitro under anaerobic conditions. The vaccine strain was delivered into the temperature-dependent rabbit model of chancroid by intragastric immunization as a single dose, or as three doses administered at two-weekly intervals. No specific antibody to HgbA was elicited after either dose schedule. Although the plasmid vector survived in vivo passage for up to 15 days following single oral challenge, HgbA expression was restricted to plasmid isolates recovered one day after immunization. Rabbits inoculated with the 3-dose booster regimen achieved no protective immunity from homologous challenge. These results emphasize that refinements in plasmid design to enhance a durable heterologous protein expression are necessary for the development of a live oral vaccine against chancroid. Copyright © 2011 Elsevier B.V. All rights reserved.
Robin, F; Beyrouthy, R; Bonacorsi, S; Aissa, N; Bret, L; Brieu, N; Cattoir, V; Chapuis, A; Chardon, H; Degand, N; Doucet-Populaire, F; Dubois, V; Fortineau, N; Grillon, A; Lanotte, P; Leyssene, D; Patry, I; Podglajen, I; Recule, C; Ros, A; Colomb-Cotinat, M; Ponties, V; Ploy, M C; Bonnet, R
2017-03-01
The objective of this study was to perform an inventory of the extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae isolates responsible for infections in French hospitals and to assess the mechanisms associated with ESBL diffusion. A total of 200 nonredundant ESBL-producing Enterobacteriaceae strains isolated from clinical samples were collected during a multicenter study performed in 18 representative French hospitals. Antibiotic resistance genes were identified by PCR and sequencing experiments. The clonal relatedness between isolates was investigated by the use of the DiversiLab system. ESBL-encoding plasmids were compared by PCR-based replicon typing and plasmid multilocus sequence typing. CTX-M-15, CTX-M-1, CTX-M-14, and SHV-12 were the most prevalent ESBLs (8% to 46.5%). The three CTX-M-type EBSLs were significantly observed in Escherichia coli (37.1%, 24.2%, and 21.8%, respectively), and CTX-M-15 was the predominant ESBL in Klebsiella pneumoniae (81.1%). SHV-12 was associated with ESBL-encoding Enterobacter cloacae strains (37.9%). qnrB , aac(6 ' )-Ib-cr , and aac(3)-II genes were the main plasmid-mediated resistance genes, with prevalences ranging between 19.5% and 45% according to the ESBL results. Molecular typing did not identify wide clonal diffusion. Plasmid analysis suggested the diffusion of low numbers of ESBL-encoding plasmids, especially in K. pneumoniae and E. cloacae However, the ESBL-encoding genes were observed in different plasmid replicons according to the bacterial species. The prevalences of ESBL subtypes differ according to the Enterobacteriaceae species. Plasmid spread is a key determinant of this epidemiology, and the link observed between the ESBL-encoding plasmids and the bacterial host explains the differences observed in the Enterobacteriaceae species. Copyright © 2017 American Society for Microbiology.
USDA-ARS?s Scientific Manuscript database
Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...
A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.
Rogers, Elizabeth E; Stenger, Drake C
2012-01-01
A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.
Mehdizadeh Gohari, Iman; Kropinski, Andrew M.; Weese, Scott J.; Parreira, Valeria R.; Whitehead, Ashley E.; Boerlin, Patrick; Prescott, John F.
2016-01-01
The recent discovery of a novel beta-pore-forming toxin, NetF, which is strongly associated with canine and foal necrotizing enteritis should improve our understanding of the role of type A Clostridium perfringens associated disease in these animals. The current study presents the complete genome sequence of two netF-positive strains, JFP55 and JFP838, which were recovered from cases of foal necrotizing enteritis and canine hemorrhagic gastroenteritis, respectively. Genome sequencing was done using Single Molecule, Real-Time (SMRT) technology-PacBio and Illumina Hiseq2000. The JFP55 and JFP838 genomes include a single 3.34 Mb and 3.53 Mb chromosome, respectively, and both genomes include five circular plasmids. Plasmid annotation revealed that three plasmids were shared by the two newly sequenced genomes, including a NetF/NetE toxins-encoding tcp-conjugative plasmid, a CPE/CPB2 toxins-encoding tcp-conjugative plasmid and a putative bacteriocin-encoding plasmid. The putative beta-pore-forming toxin genes, netF, netE and netG, were located in unique pathogenicity loci on tcp-conjugative plasmids. The C. perfringens JFP55 chromosome carries 2,825 protein-coding genes whereas the chromosome of JFP838 contains 3,014 protein-encoding genes. Comparison of these two chromosomes with three available reference C. perfringens chromosome sequences identified 48 (~247 kb) and 81 (~430 kb) regions unique to JFP55 and JFP838, respectively. Some of these divergent genomic regions in both chromosomes are phage- and plasmid-related segments. Sixteen of these unique chromosomal regions (~69 kb) were shared between the two isolates. Five of these shared regions formed a mosaic of plasmid-integrated segments, suggesting that these elements were acquired early in a clonal lineage of netF-positive C. perfringens strains. These results provide significant insight into the basis of canine and foal necrotizing enteritis and are the first to demonstrate that netF resides on a large and unique plasmid-encoded locus. PMID:26859667
A Conjugative 38 kB Plasmid Is Present in Multiple Subspecies of Xylella fastidiosa
Rogers, Elizabeth E.; Stenger, Drake C.
2012-01-01
A ∼38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19th century. PMID:23251694
NetF-producing Clostridium perfringens: Clonality and plasmid pathogenicity loci analysis.
Mehdizadeh Gohari, Iman; Kropinski, Andrew M; Weese, Scott J; Whitehead, Ashley E; Parreira, Valeria R; Boerlin, Patrick; Prescott, John F
2017-04-01
Clostridium perfringens is an important cause of foal necrotizing enteritis and canine acute hemorrhagic diarrhea. A major virulence determinant of the strains associated with these diseases appears to be a beta-sheet pore-forming toxin, NetF, encoded within a pathogenicity locus (NetF locus) on a large tcp-conjugative plasmid. Strains producing NetF also produce the putative toxin NetE, encoded within the same pathogenicity locus, as well as CPE enterotoxin and CPB2 on a second plasmid, and sometimes the putative toxin NetG within a pathogenicity locus (NetG locus) on another separate large conjugative plasmid. Previous genome sequences of two netF-positive C. perfringens showed that they both shared three similar plasmids, including the NetF/NetE and CPE/CPB2 toxins-encoding plasmids mentioned above and a putative bacteriocin-encoding plasmid. The main purpose of this study was to determine whether all NetF-producing strains share this common plasmid profile and whether their distinct NetF and CPE pathogenicity loci are conserved. To answer this question, 15 equine and 15 canine netF-positive isolates of C. perfringens were sequenced using Illumina Hiseq2000 technology. In addition, the clonal relationships among the NetF-producing strains were evaluated by core genome multilocus sequence typing (cgMLST). The data obtained showed that all NetF-producing strains have a common plasmid profile and that the defined pathogenicity loci on the plasmids are conserved in all these strains. cgMLST analysis showed that the NetF-producing C. perfringens strains belong to two distinct clonal complexes. The pNetG plasmid was absent from isolates of one of the clonal complexes, and there were minor but consistent differences in the NetF/NetE and CPE/CPB2 plasmids between the two clonal complexes. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cary, J.W.; Petersen, D.J.; Bennett, G.N.
1990-06-01
Coenzyme A (CoA)-transferase (acetoacetyl-CoA:acetate/butyrate:CoA-transferase (butyrate-acetoacetate CoA-transferase) (EC 2.8.3.9)) of Clostridium acetobutylicum ATCC 824 is an important enzyme in the metabolic shift between the acid-producing and solvent-forming states of this organism. The genes encoding the two subunits of this enzyme have been cloned and subsequent subcloning experiments established the position of the structural genes for CoA-transferase. Complementation of Escherichia coli ato mutants with the recombinant plasmid pCoAT4 (pUC19 carrying a 1.8-kilobase insert of C. acetobutylicum DNA encoding CoA-transferase activity) enabled the transformants to grow on butyrate as a sole carbon source. Despite the ability of CoA-transferase to complement the ato defectmore » in E. coli mutants, Southern blot and Western blot (immunoblot) analyses showed showed that neither the C. acetobutylicum genes encoding CoA-transferase nor the enzyme itself shared any apparent homology with its E. coli counterpart. Polypeptides of M{sub r} of the purified CoA-transferase subunits were observed by Western blot and maxicell analysis of whole-cell extracts of E.coli harboring pCoAT4. The proximity and orientation of the genes suggest that the genes encoding the two subunits of CoA-transferase may form an operon similar to that found in E. coli. In the plasmid, however, transcription appears to be primarily from the lac promoter of the vector.« less
Madsen, Jonas Stenløkke; Riber, Leise; Kot, Witold; Basfeld, Alrun; Burmølle, Mette; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes
2016-01-01
Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed to have originated. We find that mrkABCDFs of plasmids are highly expressed via a unique promoter that differs from the original Klebsiella promoter resulting in fundamental behavioral consequences. Plasmid associated mrkABCDFs did not influence the swimming behavior of the host, that hereby acquired an exceptional phenotype being able to both actively swim (planktonic behavior) and express biofilm associated fimbriae (sessile behavior). We show that this exceptional phenotype enhances the conjugal transfer of the plasmid. PMID:27627107
Marín-López, Alejandro; Ortego, Javier
2016-01-01
Modified Vaccinia Virus Ankara (MVA) is employed widely as an experimental vaccine vector for its lack of replication in mammalian cells and high expression level of foreign/heterologous genes. Recombinant MVAs (rMVAs) are used as platforms for protein production as well as vectors to generate vaccines against a high number of infectious diseases and other pathologies. The portrait of the virus combines desirable elements such as high-level biological safety, the ability to activate appropriate innate immune mediators upon vaccination, and the capacity to deliver substantial amounts of heterologous antigens. Recombinant MVAs encoding proteins of bluetongue virus (BTV), an Orbivirus that infects domestic and wild ruminants transmitted by biting midges of the Culicoides species, are excellent vaccine candidates against this virus. In this chapter we describe the methods for the generation of rMVAs encoding VP2, NS1, and VP7 proteins of bluetongue virus as a model example for orbiviruses. The protocols included cover the cloning of VP2, NS1, and VP7 BTV-4 genes in a transfer plasmid, the construction of recombinant MVAs, the titration of virus working stocks and the protein expression analysis by immunofluorescence and radiolabeling of rMVA infected cells as well as virus purification.
Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.
Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng
2007-01-01
Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.
Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin
2011-01-01
To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P < 0.01). For antibody isotype analysis, the IgG1 isotype antibody titers in all test groups were significantly higher than of IgG2a (P < 0.01). The high-level spleen lymphocyte stimulation index was observed in the three test groups under the stimulation with Con A, higher than that in control groups (P < 0.01). LTB gene could enhance the humoral immune response of CPV VP2 gene vaccine in mice.
1986-11-26
cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a
Agaphonov, Michael O
2017-12-01
The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Tolmachov, Oleg E
2010-04-01
Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.
Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P
1985-01-01
Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773
Characterization of Plasmids in a Human Clinical Strain of Lactococcus garvieae
Blanco, M. Mar; López-Campos, Guillermo H.; Cutuli, M. Teresa; Fernández-Garayzábal, José F.
2012-01-01
The present work describes the molecular characterization of five circular plasmids found in the human clinical strain Lactococcus garvieae 21881. The plasmids were designated pGL1-pGL5, with molecular sizes of 4,536 bp, 4,572 bp, 12,948 bp, 14,006 bp and 68,798 bp, respectively. Based on detailed sequence analysis, some of these plasmids appear to be mosaics composed of DNA obtained by modular exchange between different species of lactic acid bacteria. Based on sequence data and the derived presence of certain genes and proteins, the plasmid pGL2 appears to replicate via a rolling-circle mechanism, while the other four plasmids appear to belong to the group of lactococcal theta-type replicons. The plasmids pGL1, pGL2 and pGL5 encode putative proteins related with bacteriocin synthesis and bacteriocin secretion and immunity. The plasmid pGL5 harbors genes (txn, orf5 and orf25) encoding proteins that could be considered putative virulence factors. The gene txn encodes a protein with an enzymatic domain corresponding to the family actin-ADP-ribosyltransferases toxins, which are known to play a key role in pathogenesis of a variety of bacterial pathogens. The genes orf5 and orf25 encode two putative surface proteins containing the cell wall-sorting motif LPXTG, with mucin-binding and collagen-binding protein domains, respectively. These proteins could be involved in the adherence of L. garvieae to mucus from the intestine, facilitating further interaction with intestinal epithelial cells and to collagenous tissues such as the collagen-rich heart valves. To our knowledge, this is the first report on the characterization of plasmids in a human clinical strain of this pathogen. PMID:22768237
Li, Ruichao; Xie, Miaomiao; Dong, Ning; Lin, Dachuan; Yang, Xuemei; Wong, Marcus Ho Yin; Chan, Edward Wai-Chi; Chen, Sheng
2018-03-01
Multidrug resistance (MDR)-encoding plasmids are considered major molecular vehicles responsible for transmission of antibiotic resistance genes among bacteria of the same or different species. Delineating the complete sequences of such plasmids could provide valuable insight into the evolution and transmission mechanisms underlying bacterial antibiotic resistance development. However, due to the presence of multiple repeats of mobile elements, complete sequencing of MDR plasmids remains technically complicated, expensive, and time-consuming. Here, we demonstrate a rapid and efficient approach to obtaining multiple MDR plasmid sequences through the use of the MinION nanopore sequencing platform, which is incorporated in a portable device. By assembling the long sequencing reads generated by a single MinION run according to a rapid barcoding sequencing protocol, we obtained the complete sequences of 20 plasmids harbored by multiple bacterial strains. Importantly, single long reads covering a plasmid end-to-end were recorded, indicating that de novo assembly may be unnecessary if the single reads exhibit high accuracy. This workflow represents a convenient and cost-effective approach for systematic assessment of MDR plasmids responsible for treatment failure of bacterial infections, offering the opportunity to perform detailed molecular epidemiological studies to probe the evolutionary and transmission mechanisms of MDR-encoding elements.
Rotger, R; García-Valdés, E; Trallero, E P
1986-01-01
A 9.4-kilobase plasmid encoding penicillin, streptomycin, and sulfonamide resistance was isolated from a beta-lactamase-producing Eikenella corrodens strain. This plasmid appears to be identical to a resistance plasmid common to saprophytic Neisseria strains. Images PMID:3535668
Sletvold, H; Johnsen, P J; Hamre, I; Simonsen, G S; Sundsfjord, A; Nielsen, K M
2008-07-01
Glycopeptide resistant Enterococcus faecium (GREF) persists on Norwegian poultry farms despite the ban on the growth promoter avoparcin. The biological basis for long-term persistence of avoparcin resistance is not fully understood. This study presents the complete DNA sequence of the E. faecium R-plasmid pVEF3 and functional studies of some plasmid-encoded traits (a toxin-antitoxin (TA) system and an ABC transporter) that may be of importance for plasmid persistence. The pVEF3 (63.1 kbp), isolated from an E. faecium strain of poultry origin sampled in Norway in 1999, has 71 coding sequences including the vanA avoparcin/vancomycin resistance encoding gene cluster. pVEF3 encodes the TA system omega-epsilon-zeta, and plasmid stability tests and transcription analysis show that omega-epsilon-zeta is functional in Enterococcus faecalis OGIX, although with decreasing effect over time. The predicted ABC transporter was not found to confer reduced susceptibility to any of the 28 substances tested. The TA system identified in the pVEF-type plasmids may contribute to vanA plasmid persistence on Norwegian poultry farms. However, size and compositional heterogeneity among E. faecium vanA plasmids suggest that additional plasmid maintenance systems in combination with host specific factors and frequent horizontal gene transfer and rearrangement causes the observed plasmid composition and distribution patterns.
Gascoyne, D M; Heritage, J; Hawkey, P M; Turner, A; van Klingeren, B
1991-08-01
High level tetracycline resistant strains of Neisseria gonorrhoeae (TRNG) have been shown to carry a 40.6 kb (25.2 MDa) conjugative plasmid with a Class M tetracycline resistance determinant. Restriction endonuclease analysis mapping showed that there were at least two different TRNG plasmid types which were found in geographically distinct locations. The physical maps of these two plasmids were compared to a gonococcal conjugative plasmid which did not encode tetracycline resistance. The plasmid type which is endemic in the Netherlands was found to be closely related to the gonococcal conjugative plasmid, which supports the established hypothesis that the 40.6 kb plasmid has evolved by transposition of the TetM determinant into the conjugative plasmid. The plasmid found in the United States has either evolved by substantial divergent evolution or it results from a different transposition event. In the UK there have been isolations of TRNGs carrying either of the two plasmid types reflecting a flow of people both across the Atlantic and in Europe. It is possible that further TetM-containing plasmids will be found in N. gonorrhoeae paralleling the family of TEM beta-lactamase encoding plasmids already described.
Sundeen, Grace; Barbieri, Joseph T
2017-09-02
Botulinum neurotoxins (BoNT) cause the flaccid paralysis of botulism by inhibiting the release of acetylcholine from motor neurons. There are seven serotypes of BoNT (A-G), with limited therapies, and no FDA approved vaccine for botulism. An investigational formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was used to vaccinate people who are at high risk of contracting botulism. However, this formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was losing potency and was discontinued. This article reviews the different vaccines being developed to replace the discontinued toxoid vaccine. These vaccines include DNA-based, viral vector-based, and recombinant protein-based vaccines. DNA-based vaccines include plasmids or viral vectors containing the gene encoding one of the BoNT heavy chain receptor binding domains (HC). Viral vectors reviewed are adenovirus, influenza virus, rabies virus, Semliki Forest virus, and Venezuelan Equine Encephalitis virus. Among the potential recombinant protein vaccines reviewed are HC, light chain-heavy chain translocation domain, and chemically or genetically inactivated holotoxin.
Sundeen, Grace; Barbieri, Joseph T.
2017-01-01
Botulinum neurotoxins (BoNT) cause the flaccid paralysis of botulism by inhibiting the release of acetylcholine from motor neurons. There are seven serotypes of BoNT (A-G), with limited therapies, and no FDA approved vaccine for botulism. An investigational formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was used to vaccinate people who are at high risk of contracting botulism. However, this formalin-inactivated penta-serotype-BoNT/A-E toxoid vaccine was losing potency and was discontinued. This article reviews the different vaccines being developed to replace the discontinued toxoid vaccine. These vaccines include DNA-based, viral vector-based, and recombinant protein-based vaccines. DNA-based vaccines include plasmids or viral vectors containing the gene encoding one of the BoNT heavy chain receptor binding domains (HC). Viral vectors reviewed are adenovirus, influenza virus, rabies virus, Semliki Forest virus, and Venezuelan Equine Encephalitis virus. Among the potential recombinant protein vaccines reviewed are HC, light chain-heavy chain translocation domain, and chemically or genetically inactivated holotoxin. PMID:28869493
Plasmid-borne Tn5 insertion mutation resulting in accumulation of gentisate from salicylate.
Monticello, D J; Bakker, D; Schell, M; Finnerty, W R
1985-01-01
Plasmid-borne Tn5 insertion mutants of a Pseudomonas species which accumulated 2,5-dihydroxybenzoate (gentisate) following growth on 2-hydroxybenzoate (salicylate) were obtained from a pool of mutants that were unable to grow on naphthalene. One such mutant was characterized further. The ability of this mutant to oxidize gentisate was 100-fold less than the ability of a Nah+ Sal+ strain harboring the unmutagenized plasmid, although both strains oxidized and grew on salicylate. These bacteria were presumably able to metabolize salicylate via catechol, since they possessed an inducible, plasmid-encoded catechol 2,3-dioxygenase. Our results suggest that there is an alternate, plasmid-encoded route of salicylate degradation via gentisate and that some plasmid-associated relationship between this pathway and naphthalene oxidation exists. PMID:2988437
Gibert, Marta; Paytubi, Sonia; Beltrán, Sergi; Juárez, Antonio; Balsalobre, Carlos; Madrid, Cristina
2016-12-01
Plasmids of the incompatibility group HI1 (IncHI1) have been isolated from several Gram-negative pathogens and are associated with the spread of multidrug resistance. Their conjugation is tightly regulated and it is inhibited at temperatures higher than 30°C, indicating that conjugation occurs outside warm-blooded hosts. Using R27, the prototype of IncHI1 plasmids, we report that plasmid transfer efficiency in E. coli strongly depends on the physiological state of the donor cells. Conjugation frequency is high when cells are actively growing, dropping sharply when cells enter the stationary phase of growth. Accordingly, our transcriptomic assays show significant downregulation of numerous R27 genes during the stationary phase, including several tra (transfer) genes. Growth phase-dependent regulation of tra genes transcription is independent of H-NS, a silencer of horizontal gene transfer, and ppGpp and RpoS, regulators of the stationary phase, but highly dependent on the plasmid-encoded regulatory circuit TrhR/TrhY-HtdA. The metabolic sensor cAMP, whose synthesis is chromosomally encoded, is also involved in the growth phase regulation of R27 conjugation by modulating htdA expression. Our data suggest that the involvement of regulators encoded by both chromosome and plasmid are required for efficient physiological control of IncHI1 plasmid conjugation. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Bröker, Daniel; Arenskötter, Matthias; Legatzki, Antje; Nies, Dietrich H.; Steinbüchel, Alexander
2004-01-01
The complete sequence of the circular 101,016-bp megaplasmid pKB1 from the cis-1,4-polyisoprene-degrading bacterium Gordonia westfalica Kb1, which represents the first described extrachromosomal DNA of a member of this genus, was determined. Plasmid pKB1 harbors 105 open reading frames. The predicted products of 46 of these are significantly related to proteins of known function. Plasmid pKB1 is organized into three functional regions that are flanked by insertion sequence (IS) elements: (i) a replication and putative partitioning region, (ii) a putative metabolic region, and (iii) a large putative conjugative transfer region, which is interrupted by an additional IS element. Southern hybridization experiments revealed the presence of another copy of this conjugational transfer region on the bacterial chromosome. The origin of replication (oriV) of pKB1 was identified and used for construction of Escherichia coli-Gordonia shuttle vectors, which was also suitable for several other Gordonia species and related genera. The metabolic region included the heavy-metal resistance gene cadA, encoding a P-type ATPase. Expression of cadA in E. coli mediated resistance to cadmium, but not to zinc, and decreased the cellular content of cadmium in this host. When G. westfalica strain Kb1 was cured of plasmid pKB1, the resulting derivative strains exhibited slightly decreased cadmium resistance. Furthermore, they had lost the ability to use isoprene rubber as a sole source of carbon and energy, suggesting that genes essential for rubber degradation are encoded by pKB1. PMID:14679241
Kalariya, Mayurkumar; Amiji, Mansoor M
2013-09-10
The purpose of this study was to develop a water-in-oil-in-water (W/O/W) multiple emulsions-based vaccine delivery system for plasmid DNA encoding the gp100 peptide antigen for melanoma immunotherapy. The gp100 encoding plasmid DNA was encapsulated in the inner-most aqueous phase of squalane oil containing W/O/W multiple emulsions using a two-step emulsification method. In vitro transfection ability of the encapsulated plasmid DNA was investigated in murine dendritic cells by transgene expression analysis using fluorescence microscopy and ELISA methods. Prophylactic immunization using the W/O/W multiple emulsions encapsulated the gp100 encoding plasmid DNA vaccine significantly reduced tumor volume in C57BL/6 mice during subsequent B16-F10 tumor challenge. In addition, serum Th1 cytokine levels and immuno-histochemistry of excised tumor tissues indicated activation of cytotoxic T-lymphocytes mediated anti-tumor immunity causing tumor growth suppression. The W/O/W multiple emulsions-based vaccine delivery system efficiently delivers the gp100 plasmid DNA to induce cell-mediated anti-tumor immunity. Copyright © 2013 Elsevier B.V. All rights reserved.
Kid cleaves specific mRNAs at UUACU sites to rescue the copy number of plasmid R1
Pimentel, Belén; Madine, Mark A; de la Cueva-Méndez, Guillermo
2005-01-01
Stability and copy number of extra-chromosomal elements are tightly regulated in prokaryotes and eukaryotes. Toxin Kid and antitoxin Kis are the components of the parD stability system of prokaryotic plasmid R1 and they can also function in eukaryotes. In bacteria, Kid was thought to become active only in cells that lose plasmid R1 and to cleave exclusively host mRNAs at UA(A/C/U) trinucleotide sites to eliminate plasmid-free cells. Instead, we demonstrate here that Kid becomes active in plasmid-containing cells when plasmid copy number decreases, cleaving not only host- but also a specific plasmid-encoded mRNA at the longer and more specific target sequence UUACU. This specific cleavage by Kid inhibits bacterial growth and, at the same time, helps to restore the plasmid copy number. Kid targets a plasmid RNA that encodes a repressor of the synthesis of an R1 replication protein, resulting in increased plasmid DNA replication. This mechanism resembles that employed by some human herpesviruses to regulate viral amplification during infection. PMID:16163387
Davidsson, Sabina; Carlsson, Jessica; Mölling, Paula; Gashi, Natyra; Andrén, Ove; Andersson, Swen-Olof; Brzuszkiewicz, Elzbieta; Poehlein, Anja; Al-Zeer, Munir A.; Brinkmann, Volker; Scavenius, Carsten; Nazipi, Seven; Söderquist, Bo; Brüggemann, Holger
2017-01-01
Inflammation is one of the hallmarks of prostate cancer. The origin of inflammation is unknown, but microbial infections are suspected to play a role. In previous studies, the Gram-positive, low virulent bacterium Cutibacterium (formerly Propionibacterium) acnes was frequently isolated from prostatic tissue. It is unclear if the presence of the bacterium represents a true infection or a contamination. Here we investigated Cutibacterium acnes type II, also called subspecies defendens, which is the most prevalent type among prostatic C. acnes isolates. Genome sequencing of type II isolates identified large plasmids in several genomes. The plasmids are highly similar to previously identified linear plasmids of type I C. acnes strains associated with acne vulgaris. A PCR-based analysis revealed that 28.4% (21 out of 74) of all type II strains isolated from cancerous prostates carry a plasmid. The plasmid shows signatures for conjugative transfer. In addition, it contains a gene locus for tight adherence (tad) that is predicted to encode adhesive Flp (fimbrial low-molecular weight protein) pili. In subsequent experiments a tad locus-encoded putative pilin subunit was identified in the surface-exposed protein fraction of plasmid-positive C. acnes type II strains by mass spectrometry, indicating that the tad locus is functional. Additional plasmid-encoded proteins were detected in the secreted protein fraction, including two signal peptide-harboring proteins; the corresponding genes are specific for type II C. acnes, thus lacking from plasmid-positive type I C. acnes strains. Further support for the presence of Flp pili in C. acnes type II was provided by electron microscopy, revealing cell appendages in tad locus-positive strains. Our study provides new insight in the most prevalent prostatic subspecies of C. acnes, subsp. defendens, and indicates the existence of Flp pili in plasmid-positive strains. Such pili may support colonization and persistent infection of human prostates by C. acnes. PMID:29201018
A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.
Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei
2018-05-01
Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.
Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-12-20
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-09-30
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
Rhee, Mun Su; Kim, Jin-Woo; Qian, Yilei; Ingram, L O; Shanmugam, K T
2007-07-01
Bacillus coagulans is a sporogenic lactic acid bacterium that ferments glucose and xylose, major components of plant biomass, a potential feedstock for cellulosic ethanol. The temperature and pH for optimum rate of growth of B. coagulans (50 to 55 degrees C, pH 5.0) are very similar to that of commercially developed fungal cellulases (50 degrees C; pH 4.8). Due to this match, simultaneous saccharification and fermentation (SSF) of cellulose to products by B. coagulans is expected to require less cellulase than needed if the SSF is conducted at a sub-optimal temperature, such as 30 degrees C, the optimum for yeast, the main biocatalyst used by the ethanol industry. To fully exploit B. coagulans as a platform organism, we have developed an electroporation method to transfer plasmid DNA into this genetically recalcitrant bacterium. We also constructed a B. coagulans/E. coli shuttle vector, plasmid pMSR10 that contains the rep region from a native plasmid (pMSR0) present in B. coagulans strain P4-102B. The native plasmid, pMSR0 (6823bp), has 9 ORFs, and replicates by rolling-circle mode of replication. Plasmid pNW33N, developed for Geobacillus stearothermophilus, was also transformed into this host and stably maintained while several other Bacillus/Escherichia coli shuttle vector plasmids were not transformed into B. coagulans. The transformation efficiency of B. coagulans strain P4-102B using the plasmids pNW33N or pMSR10 was about 1.5x10(16) per mole of DNA. The availability of shuttle vectors and an electroporation method is expected to aid in genetic and metabolic engineering of B. coagulans.
Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.
Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C
1997-01-01
We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus. PMID:9097439
Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.
Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C
1997-04-01
We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus.
Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R
1992-01-01
The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011
Characterization of the aes gene of Escherichia coli encoding an enzyme with esterase activity.
Peist, R; Koch, A; Bolek, P; Sewitz, S; Kolbus, T; Boos, W
1997-01-01
malQ mutants of Escherichia coli lacking amylomaltase cannot grow on maltose. They express the maltose system constitutively and are sensitive to maltose when grown on another carbon source. In an attempt to isolate a multicopy suppressor that would result in growth on maltose, we transformed a malQ mutant with a gene bank of E. coli DNA which had been digested with Sau3a and cloned in pBR322. We screened the transformants on MacConkey maltose plates. A colony was isolated that appeared to be resistant to maltose and was pink on these plates, but it was still unable to grow on minimal medium with maltose as the carbon source. The plasmid was isolated, and the gene causing this phenotype was characterized. The deduced amino acid sequence of the encoded protein shows homology to that of lipases and esterases. We termed the gene aes, for acetyl esterase. Extracts of cells harboring plasmid-encoded aes under its own promoter exhibit a fivefold higher capacity to hydrolyze p-nitrophenyl acetate than do extracts of cells of plasmid-free strains. Similarly, strains harboring plasmid-encoded aes are able to grow on triacetyl glycerol (triacetin) whereas the plasmid-free strains are not. The expression of plasmid-encoded aes resulted in strong repression of the maltose transport genes in malT+ strains (10-fold reduction), but not in a malT(Con) strain which is independent of the inducer. Also, overproduction of MalT counteracted the Aes-dependent repression, indicating a direct interaction between MalT and Aes. PMID:9401025
Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O
2011-07-01
Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.
Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A; Agu, Chukwuma A; Wang, Xindan; Bernal, Juan A; Sherratt, David J; de la Cueva-Méndez, Guillermo
2014-02-18
Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid-bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs.
Pimentel, Belén; Nair, Radhika; Bermejo-Rodríguez, Camino; Preston, Mark A.; Agu, Chukwuma A.; Wang, Xindan; Bernal, Juan A.; Sherratt, David J.; de la Cueva-Méndez, Guillermo
2014-01-01
Worldwide dissemination of antibiotic resistance in bacteria is facilitated by plasmids that encode postsegregational killing (PSK) systems. These produce a stable toxin (T) and a labile antitoxin (A) conditioning cell survival to plasmid maintenance, because only this ensures neutralization of toxicity. Shortage of antibiotic alternatives and the link of TA pairs to PSK have stimulated the opinion that premature toxin activation could be used to kill these recalcitrant organisms in the clinic. However, validation of TA pairs as therapeutic targets requires unambiguous understanding of their mode of action, consequences for cell viability, and function in plasmids. Conflicting with widespread notions concerning these issues, we had proposed that the TA pair kis-kid (killing suppressor-killing determinant) might function as a plasmid rescue system and not as a PSK system, but this remained to be validated. Here, we aimed to clarify unsettled mechanistic aspects of Kid activation, and of the effects of this for kis-kid–bearing plasmids and their host cells. We confirm that activation of Kid occurs in cells that are about to lose the toxin-encoding plasmid, and we show that this provokes highly selective restriction of protein outputs that inhibits cell division temporarily, avoiding plasmid loss, and stimulates DNA replication, promoting plasmid rescue. Kis and Kid are conserved in plasmids encoding multiple antibiotic resistance genes, including extended spectrum β-lactamases, for which therapeutic options are scarce, and our findings advise against the activation of this TA pair to fight pathogens carrying these extrachromosomal DNAs. PMID:24449860
Miyamoto, Kazuaki; Li, Jihong; Sayeed, Sameera; Akimoto, Shigeru; McClane, Bruce A
2008-11-01
Clostridium perfringens type B and D isolates produce epsilon-toxin, the third most potent clostridial toxin. The epsilon-toxin gene (etx) is plasmid borne in type D isolates, but etx genetics have been poorly studied in type B isolates. This study reports the first sequencing of any etx plasmid, i.e., pCP8533etx, from type B strain NCTC8533. This etx plasmid is 64.7 kb, carries tcp conjugative transfer genes, and encodes additional potential virulence factors including beta2-toxin, sortase, and collagen adhesin but not beta-toxin. Interestingly, nearly 80% of pCP8533etx open reading frames (ORFs) are also present on pCPF5603, an enterotoxin-encoding plasmid from type A isolate F5603. Pulsed-field gel electrophoresis and overlapping PCR indicated that a pCP8533etx-like etx plasmid is also present in most, if not all, other type B isolates and some beta2-toxin-positive, cpe-negative type D isolates, while other type D isolates carry different etx plasmids. Sequences upstream of the etx gene vary between type B isolates and some type D isolates that do not carry a pCP8533etx-like etx plasmid. However, nearly all type B and D isolates have an etx locus with an upstream IS1151, and those etx loci typically reside near a dcm ORF. These results suggest that pCPF5603 and pCP8533etx evolved from insertion of mobile genetic elements carrying enterotoxin or etx genes, respectively, onto a common progenitor plasmid.
He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan
2016-08-01
The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.
Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J
1998-01-01
A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested that the "white" phenotype was the result of an insertional inactivation of an unknown chromosomal gene by Mucts62, which reduced the tellurite uptake.
Hong, Hyerim; Jung, Jaejoon; Park, Woojun
2014-01-01
Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538
Hong, Hyerim; Jung, Jaejoon; Park, Woojun
2014-01-01
Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment.
Kim, K S; Chilton, W S; Farrand, S K
1996-01-01
The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors. PMID:8655510
Kim, K S; Chilton, W S; Farrand, S K
1996-06-01
The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors.
A Simple And Rapid Minicircle DNA Vector Manufacturing System
Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying
2010-01-01
Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455
Wehmeier, U F
1995-11-07
Four new shuttle vectors for Escherichia coli (Ec) and Streptomyces, pUWL218, pUWL219, pUWL-SK and pUWL-KS, which permit recognition of recombinant (re-) plasmids on XGal plates in Ec, were constructed. These vectors contain the replication functions of the Streptomyces wide-host-range multicopy plasmid pIJ101, the tsr gene conferring resistance to thiostrepton in Streptomyces, the ColEI origin of replication from the pUC plasmids for replication in Ec and the bla gene conferring resistance to ampicillin in Ec. They possess multiple cloning sites with a number of unique restriction sites and allow direct sequencing of re-derivatives using the pUC sequencing primers.
Stable zymomonas mobilis xylose and arabinose fermenting strains
Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW
2008-04-08
The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.
Multiplexing clonality: combining RGB marking and genetic barcoding
Cornils, Kerstin; Thielecke, Lars; Hüser, Svenja; Forgber, Michael; Thomaschewski, Michael; Kleist, Nadja; Hussein, Kais; Riecken, Kristoffer; Volz, Tassilo; Gerdes, Sebastian; Glauche, Ingmar; Dahl, Andreas; Dandri, Maura; Roeder, Ingo; Fehse, Boris
2014-01-01
RGB marking and DNA barcoding are two cutting-edge technologies in the field of clonal cell marking. To combine the virtues of both approaches, we equipped LeGO vectors encoding red, green or blue fluorescent proteins with complex DNA barcodes carrying color-specific signatures. For these vectors, we generated highly complex plasmid libraries that were used for the production of barcoded lentiviral vector particles. In proof-of-principle experiments, we used barcoded vectors for RGB marking of cell lines and primary murine hepatocytes. We applied single-cell polymerase chain reaction to decipher barcode signatures of individual RGB-marked cells expressing defined color hues. This enabled us to prove clonal identity of cells with one and the same RGB color. Also, we made use of barcoded vectors to investigate clonal development of leukemia induced by ectopic oncogene expression in murine hematopoietic cells. In conclusion, by combining RGB marking and DNA barcoding, we have established a novel technique for the unambiguous genetic marking of individual cells in the context of normal regeneration as well as malignant outgrowth. Moreover, the introduction of color-specific signatures in barcodes will facilitate studies on the impact of different variables (e.g. vector type, transgenes, culture conditions) in the context of competitive repopulation studies. PMID:24476916
Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference
Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi
2018-01-01
Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933
van Mastrigt, Oscar; Lommers, Marcel M A N; de Vries, Yorick C; Abee, Tjakko; Smid, Eddy J
2018-03-23
Lactic acid bacteria can carry multiple plasmids affecting their performance in dairy fermentations. The expression of plasmid-encoded genes and the activity of the corresponding proteins is severely affected by changes in the number of plasmid copies. We studied the impact of growth rate on dynamics of plasmid copy numbers at high growth rates in chemostat cultures and down to near-zero growth rates in retentostat cultures. Five plasmids of the dairy strain Lactococcus lactis FM03-V1 were selected which varied in size (3 to 39 kb), in replication mechanism (theta or rolling-circle) and in putative (dairy-associated) functions. Copy numbers ranged from 1.5 to 40.5 and the copy number of theta-type replicating plasmids were negatively correlated to the plasmid size. Despite the extremely wide range of growth rates (0.0003 h -1 to 0.6 h -1 ), copy numbers of the five plasmids were stable and only slightly increased at near-zero growth rates showing that the plasmid replication rate was strictly controlled. One low-copy number plasmid, carrying a large exopolysaccharide gene cluster, was segregationally unstable during retentostat cultivations reflected in complete loss of the plasmid in one of the retentostat cultures. The copy number of the five plasmids was also hardly affected by varying the pH value, nutrient limitation or presence of citrate (maximum 2.2-fold) signifying the stability in copy number of the plasmids. Importance Lactococcus lactis is extensively used in starter cultures for dairy fermentations. Important traits for growth and survival of L. lactis in dairy fermentations are encoded by genes located on plasmids, such as genes involved in lactose and citrate metabolism, protein degradation and oligopeptide uptake and bacteriophage resistance. Because the number of plasmid copies could affect the expression of plasmid-encoded genes, it is important to know the factors that influence the plasmid copy numbers. We monitored plasmid copy numbers of L. lactis at near-zero growth rates, characteristic for cheese ripening. Moreover, we analysed the effect of pH, nutrient limitation and presence of citrate. This showed that plasmid copy numbers were stable giving insight into plasmid copy number dynamics in dairy fermentations. Copyright © 2018 American Society for Microbiology.
Deb, J K; Nath, N
1999-06-01
Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.
USDA-ARS?s Scientific Manuscript database
A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...
Yang, V W; Marks, J A; Davis, B P; Jeffries, T W
1994-01-01
This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063
Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan
2017-08-03
One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.
Fu, X; Xu, J G
2000-01-01
A chromosome-plasmid balanced lethal gene delivery system for Lactobacillus acidophilus based on the thyA gene was developed. The selected L. acidophilus DOM La strain carries a mutated thyA gene and has an obligate requirement for thymidine. This strain can be used as a host for the constructed shuttle vector pFXL03, lacking antibiotic-resistant markers but having the wild-type thyA gene from L. casei which complements the thyA chromosomal mutation. The vector also contains the replicon region from plasmid pUC19 and that of the Lactococcus plasmid pWV01, which allows the transfer between Escherichia coli, L. casei and L. acidophilus. Eight unique restriction sites (i.e., PstI, HindIII, SphI, SalI, AccI, XbaI, KpnI and SacI) are available for cloning. After 40-time transfers in modified MRS medium, no plasmid loss was observed. The vector pFXL03 is potentially useful as a food-grade vaccine delivery system for L. acidophilus.
Heuermann, D; Haas, R
1998-03-01
A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.
Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki
2000-01-01
A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203
Characterization of a cryptic plasmid from an alpha-proteobacterial endosymbiont of Amoeba proteus.
Park, Miey; Kim, Min-Soo; Lee, Kyung-Min; Hwang, Sue-Yun; Ahn, Tae In
2009-01-01
A new cryptic plasmid pAP3.9 was discovered in symbiotic alpha-proteobacteria present in the cytoplasm of Amoeba proteus. The plasmid is 3869bp with a GC content of 34.66% and contains replication origins for both double-strand (dso) and single-strand (sso). It has three putative ORFs encoding Mob, Rep and phosphoglycolate phosphatase (PGPase). The pAP3.9 plasmid appears to propagate by the conjugative rolling-circle replication (RCR), since it contains all required factors such as Rep, sso and dso. Mob and Rep showed highest similarities to those of the cryptic plasmid pBMYdx in Bacillus mycoides. The PGPase was homologous to that of Bacillus cereus and formed a clade with those of Bacillus sp. in molecular phylogeny. These results imply that the pAP3.9 plasmid evolved by the passage through Bacillus species. We hypothesize that the plasmid-encoded PGPase may have contributed to the establishment of bacterial symbiosis within the hostile environment of amoeba cytoplasm.
Groom, Joseph; Chung, Daehwan; Kim, Sun-Ki; Guss, Adam; Westpheling, Janet
2018-05-28
A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (≥ 60 °C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a result also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ∆recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chung, Daehwan; Groom, Joseph; Kim, Sun-Ki
A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (>/= 60 degrees C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a resultmore » also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ..delta..recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.« less
Keelara, Shivaramu; Thakur, Siddhartha
2014-09-17
The aim of this study was to characterize and determine the inter-serovar exchange of AmpC β-lactamase conferring plasmids isolated from humans, pigs and the swine environment. Plasmids isolated from a total of 21 antimicrobial resistant (AMR) Salmonella isolates representing human clinical cases (n=6), pigs (n=6) and the swine farm environment (n=9) were characterized by replicon typing and restriction digestion, inter-serovar transferability by conjugation, and presence of AmpC β-lactamase enzyme encoding gene blaCMY-2 by southern hybridization. Based on replicon typing, the majority (17/21, 81%) of the plasmids belonged to the I1-Iγ Inc group and were between 70 and 103kb. The potential for inter-serovar plasmid transfer was further confirmed by the PCR detection of AMR genes on the plasmids isolated from trans-conjugants. Plasmids from Salmonella serovars Anatum, Ouakam, Johannesburg and Typhimurium isolated from the same cohort of pigs and their environment and S. Heidelberg from a single human clinical isolate had identical plasmids based on digestion with multiple restriction enzymes (EcoRI, HindIII and PstI) and southern blotting. We demonstrated likely horizontal inter-serovar exchange of plasmid-encoding AmpC β-lactamases resistance among MDR Salmonella serotypes isolated from pigs, swine farm environment and clinical human cases. This study provides valuable information on the role of the swine farm environment and by extension other livestock farm environments, as a potential reservoir of resistant bacterial strains that potentially transmit resistance determinants to livestock, in this case, swine, humans and possibly other hosts by horizontal exchange of plasmids. Copyright © 2014 Elsevier B.V. All rights reserved.
Apaolaza, P S; Del Pozo-Rodríguez, A; Torrecilla, J; Rodríguez-Gascón, A; Rodríguez, J M; Friedrich, U; Weber, B H F; Solinís, M A
2015-11-10
X-linked juvenile retinoschisis (XLRS), which results from mutations in the gene RS1 that encodes the protein retinoschisin, is a retinal degenerative disease affecting between 1/5000 and 1/25,000 people worldwide. Currently, there is no cure for this disease and the treatment is based on the application of low-vision aids. The aim of the present work was the in vitro and in vivo evaluation of two different non-viral vectors based on solid lipid nanoparticles (SLNs), protamine and two anionic polysaccharides, hyaluronic acid (HA) or dextran (DX), for the treatment of XLRS. First, the vectors containing a plasmid which encodes both the reporter green fluorescent protein (GFP) and the therapeutic protein retinoschisin, under the control of CMV promoters, were characterized in vitro. Then, the vectors were subretinally or intravitreally administrated to C57BL/6 wild type mice. One week later, GFP was detected in all treated mice and in all retinal layers except in the Outer Nuclear Layer (ONL) and the Inner Nuclear Layer (INL), regardless of the administration route and the vector employed. Finally, two weeks after subretinal or intravitreal injection to Rs1h-deficient mice, GFP and retinoschisin expression was detected in all retinal layers, except in the ONL, which was maintained for at least two months after subretinal administration. The structural analysis of the treated Rs1h-deficient eyes showed a partial recovery of the retina related to the production of retinoschisin. This work shows for the first time a successful RS1 gene transfer to Rs1h-deficient animals using non-viral nanocarriers, with promising results that point to non-viral gene therapy as a feasible future therapeutic tool for retinal disorders.
Back to basics: pBR322 and protein expression systems in E. coli.
Balbás, Paulina; Bolívar, Francisco
2004-01-01
The extensive variety of plasmid-based expression systems in E. coli resulted from the fact that there is no single strategy for achieving maximal expression of every cloned gene. Although a number of strategies have been implemented to deal with problems associated to gene transcription and translation, protein folding, secretion, location, posttranslational modifications, particularities of different strains, and the like and more integrated processes have been developed, the basic plasmid-borne elements and their interaction with the particular host strain will influence the overall expression system and final productivity. Plasmid vector pBR322 is a well-established multipurpose cloning vector in laboratories worldwide, and a large number of derivatives have been created for specific applications and research purposes, including gene expression in its natural host, E. coli, and few other bacteria. The early characterization of the molecule, including its nucleotide sequence, replication and maintenance mechanisms, and determination of its coding regions, accounted for its success, not only as a universal cloning vector, but also as a provider of genes and an origin of replication for other intraspecies vectors. Since the publication of the aforementioned reviews, novel discoveries pertaining to these issues have appeared in the literature that deepen the understanding of the plasmid's features, behavior, and impact in gene expression systems, as well as some important strain characteristics that affect plasmid replication and stability. The objectives of this review include updating and discussing the new information about (1) the replication and maintenance of pBR322; (2) the host-related modulation mechanisms of plasmid replication; (3) the effects of growth rate on replication control, stability, and recombinant gene expression; (4) ways for plasmid amplification and elimination. Finally, (5) a summary of novel ancillary studies about pBR322 is presented.
Rossi, Franca; Capodaglio, Alessandro; Dellaglio, Franco
2008-08-01
This report describes the vector-free engineering of Lactobacillus plantarum by chromosomal integration of an exogenous gene without inactivation of physiological traits. The integrative plasmid vector pP7B6 was derived from pGIP73 by replacing the cbh site, encoding the L. plantarum conjugated bile salt hydrolase, with the prophage fragment P7B6, from L. plantarum Lp80 (DSM 4229). Plasmid pP7B6NI was obtained by inserting the nisin immunity gene nisI of Lactococcus lactis subsp. lactis DSM 20729, preceded by the constitutive promoter P32 from the same strain, in a unique XbaI site of fragment P7B6 and was used to electrotransform L. plantarum Lp80. A food grade recombinant L. plantarum Lp80NI, with 480-fold higher immunity to nisin than the wild type, was derived by integration of pP7B6NI followed by the excision of pP7B6. Polymerase chain reaction tests demonstrated that the integration of nisI in the prophage region had occurred and that the erythromycin resistance marker from pP7B6 was lost. Fifteen among 31 L. plantarum strains tested hybridized with P7B6, indicating that the integration of pP7B6-derived vectors might occur in some other L. plantarum strains. This was experimentally confirmed by constructing the recombinant strain L. plantarum LZNI from the dairy isolate L. plantarum LZ (LMG 24600).
Ruiz-Masó, José Á.; Luengo, Luis M.; Moreno-Córdoba, Inmaculada; Díaz-Orejas, Ramón; del Solar, Gloria
2017-01-01
Although differing in size, encoded traits, host range, and replication mechanism, both narrow-host-range theta-type conjugative enterobacterial plasmid R1 and promiscuous rolling-circle-type mobilizable streptococcal plasmid pMV158 encode a transcriptional repressor protein, namely CopB in R1 and CopG in pMV158, involved in replication control. The gene encoding CopB or CopG is cotranscribed with a downstream gene that encodes the replication initiator Rep protein of the corresponding plasmid. However, whereas CopG is an auto-repressor that inhibits transcription of the entire copG-repB operon, CopB is expressed constitutively and represses a second, downstream promoter that directs transcription of repA. As a consequence of the distinct regulatory pathways implied by CopB and CopG, these repressor proteins play a different role in control of plasmid replication during the steady state: while CopB has an auxiliary role by keeping repressed the regulated promoter whenever the plasmid copy number is above a low threshold, CopG plays a primary role by acting coordinately with RNAII. Here, we have studied the role of the regulatory circuit mediated by these transcriptional repressors during the establishment of these two plasmids in a new host cell, and found that excess Cop repressor molecules in the recipient cell result in a severe decrease in the frequency and/or the velocity of appearance of transformant colonies for the cognate plasmid but not for unrelated plasmids. Using the pMV158 replicon as a model system, together with highly sensitive real-time qPCR and inverse PCR methods, we have also analyzed the effect of CopG on the kinetics of repopulation of the plasmid in Streptococcus pneumoniae. We show that, whereas in the absence of CopG pMV158 repopulation occurs mainly during the first 45 min following plasmid transfer, the presence of the transcriptional repressor in the recipient cell severely impairs the replicon repopulation and makes the plasmid replicate at approximately the same rate as the chromosome at any time after transformation, which results in maximal plasmid loss rate in the absence of selection. Overall, these findings indicate that unrepressed activity of the Cop-regulated promoter is crucial for the successful colonization of the recipient bacterial cells by the plasmid. PMID:29250051
Morris, C J; Lidstrom, M E
1992-01-01
In Methylobacterium extorquens AM1, gene encoding methanol dehydrogenase polypeptides are transcriptionally regulated in response to C1 compounds, including methanol (M. E. Lidstrom and D. I. Stirling, Annu. Rev. Microbiol. 44:27-57, 1990). In order to study this regulation, a transcriptional fusion has been constructed between a beta-galactosidase reporter gene and a 1.55-kb XhoI-SalI fragment of M. extorquens AM1rif DNA encoding the N terminus of the methanol dehydrogenase large subunit (moxF) and 1,289 bp of upstream DNA. The fusion exhibited orientation-specific promoter activity in M. extorquens AM1rif but was expressed constitutively when the transcriptional fusion was located on the plasmid. However, correct regulation was restored when the construction was inserted in the M. extorquens AM1rif chromosome. This DNA fragment was shown to contain both the moxFJGI promoter and the sequences necessary in cis for its transcriptional regulation by methanol. Transcription from this promoter was studied in the M. extorquens AM1rif moxB mutant strains UV4rif and UV25rif, which have a pleiotropic phenotype with regard to the components of methanol oxidation. In these mutants, beta-galactosidase activity from the fusion was reduced to a level equal to that of the vector background when the fusion was present in both plasmid and chromosomal locations. Since both constitutive and methanol-inducible promoter activities were lost in the mutants, moxB appears to be required for transcription of the genes encoding the methanol dehydrogenase polypeptides. Images PMID:1624436
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goodyer, P.R.; Torban, E.; Dehbi, M.
1994-09-01
The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less
Cheng, Jun; Ye, Ying; Wang, Ying-ying; Li, Hui; Li, Xu; Li, Jia-bin
2008-02-01
The aim of the present study was to study the phenotypic and molecular characterization of 5 novel CTX-M-beta-1actamases carried by 5 Klebsiella pneumoniae isolates and 3 Escherichia coli isolates collected from 4 hospitals in Hefei, China. The purified PCR products were ligated with pGEM-Teasy vectors, expressed, and sequenced. The complete genes of the CTX-M-beta-lactamases were ligated with the pHSG398 vector to express prokaryotic recombinant proteins. Plasmids were extracted by rapid alkaline lysis protocol, and the PCR method was performed to determine whether the prokaryotic expression was successful or not. Antimicrobial susceptibility was tested and the phenotypes of transformants were determined according to criteria recommended by the Clinical and Laboratory Standards Institute. The kinetic parameters of enzymes were confirmed. The isoelectric points (pI) were determined by isoelectric focusing assay. Pulsed-field gel electrophoresis and plasmid profiling were performed. The PCR products had 1101 nucleotides and were determined as CTX-M-46, CTX-M-47, CTX-M-48, CTX-M-49, and CTX-M-50. All strains were resistant to cefotaxime, but most of them were susceptible or intermediate to ceftazidime. The phenotypes of novel enzymes were determined as extended-spectrum-beta-lactamases (ESBL). Penicillin G, cephalothin, cefuroxime, and cefotaxime were determined to good substrates, whereas ceftazidime hydrolysis was not detected. The pI of the 5 novel CTX-M-beta-lactamases were 8.0. CTX-M-derivatives could be the multiplex genesis in our area. This is the first report of these 5 novel plasmid-mediated CTX-M ESBL produced from China in the world. Molecular typing reveals notably different origin in genes encoding different CTX-M variants of 8 strains.
Rodriguez, Alberto; Martínez, Juan A; Millard, Pierre; Gosset, Guillermo; Portais, Jean-Charles; Létisse, Fabien; Bolivar, Francisco
2017-06-01
Metabolic engineering strategies applied over the last two decades to produce shikimate (SA) in Escherichia coli have resulted in a battery of strains bearing many expression systems. However, the effects that these systems have on the host physiology and how they impact the production of SA are still not well understood. In this work we utilized an engineered E. coli strain to determine the consequences of carrying a vector that promotes SA production from glucose with a high-yield but that is also expected to impose a significant cellular burden. Kinetic comparisons in fermentors showed that instead of exerting a negative effect, the sole presence of the plasmid increased glucose consumption without diminishing the growth rate. By constitutively expressing a biosynthetic operon from this vector, the more active glycolytic metabolism was exploited to redirect intermediates toward the production of SA, which further increased the glucose consumption rate and avoided excess acetate production. Fluxomics and metabolomics experiments revealed a global remodeling of the carbon and energy metabolism in the production strain, where the increased SA production reduced the carbon available for oxidative and fermentative pathways. Moreover, the results showed that the production of SA relies on a specific setup of the pentose phosphate pathway, where both its oxidative and non-oxidative branches are strongly activated to supply erythrose-4-phosphate and balance the NADPH requirements. This work improves our understanding of the metabolic reorganization observed in E. coli in response to the plasmid-based expression of the SA biosynthetic pathway. Biotechnol. Bioeng. 2017;114: 1319-1330. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Yin, Ling-Ling; Ruan, Su-Hong; Tian, Yu; Zhao, Kai; Xu, Kai Lin
2015-10-01
To clone the variable region genes of human anti-IL1RAP (IL-1 receptor accessory protein) monoclonal antibodies (McAb) and to construct IL1RAP chimeric antigen receptors (CARs). The VH and VL DNA of IL1RAP single chain antibodies were amplified by RACE and overlap extension PCR from total RNA extracted from 3H6E10 and 10D8A7 hybridoma and ligated into specific IL1RAP single-chain variable fragments (scFv). CD8α transmembrane domain, CD137 intracellular domain, TCR ζ chain, human CD8α signal peptide and scFv-anti-IL1RAP were cloned into plasmid LV-lac. Recombinant lentiviruses were generated by co-transfection of recombinant plasmid LV-lac, pMD2. G, and psPAX2 helper vectors into 293FT packing cells. The VH and VL genes of 2 human anti-IL1RAP McAb were acquired. The 3H6E10 VH and VL genes consisted of 402 bp and 393 bp encoding 134 and 131 aminoacid residues, respectively; 10D8A7 VH and VL genes consisted of 423 bp and 381 bp encoding 141 and 127 amine acid residues, respectively. Recombinant expression vertors LV-3H6E10 scFv-ICD and LV-10D8A7 scFv-ICD (ICD: CD8α transmembrane domain-CD137 intracellular domain-TCR ζ chain) were constructed. The target fragments were demonstrated by sequencing analysis. Recombinant plasmids were transfected into 293FT cells and lentiviral particles were acquired. Human anti-IL1RAP recombinant receptors are constructed successfully and lay a good foundation for the construction of IL1RAP-CAR killer T cell vaccine.
Puckette, Michael; Burrage, Thomas; Neilan, John G; Rasmussen, Max
2017-06-12
The Gaussia princeps luciferase is used as a stand-alone reporter of transgene expression for in vitro and in vivo expression systems due to the rapid and easy monitoring of luciferase activity. We sought to simultaneously quantitate production of other recombinant proteins by transcriptionally linking the Gaussia princeps luciferase gene to other genes of interest through the foot-and-mouth disease virus 2A translational interrupter sequence. We produced six plasmids, each encoding a single open reading frame, with the foot-and-mouth disease virus 2A sequence placed either N-terminal or C-terminal to the Gaussia princeps luciferase gene. Two plasmids included novel Gaussia princeps luciferase variants with the position 1 methionine deleted. Placing a foot-and-mouth disease virus 2A translational interrupter sequence on either the N- or C-terminus of the Gaussia princeps luciferase gene did not prevent the secretion or luminescence of resulting chimeric luciferase proteins. We also measured the ability of another polycistronic plasmid vector with a 2A-luciferase sequence placed downstream of the foot-and-mouth disease virus P1 and 3C protease genes to produce of foot-and-mouth disease virus-like particles and luciferase activity from transfected cells. Incorporation of the 2A-luciferase sequence into a transgene encoding foot-and-mouth disease virus structural proteins retained luciferase activity and the ability to form virus-like particles. We demonstrated a mechanism for the near real-time, sequential, non-destructive quantitative monitoring of transcriptionally-linked recombinant proteins and a valuable method for monitoring transgene expression in recombinant vaccine constructs.
Muscholl-Silberhorn, Albrecht B.
2000-01-01
Conjugative transfer of Enterococcus faecalis-specific sex pheromone plasmids relies on an adhesin, called aggregation substance, to confer a tight cell-to-cell contact between the mating partners. To analyze the dependence of pAD1-encoded aggregation substance, Asa1, on pheromone induction, a variety of upstream fragments were fused to an α-amylase reporter gene, amyL, by use of a novel promoter probe vector, pAMY-em1. For pheromone-regulated α-amylase activity, a total of at least six genes, traB, traC, traA, traE1, orfY, and orf1, are required: TraB efficiently represses asa1 (by a mechanism unrelated to its presumptive function in pheromone shutdown, since a complete shutdown is observed exclusively in the presence of traC); only traC can relieve traB-mediated repression in a pheromone-dependent manner. In addition to traB, traA is required but not sufficient for negative control. Mutational inactivation of traE1, orfY, or orf1, respectively, results in a total loss of α-amylase activity for constructs normally mediating constitutive expression. Inversion of a fragment covering traA, P0, and traE1 without disrupting any gene or control element switches off amyL or asa1 expression, indicating the involvement of a cis-acting, orientation-dependent factor (as had been shown for plasmid pCF10). Unexpectedly, pAD1 represses all pAMY-em1 derivatives in trans, while its own pheromone-dependent functions are unaffected. The discrepancy between the new data and those of former studies defining TraE1 as a trans-acting positive regulator is discussed. PMID:10850999
Wolk, C P; Vonshak, A; Kehoe, P; Elhai, J
1984-01-01
Wild-type cyanobacteria of the genus Anabaena are capable of oxygenic photosynthesis, differentiation of cells called heterocysts at semiregular intervals along the cyanobacterial filaments, and aerobic nitrogen fixation by the heterocysts. To foster analysis of the physiological processes characteristic of these cyanobacteria, we have constructed a family of shuttle vectors capable of replication and selection in Escherichia coli and, in unaltered form, in several strains of Anabaena. Highly efficient conjugative transfer of these vectors from E. coli to Anabaena is dependent upon the presence of broad host-range plasmid RP-4 and of helper plasmids. The shuttle vectors contain portions of plasmid pBR322 required for replication and mobilization, with sites for Anabaena restriction enzymes deleted; cyanobacterial replicon pDU1, which lacks such sites; and determinants for resistance to chloramphenicol, streptomycin, neomycin, and erythromycin. Images PMID:6324204
Development of new plasmid DNA vaccine vectors with R1-based replicons
2012-01-01
Background There has been renewed interest in biopharmaceuticals based on plasmid DNA (pDNA) in recent years due to the approval of several veterinary DNA vaccines, on-going clinical trials of human pDNA-based therapies, and significant advances in adjuvants and delivery vehicles that have helped overcome earlier efficacy deficits. With this interest comes the need for high-yield, cost-effective manufacturing processes. To this end, vector engineering is one promising strategy to improve plasmid production. Results In this work, we have constructed a new DNA vaccine vector, pDMB02-GFP, containing the runaway R1 origin of replication. The runaway replication phenotype should result in plasmid copy number amplification after a temperature shift from 30°C to 42°C. However, using Escherichia coli DH5α as a host, we observed that the highest yields of pDMB02-GFP were achieved during constant-temperature culture at 30°C, with a maximum yield of approximately 19 mg pDNA/g DCW being observed. By measuring mRNA and protein levels of the R1 replication initiator protein, RepA, we determined that RepA may be limiting pDMB02-GFP yield at 42°C. A mutant plasmid, pDMB-ATG, was constructed by changing the repA start codon from the sub-optimal GTG to ATG. In cultures of DH5α[pDMB-ATG], temperature-induced plasmid amplification was more dramatic than that observed with pDMB02-GFP, and RepA protein was detectable for several hours longer than in cultures of pDMB02-GFP at 42°C. Conclusions Overall, we have demonstrated that R1-based plasmids can produce high yields of high-quality pDNA without the need for a temperature shift, and have laid the groundwork for further investigation of this class of vectors in the context of plasmid DNA production. PMID:22889338
A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.
Brandenburger, A; Russell, S
1996-10-01
MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.
Smith, Hilde; Bossers, Alex; Harders, Frank; Wu, Guanghui; Woodford, Neil; Schwarz, Stefan; Guerra, Beatriz; Rodríguez, Irene; van Essen-Zandbergen, Alieda; Brouwer, Michael; Mevius, Dik
2015-09-01
The aim of the study was to identify the plasmid-encoded factors contributing to the emergence and spread of epidemic IncI1-Iγ plasmids obtained from Escherichia coli and Salmonella enterica isolates from animal and human reservoirs. For this, 251 IncI1-Iγ plasmids carrying various extended-spectrum β-lactamase (ESBL) or AmpC β-lactamase genes were compared using plasmid multilocus sequence typing (pMLST). Thirty-two of these plasmids belonging to different pMLST types were sequenced using Roche 454 and Illumina platforms. Epidemic IncI1-Iγ plasmids could be assigned to various dominant clades, whereas rarely detected plasmids clustered together as a distinct clade. Similar phylogenetic trees were obtained using only the plasmid backbone sequences, showing that the differences observed between the plasmids belonging to distinct clades resulted mainly from differences between their backbone sequences. Plasmids belonging to the various clades differed particularly in the presence/absence of genes encoding partitioning and addiction systems, which contribute to stable inheritance during cell division and plasmid maintenance. Despite this, plasmids belonging to the various phylogenetic clades also showed marked resistance gene associations, indicating the circulation of successful plasmid-gene combinations. The variation in traY and excA genes found in IncI1-Iγ plasmids is conserved within pMLST sequence types and plays a role in incompatibility, although functional study is needed to elucidate the role of these genes in plasmid epidemiology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Design and construction of functional AAV vectors.
Gray, John T; Zolotukhin, Serge
2011-01-01
Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.
Aoshima, Yumiko; Hokama, Ryosuke; Sou, Keitaro; Sarker, Satya Ranjan; Iida, Kabuto; Nakamura, Hideki; Inoue, Takafumi; Takeoka, Shinji
2013-12-18
The delivery of specific genes into neurons offers a potent approach for treatment of diseases as well as for the study of neuronal cell biology. Here we investigated the capabilities of cationic amino acid based lipid assemblies to act as nonviral gene delivery vectors in primary cultured neurons. An arginine-based lipid, Arg-C3-Glu2C14, and a lysine-based lipid, Lys-C3-Glu2C14, with two different types of counterion, chloride ion (Cl-) and trifluoroacetic acid (TFA-), were shown to successfully mediate transfection of primary cultured neurons with plasmid DNA encoding green fluorescent protein. Among four types of lipids, we optimized their conditions such as the lipid-to-DNA ratio and the amount of pDNA and conducted a cytotoxicity assay at the same time. Overall, Arg-C3-Glu2C14 with TFA- induced a rate of transfection in primary cultured neurons higher than that of Lys-C3-Glu2C14 using an optimal weight ratio of lipid-to-plasmid DNA of 1. Moreover, it was suggested that Arg-C3-Glu2C14 with TFA- showed the optimized value higher than that of Lipofectamine2000 in experimental conditions. Thus, Arg-C3-Glu2C14 with TFA- is a promising candidate as a reliable transfection reagent for primary cultured neurons with a relatively low cytotoxicity.
2013-01-01
The delivery of specific genes into neurons offers a potent approach for treatment of diseases as well as for the study of neuronal cell biology. Here we investigated the capabilities of cationic amino acid based lipid assemblies to act as nonviral gene delivery vectors in primary cultured neurons. An arginine-based lipid, Arg-C3-Glu2C14, and a lysine-based lipid, Lys-C3-Glu2C14, with two different types of counterion, chloride ion (Cl–) and trifluoroacetic acid (TFA–), were shown to successfully mediate transfection of primary cultured neurons with plasmid DNA encoding green fluorescent protein. Among four types of lipids, we optimized their conditions such as the lipid-to-DNA ratio and the amount of pDNA and conducted a cytotoxicity assay at the same time. Overall, Arg-C3-Glu2C14 with TFA– induced a rate of transfection in primary cultured neurons higher than that of Lys-C3-Glu2C14 using an optimal weight ratio of lipid-to-plasmid DNA of 1. Moreover, it was suggested that Arg-C3-Glu2C14 with TFA– showed the optimized value higher than that of Lipofectamine2000 in experimental conditions. Thus, Arg-C3-Glu2C14 with TFA– is a promising candidate as a reliable transfection reagent for primary cultured neurons with a relatively low cytotoxicity. PMID:24087930
Mehlmer, Norbert; Parvin, Nargis; Hurst, Charlotte H.; Knight, Marc R.; Teige, Markus; Vothknecht, Ute C.
2014-01-01
Calcium has long been acknowledged as one of the most important signalling components in plants. Many abiotic and biotic stimuli are transduced into a cellular response by temporal and spatial changes in cellular calcium concentration and the calcium-sensitive protein aequorin has been exploited as a genetically encoded calcium indicator for the measurement of calcium in planta. The objective of this work was to generate a compatible set of aequorin expression plasmids for the generation of transgenic plant lines to measure changes in calcium levels in different cellular subcompartments. Aequorin was fused to different targeting peptides or organellar proteins as a means to localize it to the cytosol, the nucleus, the plasma membrane, and the mitochondria. Furthermore, constructs were designed to localize aequorin in the stroma as well as the inner and outer surface of the chloroplast envelope membranes. The modular set-up of the plasmids also allows the easy replacement of targeting sequences to include other compartments. An additional YFP-fusion was included to verify the correct subcellular localization of all constructs by laser scanning confocal microscopy. For each construct, pBin19-based binary expression vectors driven by the 35S or UBI10 promoter were made for Agrobacterium-mediated transformation. Stable Arabidopsis lines were generated and initial tests of several lines confirmed their feasibility to measure calcium signals in vivo. PMID:22213817
GeneGuard: A modular plasmid system designed for biosafety.
Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom
2015-03-20
Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.
Igarashi, Tsutomu; Miyake, Noriko; Fujimoto, Chiaki; Yaguchi, Chiemi; Iijima, Osamu; Shimada, Takashi; Takahashi, Hiroshi
2014-01-01
Purpose To assess the feasibility of a gene therapeutic approach to treating choroidal neovascularization (CNV), we generated an adeno-associated virus type 8 vector (AAV2/8) encoding an siRNA targeting vascular endothelial growth factor (VEGF), and determined the AAV2/8 vector’s ability to inhibit angiogenesis. Methods We initially transfected 3T3 cells expressing VEGF with the AAV2/8 plasmid vector psiRNA-VEGF using the H1 promoter and found that VEGF expression was significantly diminished in the transfectants. We next injected 1 μl (3 × 1014 vg/ml) of AAV2/8 vector encoding siRNA targeting VEGF (AAV2/8/SmVEGF-2; n = 12) or control vector encoding green fluorescent protein (GFP) (AAV2/8/GFP; n = 14) into the subretinal space in C57BL/6 mice. One week later, CNV was induced by using a diode laser to make four separate choroidal burns around the optic nerve in each eye. After an additional 2 weeks, the eyes were removed for flat mount analysis of the CNV surface area. Results Subretinal delivery of AAV2/8/SmVEGF-2 significantly diminished CNV at the laser lesions, compared to AAV8/GFP (1597.3±2077.2 versus 5039.5±4055.9 µm2; p<0.05). Using an enzyme-linked immunosorbent assay, we found that VEGF levels were reduced by approximately half in the AAV2/8/SmVEGF-2 treated eyes. Conclusions These results suggest that siRNA-VEGF can be expressed across the retina and that long-term suppression of CNV is possible through the use of stable AAV2/8-mediated siRNA-VEGF expression. In vivo gene therapy may thus be a feasible approach to the clinical management of CNV in conditions such as age-related macular degeneration. PMID:24744609
Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding
2011-07-01
To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.
Basarkar, Ashwin; Singh, Jagdish
2009-01-01
Determine the efficiency of cationic nanoparticles prepared by blending poly (lactide-co-glycolide; PLGA) and methacrylate copolymer (Eudragit(R) E100) to deliver a therapeutic gene encoding mouse interleukin-10, in vitro and in vivo. Nanoparticles prepared with PLGA and E100 were evaluated for delivery of plasmid DNA encoding mouse interleukin-10 in vitro and in vivo in mice upon intramuscular injection. Blood-glucose, serum interferon-gamma levels and histology of pancreas were studied to determine therapeutic efficacy. Histological evaluation of skeletal muscle from the injection site was performed to assess the biocompatibility of nanoparticles. PLGA/E100 nanoparticles showed endosomal escape evidenced by confocal microscopy and buffering ability. Transfecting HEK293 cells with plasmid-loaded PLGA/E100 nanoparticles resulted in significantly (p < 0.05) greater expression of interleukin-10 compared to PLGA nanoparticles. Mice treated with PLGA/E100 nanoparticles displayed higher serum levels of interleukin-10 and lower blood glucose levels compared to those treated with interleukin-10 plasmid alone or PLGA nanoparticles. High expression of interleukin-10 facilitated suppression of interferon-gamma levels and reduced islet infiltration. Histology of muscle showed that nanoparticles were biocompatible and did not cause chronic inflammatory response. Nanoparticles prepared by blending PLGA with methacrylate can efficiently and safely deliver plasmid DNA encoding mouse interleukin-10 leading to prevention of autoimmune diabetes.
Cottell, Jennifer L; Webber, Mark A; Piddock, Laura J V
2012-09-01
The treatment of infections caused by antibiotic-resistant bacteria is one of the great challenges faced by clinicians in the 21st century. Antibiotic resistance genes are often transferred between bacteria by mobile genetic vectors called plasmids. It is commonly believed that removal of antibiotic pressure will reduce the numbers of antibiotic-resistant bacteria due to the perception that carriage of resistance imposes a fitness cost on the bacterium. This study investigated the ability of the plasmid pCT, a globally distributed plasmid that carries an extended-spectrum-β-lactamase (ESBL) resistance gene (bla(CTX-M-14)), to persist and disseminate in the absence of antibiotic pressure. We investigated key attributes in plasmid success, including conjugation frequencies, bacterial-host growth rates, ability to cause infection, and impact on the fitness of host strains. We also determined the contribution of the bla(CTX-M-14) gene itself to the biology of the plasmid and host bacterium. Carriage of pCT was found to impose no detectable fitness cost on various bacterial hosts. An absence of antibiotic pressure and inactivation of the antibiotic resistance gene also had no effect on plasmid persistence, conjugation frequency, or bacterial-host biology. In conclusion, plasmids such as pCT have evolved to impose little impact on host strains. Therefore, the persistence of antibiotic resistance genes and their vectors is to be expected in the absence of antibiotic selective pressure regardless of antibiotic stewardship. Other means to reduce plasmid stability are needed to prevent the persistence of these vectors and the antibiotic resistance genes they carry.
On the efficacy of malaria DNA vaccination with magnetic gene vectors.
Nawwab Al-Deen, Fatin; Ma, Charles; Xiang, Sue D; Selomulya, Cordelia; Plebanski, Magdalena; Coppel, Ross L
2013-05-28
We investigated the efficacy and types of immune responses from plasmid malaria DNA vaccine encoding VR1020-PyMSP119 condensed on the surface of polyethyleneimine (PEI)-coated SPIONs. In vivo mouse studies were done firstly to determine the optimum magnetic vector composition, and then to observe immune responses elicited when magnetic vectors were introduced via different administration routes. Higher serum antibody titers against PyMSP119 were observed with intraperitoneal and intramuscular injections than subcutaneous and intradermal injections. Robust IgG2a and IgG1 responses were observed for intraperitoneal administration, which could be due to the physiology of peritoneum as a major reservoir of macrophages and dendritic cells. Heterologous DNA prime followed by single protein boost vaccination regime also enhanced IgG2a, IgG1, and IgG2b responses, indicating the induction of appropriate memory immunity that can be elicited by protein on recall. These outcomes support the possibility to design superparamagnetic nanoparticle-based DNA vaccines to optimally evoke desired antibody responses, useful for a variety of diseases including malaria. Copyright © 2013 Elsevier B.V. All rights reserved.
Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange
Hmelo, Laura R.; Borlee, Bradley R.; Almblad, Henrik; Love, Michelle E.; Randall, Trevor E.; Tseng, Boo Shan; Lin, Chuyang; Irie, Yasuhiko; Storek, Kelly M.; Yang, Jaeun Jane; Siehnel, Richard J.; Howell, P. Lynne; Singh, Pradeep K.; Tolker-Nielsen, Tim; Parsek, Matthew R.; Schweizer, Herbert P.; Harrison, Joe J.
2016-01-01
Allelic exchange is an efficient method of bacterial genome engineering. This protocol describes the use of this technique to make gene knockouts and knockins, as well as single nucleotide insertions, deletions and substitutions in Pseudomonas aeruginosa. Unlike other approaches to allelic exchange, this protocol does not require heterologous recombinases to insert or excise selective markers from the target chromosome. Rather, positive and negative selection are enabled solely by suicide vector-encoded functions and host cell proteins. Here, mutant alleles, which are flanked by regions of homology to the recipient chromosome, are synthesized in vitro and then cloned into allelic exchange vectors using standard procedures. These suicide vectors are then introduced into recipient cells by conjugation. Homologous recombination then results in antibiotic resistant single-crossover mutants in which the plasmid has integrated site-specifically into the chromosome. Subsequently, unmarked double-crossover mutants are isolated directly using sucrose-mediated counter-selection. This two-step process yields seamless mutations that are precise to a single base pair of DNA. The entire procedure requires ~2 weeks. PMID:26492139
DOE Office of Scientific and Technical Information (OSTI.GOV)
Flores, E.; Wolk, C.P.
1985-06-01
Plasmid vectors transferable by conjugation from Escherichia coli to obligately photoautotrophic strains of Anabaena spp. are also transferred to and maintained in heterotrophic, filamentous cyanobacteria of the genus Nostoc. These organisms can be used for the genetic analysis of oxygenic photosynthesis, chromatic adaptation, nitrogen fixation, and heterocyst development.
Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.
Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel
2018-06-16
ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.
A fully decompressed synthetic bacteriophage øX174 genome assembled and archived in yeast.
Jaschke, Paul R; Lieberman, Erica K; Rodriguez, Jon; Sierra, Adrian; Endy, Drew
2012-12-20
The 5386 nucleotide bacteriophage øX174 genome has a complicated architecture that encodes 11 gene products via overlapping protein coding sequences spanning multiple reading frames. We designed a 6302 nucleotide synthetic surrogate, øX174.1, that fully separates all primary phage protein coding sequences along with cognate translation control elements. To specify øX174.1f, a decompressed genome the same length as wild type, we truncated the gene F coding sequence. We synthesized DNA encoding fragments of øX174.1f and used a combination of in vitro- and yeast-based assembly to produce yeast vectors encoding natural or designer bacteriophage genomes. We isolated clonal preparations of yeast plasmid DNA and transfected E. coli C strains. We recovered viable øX174 particles containing the øX174.1f genome from E. coli C strains that independently express full-length gene F. We expect that yeast can serve as a genomic 'drydock' within which to maintain and manipulate clonal lineages of other obligate lytic phage. Copyright © 2012 Elsevier Inc. All rights reserved.
Lacks, Sanford A.; Balganesh, Tanjore S.
1988-01-01
Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.
Clostridium perfringens type A–E toxin plasmids
Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.
2014-01-01
Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728
Molecular Characterization of Plasmid-Mediated Oxytetracycline Resistance in Aeromonas salmonicida
Adams, C. A.; Austin, B.; Meaden, P. G.; McIntosh, D.
1998-01-01
Using broth conjugation, we found that 19 of 29 (66%) oxytetracycline (OT)-resistant isolates of Aeromonas salmonicida transferred the OT resistance phenotype to Escherichia coli. The OT resistance phenotype was encoded by high-molecular-weight R-plasmids that were capable of transferring OT resistance to both environmental and clinical isolates of Aeromonas spp. The molecular basis for antibiotic resistance in OT-resistant isolates of A. salmonicida was determined. The OT resistance determinant from one plasmid (pASOT) of A. salmonicida was cloned and used in Southern blotting and hybridization experiments as a probe. The determinant was identified on a 5.4-kb EcoRI fragment on R-plasmids from the 19 OT-resistant isolates of A. salmonicida. Hybridization with plasmids encoding the five classes (classes A to E) of OT resistance determinants demonstrated that the OT resistance plasmids of the 19 A. salmonicida isolates carried the class A resistance determinant. Analysis of data generated from restriction enzyme digests showed that the OT resistance plasmids were not identical; three profiles were characterized, two of which showed a high degree of homology. PMID:9797265
Cloning and expression of Tenebrio molitor antifreeze protein in Escherichia coli.
Yue, Chang-Wu; Zhang, Yi-Zheng
2009-03-01
A novel antifreeze protein cDNA was cloned by RT-PCR from the larva of the yellow mealworm Tenebrio molitor. The coding fragment of 339 bp encodes a protein of 112 amino acid residues and was fused to the expression vectors pET32a and pTWIN1. The resulted expression plasmids were transformed into Escherischia coli strains BL21 (DE3), ER2566, and Origami B (DE3), respectively. Several strategies were used for expression of the highly disulfide-bonded beta-helix-contained protein with the activity of antifreeze in different expression systems. A protocol for production of refolded and active T. molitor antifreeze protein in bacteria was obtained.
Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A
2009-12-30
Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.
Folster, J. P.; Pecic, G.; Singh, A.; Duval, B.; Rickert, R.; Ayers, S.; Abbott, J.; McGlinchey, B.; Bauer-Turpin, J.; Haro, J.; Hise, K.; Zhao, S.; Fedorka-Cray, P. J.; Whichard, J.; McDermott, P. F.
2015-01-01
Salmonella enterica is one of the most common causes of foodborne illness in the United States. Although salmonellosis is usually self-limiting, severe infections typically require antimicrobial treatment and ceftriaxone, an extended-spectrum cephalosporin, is commonly used in both adults and children. Surveillance conducted by the National Antimicrobial Resistance Monitoring System (NARMS) has shown a recent increase in extended-spectrum cephalosporin (ESC) resistance among Salmonella Heidelberg isolated from food animals at slaughter, retail meat, and humans. ESC resistance among Salmonella in the United States is usually mediated by a plasmid-encoded blaCMY β-lactamase. In 2009, we identified 47 ESC resistant blaCMY-positive Heidelberg isolates from humans (n=18), food animals at slaughter (n=16), and retail meats (n=13) associated with a spike in the prevalence of this serovar. Almost 90% (26/29) of the animal and meat isolates were isolated from chicken carcasses or retail chicken meat. We screened NARMS isolates for the presence of blaCMY, determined whether the gene was plasmid-encoded, examined pulsed-field gel electrophoresis patterns to assess the genetic diversities of the isolates, and categorized the blaCMY plasmids by plasmid incompatibility groups and plasmid multi-locus sequence typing. All 47 blaCMY genes were found to be plasmid encoded. Incompatibility/replicon typing demonstrated that 41 were IncI1 plasmids, 40 of which only conferred blaCMY associated resistance. Six were IncA/C plasmids that carried additional resistance genes. Plasmid multi-locus sequence typing (pMLST) of the IncI1-blaCMY plasmids showed that 27 (65.8%) were sequence type (ST) 12, the most common ST among blaCMY-IncI1 plasmids from Heidelberg isolated from humans. Ten plasmids had a new ST profile, ST66, a type very similar to ST12. This work showed that the 2009 increase in ESC resistance among Salmonella Heidelberg was caused mainly by the dissemination of blaCMY on IncI1 and IncA/C plasmids in a variety of genetic backgrounds, and likely not the result of clonal expansion. PMID:22755514
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
Bryant, Kendall A.; Van Schooneveld, Trevor C.; Thapa, Ishwor; Bastola, Dhundy; Williams, Laurina O.; Safranek, Thomas J.; Hinrichs, Steven H.; Rupp, Mark E.
2013-01-01
We describe the transfer of blaKPC-4 from Enterobacter cloacae to Serratia marcescens in a single patient. DNA sequencing revealed that KPC-4 was encoded on an IncL/M plasmid, pNE1280, closely related to pCTX-M360. Further analysis found that KPC-4 was encoded within a novel Tn4401 element (Tn4401f) containing a truncated tnpA and lacking tnpR, ISKpn7 left, and Tn4401 IRL-1, which are conserved in other Tn4401 transposons. This study highlights the continued evolution of Tn4401 transposons and movement to multiple plasmid backbones that results in acquisition by multiple species of Gram-negative bacilli. PMID:23070154
New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.
Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel
2016-03-01
Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.
Sum, Chi Hong; Nafissi, Nafiseh; Slavcev, Roderick A.; Wettig, Shawn
2015-01-01
In combination with novel linear covalently closed (LCC) DNA minivectors, referred to as DNA ministrings, a gemini surfactant-based synthetic vector for gene delivery has been shown to exhibit enhanced delivery and bioavailability while offering a heightened safety profile. Due to topological differences from conventional circular covalently closed (CCC) plasmid DNA vectors, the linear topology of LCC DNA ministrings may present differences with regards to DNA interaction and the physicochemical properties influencing DNA-surfactant interactions in the formulation of lipoplexed particles. In this study, N,N-bis(dimethylhexadecyl)-α,ω-propanediammonium(16-3-16)gemini-based synthetic vectors, incorporating either CCC plasmid or LCC DNA ministrings, were characterized and compared with respect to particle size, zeta potential, DNA encapsulation, DNase sensitivity, and in vitro transgene delivery efficacy. Through comparative analysis, differences between CCC plasmid DNA and LCC DNA ministrings led to variations in the physical properties of the resulting lipoplexes after complexation with 16-3-16 gemini surfactants. Despite the size disparities between the plasmid DNA vectors (CCC) and DNA ministrings (LCC), differences in DNA topology resulted in the generation of lipoplexes of comparable particle sizes. The capacity for ministring (LCC) derived lipoplexes to undergo complete counterion release during lipoplex formation contributed to improved DNA encapsulation, protection from DNase degradation, and in vitro transgene delivery. PMID:26561857
A dual host vector for Fab phage display and expression of native IgG in mammalian cells.
Tesar, Devin; Hötzel, Isidro
2013-10-01
A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.
Quorum-quenching limits quorum-sensing exploitation by signal-negative invaders
NASA Astrophysics Data System (ADS)
Tannières, Mélanie; Lang, Julien; Barnier, Claudie; Shykoff, Jacqui A.; Faure, Denis
2017-01-01
Some bacteria produce and perceive quorum-sensing (QS) signals that coordinate several behaviours, including the costly processes that are exoenzyme production and plasmid transfer. In the case of plasmid transfer, the emergence of QS signal-altered invaders and their policing are poorly documented. In Agrobacterium tumefaciens, the virulence Ti-plasmid encodes both synthesis and sensing of QS-signals, which promote its transfer from a donor to a recipient cell. Here, we reported that QS-altered A. tumefaciens mutants arose during experimental evolution. All showed improved growth compared to their ancestor. Genome sequencing revealed that, though some had lost the Ti-plasmid, most were defective for QS-signal synthesis and Ti-plasmid conjugation (traR mutations) and one exhibited a QS-signal exploitation behaviour, using signal produced by other cells to enhance its own Ti-plasmid transfer. We explored mechanisms that can limit this QS-hijacking. We showed that the A. tumefaciens capacity to inactivate QS-signals by expressing QS-degrading enzyme could attenuate dissemination of the QS signal-negative Ti-plasmids. This work shows that enzymatic QS-disruption whether encoded by the QS-producing Ti-plasmid itself, by a companion plasmid in the same donor cells, or by one in the recipient cells, in all cases can serve as a mechanism for controlling QS exploitation by QS signal-negative mutants.
Fu, Lixia; Lu, Chengping
2013-06-01
Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).
A Shigella flexneri Virulence Plasmid Encoded Factor Controls Production of Outer Membrane Vesicles
Sidik, Saima; Kottwitz, Haila; Benjamin, Jeremy; Ryu, Julie; Jarrar, Ameer; Garduno, Rafael; Rohde, John R.
2014-01-01
Shigella spp. use a repertoire of virulence plasmid-encoded factors to cause shigellosis. These include components of a Type III Secretion Apparatus (T3SA) that is required for invasion of epithelial cells and many genes of unknown function. We constructed an array of 99 deletion mutants comprising all genes encoded by the virulence plasmid (excluding those known to be required for plasmid maintenance) of Shigella flexneri. We screened these mutants for their ability to bind the dye Congo red: an indicator of T3SA function. This screen focused our attention on an operon encoding genes that modify the cell envelope including virK, a gene of partially characterized function. We discovered that virK is required for controlled release of proteins to the culture supernatant. Mutations in virK result in a temperature-dependent overproduction of outer membrane vesicles (OMVs). The periplasmic chaperone/protease DegP, a known regulator of OMV production in Escherichia coli (encoded by a chromosomal gene), was found to similarly control OMV production in S. flexneri. Both virK and degP show genetic interactions with mxiD, a structural component of the T3SA. Our results are consistent with a model in which VirK and DegP relieve the periplasmic stress that accompanies assembly of the T3SA. PMID:25378474
Lacks, S.A.; Balganesh, T.S.
1985-02-19
Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hervey, IV, William Judson; Khalsa-Moyers, Gurusahai K; Lankford, Patricia K
Protein enrichments of engineered, affinity-tagged (or bait ) fusion proteins with interaction partners are often laden with background, non-specific proteins, due to interactions that occur in vitro as an artifact of the technique. Furthermore, the in vivo expression of the bait protein may itself affect physiology or metabolism. In this study, intrinsic affinity purification challenges were investigated in a model protein complex, DNA-dependent RNA polymerase (RNAP), encompassing chromosome- and plasmid-encoding strategies for bait proteins in two different microbial species: Escherichia coli and Rhodopseudomonas palustris. Isotope ratio measurements of bait protein expression strains relative to native, wild-type strains were performed bymore » liquid chromatography tandem mass spectrometry (LC-MS-MS) to assess bait protein expression strategies in each species. Authentic interacting proteins of RNAP were successfully discerned from artifactual co-isolating proteins by the isotopic differentiation of interactions as random or targeted (I-DIRT) method (A. J. Tackett et al. J. Proteome Res. 2005, 4 (5), 1752-1756). To investigate broader effects of bait protein production in the bacteria, we compared proteomes from strains harboring a plasmid that encodes an affinity-tagged subunit (RpoA) of the RNAP complex with the corresponding wild-type strains using stable isotope metabolic labeling. The ratio of RpoA abundance in plasmid strains versus wild type was 0.8 for R. palustris and 1.7 for E. coli. While most other proteins showed no appreciable difference, proteins significantly increased in abundance in plasmid-encoded bait-expressing strains of both species included the plasmid encoded antibiotic resistance protein, GenR and proteins involved in amino acid biosynthesis. Together, these local, complex-specific and more global, whole proteome isotopic abundance ratio measurements provided a tool for evaluating both in vivo and in vitro effects of plasmid-encoding strategies for bait protein expression. This approach has the potential for enabling discovery of protein-protein interactions among the growing number of sequenced microbial species without the need for development of chromosomal insertion systems.« less
Sena-Esteves, Miguel; Saeki, Yoshinaga; Camp, Sara M.; Chiocca, E. Antonio; Breakefield, Xandra O.
1999-01-01
We report here on the development and characterization of a novel herpes simplex virus type 1 (HSV-1) amplicon-based vector system which takes advantage of the host range and retention properties of HSV–Epstein-Barr virus (EBV) hybrid amplicons to efficiently convert cells to retrovirus vector producer cells after single-step transduction. The retrovirus genes gag-pol and env (GPE) and retroviral vector sequences were modified to minimize sequence overlap and cloned into an HSV-EBV hybrid amplicon. Retrovirus expression cassettes were used to generate the HSV-EBV-retrovirus hybrid vectors, HERE and HERA, which code for the ecotropic and the amphotropic envelopes, respectively. Retrovirus vector sequences encoding lacZ were cloned downstream from the GPE expression unit. Transfection of 293T/17 cells with amplicon plasmids yielded retrovirus titers between 106 and 107 transducing units/ml, while infection of the same cells with amplicon vectors generated maximum titers 1 order of magnitude lower. Retrovirus titers were dependent on the extent of transduction by amplicon vectors for the same cell line, but different cell lines displayed varying capacities to produce retrovirus vectors even at the same transduction efficiencies. Infection of human and dog primary gliomas with this system resulted in the production of retrovirus vectors for more than 1 week and the long-term retention and increase in transgene activity over time in these cell populations. Although the efficiency of this system still has to be determined in vivo, many applications are foreseeable for this approach to gene delivery. PMID:10559361
Gorse, Geoffrey J; Newman, Mark J; deCamp, Allan; Hay, Christine Mhorag; De Rosa, Stephen C; Noonan, Elizabeth; Livingston, Brian D; Fuchs, Jonathan D; Kalams, Spyros A; Cassis-Ghavami, Farah L
2012-05-01
We evaluated a DNA plasmid-vectored vaccine and a recombinant modified vaccinia virus Ankara vaccine (MVA-mBN32), each encoding cytotoxic and helper T-lymphocyte epitopes of human immunodeficiency virus type 1 (HIV-1) in a randomized, double-blinded, placebo-controlled trial in 36 HIV-1-uninfected adults using a heterologous prime-boost schedule. HIV-1-specific cellular immune responses, measured as interleukin-2 and/or gamma interferon production, were induced in 1 (4%) of 28 subjects after the first MVA-mBN32 immunization and in 3 (12%) of 25 subjects after the second MVA-mBN32 immunization. Among these responders, polyfunctional T-cell responses, including the production of tumor necrosis factor alpha and perforin, were detected. Vaccinia virus-specific antibodies were induced to the MVA vector in 27 (93%) of 29 and 26 (93%) of 28 subjects after the first and second immunizations with MVA-mBN32. These peptide-based vaccines were safe but were ineffective at inducing HIV-1-specific immune responses and induced much weaker responses than MVA vaccines expressing the entire open reading frames of HIV-1 proteins.
Leary, T P; Gao, Y; Splitter, G A
1992-07-01
The desire to obtain authentically glycosylated viral protein products in sufficient quantity for immunological study has led to the use of eucaryotic expression vectors for protein production. An additional advantage is that these protein products can be studied individually in the absence of their native viral environment. We have cloned a complementary DNA (cDNA) encoding bovine herpes virus-1 (BHV-1) glycoprotein 1 (gpI) into the eucaryotic expression vector, pZipNeo SVX1. Since this protein is normally embedded within the membrane of BHV-1 infected cells, we removed sequences encoding the transmembrane domain of the native protein. After transfection of the plasmid construct into the canine osteosarcoma cell line, D17, or Madin-Darby bovine kidney (MDBK) cells, a truncated BHV-1 (gpI) was secreted into the culture medium as demonstrated by radioimmunoprecipitation and SDS-PAGE. Both a CD4+ T-lymphocyte line specific for BHV-1 and freshly isolated T lymphocytes could recognize and respond to the secreted recombinant gpI. Further, recombinant gpI could elicit both antibody and cellular responses in cattle when used as an immunogen. Having established constitutively glycoprotein producing cell lines, future studies in vaccine evaluation of gpI will be facilitated.
Zhu, Weinan; Wang, Jin; Zhu, Yongzhang; Tang, Biao; Zhang, Yunyi; He, Ping; Zhang, Yan; Liu, Boyu; Guo, Xiaokui; Zhao, Guoping; Qin, Jinhong
2015-02-15
The genome of pathogenic Leptospira interrogans contains two chromosomes. Plasmids and prophages are known to play specific roles in gene transfer in bacteria and can potentially serve as efficient genetic tools in these organisms. Although plasmids and prophage remnants have recently been reported in Leptospira species, their characteristics and potential applications in leptospiral genetic transformation systems have not been fully evaluated. Three extrachromosomal replicons designated lcp1 (65,732 bp), lcp2 (56,757 bp), and lcp3 (54,986 bp) in the L. interrogans serovar Linhai strain 56609 were identified through whole genome sequencing. All three replicons were stable outside of the bacterial chromosomes. Phage particles were observed in the culture supernatant of 56609 after mitomycin C induction, and lcp3, which contained phage-related genes, was considered to be an inducible prophage. L. interrogans-Escherichia coli shuttle vectors, constructed with the predicted replication elements of single rep or rep combined with parAB loci from the three plasmids were shown to successfully transform into both saprophytic and pathogenic Leptospira species, suggesting an essential function for rep genes in supporting auto-replication of the plasmids. Additionally, a wide distribution of homologs of the three rep genes was identified in L. interrogans isolates, and correlation tests showed that the transformability of the shuttle vectors in L. interrogans isolates depended, to certain extent, on genetic compatibility between the rep sequences of both plasmid and host. Three extrachromosomal replicons co-exist in L. interrogans, one of which we consider to be an inducible prophage. The vectors constructed with the rep genes of the three replicons successfully transformed into saprophytic and pathogenic Leptospira species alike, but this was partly dependent on genetic compatibility between the rep sequences of both plasmid and host.
Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang
2013-10-01
The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei
2006-11-01
To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.
Folster, J P; Pecic, G; Singh, A; Duval, B; Rickert, R; Ayers, S; Abbott, J; McGlinchey, B; Bauer-Turpin, J; Haro, J; Hise, K; Zhao, S; Fedorka-Cray, P J; Whichard, J; McDermott, P F
2012-07-01
Salmonella enterica is one of the most common causes of foodborne illness in the United States. Although salmonellosis is usually self-limiting, severe infections typically require antimicrobial treatment, and ceftriaxone, an extended-spectrum cephalosporin (ESC), is commonly used in both adults and children. Surveillance conducted by the National Antimicrobial Resistance Monitoring System (NARMS) has shown a recent increase in ESC resistance among Salmonella Heidelberg isolated from food animals at slaughter, retail meat, and humans. ESC resistance among Salmonella in the United States is usually mediated by a plasmid-encoded bla(CMY) β-lactamase. In 2009, we identified 47 ESC-resistant bla(CMY)-positive Heidelberg isolates from humans (n=18), food animals at slaughter (n=16), and retail meats (n=13) associated with a spike in the prevalence of this serovar. Almost 90% (26/29) of the animal and meat isolates were isolated from chicken carcasses or retail chicken meat. We screened NARMS isolates for the presence of bla(CMY), determined whether the gene was plasmid-encoded, examined pulsed-field gel electrophoresis patterns to assess the genetic diversities of the isolates, and categorized the bla(CMY) plasmids by plasmid incompatibility groups and plasmid multi-locus sequence typing (pMLST). All 47 bla(CMY) genes were found to be plasmid encoded. Incompatibility/replicon typing demonstrated that 41 were IncI1 plasmids, 40 of which only conferred bla(CMY)-associated resistance. Six were IncA/C plasmids that carried additional resistance genes. pMLST of the IncI1-bla(CMY) plasmids showed that 27 (65.8%) were sequence type (ST) 12, the most common ST among bla(CMY)-IncI1 plasmids from Heidelberg isolated from humans. Ten plasmids had a new ST profile, ST66, a type very similar to ST12. This work showed that the 2009 increase in ESC resistance among Salmonella Heidelberg was caused mainly by the dissemination of bla(CMY) on IncI1 and IncA/C plasmids in a variety of genetic backgrounds, and is likely not the result of clonal expansion.
O'Brien, Frances G.; Yui Eto, Karina; Murphy, Riley J. T.; Fairhurst, Heather M.; Coombs, Geoffrey W.; Grubb, Warren B.; Ramsay, Joshua P.
2015-01-01
Staphylococcus aureus is a common cause of hospital, community and livestock-associated infections and is increasingly resistant to multiple antimicrobials. A significant proportion of antimicrobial-resistance genes are plasmid-borne, but only a minority of S. aureus plasmids encode proteins required for conjugative transfer or Mob relaxase proteins required for mobilisation. The pWBG749 family of S. aureus conjugative plasmids can facilitate the horizontal transfer of diverse antimicrobial-resistance plasmids that lack Mob genes. Here we reveal that these mobilisable plasmids carry copies of the pWBG749 origin-of-transfer (oriT) sequence and that these oriT sequences facilitate mobilisation by pWBG749. Sequences resembling the pWBG749 oriT were identified on half of all sequenced S. aureus plasmids, including the most prevalent large antimicrobial-resistance/virulence-gene plasmids, pIB485, pMW2 and pUSA300HOUMR. oriT sequences formed five subfamilies with distinct inverted-repeat-2 (IR2) sequences. pWBG749-family plasmids encoding each IR2 were identified and pWBG749 mobilisation was found to be specific for plasmids carrying matching IR2 sequences. Specificity of mobilisation was conferred by a putative ribbon-helix-helix-protein gene smpO. Several plasmids carried 2–3 oriT variants and pWBG749-mediated recombination occurred between distinct oriT sites during mobilisation. These observations suggest this relaxase-in trans mechanism of mobilisation by pWBG749-family plasmids is a common mechanism of plasmid dissemination in S. aureus. PMID:26243776
A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.
Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu
2015-05-01
Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Nácher-Vázquez, Montserrat; Ruiz-Masó, José A.; Mohedano, María L.; del Solar, Gloria; Aznar, Rosa; López, Paloma
2017-01-01
The exopolysaccharide synthesized by Lactobacillus sakei MN1 is a dextran with antiviral and immunomodulatory properties of potential utility in aquaculture. In this work we have investigated the genetic basis of dextran production by this bacterium. Southern blot hybridization experiments demonstrated the plasmidic location of the dsrLS gene, which encodes the dextransucrase involved in dextran synthesis. DNA sequencing of the 11,126 kbp plasmid (pMN1) revealed that it belongs to a family which replicates by the theta mechanism, whose prototype is pUCL287. The plasmid comprises the origin of replication, repA, repB, and dsrLS genes, as well as seven open reading frames of uncharacterized function. Lb. sakei MN1 produces dextran when sucrose, but not glucose, is present in the growth medium. Therefore, plasmid copy number and stability, as well as dsrLS expression, were investigated in cultures grown in the presence of either sucrose or glucose. The results revealed that pMN1 is a stable low-copy-number plasmid in both conditions. Gene expression studies showed that dsrLS is constitutively expressed, irrespective of the carbon source present in the medium. Moreover, dsrLS is expressed from a monocistronic transcript as well as from a polycistronic repA-repB-orf1-dsrLS mRNA. To our knowledge, this is the first report of a plasmid-borne dextransucrase-encoding gene, as well as the first time that co-transcription of genes involved in plasmid maintenance and replication with a gene encoding an enzyme has been established. PMID:29209293
Expression of bacteriocin LsbB is dependent on a transcription terminator.
Uzelac, Gordana; Miljkovic, Marija; Lozo, Jelena; Radulovic, Zorica; Tosic, Natasa; Kojic, Milan
2015-10-01
The production of LsbB, leaderless class II bacteriocin, is encoded by genes (lsbB and lmrB) located on plasmid pMN5 in Lactococcus lactis BGMN1-5. Heterologous expression of the lsbB gene using the pAZIL vector (pAZIL-lsbB) in L. lactis subsp. cremoris MG7284 resulted in a significant reduction (more than 30 times) of bacteriocin LsbB expression. Subcloning and deletion experiments with plasmid pMN5 revealed that full expression of LsbB requires the presence of a complete transcription terminator located downstream of the lsbB gene. RNA stability analysis revealed that the presence of a transcription terminator increased the RNA stability by three times and the expression of LsbB by 30 times. The study of the influence of transcription terminator on the expression of other bacteriocin genes (lcnB, for lactococcin B production) indicated that this translational terminator likely functions in a lsbB-specific manner rather than in a general manner. Copyright © 2015 Elsevier GmbH. All rights reserved.
Overproduction of α-Lipoic Acid by Gene Manipulated Escherichia coli
Sun, Yirong; Zhang, Wenbin; Ma, Jincheng; Pang, Hongshen; Wang, Haihong
2017-01-01
Alpha-lipoic acid (LA) is an important enzyme cofactor widely used by organisms and is also a natural antioxidant for the treatment of pathologies driven by low levels of endogenous antioxidants. In order to establish a safer and more efficient process for LA production, we developed a new biological method for LA synthesis based on the emerging knowledge of lipoic acid biosynthesis. We first cloned the lipD gene, which encodes the lipoyl domain of the E2 subunit of pyruvate dehydrogenase, allowing high levels of LipD production. Plasmids containing genes for the biosynthesis of LA were subsequently constructed utilizing various vectors and promotors to produce high levels of LA. These plasmids were transformed into the Escherichia coli strain BL21. Octanoic acid (OA) was used as the substrate for LA synthesis. One transformant, YS61, which carried lipD, lplA, and lipA, produced LA at levels over 200-fold greater than the wild-type strain, showing that LA could be produced efficiently in E. coli using genetic engineering methods. PMID:28068366
Jakubczak, John L.; Rollence, Michele L.; Stewart, David A.; Jafari, Jonathon D.; Von Seggern, Dan J.; Nemerow, Glen R.; Stevenson, Susan C.; Hallenbeck, Paul L.
2001-01-01
A major limitation of adenovirus type 5 (Ad5)-based gene therapy, the inability to target therapeutic genes to selected cell types, is attributable to the natural tropism of the virus for the widely expressed coxsackievirus-adenovirus receptor (CAR) protein. Modifications of the Ad5 fiber knob domain have been shown to alter the tropism of the virus. We have developed a novel system to rapidly evaluate the function of modified fiber proteins in their most relevant context, the adenoviral capsid. This transient transfection/infection system combines transfection of cells with plasmids that express high levels of the modified fiber protein and infection with Ad5.βgal.ΔF, an E1-, E3-, and fiber-deleted adenoviral vector encoding β-galactosidase. We have used this system to test the adenoviral transduction efficiency mediated by a panel of fiber protein mutants that were proposed to influence CAR interaction. A series of amino acid modifications were incorporated via mutagenesis into the fiber expression plasmid, and the resulting fiber proteins were subsequently incorporated onto adenoviral particles. Mutations located in the fiber knob AB and CD loops demonstrated the greatest reduction in fiber-mediated gene transfer in HeLa cells. We also observed effects on transduction efficiency with mutations in the FG loop, indicating that the binding site may extend to the adjacent monomer in the fiber trimer and in the HI loop. These studies support the concept that modification of the fiber knob domain to diminish or ablate CAR interaction should result in a detargeted adenoviral vector that can be combined simultaneously with novel ligands for the development of a systemically administered, targeted adenoviral vector. PMID:11222722
Joardar, Vinita; Williams, Kelly P.; Driscoll, Timothy; Hostetler, Jessica B.; Nordberg, Eric; Shukla, Maulik; Walenz, Brian; Hill, Catherine A.; Nene, Vishvanath M.; Azad, Abdu F.; Sobral, Bruno W.; Caler, Elisabet
2012-01-01
We present the draft genome for the Rickettsia endosymbiont of Ixodes scapularis (REIS), a symbiont of the deer tick vector of Lyme disease in North America. Among Rickettsia species (Alphaproteobacteria: Rickettsiales), REIS has the largest genome sequenced to date (>2 Mb) and contains 2,309 genes across the chromosome and four plasmids (pREIS1 to pREIS4). The most remarkable finding within the REIS genome is the extraordinary proliferation of mobile genetic elements (MGEs), which contributes to a limited synteny with other Rickettsia genomes. In particular, an integrative conjugative element named RAGE (for Rickettsiales amplified genetic element), previously identified in scrub typhus rickettsiae (Orientia tsutsugamushi) genomes, is present on both the REIS chromosome and plasmids. Unlike the pseudogene-laden RAGEs of O. tsutsugamushi, REIS encodes nine conserved RAGEs that include F-like type IV secretion systems similar to that of the tra genes encoded in the Rickettsia bellii and R. massiliae genomes. An unparalleled abundance of encoded transposases (>650) relative to genome size, together with the RAGEs and other MGEs, comprise ∼35% of the total genome, making REIS one of the most plastic and repetitive bacterial genomes sequenced to date. We present evidence that conserved rickettsial genes associated with an intracellular lifestyle were acquired via MGEs, especially the RAGE, through a continuum of genomic invasions. Robust phylogeny estimation suggests REIS is ancestral to the virulent spotted fever group of rickettsiae. As REIS is not known to invade vertebrate cells and has no known pathogenic effects on I. scapularis, its genome sequence provides insight on the origin of mechanisms of rickettsial pathogenicity. PMID:22056929
Erickson, J. R.; Johnston, M.
1993-01-01
We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124
Vectors for co-expression of an unrestricted number of proteins
Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad
2007-01-01
A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810
2012-01-01
Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256
DNASU plasmid and PSI:Biology-Materials repositories: resources to accelerate biological research
Seiler, Catherine Y.; Park, Jin G.; Sharma, Amit; Hunter, Preston; Surapaneni, Padmini; Sedillo, Casey; Field, James; Algar, Rhys; Price, Andrea; Steel, Jason; Throop, Andrea; Fiacco, Michael; LaBaer, Joshua
2014-01-01
The mission of the DNASU Plasmid Repository is to accelerate research by providing high-quality, annotated plasmid samples and online plasmid resources to the research community through the curated DNASU database, website and repository (http://dnasu.asu.edu or http://dnasu.org). The collection includes plasmids from grant-funded, high-throughput cloning projects performed in our laboratory, plasmids from external researchers, and large collections from consortia such as the ORFeome Collaboration and the NIGMS-funded Protein Structure Initiative: Biology (PSI:Biology). Through DNASU, researchers can search for and access detailed information about each plasmid such as the full length gene insert sequence, vector information, associated publications, and links to external resources that provide additional protein annotations and experimental protocols. Plasmids can be requested directly through the DNASU website. DNASU and the PSI:Biology-Materials Repositories were previously described in the 2010 NAR Database Issue (Cormier, C.Y., Mohr, S.E., Zuo, D., Hu, Y., Rolfs, A., Kramer, J., Taycher, E., Kelley, F., Fiacco, M., Turnbull, G. et al. (2010) Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community. Nucleic Acids Res., 38, D743–D749.). In this update we will describe the plasmid collection and highlight the new features in the website redesign, including new browse/search options, plasmid annotations and a dynamic vector mapping feature that was developed in collaboration with LabGenius. Overall, these plasmid resources continue to enable research with the goal of elucidating the role of proteins in both normal biological processes and disease. PMID:24225319
Giguère, Steeve; Hondalus, Mary K.; Yager, Julie A.; Darrah, Patricia; Mosser, David M.; Prescott, John F.
1999-01-01
Rhodococcus equi is a facultative intracellular pathogen of macrophages and a cause of pneumonia in young horses (foals) and immunocompromised people. Isolates of R. equi from pneumonic foals typically contain large, 85- or 90-kb plasmids encoding a highly immunogenic virulence-associated protein (VapA). The objective of this study was to determine the role of the 85-kb plasmid and VapA in the intracellular survival and virulence of R. equi. Clinical isolates containing the plasmid and expressing VapA efficiently replicated within mouse macrophages in vitro, while plasmid-cured derivatives of these organisms did not multiply intracellularly. An isolate harboring the large plasmid also replicated in the tissues of experimentally infected mice, whereas its plasmid-cured derivative was rapidly cleared. All foals experimentally infected with a plasmid-containing clinical isolate developed severe bronchopneumonia, whereas the foals infected with its plasmid-cured derivative remained asymptomatic and free of visible lung lesions. By day 14 postinfection, lung bacterial burdens had increased considerably in foals challenged with the plasmid-containing clinical isolate. In contrast, bacteria could no longer be cultured from the lungs of foals challenged with the isogenic plasmid-cured derivative. A recombinant, plasmid-cured derivative expressing wild-type levels of VapA failed to replicate in macrophages and remained avirulent for both mice and foals. These results show that the 85-kb plasmid of R. equi is essential for intracellular replication within macrophages and for development of disease in the native host, the foal. However, expression of VapA alone is not sufficient to restore the virulence phenotype. PMID:10377138
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions
Van Horn, Christopher R.
2017-01-01
ABSTRACT The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 (X. fastidiosa subsp. fastidiosa) or Dixon (X. fastidiosa subsp. multiplex) as the donor strain and Temecula (X. fastidiosa subsp. fastidiosa) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa, possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa, or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence in this diverse pathogen. PMID:28808128
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.
Burbank, Lindsey P; Van Horn, Christopher R
2017-11-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence in this diverse pathogen.
Genomics of high molecular weight plasmids isolated from an on-farm biopurification system.
Martini, María C; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F
2016-06-20
The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities.
pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.
Gu, Jingsong; Ye, Chunjiang
2011-03-01
A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.
Börjesson, Stefan; Ny, Sofia; Egervärn, Maria; Bergström, Jakob; Rosengren, Åsa; Englund, Stina; Löfmark, Sonja; Byfors, Sara
2016-04-01
Extended-spectrum β-lactamase (ESBL)- and plasmid-encoded ampC (pAmpC)-producing Enterobacteriaceae might spread from farm animals to humans through food. However, most studies have been limited in number of isolates tested and areas studied. We examined genetic relatedness of 716 isolates from 4,854 samples collected from humans, farm animals, and foods in Sweden to determine whether foods and farm animals might act as reservoirs and dissemination routes for ESBL/pAmpC-producing Escherichia coli. Results showed that clonal spread to humans appears unlikely. However, we found limited dissemination of genes encoding ESBL/pAmpC and plasmids carrying these genes from foods and farm animals to healthy humans and patients. Poultry and chicken meat might be a reservoir and dissemination route to humans. Although we found no evidence of clonal spread of ESBL/pAmpC-producing E. coli from farm animals or foods to humans, ESBL/pAmpC-producing E. coli with identical genes and plasmids were present in farm animals, foods, and humans.
Hughes, E J; Bayly, R C; Skurray, R A
1984-01-01
Alcaligenes eutrophus wild-type strain 345 metabolizes m- and p-toluate via a catechol meta-cleavage pathway. DNA analysis, curing studies, and transfer of this phenotype by conjugation and transformation showed that the degradative genes are encoded on a self-transmissible 85-kilobase plasmid, pRA1000. HindIII and XhoI restriction endonuclease analysis of pRA1000 showed it to be similar to the archetypal TOL plasmid, pWWO, differing in the case of HindIII only by the absence of fragments B and D present in pWWO. In strain 345, the presence of pRA1000 prevented the expression of chromosomally encoded enzymes required for the degradation of p-cresol, whereas these enzymes were expressed in strains cured of pRA1000. On the basis of studies with an R68.45-pRA1000 cointegrate plasmid, pRA1001, we conclude that the gene(s) responsible for the effect of p-cresol degradation resides within or near the m- and p-toluate degradative region on pRA1000. Images PMID:6325399
Fekete, Péter Z; Brzuszkiewicz, Elzbieta; Blum-Oehler, Gabriele; Olasz, Ferenc; Szabó, Mónika; Gottschalk, Gerhard; Hacker, Jörg; Nagy, Béla
2012-01-01
In this study the plasmid pTC, a 90 kb self-conjugative virulence plasmid of the porcine enterotoxigenic Escherichia coli (ETEC) strain EC2173 encoding the STa and STb heat-stable enterotoxins and tetracycline resistance, has been sequenced in two steps. As a result we identified five main distinct regions of pTC: (i) the maintenance region responsible for the extreme stability of the plasmid, (ii) the TSL (toxin-specific locus comprising the estA and estB genes) which is unique and characteristic for pTC, (iii) a Tn10 transposon, encoding tetracycline resistance, (iv) the tra (plasmid transfer) region, and (v) the colE1-like origin of replication. It is concluded that pTC is a self-transmissible composite plasmid harbouring antibiotic resistance and virulence genes. pTC belongs to a group of large conjugative E. coli plasmids represented by NR1 with a widespread tra backbone which might have evolved from a common ancestor. This is the first report of a completely sequenced animal ETEC virulence plasmid containing an antimicrobial resistance locus, thereby representing a selection advantage for spread of pathogenicity in the presence of antimicrobials leading to increased disease potential. Copyright © 2011. Published by Elsevier GmbH.
Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza
2015-01-01
Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938
Lorenzo-Díaz, Fabián; Fernández-López, Cris; Lurz, Rudi
2017-01-01
Abstract Horizontal gene transfer is a key process in the evolution of bacteria and also represents a source of genetic variation in eukaryotes. Among elements participating in gene transfer, thousands of small (<10 kb) mobile bacterial plasmids that replicate by the rolling circle mechanism represent a driving force in the spread of antibiotic resistances. In general, these plasmids are built as genetic modules that encode a replicase, an antibiotic-resistance determinant, and a relaxase that participates in their conjugative mobilization. Further, they control their relatively high copy number (∼30 copies per genome equivalent) by antisense RNAs alone or combined with a repressor protein. We report here that the MobM conjugative relaxase encoded by the promiscuous plasmid pMV158 participates in regulation of the plasmid copy number by transcriptional repression of the antisense RNA, thus increasing the number of plasmid molecules ready to be horizontally transferred (mobilization) and/or vertically inherited (replication). This type of crosstalk between genetic modules involved in vertical and horizontal gene flow has not been reported before. PMID:28525572
The Tcp conjugation system of Clostridium perfringens.
Wisniewski, Jessica A; Rood, Julian I
2017-05-01
The Gram-positive pathogen Clostridium perfringens possesses a family of large conjugative plasmids that is typified by the tetracycline resistance plasmid pCW3. Since these plasmids may carry antibiotic resistance genes or genes encoding extracellular or sporulation-associated toxins, the conjugative transfer of these plasmids appears to be important for the epidemiology of C. perfringens-mediated diseases. Sequence analysis of members of this plasmid family identified a highly conserved 35kb region that encodes proteins with various functions, including plasmid replication and partitioning. The tcp conjugation locus also was identified in this region, initially based on low-level amino acid sequence identity to conjugation proteins from the integrative conjugative element Tn916. Genetic studies confirmed that the tcp locus is required for conjugative transfer and combined with biochemical and structural analyses have led to the development of a functional model of the Tcp conjugation apparatus. This review summarises our current understanding of the Tcp conjugation system, which is now one of the best-characterized conjugation systems in Gram-positive bacteria. Copyright © 2017 Elsevier Inc. All rights reserved.
Haney, Matthew J; Zhao, Yuling; Harrison, Emily B; Mahajan, Vivek; Ahmed, Shaheen; He, Zhijian; Suresh, Poornima; Hingtgen, Shawn D; Klyachko, Natalia L; Mosley, R Lee; Gendelman, Howard E; Kabanov, Alexander V; Batrakova, Elena V
2013-01-01
The ability to precisely upregulate genes in inflamed brain holds great therapeutic promise. Here we report a novel class of vectors, genetically modified macrophages that carry reporter and therapeutic genes to neural cells. Systemic administration of macrophages transfected ex vivo with a plasmid DNA (pDNA) encoding a potent antioxidant enzyme, catalase, produced month-long expression levels of catalase in the brain resulting in three-fold reductions in inflammation and complete neuroprotection in mouse models of Parkinson's disease (PD). This resulted in significant improvements in motor functions in PD mice. Mechanistic studies revealed that transfected macrophages secreted extracellular vesicles, exosomes, packed with catalase genetic material, pDNA and mRNA, active catalase, and NF-κb, a transcription factor involved in the encoded gene expression. Exosomes efficiently transfer their contents to contiguous neurons resulting in de novo protein synthesis in target cells. Thus, genetically modified macrophages serve as a highly efficient system for reproduction, packaging, and targeted gene and drug delivery to treat inflammatory and neurodegenerative disorders.
Yan, Y; Xu, W; Chen, H; Ma, Z; Zhu, Y; Cai, S
1994-01-01
The partial structure gene encoding ES antigen derived from Trichinella spiralis (TSP) muscle larvae was cloned, characterized, and expressed in E. coli. The target DNA (0.7 kb) was directly obtained from the TSP total RNA by using RNA PCR technique. Based on the analysis with the RE digestion, the fragment was cloned into the fusion expression vector pEX31C. It was shown that a kind of 37kDa fusion protein was expressed in E. coli containing the recombinant plasmid by SDS-PAGE electrophoresis. The expressed protein was over 22% of the total cell protein, and it was aggregated in the form of inclusion bodies in E. coli. The purified protein could be recognized in ELISA both by sera from swine-infected with TSP and by the monoclonal antibody against TSP. These findings suggest that the recombinant protein is a potentially valuable antigen both for immunodiagnosis and vaccine development of trichinellosis.
Haney, Matthew J.; Zhao, Yuling; Harrison, Emily B.; Mahajan, Vivek; Ahmed, Shaheen; He, Zhijian; Suresh, Poornima; Hingtgen, Shawn D.; Klyachko, Natalia L.; Mosley, R. Lee; Gendelman, Howard E.; Kabanov, Alexander V.; Batrakova, Elena V.
2013-01-01
The ability to precisely upregulate genes in inflamed brain holds great therapeutic promise. Here we report a novel class of vectors, genetically modified macrophages that carry reporter and therapeutic genes to neural cells. Systemic administration of macrophages transfected ex vivo with a plasmid DNA (pDNA) encoding a potent antioxidant enzyme, catalase, produced month-long expression levels of catalase in the brain resulting in three-fold reductions in inflammation and complete neuroprotection in mouse models of Parkinson's disease (PD). This resulted in significant improvements in motor functions in PD mice. Mechanistic studies revealed that transfected macrophages secreted extracellular vesicles, exosomes, packed with catalase genetic material, pDNA and mRNA, active catalase, and NF-κb, a transcription factor involved in the encoded gene expression. Exosomes efficiently transfer their contents to contiguous neurons resulting in de novo protein synthesis in target cells. Thus, genetically modified macrophages serve as a highly efficient system for reproduction, packaging, and targeted gene and drug delivery to treat inflammatory and neurodegenerative disorders. PMID:23620794
Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P
2012-09-01
Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.
Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W
2010-08-01
The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.
Galetto, Luciana; Bosco, Domenico; Balestrini, Raffaella; Genre, Andrea; Fletcher, Jacqueline; Marzachì, Cristina
2011-01-01
Phytoplasmas, uncultivable phloem-limited phytopathogenic wall-less bacteria, represent a major threat to agriculture worldwide. They are transmitted in a persistent, propagative manner by phloem-sucking Hemipteran insects. Phytoplasma membrane proteins are in direct contact with hosts and are presumably involved in determining vector specificity. Such a role has been proposed for phytoplasma transmembrane proteins encoded by circular extrachromosomal elements, at least one of which is a plasmid. Little is known about the interactions between major phytoplasma antigenic membrane protein (Amp) and insect vector proteins. The aims of our work were to identify vector proteins interacting with Amp and to investigate their role in transmission specificity. In controlled transmission experiments, four Hemipteran species were identified as vectors of “Candidatus Phytoplasma asteris”, the chrysanthemum yellows phytoplasmas (CYP) strain, and three others as non-vectors. Interactions between a labelled (recombinant) CYP Amp and insect proteins were analysed by far Western blots and affinity chromatography. Amp interacted specifically with a few proteins from vector species only. Among Amp-binding vector proteins, actin and both the α and β subunits of ATP synthase were identified by mass spectrometry and Western blots. Immunofluorescence confocal microscopy and Western blots of plasma membrane and mitochondrial fractions confirmed the localisation of ATP synthase, generally known as a mitochondrial protein, in plasma membranes of midgut and salivary gland cells in the vector Euscelidius variegatus. The vector-specific interaction between phytoplasma Amp and insect ATP synthase is demonstrated for the first time, and this work also supports the hypothesis that host actin is involved in the internalization and intracellular motility of phytoplasmas within their vectors. Phytoplasma Amp is hypothesized to play a crucial role in insect transmission specificity. PMID:21799902
Mayrhofer-Iro, M.; Ladurner, A.; Meissner, C.; Derntl, C.; Reiter, M.; Haider, F.; Dimmel, K.; Rössler, N.; Klein, R.; Baranyi, U.; Scholz, H.
2013-01-01
In the study described here, we successfully developed a transformation system for halo(alkali)philic members of the Archaea. This transformation system comprises a series of Natrialba magadii/Escherichia coli shuttle vectors based on a modified method to transform halophilic members of the Archaea and genomic elements of the N. magadii virus ϕCh1. The shuttle vector pRo-5, based on the repH-containing region of ϕCh1, stably replicated in E. coli and N. magadii and in several halophilic and haloalkaliphilic members of the Archaea not transformable so far. The ϕCh1 operon ORF53/ORF54 (repH) was essential for pRo-5 replication and was thus identified as the minimal replication origin. The plasmid allowed homologous and heterologous gene expression, as exemplified by the expression of ϕCh1 ORF3452, which encodes a structural protein, and the reporter gene bgaH of Haloferax lucentense in N. magadii. The new transformation/vector system will facilitate genetic studies within N. magadii and other haloalkaliphilic archaea and will allow the detailed characterization of the gene functions of N. magadii virus ϕCh1 in their extreme environments. PMID:23416999
Giuraniuc, Claudiu V.; MacPherson, Murray; Saka, Yasushi
2013-01-01
Construction of synthetic genetic networks requires the assembly of DNA fragments encoding functional biological parts in a defined order. Yet this may become a time-consuming procedure. To address this technical bottleneck, we have created a series of Gateway shuttle vectors and an integration vector, which facilitate the assembly of artificial genes and their expression in the budding yeast Saccharomyces cerevisiae. Our method enables the rapid construction of an artificial gene from a promoter and an open reading frame (ORF) cassette by one-step recombination reaction in vitro. Furthermore, the plasmid thus created can readily be introduced into yeast cells to test the assembled gene’s functionality. As flexible regulatory components of a synthetic genetic network, we also created new versions of the tetracycline-regulated transactivators tTA and rtTA by fusing them to the auxin-inducible degron (AID). Using our gene assembly approach, we made yeast expression vectors of these engineered transactivators, AIDtTA and AIDrtTA and then tested their functions in yeast. We showed that these factors can be regulated by doxycycline and degraded rapidly after addition of auxin to the medium. Taken together, the method for combinatorial gene assembly described here is versatile and would be a valuable tool for yeast synthetic biology. PMID:23675537
Zhang, Xiaoguang; Yang, Ren; Wang, Jiao; Wang, Xuan; Hou, Mieling; An, Lina; Zhu, Ying; Cao, Yuxi; Zeng, Yi
2016-01-01
We used 293 cells to express the recombinant membrane protein of the Ebola virus. Then, the immunogenicity of the recombinant protein was studied by immunized BALB/c mice. According to the codon use frequency of humans, the gene encoding the extracellular domain of the Ebola virus membrane protein was optimized, synthesized, and inserted into the eukaryotic expression plasmid pXG-Fc to construct the human IgG Fc and Ebola GP fusion protein expression plasmid pXG-modGP-Fc. To achieve expression, the fusion protein expression vector was transfected into high-density 293 cells using transient transfection technology. The recombinant protein was purified by protein A affinity chromatography. BALB/c mice were immunized with the purified fusion protein, and serum antibody titers evaluated by an indirect enzyme-linked immunosorbent assay (ELISA). Purification and analyses of the protein revealed that the eukaryotic expression vector could express the recombinant protein GP-Fc effectively, and that the recombinant protein in the supernatant of the cell culture was present as a dimer. After immunization with the purified recombinant protein, a high titer of antigen-specific IgG could be detected in the serum of immunized mice by indirect ELISA, showing that the recombinant protein had good immunogenicity. These data suggest that we obtained a recombinant protein with good immunogenicity. Our study is the basis for development of a vaccine against the Ebola virus and for screening of monoclonal antibodies.
Shang, Shu-huan; Zhang, Yu-feng; Shi, Bin; Cheng, Xiang-rong
2008-10-01
To construct a recombinant human platelet-derived growth factor-B (PDGF-B) adenoviral vector and to transfect it into human periodontal ligament stem cells (PDLSC). The recombinant plasmid pAd-PDGF-B was constructed by homologous recombination and confirmed by restriction endonucleases digestion. Recombinant adenovirus was packaged in HEK293 cells. PDLSC were transfected with recombinant adenovirus and PDGF-B expression was confirmed. Expression of collagen type I gene was determined by quantitative analysis of the products of RT-PCR. The cell proliferation was determined with MTT colorimetric assay. The recombinant plasmid pAd-PDGF-B was confirmed by restriction endonucleases digestion. EGFP expression was observed on the third day after transfecting, and the expression of PDGF-B was detected. Immunohistochemical methods revealed that PDGF-B was expressed in PDLSC. Levels of expression of collagen type I gene were increased significantly by transfer of the exogenous PDGF-B gene to PDLSC. At the same time, findings indicated that Ad-PDGF-B stimulated PDLSC proliferation. MTT assay indicated the absorbance of PDLSC by stimulating with Ad-PDGF-B was (0.68 +/- 0.02), P < 0.01. Using the AdEasy system, the human PDGF-B recombinant adenovirus can be rapidly obtained. These results indicate that recombinant adenoviruses encoding PDGF-B transgenes could modulate proliferative activity of PDLSC, enhance the high expression of collagen type I and lay the foundation for periodontal tissue regeneration and dental implant gene therapy.
Complete Sequence and Molecular Epidemiology of IncK Epidemic Plasmid Encoding blaCTX-M-14
Cottell, Jennifer L.; Webber, Mark A.; Coldham, Nick G.; Taylor, Dafydd L.; Cerdeño-Tárraga, Anna M.; Hauser, Heidi; Thomson, Nicholas R.; Woodward, Martin J.
2011-01-01
Antimicrobial drug resistance is a global challenge for the 21st century with the emergence of resistant bacterial strains worldwide. Transferable resistance to β-lactam antimicrobial drugs, mediated by production of extended-spectrum β-lactamases (ESBLs), is of particular concern. In 2004, an ESBL-carrying IncK plasmid (pCT) was isolated from cattle in the United Kingdom. The sequence was a 93,629-bp plasmid encoding a single antimicrobial drug resistance gene, blaCTX-M-14. From this information, PCRs identifying novel features of pCT were designed and applied to isolates from several countries, showing that the plasmid has disseminated worldwide in bacteria from humans and animals. Complete DNA sequences can be used as a platform to develop rapid epidemiologic tools to identify and trace the spread of plasmids in clinically relevant pathogens, thus facilitating a better understanding of their distribution and ability to transfer between bacteria of humans and animals. PMID:21470454
Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete
2004-09-09
We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.
Zhang, Bo; Zhang, Lin; Dai, Ruixue; Yu, Meiying; Zhao, Guoping; Ding, Xiaoming
2013-01-01
Streptomyces bacteria are known for producing important natural compounds by secondary metabolism, especially antibiotics with novel biological activities. Functional studies of antibiotic-biosynthesizing gene clusters are generally through homologous genomic recombination by gene-targeting vectors. Here, we present a rapid and efficient method for construction of gene-targeting vectors. This approach is based on Streptomyces phage φBT1 integrase-mediated multisite in vitro site-specific recombination. Four 'entry clones' were assembled into a circular plasmid to generate the destination gene-targeting vector by a one-step reaction. The four 'entry clones' contained two clones of the upstream and downstream flanks of the target gene, a selectable marker and an E. coli-Streptomyces shuttle vector. After targeted modification of the genome, the selectable markers were removed by φC31 integrase-mediated in vivo site-specific recombination between pre-placed attB and attP sites. Using this method, part of the calcium-dependent antibiotic (CDA) and actinorhodin (Act) biosynthetic gene clusters were deleted, and the rrdA encoding RrdA, a negative regulator of Red production, was also deleted. The final prodiginine production of the engineered strain was over five times that of the wild-type strain. This straightforward φBT1 and φC31 integrase-based strategy provides an alternative approach for rapid gene-targeting vector construction and marker removal in streptomycetes.
Neomycin resistance as a selectable marker in Methanococcus maripaludis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Argyle, J.L.; Leigh, J.A.; Tumbula, D.L.
1996-11-01
The authors cloned the aminoglycoside phosphotransferase genes APH3{prime}I and APH3{prime}II between the Methanococcus voltae methyl reductase promoter and terminator in a plasmid containing a fragment of Methanococcus maripaludis chromosomal DNA. The resulting plasmids encoding neomycin resistance transformed M. maripaludis at frequencies similar to those observed for pKAS102 encoding puromycin resistance. The antibiotic geneticin was not inhibitory to M. maripaludis. 22 refs., 3 figs., 3 tabs.
Agrobacterium-mediated transformation of lipomyces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Ziyu; Magnuson, Jon K.; Deng, Shuang
This disclosure provides Agrobacterium-mediated transformation methods for the oil-producing (oleaginous) yeast Lipomyces sp., as well as yeast produced by the method. Such methods utilize Agrobacterium sp. cells that have a T-DNA binary plasmid, wherein the T-DNA binary plasmid comprises a first nucleic acid molecule encoding a first protein and a second nucleic acid molecule encoding a selective marker that permits growth of transformed Lipomyces sp. cells in selective culture media comprising an antibiotic.
Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.
2013-01-01
To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051
Replicon typing of plasmids encoding resistance to newer beta-lactams.
Carattoli, Alessandra; Miriagou, Vivi; Bertini, Alessia; Loli, Alexandra; Colinon, Celine; Villa, Laura; Whichard, Jean M; Rossolini, Gian Maria
2006-07-01
Polymerase chain reaction-based replicon typing represents a novel method to describe the dissemination and follow the evolution of resistance plasmids. We used this approach to study 26 epidemiologically unrelated Enterobacteriaceae and demonstrate the dominance of incompatibility (Inc) A/C or Inc N-related plasmids carrying some emerging resistance determinants to extended-spectrum cephalosporins and carbapenems.
Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin
2016-01-01
Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
2012-01-01
Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697
Nafissi, Nafiseh; Slavcev, Roderick
2012-12-06
While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.
Folster, J. P.; Pecic, G.; Stroika, S.; Rickert, R.; Whichard, J.
2015-01-01
Escherichia coli O157 is a major cause of foodborne illness. Plasmids are genetic elements that mobilize antimicrobial resistance determinants including blaCMY β-lactamases that confer resistance to extended-spectrum cephalosporins (ESC). ESCs are important for treating a variety of infections. IncA/C plasmids are found among diverse sources, including cattle, the principal source of E. coli O157 infections in humans. IncI1 plasmids are common among E. coli and Salmonella from poultry and other avian sources. To broaden our understanding of reservoirs of blaCMY, we determined the types of plasmids carrying blaCMY among E. coli O157. From 1996 to 2009, 3742 E. coli O157 isolates were tested. Eleven (0.29%) were ceftriaxone resistant and had a blaCMY-2-containing plasmid. All four isolates submitted before 2001 and a single 2001 isolate had blaCMY encoded on IncA/C plasmids, while all five isolates submitted after 2001 and a single 2001 isolate had blaCMY carried on IncI1 plasmids. The IncI1 plasmids were ST2, ST20, and ST23. We conclude that cephalosporin resistance among E. coli O157:H7 is due to plasmid-encoded blaCMY genes and that plasmid types appear to have shifted from IncA/C to IncI1. This shift suggests either a change in plasmid type among animal reservoirs or that the organism has expanded into avian reservoirs. More analysis of human, retail meat, and food animal isolates is necessary to broaden our understanding of the antimicrobial resistance determinants of ESC resistance among E. coli O157. PMID:26478858
Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu
2008-06-01
This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.
Turning self-destructing Salmonella into a universal DNA vaccine delivery platform.
Kong, Wei; Brovold, Matthew; Koeneman, Brian A; Clark-Curtiss, Josephine; Curtiss, Roy
2012-11-20
We previously developed a biological containment system using recombinant Salmonella Typhimurium strains that are attenuated yet capable of synthesizing protective antigens. The regulated delayed attenuation and programmed self-destructing features designed into these S. Typhimurium strains enable them to efficiently colonize host tissues and allow release of the bacterial cell contents after lysis. To turn such a recombinant attenuated Salmonella vaccine (RASV) strain into a universal DNA vaccine-delivery vehicle, our approach was to genetically modify RASV strains to display a hyperinvasive phenotype to maximize Salmonella host entry and host cell internalization, to enable Salmonella endosomal escape to release a DNA vaccine into the cytosol, and to decrease Salmonella-induced pyroptosis/apoptosis that allows the DNA vaccine time to traffic to the nucleus for efficient synthesis of encoded protective antigens. A DNA vaccine vector that encodes a domain that contributes to the arabinose-regulated lysis phenotype but has a eukaryotic promoter was constructed. The vector was then improved by insertion of multiple DNA nuclear-targeting sequences for efficient nuclear trafficking and gene expression, and by increasing nuclease resistance to protect the plasmid from host degradation. A DNA vaccine encoding influenza WSN virus HA antigen delivered by the RASV strain with the best genetic attributes induced complete protection to mice against a lethal influenza virus challenge. Adoption of these technological improvements will revolutionize means for effective delivery of DNA vaccines to stimulate mucosal, systemic, and cellular protective immunities, and lead to a paradigm shift in cost-effective control and prevention of a diversity of diseases.
Turning self-destructing Salmonella into a universal DNA vaccine delivery platform
Kong, Wei; Brovold, Matthew; Koeneman, Brian A.; Clark-Curtiss, Josephine; Curtiss, Roy
2012-01-01
We previously developed a biological containment system using recombinant Salmonella Typhimurium strains that are attenuated yet capable of synthesizing protective antigens. The regulated delayed attenuation and programmed self-destructing features designed into these S. Typhimurium strains enable them to efficiently colonize host tissues and allow release of the bacterial cell contents after lysis. To turn such a recombinant attenuated Salmonella vaccine (RASV) strain into a universal DNA vaccine-delivery vehicle, our approach was to genetically modify RASV strains to display a hyperinvasive phenotype to maximize Salmonella host entry and host cell internalization, to enable Salmonella endosomal escape to release a DNA vaccine into the cytosol, and to decrease Salmonella-induced pyroptosis/apoptosis that allows the DNA vaccine time to traffic to the nucleus for efficient synthesis of encoded protective antigens. A DNA vaccine vector that encodes a domain that contributes to the arabinose-regulated lysis phenotype but has a eukaryotic promoter was constructed. The vector was then improved by insertion of multiple DNA nuclear-targeting sequences for efficient nuclear trafficking and gene expression, and by increasing nuclease resistance to protect the plasmid from host degradation. A DNA vaccine encoding influenza WSN virus HA antigen delivered by the RASV strain with the best genetic attributes induced complete protection to mice against a lethal influenza virus challenge. Adoption of these technological improvements will revolutionize means for effective delivery of DNA vaccines to stimulate mucosal, systemic, and cellular protective immunities, and lead to a paradigm shift in cost-effective control and prevention of a diversity of diseases. PMID:23129620
hisT is part of a multigene operon in Escherichia coli K-12.
Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E
1985-01-01
The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810
Lord, Megan S; Ellis, April L; Farrugia, Brooke L; Whitelock, John M; Grenett, Hernan; Li, Chuanyu; O'Grady, Robert L; DeCarlo, Arthur A
2017-03-28
The repair of dermal wounds, particularly in the diabetic population, poses a significant healthcare burden. The impaired wound healing of diabetic wounds is attributed to low levels of endogenous growth factors, including vascular endothelial growth factor (VEGF), that normally stimulate multiple phases of wound healing. In this study, chitosan scaffolds were prepared via freeze drying and loaded with plasmid DNA encoding perlecan domain I and VEGF189 and analyzed in vivo for their ability to promote dermal wound healing. The plasmid DNA encoding perlecan domain I and VEGF189 loaded scaffolds promoted dermal wound healing in normal and diabetic rats. This treatment resulted in an increase in the number of blood vessels and sub-epithelial connective tissue matrix components within the wound beds compared to wounds treated with chitosan scaffolds containing control DNA or wounded controls. These results suggest that chitosan scaffolds containing plasmid DNA encoding VEGF189 and perlecan domain I have the potential to induce angiogenesis and wound healing. Copyright © 2017 Elsevier B.V. All rights reserved.
2009-01-01
Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112
The evolution of heart gene delivery vectors.
Wasala, Nalinda B; Shin, Jin-Hong; Duan, Dongsheng
2011-10-01
Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. Copyright © 2011 John Wiley & Sons, Ltd.
The evolution of heart gene delivery vectors
Wasala, Nalinda B.; Shin, Jin-Hong; Duan, Dongsheng
2012-01-01
Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. PMID:21837689
Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique
2003-01-01
The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947
Construction of pTM series plasmids for gene expression in Brucella species.
Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing
2016-04-01
Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.
Folster, Jason P.; Grass, Julian E.; Bicknese, Amelia; Taylor, Julia; Friedman, Cindy R.; Whichard, Jean M.
2017-01-01
Salmonella is an important cause of foodborne illness; however, quickly identifying the source of these infections can be difficult, and source identification is a crucial step in preventing additional illnesses. Although most infections are self-limited, invasive salmonellosis may require antimicrobial treatment. Ceftriaxone, an extended-spectrum cephalosporin, is commonly used for treatment of salmonellosis. Previous studies have identified a correlation between the food animal/retail meat source of ceftriaxone-resistant Salmonella and the type of resistance gene and plasmid it carries. In this study, we examined seven outbreaks of ceftriaxone-resistant Salmonella infections, caused by serotypes Typhimurium, Newport, Heidelberg, and Infantis. All isolates were positive for a plasmid-encoded blaCMY gene. Plasmid incompatibility typing identified five IncI1 and two IncA/C plasmids. Both outbreaks containing blaCMY-IncA/C plasmids were linked to consumption of cattle products. Three of five outbreaks with blaCMY-IncI1 (ST12) plasmids were linked to a poultry source. The remaining IncI1 outbreaks were associated with ground beef (ST20) and tomatoes (ST12). Additionally, we examined isolates from five unsolved clusters of ceftriaxone-resistant Salmonella infections and used our plasmid encoded gene findings to predict the source. Overall, we identified a likely association between the source of ceftriaxone-resistant Salmonella outbreaks and the type of resistance gene/plasmid it carries. PMID:27828730
Folster, Jason P; Grass, Julian E; Bicknese, Amelia; Taylor, Julia; Friedman, Cindy R; Whichard, Jean M
2017-03-01
Salmonella is an important cause of foodborne illness; however, quickly identifying the source of these infections can be difficult, and source identification is a crucial step in preventing additional illnesses. Although most infections are self-limited, invasive salmonellosis may require antimicrobial treatment. Ceftriaxone, an extended-spectrum cephalosporin, is commonly used for treatment of salmonellosis. Previous studies have identified a correlation between the food animal/retail meat source of ceftriaxone-resistant Salmonella and the type of resistance gene and plasmid it carries. In this study, we examined seven outbreaks of ceftriaxone-resistant Salmonella infections, caused by serotypes Typhimurium, Newport, Heidelberg, and Infantis. All isolates were positive for a plasmid-encoded bla CMY gene. Plasmid incompatibility typing identified five IncI1 and two IncA/C plasmids. Both outbreaks containing bla CMY -IncA/C plasmids were linked to consumption of cattle products. Three of five outbreaks with bla CMY -IncI1 (ST12) plasmids were linked to a poultry source. The remaining IncI1 outbreaks were associated with ground beef (ST20) and tomatoes (ST12). In addition, we examined isolates from five unsolved clusters of ceftriaxone-resistant Salmonella infections and used our plasmid-encoded gene findings to predict the source. Overall, we identified a likely association between the source of ceftriaxone-resistant Salmonella outbreaks and the type of resistance gene/plasmid it carries.
A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads
Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...
2018-02-01
In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less
A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka
In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less
Winstone, Nicola; Wilson, Aaron J.; Morrow, Gavin; Boggiano, Cesar; Chiuchiolo, Maria J.; Lopez, Mary; Kemelman, Marina; Ginsberg, Arielle A.; Mullen, Karl; Coleman, John W.; Wu, Chih-Da; Narpala, Sandeep; Ouellette, Ian; Dean, Hansi J.; Lin, Feng; Sardesai, Niranjan Y.; Cassamasa, Holly; McBride, Dawn; Felber, Barbara K.; Pavlakis, George N.; Schultz, Alan; Hudgens, Michael G.; King, C. Richter; Zamb, Timothy J.; Parks, Christopher L.; McDermott, Adrian B.
2011-01-01
DNA priming has previously been shown to elicit augmented immune responses when administered by electroporation (EP) or codelivered with a plasmid encoding interleukin-12 (pIL-12). We hypothesized that the efficacy of a DNA prime and recombinant adenovirus 5 boost vaccination regimen (DNA/rAd5) would be improved when incorporating these vaccination strategies into the DNA priming phase, as determined by pathogenic simian immunodeficiency virus SIVmac239 challenge outcome. The whole SIVmac239 proteome was delivered in 5 separate DNA plasmids (pDNA-SIV) by EP with or without pIL-12, followed by boosting 4 months later with corresponding rAd5-SIV vaccine vectors. Remarkably, after repeated low-dose SIVmac239 mucosal challenge, we demonstrate 2.6 and 4.4 log reductions of the median SIV peak and set point viral loads in rhesus macaques (RMs) that received pDNA-SIV by EP with pIL-12 compared to the median peak and set point viral loads in mock-immunized controls (P < 0.01). In 5 out of 6 infected RMs, strong suppression of viremia was observed, with intermittent “blips” in virus replication. In 2 RMs, we could not detect the presence of SIV RNA in tissue and lymph nodes, even after 13 viral challenges. RMs immunized without pIL-12 demonstrated a typical maximum of 1.5 log reduction in virus load. There was no significant difference in the overall magnitude of SIV-specific antibodies or CD8 T-cell responses between groups; however, pDNA delivery by EP with pIL-12 induced a greater magnitude of SIV-specific CD4 T cells that produced multiple cytokines. This vaccine strategy is relevant for existing vaccine candidates entering clinical evaluation, and this model may provide insights into control of retrovirus replication. PMID:21734035
Bauwens, Andreas; Marejková, Monika; Middendorf-Bauchart, Barbara; Prager, Rita; Kossow, Annelene; Zhang, Wenlan; Karch, Helge
2017-01-01
ABSTRACT Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H− strains, first identified in Germany, have emerged as important pathogens throughout Europe. Besides chromosomally encoded Shiga toxin 2a (the major virulence factor), several putative virulence loci, including the hly, etp, and sfp operons, encoding EHEC hemolysin, type II secretion system proteins, and Sfp fimbriae, respectively, are located on the 121-kb plasmid pSFO157 in German strains. Here we report novel SF EHEC O157:H− strains isolated from patients in the Czech Republic. These strains share the core genomes and chromosomal virulence loci encoding toxins (stx2a and the cdtV-ABC operon) and adhesins (eae-γ, efa1, lpfAO157OI-141, and lpfAO157OI-154) with German strains but differ essentially in their plasmids. In contrast to all previously detected SF EHEC O157:H− strains, the Czech strains carry two plasmids, of 79 kb and 86 kb. The 79-kb plasmid harbors the sfp operon, but neither of the plasmids contains the hly and etp operons. Sequence analyses demonstrated that the 79-kb plasmid (pSFO157 258/98-1) evolved from pSFO157 of German strains by deletion of a 41,534-bp region via homologous recombination, resulting in loss of the hly and etp operons. The 86-kb plasmid (pSFO157 258/98-2) displays 98% sequence similarity to a 92.7-kb plasmid of an extraintestinal pathogenic E. coli bloodstream isolate. Our finding of this novel plasmid composition in SF EHEC O157:H− strains extends the evolutionary history of EHEC O157 plasmids. Moreover, the unique molecular plasmid characteristics permit the identification of such strains, thereby facilitating further investigations of their geographic distribution, clinical significance, and epidemiology. IMPORTANCE Since their first identification in Germany in 1989, sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H− (nonmotile) strains have emerged as important causes of the life-threatening disease hemolytic-uremic syndrome in Europe. They account for 10 to 20% of sporadic cases of this disease and have caused several large outbreaks. The strains isolated throughout Europe share conserved chromosomal and plasmid characteristics. Here we identified novel sorbitol-fermenting enterohemorrhagic E. coli O157:H− patient isolates in the Czech Republic which differ from all such strains reported previously by their unique plasmid characteristics, including plasmid number, composition of plasmid-carried virulence genes, and plasmid origins. Our findings contribute substantially to understanding the evolution of E. coli O157 strains and their plasmids. In practical terms, they enable the identification of strains with these novel plasmid characteristics in patient stool samples and thus the investigation of their roles as human pathogens in other geographic areas. PMID:28970221
Bauwens, Andreas; Marejková, Monika; Middendorf-Bauchart, Barbara; Prager, Rita; Kossow, Annelene; Zhang, Wenlan; Karch, Helge; Mellmann, Alexander; Bielaszewska, Martina
2017-12-01
Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H - strains, first identified in Germany, have emerged as important pathogens throughout Europe. Besides chromosomally encoded Shiga toxin 2a (the major virulence factor), several putative virulence loci, including the hly , etp , and sfp operons, encoding EHEC hemolysin, type II secretion system proteins, and Sfp fimbriae, respectively, are located on the 121-kb plasmid pSFO157 in German strains. Here we report novel SF EHEC O157:H - strains isolated from patients in the Czech Republic. These strains share the core genomes and chromosomal virulence loci encoding toxins ( stx 2a and the cdtV -ABC operon) and adhesins ( eae -γ, efa1 , lpfA O157OI-141 , and lpfA O157OI-154 ) with German strains but differ essentially in their plasmids. In contrast to all previously detected SF EHEC O157:H - strains, the Czech strains carry two plasmids, of 79 kb and 86 kb. The 79-kb plasmid harbors the sfp operon, but neither of the plasmids contains the hly and etp operons. Sequence analyses demonstrated that the 79-kb plasmid (pSFO157 258/98-1) evolved from pSFO157 of German strains by deletion of a 41,534-bp region via homologous recombination, resulting in loss of the hly and etp operons. The 86-kb plasmid (pSFO157 258/98-2) displays 98% sequence similarity to a 92.7-kb plasmid of an extraintestinal pathogenic E. coli bloodstream isolate. Our finding of this novel plasmid composition in SF EHEC O157:H - strains extends the evolutionary history of EHEC O157 plasmids. Moreover, the unique molecular plasmid characteristics permit the identification of such strains, thereby facilitating further investigations of their geographic distribution, clinical significance, and epidemiology. IMPORTANCE Since their first identification in Germany in 1989, sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H - (nonmotile) strains have emerged as important causes of the life-threatening disease hemolytic-uremic syndrome in Europe. They account for 10 to 20% of sporadic cases of this disease and have caused several large outbreaks. The strains isolated throughout Europe share conserved chromosomal and plasmid characteristics. Here we identified novel sorbitol-fermenting enterohemorrhagic E. coli O157:H - patient isolates in the Czech Republic which differ from all such strains reported previously by their unique plasmid characteristics, including plasmid number, composition of plasmid-carried virulence genes, and plasmid origins. Our findings contribute substantially to understanding the evolution of E. coli O157 strains and their plasmids. In practical terms, they enable the identification of strains with these novel plasmid characteristics in patient stool samples and thus the investigation of their roles as human pathogens in other geographic areas. Copyright © 2017 American Society for Microbiology.
Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan
2014-01-01
In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961
Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard
1983-01-01
We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426
Replicon Typing of Plasmids Encoding Resistance to Newer β-Lactams
Miriagou, Vivi; Bertini, Alessia; Loli, Alexandra; Colinon, Celine; Villa, Laura; Whichard, Jean M.; Rossolini, Gian Maria
2006-01-01
Polymerase chain reaction–based replicon typing represents a novel method to describe the dissemination and follow the evolution of resistance plasmids. We used this approach to study 26 epidemiologically unrelated Enterobacteriaceae and demonstrate the dominance of incompatibility (Inc) A/C or Inc N-related plasmids carrying some emerging resistance determinants to extended-spectrum cephalosporins and carbapenems. PMID:16836838
USDA-ARS?s Scientific Manuscript database
The genomes of a diverse set of Shiga toxin-producing E. coli strains and the presence of 38 plasmids among all the isolates were determined. Among the novel plasmids found, there were eight that encoded resistance genes to antibiotics, including aminoglycosides, carbapenems, penicillins, cephalosp...
Sesma, F; Gardiol, D; de Ruiz Holgado, A P; de Mendoza, D
1990-01-01
The citrate plasmid (Cit+ plasmid) from Lactococcus lactis subsp. lactis biovar diacetylactis was cloned into the EcoRI site of plasmid pUC18. This recombinant plasmid enabled Escherichia coli K-12 to transport and utilize citrate as a source of energy, indicating expression of the citrate permease from L. lactis biovar diacetylactis. The citrate permease was under the control of the lac promoter of pUC18. Genetic expression of the Cit+ plasmid in maxicells revealed that the plasmid encoded two polypeptides of 47 and 32 kilodaltons, determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2117878
Toda, Hiroshi; Itoh, Nobuya
2017-01-01
The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.
NDM-1 encoded by a pNDM-HN380-like plasmid pNDM-BJ03 in clinical Enterobacter cloacae.
Lü, Yang; Liu, Wei; Liang, Hui; Zhao, Shulong; Zhang, Wei; Liu, Jia; Jin, Cheng; Hu, Hongyan
2018-02-01
A carbapenemase-producing Enterobacter cloacae hhy03 with a bla NDM-1 and bla SHV-12 -coharboring plasmid was isolated from a sputum specimen of a patient. This is the third nucleotide sequence report of bla NDM-1 -harboring plasmid from Enterobacter cloacae that have caused lethal infections in China, indicating the spread of NDM-1 by IncX3 plasmid between Enterobacteriaceae. Copyright © 2017. Published by Elsevier Inc.
Le Pihive, E; Blaha, D; Chenavas, S; Thibault, F; Vidal, D; Valade, E
2009-11-01
Francisella tularensis is the causative agent of tularemia, a zoonotic disease often transmitted to humans by infected animals. The lack of useful specific genetic tools has long hampered the study of F. tularensis subspecies. We identified and characterized two new plasmids, pF242 and pF243, isolated from Francisella philomiragia strains ATCC 25016 and ATCC 25017, respectively. Sequence analysis revealed that pF242 and pF243 are closely related to pC194 and pFNL10 plasmids, respectively. Two generations of pF242- and pF243-based shuttle vectors, harboring several antibiotic resistance markers, were developed. We used the first generation to compare transformation efficiencies in two virulent F. tularensis subspecies. We found that electroporation was more efficient than cryotransformation: almost all vectors tested were successfully introduced by electroporation into Francisella strains with a high level of efficiency. The second generation of shuttle vectors, containing a multiple cloning site and/or gfp gene downstream of Francisella groES promotor, was used for GFP production in F. tularensis. The development of new shuttle vectors offers new perspectives in the genetic manipulation of F. tularensis, helping to elucidate the mechanisms underlying its virulence.
Non-viral gene delivery strategies for cancer therapy, tissue engineering and regenerative medicine
NASA Astrophysics Data System (ADS)
Bhise, Nupura S.
Gene therapy involves the delivery of deoxyribonucleic acid (DNA) into cells to override or replace a malfunctioning gene for treating debilitating genetic diseases, including cancer and neurodegenerative diseases. In addition to its use as a therapeutic, it can also serve as a technology to enable regenerative medicine strategies. The central challenge of the gene therapy research arena is developing a safe and effective delivery agent. Since viral vectors have critical immunogenic and tumorogenic safety issues that limit their clinical use, recent efforts have focused on developing non-viral biomaterial based delivery vectors. Cationic polymers are an attractive class of gene delivery vectors due to their structural versatility, ease of synthesis, biodegradability, ability to self-complex into nanoparticles with negatively charged DNA, capacity to carry large cargo, cellular uptake and endosomal escape capacity. In this thesis, we hypothesized that developing a biomaterial library of poly(betaamino esters) (PBAE), a newer class of cationic polymers consisting of biodegradable ester groups, would allow investigating vector design parameters and formulating effective non-viral gene delivery strategies for cancer drug delivery, tissue engineering and stem cell engineering. Consequently, a high-throughput transfection assay was developed to screen the PBAE-based nanoparticles in hard to transfect fibroblast cell lines. To gain mechanistic insights into the nanoparticle formulation process, biophysical properties of the vectors were characterized in terms of molecular weight (MW), nanoparticle size, zeta potential and plasmid per particle count. We report a novel assay developed for quantifying the plasmid per nanoparticle count and studying its implications for co-delivery of multiple genes. The MW of the polymers ranged from 10 kDa to 100 kDa, nanoparticle size was about 150 run, zeta potential was about 30 mV in sodium acetate buffer (25 mM, pH 5) and 30 to 100 plasmids were associated with a single polymeric nanoparticle. To develop PBAE vectors for application in cancer drug delivery and 3-D tissue engineered cultures, the gene delivery efficacy of PBAE nanoparticles was evaluated in mammary epithelial cells used as a model for studying normal development of mammary gland as well as the events that lead to development of breast cancer. We investigated how small molecular changes to the end-capping terminal group of the polymer and changes to the polymer MW affect gene delivery in 2-D mammary cell culture compared to 3-D primary organotypic cultured mouse mammary tissue. We reported that the polymers synthesized here are more effective for gene delivery than FuGENERTM HD, one of the leading commercially available reagents for non-viral gene delivery. We also highlighted that transfection of the 3-D organotypic cultures is more difficult than transfection of 2-D cultures, but likely models some of the key challenges for in vivo gene therapy more closely than 2-D cultures. Finally, we evaluated the use of PBAE nanotechnology for genetic manipulation of stem cell fate for regenerative medicine applications. We developed a PBAE nanoparticle based non-viral protocol and compared it with an electroporation based approach to deliver episomal plasmids encoding reprogramming factors for derivation of human induced pluripotent stem cells (hiPSC). The hiPSCs generated using these approaches can be differentiated into specific cell types for in vitro disease modeling and drug screening, specifically to study retinal degeneration.
Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors
Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro
2012-01-01
We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107
Woods, J P; Heinecke, E L; Goldman, W E
1998-04-01
We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.
Nakayama, Kosuke; Ohmori, Takeshi; Ishikawa, Satoshi; Iwata, Natsumi; Seto, Yasuo; Kawahara, Kazuyoshi
2016-05-01
The plasmid encoding His-tagged organophosphorus hydrolase (OPH) cloned from Sphingobium fuliginis was modified to be transferred back to this bacterium. The replication function of S. amiense plasmid was inserted at downstream of OPH gene, and S. fuliginis was transformed with this plasmid. The transformant produced larger amount of active OPH with His-tag than E. coli.
Sentchilo, Vladimir S.; Perebituk, Alexander N.; Zehnder, Alexander J. B.; van der Meer, Jan Roelof
2000-01-01
Twenty different Pseudomonas strains utilizing m-toluate were isolated from oil-contaminated soil samples near Minsk, Belarus. Seventeen of these isolates carried plasmids ranging in size from 78 to about 200 kb (assigned pSVS plasmids) and encoding the meta cleavage pathway for toluene metabolism. Most plasmids were conjugative but of unknown incompatibility groups, except for one, which belonged to the IncP9 group. The organization of the genes for toluene catabolism was determined by restriction analysis and hybridization with xyl gene probes of pWW0. The majority of the plasmids carried xyl-type genes highly homologous to those of pWW53 and organized in a similar manner (M. T. Gallegos, P. A. Williams, and J. L. Ramos, J. Bacteriol. 179:5024–5029, 1997), with two distinguishable meta pathway operons, one upper pathway operon, and three xylS-homologous regions. All of these plasmids also possessed large areas of homologous DNA outside the catabolic genes, suggesting a common ancestry. Two other pSVS plasmids carried only one meta pathway operon, one upper pathway operon, and one copy each of xylS and xylR. The backbones of these two plasmids differed greatly from those of the others. Whereas these parts of the plasmids, carrying the xyl genes, were mostly conserved between plasmids of each group, the noncatabolic parts had undergone intensive DNA rearrangements. DNA sequencing of specific regions near and within the xylTE and xylA genes of the pSVS plasmids confirmed the strong homologies to the xyl genes of pWW53 and pWW0. However, several recombinations were discovered within the upper pathway operons of the pSVS plasmids and pWW0. The main genetic mechanisms which are thought to have resulted in the present-day configuration of the xyl operons are discussed in light of the diversity analysis carried out on the pSVS plasmids. PMID:10877777
A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.
Hassan, Sally; Keshavarz-Moore, Eli; Ward, John
2016-09-01
With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.
Qu, Daofeng; Han, Jianzhong; Du, Aifang
2013-07-01
The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.
Lim, C K; Smith, M C; Petty, J; Baumberg, S; Wootton, J C
1989-12-01
The aphD gene of Streptomyces griseus, encoding a streptomycin 6-phosphotransferase (SPH), was sub-cloned in the pBR322-based expression vector pRK9 (which contains the Serratia marcescens trp promoter) with selection for expression of streptomycin resistance in Escherichia coli. Two hybrid plasmids, pCKL631 and pCKL711, were isolated which conferred resistance. Both contained a approximately 2 kbp fragment already suspected to include aphD. The properties of in vitro deletion derivatives of these plasmids were consistent with the presumed location of aphD. In vitro deletion of a sequence including most of the trp promoter largely, but not quite completely, abolished the ability of the plasmid to confer streptomycin resistance, confirming that expression was indeed principally from the trp promoter. A polypeptide of approximately 34.5 kDa was present in minicells containing plasmids that conferred streptomycin resistance, but was absent when the plasmids contained in vitro deletions removing streptomycin resistance. Part of the fragment was sequenced and an open reading frame corresponding to aphD identified. A computer-assisted comparison of the deduced SPH sequence with those of other antibiotic phosphotransferases suggested a common structure A-B-C-D-E, where B and D were conserved between all sequences compared while A, C and E divided between the streptomycin and hygromycin B phosphotransferases on one hand and kanamycin/neomycin ones on the other. A composite sequence data base was searched for homologues to consensus matrices constructed from five approximately 12-residue subsequences within blocks B and D. For one subsequence, corresponding to the N-terminal portion of block D, those sequences from the database that yielded the highest homology scores comprised almost entirely either antibiotic phosphotransferases or eukaryotic protein kinases. Possible evolutionary implications of this homology, previously described by other groups, are discussed.
Geoffroy, C; Alouf, J E
1988-07-01
A chromosomal DNA fragment from Bacillus alvei, encoding a thiol-dependent haemolytic product known as alveolysin (Mr 60,000, pI 5.0) was cloned in Escherichia coli SK1592, using pBR322 as the vector plasmid. Only a single haemolysin-positive clone was identified, by testing for haemolysis on blood agar plates. The haemolytic material was associated with the host bacterial cell. It was released by ultrasonic disruption and purified 267-fold. A 64 kDa polypeptide of pI 8.2 cofractionated with haemolytic activity during gel filtration chromatography and isoelectric focusing. It behaved identically to alveolysin in its activation by thiols, inactivation by thiol group reagents, inhibition by cholesterol, and neutralization, immunoprecipitation and immunoblotting by immune sera raised against alveolysin and streptolysin O.
The genome biology of phytoplasma: modulators of plants and insects.
Sugio, Akiko; Hogenhout, Saskia A
2012-06-01
Phytoplasmas are bacterial pathogens of plants that are transmitted by insects. These bacteria uniquely multiply intracellularly in both plants (Plantae) and insects (Animalia). Similarly to bacterial endosymbionts, phytoplasmas have reduced genomes with limited metabolic capabilities. Nonetheless, the chromosomes of many phytoplasmas are rich in repeated DNA consisting of mobile elements. Phytoplasmas produce an arsenal of effectors most of which are encoded on these mobile elements and on plasmids. These effectors target conserved plant transcription factors resulting in witches' broom and leafy flower symptoms and suppression of plant defense to insect vectors that transmit the phytoplasmas. Future studies of these fascinating microbes will generate a wealth of new knowledge about forces that shape genomes and microbial interactions with multicellular hosts. Copyright © 2012 Elsevier Ltd. All rights reserved.
Intramolecular transposition by a synthetic IS50 (Tn5) derivative
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomcsanyi, T.; Phadnis, S.H.; Berg, D.E.
1990-11-01
We report the formation of deletions and inversions by intramolecular transposition of Tn5-derived mobile elements. The synthetic transposons used contained the IS50 O and I end segments and the transposase gene, a contraselectable gene encoding sucrose sensitivity (sacB), antibiotic resistance genes, and a plasmid replication origin. Both deletions and inversions were associated with loss of a 300-bp segment that is designated the vector because it is outside of the transposon. Deletions were severalfold more frequent than inversions, perhaps reflecting constraints on DNA twisting or abortive transposition. Restriction and DNA sequence analyses showed that both types of rearrangements extended from onemore » transposon end to many different sites in target DNA. In the case of inversions, transposition generated 9-bp direct repeats of target sequences.« less
Bossé, Janine T.; Li, Yanwen; Walker, Stephanie; Atherton, Tom; Fernandez Crespo, Roberto; Williamson, Susanna M.; Rogers, Jon; Chaudhuri, Roy R.; Weinert, Lucy A.; Oshota, Olusegun; Holden, Matt T. G.; Maskell, Duncan J.; Tucker, Alexander W.; Wren, Brendan W.; Rycroft, Andrew N.; Langford, Paul R.
2015-01-01
Objectives The objective of this study was to determine the distribution and genetic basis of trimethoprim resistance in Actinobacillus pleuropneumoniae isolates from pigs in England. Methods Clinical isolates collected between 1998 and 2011 were tested for resistance to trimethoprim and sulphonamide. The genetic basis of trimethoprim resistance was determined by shotgun WGS analysis and the subsequent isolation and sequencing of plasmids. Results A total of 16 (out of 106) A. pleuropneumoniae isolates were resistant to both trimethoprim (MIC >32 mg/L) and sulfisoxazole (MIC ≥256 mg/L), and a further 32 were resistant only to sulfisoxazole (MIC ≥256 mg/L). Genome sequence data for the trimethoprim-resistant isolates revealed the presence of the dfrA14 dihydrofolate reductase gene. The distribution of plasmid sequences in multiple contigs suggested the presence of two distinct dfrA14-containing plasmids in different isolates, which was confirmed by plasmid isolation and sequencing. Both plasmids encoded mobilization genes, the sulphonamide resistance gene sul2, as well as dfrA14 inserted into strA, a streptomycin-resistance-associated gene, although the gene order differed between the two plasmids. One of the plasmids further encoded the strB streptomycin-resistance-associated gene. Conclusions This is the first description of mobilizable plasmids conferring trimethoprim resistance in A. pleuropneumoniae and, to our knowledge, the first report of dfrA14 in any member of the Pasteurellaceae. The identification of dfrA14 conferring trimethoprim resistance in A. pleuropneumoniae isolates will facilitate PCR screens for resistance to this important antimicrobial. PMID:25957382
DOE Office of Scientific and Technical Information (OSTI.GOV)
Groom, Joseph; Chung, Daehwan; Olson, Daniel G.
2016-01-29
Clostridium thermocellum is a leading candidate for the consolidated bioprocessing of lignocellulosic biomass for the production of fuels and chemicals. A limitation to the engineering of this strain is the availability of stable replicating plasmid vectors for homologous and heterologous expression of genes that provide improved and/or novel pathways for fuel production. Current vectors relay on replicons from mesophilic bacteria and are not stable at the optimum growth temperature of C. thermocellum. To develop more thermostable genetic tools for C. thermocellum, we constructed vectors based on the hyperthermophilic Caldicellulosiruptor bescii replicon pBAS2. Autonomously replicating shuttle vectors based on pBAS2 reproduciblymore » transformed C. thermocellum at 60 °C and were maintained in multiple copy. Promoters, selectable markers and plasmid replication proteins from C. bescii were functional in C. thermocellum. Phylogenetic analyses of the proteins contained on pBAS2 revealed that the replication initiation protein RepL is unique among thermophiles. Lastly, these results suggest that pBAS2 may be a broadly useful replicon for other thermophilic Firmicutes.« less
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
Kukor, J J; Olsen, R H; Siak, J S
1989-01-01
When Pseudomonas aeruginosa PAO1c or P. putida PPO200 or PPO300 carry plasmid pJP4, which encodes enzymes for the degradation of 2,4-dichlorophenoxyacetic acid (TFD) to 2-chloromaleylacetate, cells do not grow on TFD and UV-absorbing material with spectral characteristics of chloromaleylacetate accumulates in the culture medium. Using plasmid pRO1727, we cloned from the chromosome of a nonfluorescent pseudomonad, Pseudomonas sp. strain PKO1, 6- and 0.5-kilobase BamHI DNA fragments which contain the gene for maleylacetate reductase. When carrying either of the recombinant plasmids, pRO1944 or pRO1945, together with pJP4, cells of P. aeruginosa or P. putida were able to utilize TFD as a sole carbon source for growth. A novel polypeptide with an estimated molecular weight of 18,000 was detected in cell extracts of P. aeruginosa carrying either plasmid pRO1944 or plasmid pRO1945. Maleylacetate reductase activity was induced in cells of P. aeruginosa or P. putida carrying plasmid pRO1945, as well as in cells of Pseudomonas strain PKO1, when grown on L-tyrosine, suggesting that the tyrosine catabolic pathway might be the source from which maleylacetate reductase is recruited for the degradation of TFD in pJP4-bearing cells of Pseudomonas sp. strain PKO1. Images PMID:2722753
Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy
2010-01-01
asdA mutants of Gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd+ plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd+ plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric Gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd+ expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd+ vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd+ plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry. PMID:21209920
Santander, Javier; Xin, Wei; Yang, Zhao; Curtiss, Roy
2010-12-29
asdA mutants of gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. In environments deprived of DAP, i.e., animal tissues, they will undergo lysis. Deletion of the asdA gene has previously been exploited to develop antibiotic-sensitive strains of live attenuated recombinant bacterial vaccines. Introduction of an Asd(+) plasmid into a ΔasdA mutant makes the bacterial strain plasmid-dependent. This dependence on the Asd(+) plasmid vector creates a balanced-lethal complementation between the bacterial strain and the recombinant plasmid. E. ictaluri is an enteric gram-negative fish pathogen that causes enteric septicemia in catfish. Because E. ictaluri is a nasal/oral invasive intracellular pathogen, this bacterium is a candidate to develop a bath/oral live recombinant attenuated Edwardsiella vaccine (RAEV) for the catfish aquaculture industry. As a first step to develop an antibiotic-sensitive RAEV strain, we characterized and deleted the E. ictaluri asdA gene. E. ictaluri ΔasdA01 mutants exhibit an absolute requirement for DAP to grow. The asdA gene of E. ictaluri was complemented by the asdA gene from Salmonella. Several Asd(+) expression vectors with different origins of replication were transformed into E. ictaluri ΔasdA01. Asd(+) vectors were compatible with the pEI1 and pEI2 E. ictaluri native plasmids. The balanced-lethal system was satisfactorily evaluated in vivo. Recombinant GFP, PspA, and LcrV proteins were synthesized by E. ictaluri ΔasdA01 harboring Asd(+) plasmids. Here we constructed a balanced-lethal system, which is the first step to develop an antibiotic-sensitive RAEV for the aquaculture industry.
Using Phage Display to Create Recombinant Antibodies.
Dasch, James R; Dasch, Amy L
2017-09-01
A variety of phage display technologies have been developed since the approach was first described for antibodies. The most widely used approaches incorporate antibody sequences into the minor coat protein pIII of the nonlytic filamentous phage fd or M13. Libraries of variable gene sequences, encoding either scFv or Fab fragments, are made by incorporating sequences into phagemid vectors. The phagemid is packaged into phage particles with the assistance of a helper phage to produce the antibody display phage. This protocol describes a method for creating a phagemid library. The multiple cloning site (MCS) of the pBluescript KS(-) phagemid vector is replaced by digestion with the restriction enzyme BssHII, followed by the insertion of four overlapping oligonucleotides to create a new MCS within the vector. Next, the 3' portion of gene III (from M13mp18) is amplified and combined with an antibody sequence using overlap extension PCR. This product is inserted into the phagemid vector to create pPDS. Two helper plasmids are also created from the modified pBluescript vector: pLINK provides the linker between the heavy and light chains, and pFABC provides the CH1 domain of the heavy chain. An antibody cDNA library is constructed from the RNA of interest and ligated into pPDS. The phagemid library is electroporated into Escherichia coli cells along with the VCS-M13 helper phage. © 2017 Cold Spring Harbor Laboratory Press.
Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R
2004-07-01
The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.
Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid
2017-03-01
There is no effective vaccine for the prevention and elimination of leishmaniasis. For this reason, we assessed the protective effects of DNA vaccines containing LeIF, TSA genes alone, or LeIF-TSA fusion against cutaneous leishmaniasis pEGFP-N1 plasmid (empty vector) and phosphate buffer saline (PBS) were used as control groups. Therefore, cellular and humoral immune responses were evaluated before and after the challenge with Leishmania major. Lesion diameter was also measured 3-12 weeks after challenge. All immunized mice with plasmid DNA encoding Leishmania antigens induced the partial immunity characterized by increased IFN-γ and IgG2a levels compared with control groups (p < 0.001). Furthermore, the immunized mice showed significant reduction in mean lesion sizes compared with mice in empty vector and PBS groups (p < 0.05). The reduction in lesion diameter was 29.3%, 34.1%, and 46.2% less in groups vaccinated with LeIF, TSA, and LeIF-TSA, respectively, than in PBS group at 12th week post infection. IFN/IL-4 and IgG2a/IgG1 ratios indicated that group receiving LeIF-TSA fusion had the highest IFN-γ and IgG2a levels. In this study, DNA immunization promoted Th1 immune response characterized by higher IFN-γ and IgG2a levels and also reduction in lesion size. These results showed that a bivalent vaccine containing two distinct antigens may induce more potent immune responses against leishmaniasis. © 2017 APMIS. Published by John Wiley & Sons Ltd.
Reschner, Anca; Scohy, Sophie; Vandermeulen, Gaëlle; Daukandt, Marc; Jacques, Céline; Michel, Benjamin; Nauwynck, Hans; Xhonneux, Florence; Préat, Véronique; Vanderplasschen, Alain; Szpirer, Cédric
2013-01-01
The appearance of new viruses and the cost of developing certain vaccines require that new vaccination strategies now have to be developed. DNA vaccination seems to be a particularly promising method. For this application, plasmid DNA is injected into the subject (man or animal). This plasmid DNA encodes an antigen that will be expressed by the cells of the subject. In addition to the antigen, the plasmid also encodes a resistance to an antibiotic, which is used during the construction and production steps of the plasmid. However, regulatory agencies (FDA, USDA and EMA) recommend to avoid the use of antibiotics resistance genes. Delphi Genetics developed the Staby® technology to replace the antibiotic-resistance gene by a selection system that relies on two bacterial genes. These genes are small in size (approximately 200 to 300 bases each) and consequently encode two small proteins. They are naturally present in the genomes of bacteria and on plasmids. The technology is already used successfully for production of recombinant proteins to achieve higher yields and without the need of antibiotics. In the field of DNA vaccines, we have now the first data validating the innocuousness of this Staby® technology for eukaryotic cells and the feasibility of an industrial production of an antibiotic-free DNA vaccine. Moreover, as a proof of concept, mice have been successfully vaccinated with our antibiotic-free DNA vaccine against a deadly disease, pseudorabies (induced by Suid herpesvirus-1). PMID:24051431
Reschner, Anca; Scohy, Sophie; Vandermeulen, Gaëlle; Daukandt, Marc; Jacques, Céline; Michel, Benjamin; Nauwynck, Hans; Xhonneux, Florence; Préat, Véronique; Vanderplasschen, Alain; Szpirer, Cédric
2013-10-01
The appearance of new viruses and the cost of developing certain vaccines require that new vaccination strategies now have to be developed. DNA vaccination seems to be a particularly promising method. For this application, plasmid DNA is injected into the subject (man or animal). This plasmid DNA encodes an antigen that will be expressed by the cells of the subject. In addition to the antigen, the plasmid also encodes a resistance to an antibiotic, which is used during the construction and production steps of the plasmid. However, regulatory agencies (FDA, USDA and EMA) recommend to avoid the use of antibiotics resistance genes. Delphi Genetics developed the Staby(®) technology to replace the antibiotic-resistance gene by a selection system that relies on two bacterial genes. These genes are small in size (approximately 200 to 300 bases each) and consequently encode two small proteins. They are naturally present in the genomes of bacteria and on plasmids. The technology is already used successfully for production of recombinant proteins to achieve higher yields and without the need of antibiotics. In the field of DNA vaccines, we have now the first data validating the innocuousness of this Staby(®) technology for eukaryotic cells and the feasibility of an industrial production of an antibiotic-free DNA vaccine. Moreover, as a proof of concept, mice have been successfully vaccinated with our antibiotic-free DNA vaccine against a deadly disease, pseudorabies (induced by Suid herpesvirus-1).
Diao, Yong; Zhao, Xiao-Feng; Lin, Jun-Sheng; Wang, Qi-Zhao; Xu, Rui-An
2011-01-07
To investigate the effect of transgenic expression of kallistatin (Kal) on carbon tetrachloride (CCl(4))-induced liver injury by intramuscular (im) electrotransfer of a Kal-encoding plasmid formulated with poly-L-glutamate (PLG). The pKal plasmid encoding Kal gene was formulated with PLG and electrotransferred into mice skeletal muscle before the administration of CCl4. The expression level of Kal was measured. The serum biomarker levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), malonyldialdehyde (MDA), and tumor necrosis factor (TNF)-α were monitored. The extent of CCl4-induced liver injury was analyzed histopathologically. The transgene of Kal was sufficiently expressed after an im injection of plasmid formulated with PLG followed by electroporation. In the Kal gene-transferred mice, protection against CCl4-induced liver injury was reflected by significantly decreased serum ALT, AST, MDA and TNF-α levels compared to those in control mice (P<0.01 to 0.05 in a dose-dependent manner). Histological observations also revealed that hepatocyte necrosis, hemorrhage, vacuolar change and hydropic degeneration were apparent in mice after CCl4 administration. In contrast, the damage was markedly attenuated in the Kal gene-transferred mice. The expression of hepatic fibrogenesis marker transforming growth factor-β1 was also reduced in the pKal transferred mice. Intramuscular electrotransfer of plasmid pKal which was formulated with PLG significantly alleviated the CCl4-induced oxidative stress and inflammatory response, and reduced the liver damage in a mouse model.
Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun
2010-02-01
In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.
Jay, Chris; Nemunaitis, Gregory; Nemunaitis, John; Senzer, Neil; Hinderlich, Stephan; Darvish, Daniel; Ogden, Julie; Eager, John; Tong, Alex; Maples, Phillip B
2008-01-01
Hereditary Inclusion Body Myopathy (HIBM2) is a chronic progressive skeletal muscle wasting disorder which generally leads to complete disability before the age of 50 years. There is currently no effective therapeutic treatment for HIBM2. Development of this disease is related to expression in family members of an autosomal recessive mutation of the GNE gene, which encodes the bifunctional enzyme UDP-GlcNAc 2-epimerase/ManNAc kinase (GNE/MNK). This is the rate limiting bifunctional enzyme that catalyzes the first 2 steps of sialic acid biosynthesis. Decreased sialic acid production, consequently leads to decreased sialyation of a variety of glycoproteins including the critical muscle protein alpha-dystroglycan (α-DG). This in turn severely cripples muscle function and leads to the onset of the syndrome. We hypothesize that replacing the mutated GNE gene with the wildtype gene may restore functional capacity of GNE/MNK and therefore production of sialic acid, allowing for improvement in muscle function and/or delay in rate of muscle deterioration. We have constructed three GNE gene/CMV promoter plasmids (encoding the wildtype, HIBM2, and Sialuria forms of GNE) and demonstrated enhanced GNE gene activity following delivery to GNE-deficient CHO-Lec3 cells. GNE/MNK enzyme function was significantly increased and subsequent induction of sialic acid production was demonstrated after transfection into Lec3 cells with the wild type or R266Q mutant GNE vector. These data form the foundation for future preclinical and clinical studies for GNE gene transfer to treat HIBM2 patients. PMID:19787087
Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria
Taton, Arnaud; Unglaub, Federico; Wright, Nicole E.; Zeng, Wei Yue; Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian; Peterson, Todd C.; Haerizadeh, Farzad; Golden, Susan S.; Golden, James W.
2014-01-01
Inspired by the developments of synthetic biology and the need for improved genetic tools to exploit cyanobacteria for the production of renewable bioproducts, we developed a versatile platform for the construction of broad-host-range vector systems. This platform includes the following features: (i) an efficient assembly strategy in which modules released from 3 to 4 donor plasmids or produced by polymerase chain reaction are assembled by isothermal assembly guided by short GC-rich overlap sequences. (ii) A growing library of molecular devices categorized in three major groups: (a) replication and chromosomal integration; (b) antibiotic resistance; (c) functional modules. These modules can be assembled in different combinations to construct a variety of autonomously replicating plasmids and suicide plasmids for gene knockout and knockin. (iii) A web service, the CYANO-VECTOR assembly portal, which was built to organize the various modules, facilitate the in silico construction of plasmids, and encourage the use of this system. This work also resulted in the construction of an improved broad-host-range replicon derived from RSF1010, which replicates in several phylogenetically distinct strains including a new experimental model strain Synechocystis sp. WHSyn, and the characterization of nine antibiotic cassettes, four reporter genes, four promoters, and a ribozyme-based insulator in several diverse cyanobacterial strains. PMID:25074377
Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae
Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro
2011-01-01
Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137
Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.
Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro
2011-01-01
Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.
PemK toxin encoded by the Xylella fastidiosa IncP-1 plasmid pXF-RIV11 is a ribonuclease
USDA-ARS?s Scientific Manuscript database
Stable inheritance of the IncP-1 plasmid pXF-RIV11 in Xylella fastidiosa is conferred by the pemI/pemK plasmid addiction system. PemK serves as a toxin inhibiting bacterial growth; PemI is the corresponding antitoxin that blocks activity of PemK toxin by direct binding. Here, PemK toxin and PemI ant...
Network Analysis of Plasmidomes: The Azospirillum brasilense Sp245 Case
Fondi, Marco
2014-01-01
Azospirillum brasilense is a nitrogen-fixing bacterium living in association with plant roots. The genome of the strain Sp245, isolated in Brazil from wheat roots, consists of one chromosome and six plasmids. In this work, the A. brasilense Sp245 plasmids were analyzed in order to shed some light on the evolutionary pathways they followed over time. To this purpose, a similarity network approach was applied in order to identify the evolutionary relationships among all the A. brasilense plasmids encoded proteins; in this context a computational pipeline specifically devoted to the analysis and the visualization of the network-like evolutionary relationships among different plasmids molecules was developed. This information was supplemented with a detailed (in silico) functional characterization of both the connected (i.e., sharing homology with other sequences in the dataset) and the unconnected (i.e., not sharing homology) components of the network. Furthermore, the most likely source organism for each of the genes encoded by A. brasilense plasmids was checked, allowing the identification of possible trends of gene loss/gain in this microorganism. Data obtained provided a detailed description of the evolutionary landscape of the plasmids of A. brasilense Sp245, suggesting some of the molecular mechanisms responsible for the present-day structure of these molecules. PMID:25610702
Roberts, D P; Berman, P M; Allen, C; Stromberg, V K; Lacy, G H; Mount, M S
1986-07-01
Several genes encoding enzymes capable of degrading plant cell wall components have been cloned from Erwinia carotovora subsp. carotovora EC14. Plasmids containing cloned EC14 DNA mediate the production of endo-pectate lyases, exo-pectate lyase, endo-polygalacturonase, and cellulase(s). Escherichia coli strains containing one of these plasmids or combinations of two plasmids were tested for their ability to macerate potato tuber slices. Only one E. coli strain, containing two plasmids that encode endo-pectate lyases, exo-pectate lyase, and endo-polygalacturonase, caused limited maceration. The pectolytic proteins associated with one of these plasmids, pDR1, have been described previously (D. P. Roberts, P. M. Berman, C. Allen, V. K. Stromberg, G. H. Lacy, and M. S. Mount, Can. J. Plant Pathol. 8:17-27, 1986) and include two secreted endo-pectate lyases. The second plasmid, pDR30, contains a 2.1-kilobase EC14 DNA insert that mediates the production of an exo-pectate lyase and an endo-polygalacturonase. These enzymes are similar in physicochemical properties to those produced by EC14. Our results suggest that the concerted activities of endo-pectate lyases with endo-polygalacturonase or exo-pectate lyase or both cause maceration.
Roberts, D P; Berman, P M; Allen, C; Stromberg, V K; Lacy, G H; Mount, M S
1986-01-01
Several genes encoding enzymes capable of degrading plant cell wall components have been cloned from Erwinia carotovora subsp. carotovora EC14. Plasmids containing cloned EC14 DNA mediate the production of endo-pectate lyases, exo-pectate lyase, endo-polygalacturonase, and cellulase(s). Escherichia coli strains containing one of these plasmids or combinations of two plasmids were tested for their ability to macerate potato tuber slices. Only one E. coli strain, containing two plasmids that encode endo-pectate lyases, exo-pectate lyase, and endo-polygalacturonase, caused limited maceration. The pectolytic proteins associated with one of these plasmids, pDR1, have been described previously (D. P. Roberts, P. M. Berman, C. Allen, V. K. Stromberg, G. H. Lacy, and M. S. Mount, Can. J. Plant Pathol. 8:17-27, 1986) and include two secreted endo-pectate lyases. The second plasmid, pDR30, contains a 2.1-kilobase EC14 DNA insert that mediates the production of an exo-pectate lyase and an endo-polygalacturonase. These enzymes are similar in physicochemical properties to those produced by EC14. Our results suggest that the concerted activities of endo-pectate lyases with endo-polygalacturonase or exo-pectate lyase or both cause maceration. Images PMID:3013836
Plasmid DNA Delivery: Nanotopography Matters.
Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong
2017-12-20
Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.
Sakai, Y; Goh, T K; Tani, Y
1993-06-01
We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.
Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y
2016-01-01
Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.
Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica.
Hoffmann, Maria; Pettengill, James B; Gonzalez-Escalona, Narjol; Miller, John; Ayers, Sherry L; Zhao, Shaohua; Allard, Marc W; McDermott, Patrick F; Brown, Eric W; Monday, Steven R
2017-01-01
Determinants of multidrug resistance (MDR) are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio) RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI), and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about resistance genes in plasmids, advances in plasmid sequencing, and phylogenetic analyses, and important insights about how MDR evolution occurs across diverse serotypes from different animal sources, particularly in agricultural settings where antimicrobial drug use practices vary.
Lobato-Márquez, Damián; Molina-García, Laura; Moreno-Córdoba, Inma; García-Del Portillo, Francisco; Díaz-Orejas, Ramón
2016-01-01
Certain Salmonella enterica serovars belonging to subspecies I carry low-copy-number virulence plasmids of variable size (50-90 kb). All of these plasmids share the spv operon, which is important for systemic infection. Virulence plasmids are present at low copy numbers. Few copies reduce metabolic burden but suppose a risk of plasmid loss during bacterial division. This drawback is counterbalanced by maintenance modules that ensure plasmid stability, including partition systems and toxin-antitoxin (TA) loci. The low-copy number virulence pSLT plasmid of Salmonella enterica serovar Typhimurium encodes three auxiliary maintenance systems: one partition system ( parAB ) and two TA systems ( ccdAB ST and vapBC2 ST ). The TA module ccdAB ST has previously been shown to contribute to pSLT plasmid stability and vapBC2 ST to bacterial virulence. Here we describe a novel assay to measure plasmid stability based on the selection of plasmid-free cells following elimination of plasmid-containing cells by ParE toxin, a DNA gyrase inhibitor. Using this new maintenance assay we confirmed a crucial role of parAB in pSLT maintenance. We also showed that vapBC2 ST , in addition to contribute to bacterial virulence, is important for plasmid stability. We have previously shown that ccdAB ST encodes an inactive CcdB ST toxin. Using our new stability assay we monitored the contribution to plasmid stability of a ccdAB ST variant containing a single mutation (R99W) that restores the toxicity of CcdB ST . The "activation" of CcdB ST (R99W) did not increase pSLT stability by ccdAB ST . In contrast, ccdAB ST behaves as a canonical type II TA system in terms of transcriptional regulation. Of interest, ccdAB ST was shown to control the expression of a polycistronic operon in the pSLT plasmid. Collectively, these results show that the contribution of the CcdB ST toxin to pSLT plasmid stability may depend on its role as a co-repressor in coordination with CcdA ST antitoxin more than on its toxic activity.
Methods for Gene Transfer to the Central Nervous System
Kantor, Boris; Bailey, Rachel M.; Wimberly, Keon; Kalburgi, Sahana N.; Gray, Steven J.
2015-01-01
Gene transfer is an increasingly utilized approach for research and clinical applications involving the central nervous system (CNS). Vectors for gene transfer can be as simple as an unmodified plasmid, but more commonly involve complex modifications to viruses to make them suitable gene delivery vehicles. This chapter will explain how tools for CNS gene transfer have been derived from naturally occurring viruses. The current capabilities of plasmid, retroviral, adeno-associated virus, adenovirus, and herpes simplex virus vectors for CNS gene delivery will be described. These include both focal and global CNS gene transfer strategies, with short- or long-term gene expression. As is described in this chapter, an important aspect of any vector is the cis-acting regulatory elements incorporated into the vector genome that control when, where, and how the transgene is expressed. PMID:25311922
Orndorff, P E; Falkow, S
1984-01-01
The recombinant plasmid pSH2 confers type 1 piliation (Pil+) on a nonpiliated (Pil-) strain of Escherichia coli K-12. At least four plasmid-encoded gene products are involved in pilus biosynthesis and expression. We present evidence which indicates that one gene encodes an inhibitor of piliation. Hyperpiliated (Hyp) mutants were isolated after Tn5 insertion mutagenesis of pSH2 and introduction of the plasmid DNA into a Pil- strain of E. coli as unique small, compact colonies. Also, Hyp mutants clumped during growth in static broth and were piliated under several cultural conditions that normally suppressed piliation. Electron microscopic examination of Hyp mutants associated an observed 40-fold increase in pilin antigen with an increase in the number and length of pili per cell. All Hyp mutants examined failed to produce a 23-kilodalton protein that was encoded by a gene adjacent to the structural (pilin) gene for type 1 pili, and all Tn5 insertion mutations that produced the Hyp phenotype mapped in this region (hyp). Piliation in Hyp mutants could be reduced to near parental levels by introducing a second plasmid containing a parental hyp gene. Thus the 23-kilodalton (hyp) protein appears to act in trans to regulate the level of piliation. Images PMID:6148338
Assessing the biocompatibility of click-linked DNA in Escherichia coli
Sanzone, A. Pia; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali
2012-01-01
The biocompatibility of a triazole mimic of the DNA phosphodiester linkage in Escherichia coli has been evaluated. The requirement for selective pressure on the click-containing gene was probed via a plasmid containing click DNA backbone linkages in each strand of the gene encoding the fluorescent protein mCherry. The effect of proximity of the click linkers on their biocompatibility was also probed by placing two click DNA linkers 4-bp apart at the region encoding the fluorophore of the fluorescent protein. The resulting click-containing plasmid was found to encode mCherry in E. coli at a similar level to the canonical equivalent. The ability of the cellular machinery to read through click-linked DNA was further probed by using the above click-linked plasmid to express mCherry using an in vitro transcription/translation system, and found to also be similar to that from canonical DNA. The yield and fluorescence of recombinant mCherry expressed from the click-linked plasmid was also compared to that from the canonical equivalent, and found to be the same. The biocompatibility of click DNA ligation sites at close proximity in a non-essential gene demonstrated in E. coli suggests the possibility of using click DNA ligation for the enzyme-free assembly of chemically modified genes and genomes. PMID:22904087
Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle
2002-01-01
We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607
Myeloma Xenograft Destruction by a Nonviral Vector Delivering Oncolytic Infectious Nucleic Acid
Hadac, Elizabeth M; Kelly, Elizabeth J; Russell, Stephen J
2011-01-01
The feasibility of using a nonviral vector formulation to initiate an oncolytic viral infection has not been previously demonstrated. We therefore sought to determine whether infectious nucleic acid (INA) could be used in place of virus particles to initiate an oncolytic picornavirus infection in vivo. Infectious RNA encoding coxsackievirus A21 (CVA21) was transcribed from plasmid DNA using T7 polymerase. Within 48 hours of injecting this RNA into KAS6/1 myeloma xenografts, high titers of infectious CVA21 virions were detected in the bloodstream. Tumors regressed rapidly thereafter and mice developed signs of myositis. At euthanasia, CVA21 was recovered from regressing tumors and from skeletal muscles. Treatment outcomes were comparable following intratumoral injection of naked RNA or fully infectious CVA21 virus. Dose–response studies showed that an effective oncolytic infection could be established by intratumoral injection of 1 µg of infectious RNA. The oncolytic infection could also be initiated by intravenous injection of infectious RNA. Our study demonstrates that INA is a highly promising alternative drug formulation for oncolytic virotherapy. PMID:21505425
Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli
Jacobus, Ana Paula; Gross, Jeferson
2015-01-01
PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528
Richie, Thomas L.; Charoenvit, Yupin; Wang, Ruobing; Epstein, Judith E.; Hedstrom, Richard C.; Kumar, Sanjai; Luke, Thomas C.; Freilich, Daniel A.; Aguiar, Joao C.; Sacci, Jr., John B.; Sedegah, Martha; Nosek, Jr., Ronald A.; De La Vega, Patricia; Berzins, Mara P.; Majam, Victoria F.; Abot, Esteban N.; Ganeshan, Harini; Richie, Nancy O.; Banania, Jo Glenna; Baraceros, Maria Fe B.; Geter, Tanya G.; Mere, Robin; Bebris, Lolita; Limbach, Keith; Hickey, Bradley W.; Lanar, David E.; Ng, Jennifer; Shi, Meng; Hobart, Peter M.; Norman, Jon A.; Soisson, Lorraine A.; Hollingdale, Michael R.; Rogers, William O.; Doolan, Denise L.; Hoffman, Stephen L.
2012-01-01
When introduced in the 1990s, immunization with DNA plasmids was considered potentially revolutionary for vaccine development, particularly for vaccines intended to induce protective CD8 T cell responses against multiple antigens. We conducted, in 1997−1998, the first clinical trial in healthy humans of a DNA vaccine, a single plasmid encoding Plasmodium falciparum circumsporozoite protein (PfCSP), as an initial step toward developing a multi-antigen malaria vaccine targeting the liver stages of the parasite. As the next step, we conducted in 2000–2001 a clinical trial of a five-plasmid mixture called MuStDO5 encoding pre-erythrocytic antigens PfCSP, PfSSP2/TRAP, PfEXP1, PfLSA1 and PfLSA3. Thirty-two, malaria-naïve, adult volunteers were enrolled sequentially into four cohorts receiving a mixture of 500 μg of each plasmid plus escalating doses (0, 20, 100 or 500 μg) of a sixth plasmid encoding human granulocyte macrophage-colony stimulating factor (hGM-CSF). Three doses of each formulation were administered intramuscularly by needle-less jet injection at 0, 4 and 8 weeks, and each cohort had controlled human malaria infection administered by five mosquito bites 18 d later. The vaccine was safe and well-tolerated, inducing moderate antigen-specific, MHC-restricted T cell interferon-γ responses but no antibodies. Although no volunteers were protected, T cell responses were boosted post malaria challenge. This trial demonstrated the MuStDO5 DNA and hGM-CSF plasmids to be safe and modestly immunogenic for T cell responses. It also laid the foundation for priming with DNA plasmids and boosting with recombinant viruses, an approach known for nearly 15 y to enhance the immunogenicity and protective efficacy of DNA vaccines. PMID:23151451
Sanchez, Danilo Garcia; de Melo, Fernanda Maciel; Savazzi, Eduardo Angelino; Stehling, Eliana Guedes
2018-06-16
Bacterial resistance occurs by spontaneous mutations or horizontal gene transfer mediated by mobile genetic elements, which represents a great concern. Resistance to β-lactam antibiotics is mainly due to the production of β-lactamases, and an important mechanism of fluoroquinolone resistance is the acquisition plasmid determinants. The aim of this study was to verify the presence of β-lactamase-encoding genes and plasmid-mediated quinolone resistance genes in different water samples obtained from São Paulo state, Brazil. A high level of these resistance genes was detected, being the bla SHV , bla GES , and qnr the most prevalent. Besides that, the bla NDM gene, which codify an important and hazardous metallo-β-lactamase, was detected.
Bentley, L; Fehrsen, J; Jordaan, F; Huismans, H; du Plessis, D H
2000-04-01
VP2 is an outer capsid protein of African horsesickness virus (AHSV) and is recognized by serotype-discriminatory neutralizing antibodies. With the objective of locating its antigenic regions, a filamentous phage library was constructed that displayed peptides derived from the fragmentation of a cDNA copy of the gene encoding VP2. Peptides ranging in size from approximately 30 to 100 amino acids were fused with pIII, the attachment protein of the display vector, fUSE2. To ensure maximum diversity, the final library consisted of three sub-libraries. The first utilized enzymatically fragmented DNA encoding only the VP2 gene, the second included plasmid sequences, while the third included a PCR step designed to allow different peptide-encoding sequences to recombine before ligation into the vector. The resulting composite library was subjected to immunoaffinity selection with AHSV-specific polyclonal chicken IgY, polyclonal horse immunoglobulins and a monoclonal antibody (MAb) known to neutralize AHSV. Antigenic peptides were located by sequencing the DNA of phages bound by the antibodies. Most antigenic determinants capable of being mapped by this method were located in the N-terminal half of VP2. Important binding areas were mapped with high resolution by identifying the minimum overlapping areas of the selected peptides. The MAb was also used to screen a random 17-mer epitope library. Sequences that may be part of a discontinuous neutralization epitope were identified. The amino acid sequences of the antigenic regions on VP2 of serotype 3 were compared with corresponding regions on three other serotypes, revealing regions with the potential to discriminate AHSV serotypes serologically.
Production and purification of non replicative canine adenovirus type 2 derived vectors.
Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard
2013-12-03
Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.
Ho, Wing Sze; Yap, Kien-Pong; Yeo, Chew Chieng; Rajasekaram, Ganeswrie; Thong, Kwai Lin
2015-01-01
Extraintestinal pathogenic Escherichia coli (ExPEC) that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA, and FIB) with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as bla TEM-1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR) to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD) which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM)-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA)-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok) and a plasmid partitioning system, ParAB, and PsiAB, which are important for plasmid maintenance were also found. Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of clinical importance. Such phenomenon is bothersome when the plasmids are transmissible, facilitating the spread of virulence and resistance plasmids among pathogenic bacteria. Notably, certain TA systems are more commonly found in particular ExPEC plasmid types, indicating the possible relationships between certain TA systems and ExPEC pathogenesis.
Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.
Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E
2003-11-01
We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.
Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi
2016-07-01
Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Venturini, Carola; Hassan, Karl A; Roy Chowdhury, Piklu; Paulsen, Ian T; Walker, Mark J; Djordjevic, Steven P
2013-01-01
Enterohemorrhagic Escherichia coli (EHEC) and atypical enteropathogenic E. coli (aEPEC) are important zoonotic pathogens that increasingly are becoming resistant to multiple antibiotics. Here we describe two plasmids, pO26-CRL125 (125 kb) from a human O26:H- EHEC, and pO111-CRL115 (115kb) from a bovine O111 aEPEC, that impart resistance to ampicillin, kanamycin, neomycin, streptomycin, sulfathiazole, trimethoprim and tetracycline and both contain atypical class 1 integrons with an identical IS26-mediated deletion in their 3´-conserved segment. Complete sequence analysis showed that pO26-CRL125 and pO111-CRL115 are essentially identical except for a 9.7 kb fragment, present in the backbone of pO26-CRL125 but absent in pO111-CRL115, and several indels. The 9.7 kb fragment encodes IncI-associated genes involved in plasmid stability during conjugation, a putative transposase gene and three imperfect repeats. Contiguous sequence identical to regions within these pO26-CRL125 imperfect repeats was identified in pO111-CRL115 precisely where the 9.7 kb fragment is missing, suggesting it may be mobile. Sequences shared between the plasmids include a complete IncZ replicon, a unique toxin/antitoxin system, IncI stability and maintenance genes, a novel putative serine protease autotransporter, and an IncI1 transfer system including a unique shufflon. Both plasmids carry a derivate Tn21 transposon with an atypical class 1 integron comprising a dfrA5 gene cassette encoding resistance to trimethoprim, and 24 bp of the 3´-conserved segment followed by Tn6026, which encodes resistance to ampicillin, kanymycin, neomycin, streptomycin and sulfathiazole. The Tn21-derivative transposon is linked to a truncated Tn1721, encoding resistance to tetracycline, via a region containing the IncP-1α oriV. Absence of the 5 bp direct repeats flanking Tn3-family transposons, indicates that homologous recombination events played a key role in the formation of this complex antibiotic resistance gene locus. Comparative sequence analysis of these closely related plasmids reveals aspects of plasmid evolution in pathogenic E. coli from different hosts.
Pang, Xiao-Yang; Cui, Wen-Ming; Liu, Lu; Zhang, Shu-Wen; Lv, Jia-Ping
2014-01-01
Autolysis of lactic acid bacteria (LAB) plays a vital role in dairy processing. During cheese making, autolysis of LAB affects cheese flavor development through release of intracellular enzymes and restricts the proliferation of cells in yogurt fermentation and probiotics production. In order to explore the mechanism of autolysis, the gene for the autolytic enzymes of L. bulgaricus, N-acetylmuramidase (mur), was cloned and sequenced (GenBank accession number: KF157911). Mur gene overexpression and gene knockout vectors were constructed based on pMG76e and pUC19 vectors. Recombinant plasmids were transformed into L. bulgaricus ljj-6 by electroporation, then three engineered strains with pMG76e-mur vector and fifteen engineered strains with pUC19-mur::EryBII were screened. The autolysis of the mur knockout strain was significantly lower and autolysis of the mur overexpressed strain was significantly higher compared with that of the wild type strain ljj-6. This result suggested that the mur gene played an important role in autolysis of L. bulgaricus. On the other hand, autolytic activity in a low degree was still observed in the mur knockout strain, which implied that other enzymes but autolysin encoded by mur were also involved in autolysis of L. bulgaricus.
Engineering nanoparticle-coated bacteria as oral DNA vaccines for cancer immunotherapy.
Hu, Qinglian; Wu, Min; Fang, Chun; Cheng, Changyong; Zhao, Mengmeng; Fang, Weihuan; Chu, Paul K; Ping, Yuan; Tang, Guping
2015-04-08
Live attenuated bacteria are of increasing importance in biotechnology and medicine in the emerging field of cancer immunotherapy. Oral DNA vaccination mediated by live attenuated bacteria often suffers from low infection efficiency due to various biological barriers during the infection process. To this end, we herein report, for the first time, a new strategy to engineer cationic nanoparticle-coated bacterial vectors that can efficiently deliver oral DNA vaccine for efficacious cancer immunotherapy. By coating live attenuated bacteria with synthetic nanoparticles self-assembled from cationic polymers and plasmid DNA, the protective nanoparticle coating layer is able to facilitate bacteria to effectively escape phagosomes, significantly enhance the acid tolerance of bacteria in stomach and intestines, and greatly promote dissemination of bacteria into blood circulation after oral administration. Most importantly, oral delivery of DNA vaccines encoding autologous vascular endothelial growth factor receptor 2 (VEGFR2) by this hybrid vector showed remarkable T cell activation and cytokine production. Successful inhibition of tumor growth was also achieved by efficient oral delivery of VEGFR2 with nanoparticle-coated bacterial vectors due to angiogenesis suppression in the tumor vasculature and tumor necrosis. This proof-of-concept work demonstrates that coating live bacterial cells with synthetic nanoparticles represents a promising strategy to engineer efficient and versatile DNA vaccines for the era of immunotherapy.
Antibiotic resistance due to an unusual ColE1-type replicon plasmid in Aeromonas salmonicida.
Vincent, Antony T; Emond-Rheault, Jean-Guillaume; Barbeau, Xavier; Attéré, Sabrina A; Frenette, Michel; Lagüe, Patrick; Charette, Steve J
2016-06-01
Aeromonas salmonicida subsp. salmonicida is a fish pathogen known to have a rich plasmidome. In the present study, we discovered an isolate of this bacterium bearing an additional unidentified small plasmid. After having sequenced the DNA of that isolate by next-generation sequencing, it appeared that the new small plasmid is a ColE1-type replicon plasmid, named here pAsa7. This plasmid bears a functional chloramphenicol-acetyltransferase-encoding gene (cat-pAsa7) previously unknown in A. salmonicida and responsible for resistance to chloramphenicol. A comparison of pAsa7 with pAsa2, the only known ColE1-type replicon plasmid usually found in A. salmonicida subsp. salmonicida, revealed that even if both plasmids share a high structural similarity, it is still unclear if pAsa7 is a derivative of pAsa2 since they showed several mutations at the nucleotide level. Transcriptomic analysis revealed that the cat-pAsa4 gene, another chloramphenicol-acetyltransferase-encoding gene, found on the large plasmid pAsa4, was significantly more transcribed than cat-pAsa7. This was correlated with a higher chloramphenicol resistance for isolates bearing pAsa4 compared with the one having pAsa7. Finally, a phylogenetic analysis showed that both CAT-pAsa4 and CAT-pAsa7 proteins were in different clusters. The clustering was supported by the identity of residues involved in the catalytic site. In addition, to give a better understanding of the large drug-resistance panel of A. salmonicida, this study reinforces the hypothesis that A. salmonicida subsp. salmonicida is a considerable reservoir for mobile genetic elements such as plasmids.
Bossé, Janine T; Li, Yanwen; Walker, Stephanie; Atherton, Tom; Fernandez Crespo, Roberto; Williamson, Susanna M; Rogers, Jon; Chaudhuri, Roy R; Weinert, Lucy A; Oshota, Olusegun; Holden, Matt T G; Maskell, Duncan J; Tucker, Alexander W; Wren, Brendan W; Rycroft, Andrew N; Langford, Paul R
2015-08-01
The objective of this study was to determine the distribution and genetic basis of trimethoprim resistance in Actinobacillus pleuropneumoniae isolates from pigs in England. Clinical isolates collected between 1998 and 2011 were tested for resistance to trimethoprim and sulphonamide. The genetic basis of trimethoprim resistance was determined by shotgun WGS analysis and the subsequent isolation and sequencing of plasmids. A total of 16 (out of 106) A. pleuropneumoniae isolates were resistant to both trimethoprim (MIC >32 mg/L) and sulfisoxazole (MIC ≥256 mg/L), and a further 32 were resistant only to sulfisoxazole (MIC ≥256 mg/L). Genome sequence data for the trimethoprim-resistant isolates revealed the presence of the dfrA14 dihydrofolate reductase gene. The distribution of plasmid sequences in multiple contigs suggested the presence of two distinct dfrA14-containing plasmids in different isolates, which was confirmed by plasmid isolation and sequencing. Both plasmids encoded mobilization genes, the sulphonamide resistance gene sul2, as well as dfrA14 inserted into strA, a streptomycin-resistance-associated gene, although the gene order differed between the two plasmids. One of the plasmids further encoded the strB streptomycin-resistance-associated gene. This is the first description of mobilizable plasmids conferring trimethoprim resistance in A. pleuropneumoniae and, to our knowledge, the first report of dfrA14 in any member of the Pasteurellaceae. The identification of dfrA14 conferring trimethoprim resistance in A. pleuropneumoniae isolates will facilitate PCR screens for resistance to this important antimicrobial. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seetharam, S.; Waters, H.L.; Seidman, M.M.
The hereditary dysplastic nevus syndrome (DNS) is an autosomal dominant disorder in which affected individuals have increased numbers of dysplastic (premalignant) nevi and a greater than 100-fold increased risk of developing cutaneous melanoma. Epstein-Barr virus-transformed lymphoblastoid cell lines from patients with hereditary DNS have been shown to be hypermutable to UV radiation. To examine the mechanism involved in this UV hypermutability, we used a shuttle vector plasmid, pZ189, which carries a 160-base pair marker gene, supF, and can replicate in human cells. pZ189 was treated with UV radiation and transfected into DNS6BE, a lymphoblastoid cell line from a patient withmore » hereditary DNS. Plasmid survival after UV was similar with the DNS6BE line and with a lymphoblastoid cell line from a normal donor. Plasmid mutation frequency was greater with the DNS line in accord with the DNS cellular hypermutability. Base sequence analysis was performed on 69 mutated plasmids recovered from the DNS line. There were significantly more plasmids with single base substitution mutations (P less than 0.01) in comparison to UV-treated plasmids passed through normal fibroblasts. pZ189 hypermutability and an increased frequency of single base substitutions was previously found with a cell line from a melanoma-prone xeroderma pigmentosum patient. These differences may be related to the increased melanoma susceptibility in both DNS and xeroderma pigmentosum.« less
Kobayashi, Miho; Nomura, Masaru; Kimoto, Hiromi
2007-11-01
This study was designed selectively to eliminate a theta-plasmid from Lactococcus lactis strains by transforming synthetic competitors. A shuttle vector for Escherichia coli and L. lactis, pDB1, was constructed by ligating a partial replicon of pDR1-1B, which is a 7.3 kb theta-plasmid in L. lactis DRC1, with an erythromycin resistance gene into pBluescript II KS(+). This versatile vector was used to construct competitors to common lactococcal theta-plasmids. pDB1 contains the 5' half of the replication origin and the 3' region of repB of pDR1-1B, but lacks the 1.1-kb region normally found between these two segments. A set of primers, Pv3 and Pv4, was designed to amplify the 1.1-kb middle parts of the general theta-replicons of lactococcal plasmids. When the PCR products were cloned into the Nru I and Xho I sites of pDB1, synthetic replicons were constructed and replication activity was restored. A number of theta-plasmids in L. lactis ssp. lactis and cremoris were eliminated selectively by transforming the synthetic competitors. These competitors were easily eliminated by subculture for a short time in the absence of selection. The resulting variants contained no exogenous DNA and are suitable for food products, since part of the phenotype was altered without altering other plasmids indispensable for fermentation.
Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying
2011-03-01
To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.
Toda, Hiroshi; Itoh, Nobuya
2017-01-01
The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli–Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 (rhsmo) and alcohol dehydrogenase gene from Leifsonia sp. S749 (lsadh), in K. rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase (gapdh) promotor. The RhSMO–LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent–water biphasic reaction system to efficiently convert styrene into (S)-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells. PMID:29230202
Fallico, V; Ross, R P; Fitzgerald, G F; McAuliffe, O
2012-07-01
A collection of 17 natural lactococcal isolates from raw milk cheeses were studied in terms of their plasmid distribution, content, and diversity. All strains in the collection harbored an abundance of plasmids, including Lactococcus lactis ssp. cremoris DPC3758, whose 8-plasmid complement was selected for sequencing. The complete sequences of pAF22 (22,388 kb), pAF14 (14,419 kb), pAF12 (12,067 kb), pAF07 (7,435 kb), and pAF04 (3,801 kb) were obtained, whereas gene functions of technological interest were mapped to pAF65 (65 kb) and pAF45 (45 kb) by PCR. The plasmids of L. lactis DPC3758 were found to encode many genes with the potential to improve the technological properties of dairy starters. These included 3 anti-phage restriction/modification (R/M) systems (1 of type I and 2 of type II) and genes for immunity/resistance to nisin, lacticin 481, cadmium, and copper. Regions encoding conjugative/mobilization functions were present in 6 of the 8 plasmids, including those containing the R/M systems, thus enabling the food-grade transfer of these mechanisms to industrial strains. Using cadmium selection, the sequential stacking of the R/M plasmids into a plasmid-free host provided the recipient with increased protection against 936- and c2-type phages. The association of food-grade selectable markers and mobilization functions on L. lactis DPC3758 plasmids will facilitate their exploitation to obtain industrial strains with enhanced phage protection and robustness. These natural plasmids also provide another example of the major role of plasmids in contributing to host fitness and preservation within its ecological niche. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying
2008-02-01
To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.
Pettis, Gregg S.; Prakash, Shubha
1999-01-01
A database search revealed extensive sequence similarity between Streptomyces lividans plasmid pIJ101 and Streptomyces plasmid pSB24.2, which is a deletion derivative of Streptomyces cyanogenus plasmid pSB24.1. The high degree of relatedness between the two plasmids allowed the construction of a genetic map of pSB24.2, consisting of putative transfer and replication loci. Two pSB24.2 loci, namely, the cis-acting locus for transfer (clt) and the transfer-associated korB gene, were shown to be capable of complementing the pIJ101 clt and korB functions, respectively, a result that is consistent with the notion that pIJ101 and the parental plasmid pSB24.1 encode highly similar, if not identical, conjugation systems. PMID:10419972
Novel Minicircle Vector for Gene Therapy in Murine Myocardial Infarction
Huang, Mei; Chen, ZhiYing; Hu, Shijun; Jia, Fangjun; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Kay, Mark A.; Wu, Joseph C.
2011-01-01
Background Conventional plasmids for gene therapy produce low-level and short-term gene expression. In this study, we develop a novel non-viral vector which robustly and persistently expresses the hypoxia inducible factor-1 alpha (HIF-1α) therapeutic gene in the heart, leading to functional benefits following myocardial infarction (MI). Methods and Results We first created minicircles carrying double fusion (MC-DF) reporter gene consisting of firefly luciferase and enhanced green fluorescent protein (Fluc-eGFP) for noninvasive measurement of transfection efficiency. Mouse C2C12 myoblasts and normal FVB mice were used for in vitro and in vivo confirmation, respectively. Bioluminescence imaging (BLI) showed stable minicircle gene expression in the heart for >12 weeks and the activity level was 5.6±1.2 fold stronger than regular plasmid at day 4 (P<0.01). Next, we created minicircles carrying hypoxia inducible factor-1 alpha (MC-HIF-1α) therapeutic gene for treatment of MI. Adult FVB mice underwent LAD ligation and were injected intramyocardially with (1) MC-HIF-1α, (2) regular plasmid carrying HIF-1α (PL-HIF-1α) as positive control, and (3) PBS as negative control (n=10/group). Echocardiographic study showed a significantly greater improvement of left ventricular ejection fraction (LVEF) in the minicircle group (51.3%±3.6%) compared to regular plasmid group (42.3%±4.1%) and saline group (30.5%±2.8%) at week 4 (P<0.05 for both). Histology demonstrated increased neoangiogenesis in both treatment groups. Finally, Western blot showed minicircles express >50% higher HIF-1α level than regular plasmid. Conclusion Taken together, this is the first study to demonstrate that minicircles can significantly improve transfection efficiency, duration of transgene expression, and cardiac contractility. Given the serious drawbacks associated with most viral vectors, we believe this novel non-viral vector can be of great value for cardiac gene therapy protocols. PMID:19752373
Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min
2016-01-01
This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.
Subunit association of gamma-glutamyltranspeptidase of Escherichia coli K-12.
Hashimoto, W; Suzuki, H; Nohara, S; Tachi, H; Yamamoto, K; Kumagai, H
1995-12-01
gamma-Glutamyltranspeptidase [EC 2.3.2.2] of Escherichia coli K-12 consists of one large subunit and one small subunit, which can be separated from each other by high-performance liquid chromatography. Using ion spray mass spectrometry, the masses of the large and the small subunit were determined to be 39,207 and 20,015, respectively. The large subunit exhibited no gamma-glutamyltranspeptidase activity and the small subunit had little enzymatic activity, but a mixture of the two subunits showed partial recovery of the enzymatic activity. The results of native-polyacrylamide gel electrophoresis suggested that they could partially recombine, and that the recombined dimer exhibited enzymatic activity. The gene of gamma-glutamyltranspeptidase encoded a signal peptide, and the large and small subunits in a single open reading frame in that order. Two kinds of plasmid were constructed encoding the signal peptide and either the large or the small subunit. A gamma-glutamyltranspeptidase-less mutant of E. coli K-12 was transformed with each plasmid or with both of them. The strain harboring the plasmid encoding each subunit produced a small amount of the corresponding subunit protein in the periplasmic space but exhibited no enzymatic activity. The strain transformed with both plasmids together exhibited the enzymatic activity, but its specific activity was approximately 3% of that of a strain harboring a plasmid encoding the intact structural gene. These results indicate that a portion of the separated large and small subunits can be reconstituted in vitro and exhibit the enzymatic activity, and that the expressed large and small subunits independently are able to associate in vivo and be folded into an active structure, though the specific activity of the associated subunits was much lower than that of native enzyme. This suggests that the synthesis of gamma-glutamyltranspeptidase in a single precursor polypeptide and subsequent processing are more effective to construct the intact structure of gamma-glutamyltranspeptidase than the association of the separated large and small subunits.
USDA-ARS?s Scientific Manuscript database
A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...
Expression of Duplicate msa Genes in the Salmonid Pathogen Renibacterium salmoninarum
Rhodes, Linda D.; Coady, Alison M.; Strom, Mark S.
2002-01-01
Renibacterium salmoninarum is a gram-positive bacterium responsible for bacterial kidney disease of salmon and trout. R. salmoninarum has two identical copies of the gene encoding major soluble antigen (MSA), an immunodominant, extracellular protein. To determine whether one or both copies of msa are expressed, reporter plasmids encoding a fusion of MSA and green fluorescent protein controlled by 0.6 kb of promoter region from msa1 or msa2 were constructed and introduced into R. salmoninarum. Single copies of the reporter plasmids integrated into the chromosome by homologous recombination. Expression of mRNA and protein from the integrated plasmids was detected, and transformed cells were fluorescent, demonstrating that both msa1 and msa2 are expressed under in vitro conditions. This is the first report of successful transformation and homologous recombination in R. salmoninarum. PMID:12406741
2006-05-10
nifH encoding plasmids of diazotrophic bacteria isolated from roots of a salt marsh grass. Meeting Abstract, 105th General Meeting of the American...When the method was applied to 100 endogenous plasmids isolated from cultivated marine diazotrophs from salt marsh grass rhizoplane niches remarkably...Beeson, K.E., D.L. Erdner, C.E. Bagwell, C.R. Lovell, and P.A. Sobecky. 2002. Differentiation of plasmids in marine diazotroph assemblages
Cell-Penetrating Peptide-Mediated Delivery of Cas9 Protein and Guide RNA for Genome Editing.
Suresh, Bharathi; Ramakrishna, Suresh; Kim, Hyongbum
2017-01-01
The clustered, regularly interspaced, short palindromic repeat (CRISPR)-associated (Cas) system represents an efficient tool for genome editing. It consists of two components: the Cas9 protein and a guide RNA. To date, delivery of these two components has been achieved using either plasmid or viral vectors or direct delivery of protein and RNA. Plasmid- and virus-free direct delivery of Cas9 protein and guide RNA has several advantages over the conventional plasmid-mediated approach. Direct delivery results in shorter exposure time at the cellular level, which in turn leads to lower toxicity and fewer off-target mutations with reduced host immune responses, whereas plasmid- or viral vector-mediated delivery can result in uncontrolled integration of the vector sequence into the host genome and unwanted immune responses. Cell-penetrating peptide (CPP), a peptide that has an intrinsic ability to translocate across cell membranes, has been adopted as a means of achieving efficient Cas9 protein and guide RNA delivery. We developed a method for treating human cell lines with CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs that leads to endogenous gene disruption. Here we describe a protocol for preparing an efficient CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNAs, as well as treatment methods to achieve safe genome editing in human cell lines.
Tsukagoshi, Y; Nikawa, J; Hosaka, K; Yamashita, S
1991-01-01
The coding region of the CCT gene from the yeast Saccharomyces cerevisiae was cloned into the pUC18 expression vector. The plasmid directed the synthesis of an active cholinephosphate cytidylyltransferase in Escherichia coli, confirming that CCT is the structural gene for this enzyme. The enzyme produced in E. coli efficiently utilized cholinephosphate and N,N-dimethylethanolaminephosphate, but N-methylethanolamine-phosphate and ethanolaminephosphate were poor substrates. Consistently, disruption of the CCT locus in the wild-type yeast cells resulted in a drastic decrease in activities with respect to the former two substrates. When activity was expressed in E. coli, over 90% was recovered in the cytosol, whereas most of the activity of yeast cells was associated with membranes, suggesting that yeast cells possess a mechanism that promotes membrane association of cytidylyltransferase. Images PMID:1848222
Involvement of the pagR gene of pXO2 in anthrax pathogenesis
Liang, Xudong; Zhang, Enmin; Zhang, Huijuan; Wei, Jianchun; Li, Wei; Zhu, Jin; Wang, Bingxiang; Dong, Shulin
2016-01-01
Anthrax is a disease caused by Bacillus anthracis. Specifically, the anthrax toxins and capsules encoded by the pXO1 and pXO2 plasmids, respectively, are the major virulence factors. We previously reported that the pXO1 plasmid was retained in the attenuated strain of B. anthracis vaccine strains even after subculturing at high temperatures. In the present study, we reinvestigate the attenuation mechanism of Pasteur II. Sequencing of pXO1 and pXO2 from Pasteur II strain revealed mutations in these plasmids as compared to the reference sequences. Two deletions on these plasmids, one each on pXO1 and pXO2, were confirmed to be unique to the Pasteur II strain as compared to the wild-type strains. Gene replacement with homologous recombination revealed that the mutation in the promoter region of the pagR gene on pXO2, but not the mutation on pXO1, contributes to lethal levels of toxin production. This result was further confirmed by RT-PCR, western blot, and animal toxicity assays. Taken together, our results signify that the attenuation of the Pasteur II vaccine strain is caused by a mutation in the pagR gene on its pXO2 plasmid. Moreover, these data suggest that pXO2 plasmid encoded proteins are involved in the virulence of B. anthracis. PMID:27363681
Beach, D; Piper, M; Nurse, P
1982-01-01
A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.
Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization
NASA Astrophysics Data System (ADS)
Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.
1995-10-01
Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.
Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi
2017-07-21
Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Domingo Meza-Aguilar, J.; Laboratorio de Patogenicidad Bacteriana, Unidad de Hemato Oncología e Investigación, Hospital Infantil de México Federico Gómez 06720, D.F.; Fromme, Petra
Highlights: • X-ray crystal structure of the passenger domain of Plasmid encoded toxin at 2.3 Å. • Structural differences between Pet passenger domain and EspP protein are described. • High flexibility of the C-terminal beta helix is structurally assigned. - Abstract: Autotransporters (ATs) represent a superfamily of proteins produced by a variety of pathogenic bacteria, which include the pathogenic groups of Escherichia coli (E. coli) associated with gastrointestinal and urinary tract infections. We present the first X-ray structure of the passenger domain from the Plasmid-encoded toxin (Pet) a 100 kDa protein at 2.3 Å resolution which is a cause ofmore » acute diarrhea in both developing and industrialized countries. Pet is a cytoskeleton-altering toxin that induces loss of actin stress fibers. While Pet (pdb code: 4OM9) shows only a sequence identity of 50% compared to the closest related protein sequence, extracellular serine protease plasmid (EspP) the structural features of both proteins are conserved. A closer structural look reveals that Pet contains a β-pleaded sheet at the sequence region of residues 181–190, the corresponding structural domain in EspP consists of a coiled loop. Secondary, the Pet passenger domain features a more pronounced beta sheet between residues 135 and 143 compared to the structure of EspP.« less
Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun
2016-01-18
In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.
Clément, Nathalie; Velu, Thierry; Brandenburger, Annick
2002-09-01
The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.
Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J
1992-01-01
Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052
Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B
1999-05-01
The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, L.E.; Detter, C,; Barrie, K.
2006-06-01
Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less
Botts, Ryan T.; Apffel, Brooke A.; Walters, C. J.; Davidson, Kelly E.; Echols, Ryan S.; Geiger, Michael R.; Guzman, Victoria L.; Haase, Victoria S.; Montana, Michal A.; La Chat, Chip A.; Mielke, Jenna A.; Mullen, Kelly L.; Virtue, Cierra C.; Brown, Celeste J.; Top, Eva M.; Cummings, David E.
2017-01-01
Self-transmissible and mobilizable plasmids contribute to the emergence and spread of multidrug-resistant bacteria by enabling the horizontal transfer of acquired antibiotic resistance. The objective of this study was to capture and characterize self-transmissible and mobilizable resistance plasmids from a coastal wetland impacted by urban stormwater runoff and human wastewater during the rainy season. Four plasmids were captured, two self-transmissible and two mobilizable, using both mating and enrichment approaches. Plasmid genomes, sequenced with either Illumina or PacBio platforms, revealed representatives of incompatibility groups IncP-6, IncR, IncN3, and IncF. The plasmids ranged in size from 36 to 144 kb and encoded known resistance genes for most of the major classes of antibiotics used to treat Gram-negative infections (tetracyclines, sulfonamides, β-lactams, fluoroquinolones, aminoglycosides, and amphenicols). The mobilizable IncP-6 plasmid pLNU-11 was discovered in a strain of Citrobacter freundii enriched from the wetland sediments with tetracycline and nalidixic acid, and encodes a novel AmpC-like β-lactamase (blaWDC-1), which shares less than 62% amino acid sequence identity with the PDC class of β-lactamases found in Pseudomonas aeruginosa. Although the IncR plasmid pTRE-1611 was captured by mating wetland bacteria with P. putida KT2440 as recipient, it was found to be mobilizable rather than self-transmissible. Two self-transmissible multidrug-resistance plasmids were also captured: the small (48 kb) IncN3 plasmid pTRE-131 was captured by mating wetland bacteria with Escherichia coli HY842 where it is seemed to be maintained at nearly 240 copies per cell, while the large (144 kb) IncF plasmid pTRE-2011, which was isolated from a cefotaxime-resistant environmental strain of E. coli ST744, exists at just a single copy per cell. Furthermore, pTRE-2011 bears the globally epidemic blaCTX-M-55 extended-spectrum β-lactamase downstream of ISEcp1. Our results indicate that urban coastal wetlands are reservoirs of diverse self-transmissible and mobilizable plasmids of relevance to human health. PMID:29067005
Ruwona, Tinashe B; Xu, Haiyue; Li, Junwei; Diaz-Arévalo, Diana; Kumar, Amit; Zeng, Mingtao; Cui, Zhengrong
2016-05-03
Botulinum neurotoxin (BoNT) is a lethal neurotoxin, for which there is currently not an approved vaccine. Recent efforts in developing vaccine candidates against botulism have been directed at the heavy chain fragment of BoNT, because antibodies against this region have been shown to prevent BoNT from binding to its receptor and thus to nerve cell surface, offering protection against BoNT intoxication. In the present study, it was shown that immunization with plasmid DNA that encodes the 50 KDa C-terminal fragment of the heavy chain of BoNT serotype C (i.e., BoNT/C-Hc50) and is carried by cationic poly (lactic-co-glycolic) acid (PLGA) nanoparticles induces stronger BoNT/C-specific antibody responses, as compared to immunization with the plasmid alone. Importantly, the antibodies have BoNT/C-neutralizing activity, protecting the immunized mice from a lethal dose of BoNT/C challenge. A plasmid DNA vaccine encoding the Hc50 fragments of BoNT serotypes that cause human botulism may represent a viable vaccine candidate for protecting against botulinum neurotoxin intoxication.
Takamitsu, Ito; Fukui, Yasuo; Ono, Noriaki; Ikeda, Fumiaki; Kanayama, Akiko; Kobayashi, Intetsu
2013-03-01
Metallo-beta-lactamase (MBL) producing Serratia marcescens isolate was recovered from a study patient in September, 2007 in whom MBL non-producing S. marcescens had been isolated 2 months previously. Two S. marcescens isolates recovered from the study patient showed the same pulsed-field gel electrophoresis (PFGE) pattern. Seven S. marcescens isolates were recovered from other patients in our hospital during August, 2007 and November, 2007. Five of the seven isolates produced MBL. All of the MBL-producing isolates showed the same PFGE pattern and harbored plasmids of the same size and bla(IMP) genes. The bla(IMP) genes were easily transferred to Escherichia coli DH5alpha by transformation of a plasmid purified from the MBL-producing isolate. Those transformation experiments suggested that bla(IMP) genes were encoded by the plasmid. From these observations, it was speculated that the MBL non-producing S. marcescens isolate recovered from the study patient had acquired the plasmid which encoded bla(IMP) genes and a monoclone of MBL-producing S. marcescens spread horizontally in our hospital.
Williams, Laura E; Wireman, Joy; Hilliard, Valda C; Summers, Anne O
2013-01-01
Plasmids are important in evolution and adaptation of host bacteria, yet we lack a comprehensive picture of their own natural variation. We used replicon typing and RFLP analysis to assess diversity and distribution of plasmids in the ECOR, SARA, SARB and SARC reference collections of Escherichia coli and Salmonella. Plasmids, especially large (≥30 kb) plasmids, are abundant in these collections. Host species and genotype clearly impact plasmid prevalence; plasmids are more abundant in ECOR than SAR, but, within ECOR, subgroup B2 strains have the fewest large plasmids. The majority of large plasmids have unique RFLP patterns, suggesting high variation, even within dominant replicon families IncF and IncI1. We found only four conserved plasmid types within ECOR, none of which are widely distributed. Within SAR, conserved plasmid types are primarily serovar-specific, including a pSLT-like plasmid in 13 Typhimurium strains. Conservation of pSLT contrasts with variability of other plasmids, suggesting evolution of serovar-specific virulence plasmids is distinct from that of most enterobacterial plasmids. We sequenced a conserved serovar Heidelberg plasmid but did not detect virulence or antibiotic resistance genes. Our data illustrate the high degree of natural variation in large plasmids of E. coli and Salmonella, even among plasmids sharing backbone genes. Copyright © 2012 Elsevier Inc. All rights reserved.
Hamazaki, Hideaki; Hamazaki, Michiko Horikawa
2016-01-15
Protein-glucosylgalactosylhydroxylysine glucosidase (PGGHG; EC3.2.1.107) cleaves glucose from disaccharide unit (Glc-α1,2-Gal) linked to hydroxylysine residues of collagen. In the present paper we first show that PGGHG is the product of ATHL1 gene as follows. (1) PGGHG was purified from chick embryos and digested with trypsin. LC-MS/MS analysis suggested the tryptic-peptides were from the ATHL1 gene product. (2) Chick embryo ATHL1 cDNA was cloned to a cloning and expression vector and two plasmid clones with different ATHL1 CDS insert were obtained. (3) Each plasmid DNA was transformed into Escherichia coli cells for expression and two isoforms of chicken PGGHG were obtained. (4) Both isoforms effectively released glucose from type IV collagen. Next, we searched for carboxyl residues crucial for catalytic activity as follows; human ATHL1 cDNA was cloned into a cloning and expression vector and 18 mutants were obtained by site-directed mutagenesis for 15 carboxyl residues conserved in ATHL1 of jawed vertebrates. The expression analysis indicated that substitutions of Asp301, Glu430 and Glu574 with sterically conservative (D301N, E430Q, E574Q) or functionally conservative (D301E, E430D, E574D) residues led to the complete elimination of enzyme activity. These findings lead us to the conclusion that PGGHG is encoded by ATHL1 and three carboxyl residues (corresponding to Asp301, Glu430 and Glu574 of human PGGHG) might be involved in the catalytic site of PGGHG. Copyright © 2015 Elsevier Inc. All rights reserved.
Hattori, Kayoko; Nishikawa, Makiya; Watcharanurak, Kanitta; Ikoma, Akihiko; Kabashima, Kenji; Toyota, Hiroyasu; Takahashi, Yuki; Takahashi, Rei; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-03-01
The short in vivo half-life of IFN-gamma can prevent the cytokine from inducing immunological changes that are favorable for the treatment of Th2-dominant diseases, such as atopic dermatitis. To examine whether a sustained supply of IFN-gamma is effective in regulating the balance of Th lymphocyte subpopulations, plasmid vector encoding mouse IFN-gamma, pCpG-Mugamma, or pCMV-Mugamma was injected into the tail vein of NC/Nga mice, a model for human atopic dermatitis. A single hydrodynamic injection of a CpG motif reduced pCpG-Mugamma at a dose of 0.14 microg/mouse resulted in a sustained concentration of IFN-gamma in the serum, and the concentration was maintained at >300 pg/ml over 80 d. The pCpG-Mugamma-mediated IFN-gamma gene transfer was associated with an increase in the serum concentration of IL-12, reduced production of IgE, and inhibition of mRNA expression of IL-4, -5, -10, -13, and -17 and thymus and activation-regulated chemokine in the spleen. These immunological changes were not clearly observed in mice receiving two injections of 20 microg pCMV-Mugamma, a CpG-replete plasmid DNA, because of the transient nature of the expression from the vector. The mice receiving pCpG-Mugamma showed a significant reduction in the severity of skin lesions and in the intensity of their scratching behavior. Furthermore, high transepidermal water loss, epidermal thickening, and infiltration of lymphocytes and eosinophils, all of which were obvious in the untreated mice, were significantly inhibited. These results indicate that an extraordinary sustained IFN-gamma expression induces favorable immunological changes, leading to a Th1-dominant state in the atopic dermatitis model.
Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu
2005-01-01
We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.
Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan
2014-09-30
A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.
Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan
2016-04-19
A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bredberg, A.; Kraemer, K.H.; Seidman, M.M.
1986-11-01
A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less
Kukor, J J; Olsen, R H
1991-01-01
Plasmid pRO1957 contains a 26.5-kb BamHI restriction endonuclease-cleaved DNA fragment cloned from the chromosome of Pseudomonas pickettii PKO1 that allows P. aeruginosa PAO1c to grow on toluene, benzene, phenol, or m-cresol as the sole carbon source. The genes encoding enzymes for meta cleavage of catechol or 3-methylcatechol, derived from catabolism of these substrates, were subcloned from pRO1957 and were shown to be organized into a single operon with the promoter proximal to tbuE. Deletion and analysis of subclones demonstrated that the order of genes in the meta cleavage operon was tbuEFGKIHJ, which encoded catechol 2,3-dioxygenase, 2-hydroxymuconate semialdehyde hydrolase, 2-hydroxymuconate semialdehyde dehydrogenase, 4-hydroxy-2-oxovalerate aldolase, 4-oxalocrotonate decarboxylase, 4-oxalocrotonate isomerase, and 2-hydroxypent-2,4-dienoate hydratase, respectively. The regulatory gene for the tbuEFGKIHJ operon, designated tbuS, was subcloned into vector plasmid pRO2317 from pRO1957 as a 1.3-kb PstI fragment, designated pRO2345. When tbuS was not present, meta pathway enzyme expression was partially derepressed, but these activity levels could not be fully induced. However, when tbuS was present in trans with tbuEFGKIHJ, meta pathway enzymes were repressed in the absence of an effector and were fully induced when an effector was present. This behavior suggests that the gene product of tbuS acts as both a repressor and an activator. Phenol and m-cresol were inducers of meta pathway enzymatic activity. Catechol, 3-methylcatechol, 4-methylcatechol, o-cresol, and p-cresol were not inducers but could be metabolized by cells previously induced by phenol or m-cresol. PMID:1856161
Overcoming codon-usage bias in heterologous protein expression in Streptococcus gordonii.
Lee, Song F; Li, Yi-Jing; Halperin, Scott A
2009-11-01
One of the limitations facing the development of Streptococcus gordonii into a successful vaccine vector is the inability of this bacterium to express high levels of heterologous proteins. In the present study, we have identified 12 codons deemed as rare codons in S. gordonii and seven other streptococcal species. tRNA genes encoding 10 of the 12 rare codons were cloned into a plasmid. The plasmid was transformed into strains of S. gordonii expressing the fusion protein SpaP/S1, the anti-complement receptor 1 (CR1) single-chain variable fragment (scFv) antibody, or the Toxoplasma gondii cyclophilin C18 protein. These three heterologous proteins contained high percentages of amino acids encoded by rare codons. The results showed that the production of SpaP/S1, anti-CR1 scFv and C18 increased by 2.7-, 120- and 10-fold, respectively, over the control strains. In contrast, the production of the streptococcal SpaP protein without the pertussis toxin S1 fragment was not affected by tRNA gene supplementation, indicating that the increased production of SpaP/S1 protein was due to the ability to overcome the limitation caused by rare codons required for the S1 fragment. The increase in anti-CR1 scFv production was also observed in Streptococcus mutans following tRNA gene supplementation. Collectively, the findings in the present study demonstrate for the first time, to the best of our knowledge, that codon-usage bias exists in Streptococcus spp. and the limitation of heterologous protein expression caused by codon-usage bias can be overcome by tRNA supplementation.
Washington, O R; Deslauriers, M; Stevens, D P; Lyford, L K; Haque, S; Yan, Y; Flood, P M
1993-01-01
Fimbrillin is the major subunit protein of fimbriae from the human periodontal pathogen Porphyromonas (Bacteroides) gingivalis. We describe here the generation and initial characterization of recombinant fimbrillin (r-fimbrillin) isolated from P. gingivalis 381. A fragment of DNA encoding the gene for fimbrillin was generated by polymerase chain reaction and cloned into the expression vector pET11b. Plasmids containing the recombinant gene were transfected into Escherichia coli. Clones were selected on plates for ampicillin resistance and individually screened by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for protein production after activation with IPTG (isopropyl-beta-D- thiogalactopyranoside). One clone, OW0.2, produced significant amounts of a 42-kDa protein after induction with IPTG. This clone contained the pET11b plasmid with a 1-kb insert that had sequence homology to the gene encoding fimbrillin. The majority of recombinant protein from clone OW0.2 was found in the cytoplasm within inclusion bodies. Protein aggregates were solubilized in 8 M urea, and SDS-PAGE analysis showed two major protein bands, one at 42 kDa and the other at 17 kDa. These two proteins coeluted from a DEAE-Sepharose column at 0.15 M NaCl and were reactive to rabbit antiserum to fimbrillin in a Western blot (immunoblot). A preparation giving a single protein band at 42 kDa in SDS-PAGE was obtained by size fractionation by using continuous-elution electrophoresis. Lymph node cells from animals immunized with either fimbrillin from P. gingivalis or r-fimbrillin showed antigen-specific proliferation to both P. gingivalis fimbrillin and r-fimbrillin in an in vitro recall assay. Therefore, it appears that r-fimbrillin is chemically, antigenically, and serologically identical to fimbrillin isolated from P. gingivalis 381. Images PMID:8094377
Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou
2012-01-01
Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.
Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop
2016-01-01
The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.
Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii
Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin
2015-01-01
The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991
Improvement and Optimization of Two Engineered Phage Resistance Mechanisms in Lactococcus lactis
McGrath, Stephen; Fitzgerald, Gerald F.; van Sinderen, Douwe
2001-01-01
Homologous replication module genes were identified for four P335 type phages. DNA sequence analysis revealed that all four phages exhibited more than 90% DNA homology for at least two genes, designated rep2009 and orf17. One of these genes, rep2009, codes for a putative replisome organizer protein and contains an assumed origin of phage DNA replication (ori2009), which was identical for all four phages. DNA fragments representing the ori2009 sequence confer a phage-encoded resistance (Per) phenotype on lactococcal hosts when they are supplied on a high-copy-number vector. Furthermore, cloning multiple copies of the ori2009 sequence was found to increase the effectiveness of the Per phenotype conferred. A number of antisense plasmids targeting specific genes of the replication module were constructed. Two separate plasmids targeting rep2009 and orf17 were found to efficiently inhibit proliferation of all four phages by interfering with intracellular phage DNA replication. These results represent two highly effective strategies for inhibiting bacteriophage proliferation, and they also identify a novel gene, orf17, which appears to be important for phage DNA replication. Furthermore, these results indicate that although the actual mechanisms of DNA replication are very similar, if not identical, for all four phages, expression of the replication genes is significantly different in each case. PMID:11157223
Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin
2014-01-01
The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083
Sanchez, Alba E; Aquino, Guillermo; Ostoa-Saloma, Pedro; Laclette, Juan P; Rocha-Zavaleta, Leticia
2004-07-01
A plasmid vector encoding the cholera toxin B subunit (pCtB) was evaluated as an intradermal genetic adjuvant for a model DNA vaccine expressing the human papillomavirus type 16 L1 capsid gene (p16L1) in mice. p16L1 was coadministered with plasmid pCtB or commercial polypeptide CtB as a positive control. Coadministration of pCtB induced a significant increment of specific anti-L1 immunoglobulin A (IgA) antibodies in cervical secretions (P < 0.05) and fecal extracts (P < 0.005). Additionally, coadministration of pCtB enhanced the production of interleukin-2 and gamma interferon by spleen cells but did not affect the production of interleukin-4, suggesting a Th1-type helper response. Furthermore, improved CD8+ T-cell-mediated cytotoxic activity was observed in mice vaccinated with the DNA vaccine with pCtB as an adjuvant. This adjuvant effect was comparable to that induced by the CtB polypeptide. These results indicate that intradermal coadministration of pCtB is an adequate means to enhance the mucosa-, Th1-, and CD8(+)-mediated cytotoxic responses induced by a DNA vaccine.
Golzio, Muriel; Sersa, Gregor; Escoffre, Jean-Michel; Coer, Andrej; Vidic, Suzana; Teissie, Justin
2012-01-01
Abstract One of the applications of electroporation/electropulsation in biomedicine is gene electrotransfer, the wider use of which is hindered by low transfection efficiency in vivo compared with viral vectors. The aim of our study was to determine whether modulation of the extracellular matrix in solid tumors, using collagenase and hyaluronidase, could increase the transfection efficiency of gene electrotransfer in histologically different solid subcutaneous tumors in mice. Tumors were treated with enzymes before electrotransfer of plasmid DNA encoding either green fluorescent protein or luciferase. Transfection efficiency was determined 3, 9, and 15 days posttransfection. We demonstrated that pretreatment of tumors with a combination of enzymes significantly increased the transfection efficiency of electrotransfer in tumors with a high extracellular matrix area (LPB fibrosarcoma). In tumors with a smaller extracellular matrix area and less organized collagen lattice, the increase was not so pronounced (SA-1 fibrosarcoma and EAT carcinoma), whereas in B16 melanoma, in which only traces of collagen are present, pretreatment of tumors with hyaluronidase alone was more efficient than pretreatment with both enzymes. In conclusion, our results suggest that modification of the extracellular matrix could improve distribution of plasmid DNA in solid subcutaneous tumors, demonstrated by an increase in transfection efficiency, and thus have important clinical implications for electrogene therapy. PMID:21797718
Rauta, Pradipta R; Nayak, Bismita; Monteiro, Gabriel A; Mateus, Marília
2017-01-10
The current investigation aimed at designing DNA vaccines against Aeromonas hydrophila infections. The DNA vaccine candidates were designed to express two antigenic outer membrane protein (Aha1) peptides and to be delivered by a nanoparticle-based delivery system. Gene sequences of conserved regions of antigenic Aha1 [aha1(211-381), aha1(211-381)opt, aha1(703-999) and aha1(703-999)opt] were cloned into pVAX-GFP expression vector. The selected DNA vaccine candidates were purified from E. coli DH5α and transfected into Chinese hamster ovary cells. The expression of the antigenic peptides was measured in cells along post-transfection time, through the fluorescence intensity of the reporter GFP. The lipofection efficiency of aha-pVAX-GFP was highest after 24h incubation. Formulated PLGA-chitosan nanoparticle/plasmid DNA complexes were characterized in terms of size, size distribution and zeta potential. Nanocomplexes with average diameters in the range of 150-170nm transfected in a similar fashion into CHO cells confirmed transfection efficiency comparable to that of lipofection. DNA entrapment and further DNase digestion assays demonstrated ability for pDNA protection by the nanoparticles against enzymatic digestion. Copyright © 2016 Elsevier B.V. All rights reserved.
Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression
Camps, Manel
2010-01-01
ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961
Characterization of new plasmids from methylotrophic bacteria.
Brenner, V; Holubová, I; Benada, O; Hubácek, J
1991-07-01
Several tens of methanol-utilizing bacterial strains isolated from soil were screened for the presence of plasmids. From the obligate methylotroph Methylomonas sp. strain R103a plasmid pIH36 (36 kb) was isolated and its restriction map was constructed. In pink-pigmented facultative methylotrophs (PPFM), belonging to the genus Methylobacterium four plasmids were detected: plasmids pIB200 (200 kb) and pIB14 (14 kb) in the strain R15d and plasmids pWU14 (14 kb) and pWU7 (7.8 kb) in the strain M17. Because of the small size and the presence of several unique REN sites (HindIII, EcoRI, NcoI), plasmid pWU7 was chosen for the construction of a vector for cloning in methylotrophs. Cointegrates pKWU7A and pKWU7B were formed between pWU7 and the E. coli plasmid pK19 Kmr, which were checked for conjugative transfer from E. coli into the methylotrophic host.
Paul, Deepjyoti; Ingti, Birson; Bhattacharjee, Dibyojyoti; Maurya, Anand Prakash; Dhar, Debadatta; Chakravarty, Atanu; Bhattacharjee, Amitabha
2017-05-01
The bla OXA-23 group was considered as the first group of OXA-type β-lactamases conferring carbapenem resistance and has been reported worldwide in Acinetobacter baumannii, however their presence in Escherichia coli is very rare and unique. This study describes an unusual occurrence of bla OXA-23 in 14 clinical isolates of E. coli obtained from intensive care unit patients admitted to a tertiary referral hospital in India. The bla OXA-23 gene was found located within a self-conjugative plasmid of IncF rep B and IncK incompatibility types and simultaneously carrying bla CTX-M-15 , bla VEB-1 , bla PER-1 and/or bla NDM-1 . The copy number of bla OXA-23 within the IncK-type plasmid was inversely proportional to increasing concentrations of imipenem, whereas in the case of the IncF rep B-type the result was variable; and increased copy number of the IncK-type plasmid was observed with increasing concentrations of meropenem. Plasmids encoding bla OXA-23 could be successfully eliminated after single treatment and were found to be not highly stable, as complete loss of plasmids was observed within 5-10 days. This study emphasises that carbapenem stress invariably altered the copy number of two different Inc type plasmids encoding the bla OXA-23 resistance gene and also highlights a potential threat of clonal expansion of this class D carbapenemase through a heterologous host in this country, which is in second incidence globally. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M
2015-01-01
A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.
Bergsveinson, Jordyn; Ziola, Barry
2017-12-01
Beer-spoilage-related lactic acid bacteria (BSR LAB) belong to multiple genera and species; however, beer-spoilage capacity is isolate-specific and partially acquired via horizontal gene transfer within the brewing environment. Thus, the extent to which genus-, species-, or environment- (i.e., brewery-) level genetic variability influences beer-spoilage phenotype is unknown. Publicly available Lactobacillus brevis genomes were analyzed via BlAst Diagnostic Gene findEr (BADGE) for BSR genes and assessed for pangenomic relationships. Also analyzed were functional coding capacities of plasmids of LAB inhabiting extreme niche environments. Considerable genetic variation was observed in L. brevis isolated from clinical samples, whereas 16 candidate genes distinguish BSR and non-BSR L. brevis genomes. These genes are related to nutrient scavenging of gluconate or pentoses, mannose, and metabolism of pectin. BSR L. brevis isolates also have higher average nucleotide identity and stronger pangenome association with one another, though isolation source (i.e., specific brewery) also appears to influence the plasmid coding capacity of BSR LAB. Finally, it is shown that niche-specific adaptation and phenotype are plasmid-encoded for both BSR and non-BSR LAB. The ultimate combination of plasmid-encoded genes dictates the ability of L. brevis to survive in the most extreme beer environment, namely, gassed (i.e., pressurized) beer.
Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.
Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by themore » full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids. IMPORTANCEUnderstanding the mechanism of antimicrobial resistance transfer in bacteria such asStaphylococcus aureusis an important step toward potentially slowing the spread of antimicrobial-resistant infections. This work establishes protein-DNA interactions essential for the transfer of theStaphylococcus aureusmultiresistance plasmid pSK41 by its relaxase, NES. This enzyme also processed variantoriT-like sequences found on numerous plasmids previously considered nontransmissible, suggesting that in conjunction with an uncharacterized accessory protein, these plasmids may be transferred horizontally via a relaxase intransmechanism. These findings have important implications for our understanding of staphylococcal resistance plasmid evolution.« less
Nilsen, E; Haldorsen, B C; Sundsfjord, A; Simonsen, G S; Ingebretsen, A; Naseer, U; Samuelsen, O
2013-11-01
We investigated the prevalence of extended-spectrum β-lactamases (ESBLs) in Enterobacter spp. bloodstream isolates from 19 hospital laboratories in Norway during 2011. A total of 62/230 (27%) isolates were resistant to third-generation cephalosporins and four (1.7%) were ESBL-positive; blaCTX -M-15 (n = 3) and blaSHV -12 (n = 1). This is comparable to the prevalence of ESBLs in clinical isolates of Escherichia coli and Klebsiella pneumoniae in Norway during the same period. All ESBL-positive isolates were multidrug resistant (MDR) and harboured plasmid-mediated quinolone resistance. Three isolates supported transfer of large IncHI2-plasmids harbouring ESBL- and MDR-encoding genes to E. coli recipients by in vitro conjugation. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.
A recursive technique for adaptive vector quantization
NASA Technical Reports Server (NTRS)
Lindsay, Robert A.
1989-01-01
Vector Quantization (VQ) is fast becoming an accepted, if not preferred method for image compression. The VQ performs well when compressing all types of imagery including Video, Electro-Optical (EO), Infrared (IR), Synthetic Aperture Radar (SAR), Multi-Spectral (MS), and digital map data. The only requirement is to change the codebook to switch the compressor from one image sensor to another. There are several approaches for designing codebooks for a vector quantizer. Adaptive Vector Quantization is a procedure that simultaneously designs codebooks as the data is being encoded or quantized. This is done by computing the centroid as a recursive moving average where the centroids move after every vector is encoded. When computing the centroid of a fixed set of vectors the resultant centroid is identical to the previous centroid calculation. This method of centroid calculation can be easily combined with VQ encoding techniques. The defined quantizer changes after every encoded vector by recursively updating the centroid of minimum distance which is the selected by the encoder. Since the quantizer is changing definition or states after every encoded vector, the decoder must now receive updates to the codebook. This is done as side information by multiplexing bits into the compressed source data.
Liu, Lu; Feng, Yu; McNally, Alan; Zong, Zhiyong
2018-06-14
New Delhi MBL (NDM) is a type of carbapenemase; 20 variants of NDM have been identified to date. We have found a new variant of NDM, NDM-21, and describe it here. A carbapenem-resistant Escherichia coli was subjected to WGS using an Illumina X10 sequencer to identify the antimicrobial resistance genes and its ST. The gene encoding the new variant of NDM was cloned into E. coli DH5α, with blaNDM-5 being cloned as the control. Transformants were tested for susceptibility to carbapenems. Mating was performed to obtain the plasmid carrying the new blaNDM gene and the complete plasmid sequence was obtained using long-read MinION sequencing. The E. coli isolate belonged to ST617 and phylogenetic group A. It had a gene encoding NDM-21, a new NDM variant. NDM-21 differs from NDM-5 by a Gly-to-Ser amino acid substitution at position 69 (G69S). NDM-21 retains the same activity against carbapenems as NDM-5. blaNDM-21 is carried by a 46.1 kb IncX3 plasmid, which is self-transmissible, and is located in a complex genetic context as blaNDM-5. The isolate also carried blaCTX-M-55, which encodes an ESBL conferring resistance to aztreonam (which completed its resistance to all clinically available β-lactams), and rmtB, which mediates high-level resistance to aminoglycosides, on an IncFII plasmid. A new NDM variant has been identified and blaNDM-21 has evolved from blaNDM-5 on an IncX3 plasmid.
Plasmid-Encoded Phthalate Catabolic Pathway in Arthrobacter keyseri 12B†
Eaton, Richard W.
2001-01-01
Several 2-substituted benzoates (including 2-trifluoromethyl-, 2-chloro-, 2-bromo-, 2-iodo-, 2-nitro-, 2-methoxy-, and 2-acetyl-benzoates) were converted by phthalate-grown Arthrobacter keyseri (formerly Micrococcus sp.) 12B to the corresponding 2-substituted 3,4-dihydroxybenzoates (protocatechuates). Because these products lack a carboxyl group at the 2 position, they were not substrates for the next enzyme of the phthalate catabolic pathway, 3,4-dihydroxyphthalate 2-decarboxylase, and accumulated. When these incubations were carried out in iron-containing minimal medium, the products formed colored chelates. This chromogenic response was subsequently used to identify recombinant Escherichia coli strains carrying genes encoding the responsible enzymes, phthalate 3,4-dioxygenase and 3,4-dihydroxy-3,4-dihydrophthalate dehydrogenase, from the 130-kbp plasmid pRE1 of strain 12B. Beginning with the initially cloned 8.14-kbp PstI fragment of pRE824 as a probe to identify recombinant plasmids carrying overlapping fragments, a DNA segment of 33.5 kbp was cloned from pRE1 on several plasmids and mapped using restriction endonucleases. From these plasmids, the sequence of 26,274 contiguous bp was determined. Sequenced DNA included several genetic units: tnpR, pcm operon, ptr genes, pehA, norA fragment, and pht operon, encoding a transposon resolvase, catabolism of protocatechuate (3,4-dihydroxybenzoate), a putative ATP-binding cassette transporter, a possible phthalate ester hydrolase, a fragment of a norfloxacin resistance-like transporter, and the conversion of phthalate to protocatechuate, respectively. Activities of the eight enzymes involved in the catabolism of phthalate through protocatechuate to pyruvate and oxaloacetate were demonstrated in cells or cell extracts of recombinant E. coli strains. PMID:11371533
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Kim, K S; Farrand, S K
1996-01-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes. PMID:8655509
Bacterial plasmid transfer under space flight conditions: The Mobilisatsia experience
NASA Astrophysics Data System (ADS)
de Boever, P.; Ilyin, V.; Mahillon, J.; Mergeay, M.
Background Microorganisms are subject to a genetic evolution which may lead to the capacity to colonize new environments and to cause infections Central players in this evolutionary process are mobile genetic elements phages plasmids and transposons The latter help to mobilize and reorganize genes be it within a given genome intragenomic mobility or between bacterial cells intercellular mobility Confined environment and space flight related factors such as microgravity and cosmic radiation may influence the frequency with which mobile genetic elements are exchanged between microorganisms Aim Within the frame of the Mobilisatsia experiment a triparental microbial plasmid transfer was promoted aboard the International Space Station ISS The efficiency of the plasmid exchange process was compared with a synchronously performed ground control experiment An experiment was carried out with well-characterized Gram-negative test strains and one experiment was done with Gram-positive test strains Results The experiment took place during the Soyouz Mission 8 to the ISS from April 19th until April 30th 2004 Liquid cultures of the bacterial strains Cupriavidus metallidurans AE815 final recipient Escherichia coli CM1962 carrying a mobilisable vector with a nickel-resistance marker and E coli CM140 carrying the Broad Host Range plasmid RP4 for the Gram-negative experiment and Bacillus thuringiensis Bti AND931 carrying the conjugative plasmid pXO16 Bti 4Q7 with mobilisable vector pC194 carrying a resistance to chloramphenicol and Bti GBJ002
[Construction of the superantigen SEA transfected laryngocarcinoma cells].
Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua
2013-04-01
To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.
Lee, Min Woo; Rogers, Elizabeth E; Stenger, Drake C
2010-12-01
Xylella fastidiosa strain riv11 harbors a 25-kbp plasmid (pXF-RIV11) belonging to the IncP-1 incompatibility group. Replication and stability factors of pXF-RIV11 were identified and used to construct plasmids able to replicate in X. fastidiosa and Escherichia coli. Replication in X. fastidiosa required a 1.4-kbp region from pXF-RIV11 containing a replication initiation gene (trfA) and the adjacent origin of DNA replication (oriV). Constructs containing trfA and oriV from pVEIS01, a related IncP-1 plasmid of the earthworm symbiont Verminephrobacter eiseniae, also were competent for replication in X. fastidiosa. Constructs derived from pXF-RIV11 but not pVEIS01 replicated in Agrobacterium tumefaciens, Xanthomonas campestris, and Pseudomonas syringae. Although plasmids bearing replication elements from pXF-RIV11 or pVEIS01 could be maintained in X. fastidiosa under antibiotic selection, removal of selection resulted in plasmid extinction after 3 weekly passages. Addition of a toxin-antitoxin addiction system (pemI/pemK) from pXF-RIV11 improved plasmid stability such that >80 to 90% of X. fastidiosa cells retained plasmid after 5 weekly passages in the absence of antibiotic selection. Expression of PemK in E. coli was toxic for cell growth, but toxicity was nullified by coexpression of PemI antitoxin. Deletion of N-terminal sequences of PemK containing the conserved motif RGD abolished toxicity. In vitro assays revealed a direct interaction of PemI with PemK, suggesting that antitoxin activity of PemI is mediated by toxin sequestration. IncP-1 plasmid replication and stability factors were added to an E. coli cloning vector to constitute a stable 6.0-kbp shuttle vector (pXF20-PEMIK) suitable for use in X. fastidiosa.
Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat
2012-01-01
The development of Lactobacillus plantarum to be used in starter cultures in the food industry has been limited because of the lack of a food-grade cloning vector for the bacterium. In this study, the plasmid pFLP1 was constructed by joining 2 DNA fragments derived from food-approved organisms. The 5.2-kb BamHI/KpnI DNA fragment of pRV566 containing the theta-type replicon of Lactobacillus sakei was ligated to the BamHI/KpnI DNA fragment of a 2.9-kb lactococcal cadmium resistance determinant amplified from pND918. The 8.1-kb newly constructed plasmid could transform L. plantarum N014, a bacteriocin-producing bacteria originally isolated from nham, a traditional Thai fermented sausage. The resulting transformant, L. plantarum N014-FLP, and its parent strain were shown to be very similar in growth rate and bacteriocin activity. In addition, the plasmid was very stable in its host bacteria under nonselective pressure for 100 generations in MRS medium and for 5 days in a nham model. These results suggest that pFLP1 is a potential food-grade cloning vector for L. plantarum.
Coelho-Castelo, AAM; Trombone, AP; Rosada, RS; Santos, RR; Bonato, VLD; Sartori, A; Silva, CL
2006-01-01
In order to assess a new strategy of DNA vaccine for a more complete understanding of its action in immune response, it is important to determine the in vivo biodistribution fate and antigen expression. In previous studies, our group focused on the prophylactic and therapeutic use of a plasmid DNA encoding the Mycobacterium leprae 65-kDa heat shock protein (Hsp65) and achieved an efficient immune response induction as well as protection against virulent M. tuberculosis challenge. In the present study, we examined in vivo tissue distribution of naked DNA-Hsp65 vaccine, the Hsp65 message, genome integration and methylation status of plasmid DNA. The DNA-Hsp65 was detectable in several tissue types, indicating that DNA-Hsp65 disseminates widely throughout the body. The biodistribution was dose-dependent. In contrast, RT-PCR detected the Hsp65 message for at least 15 days in muscle or liver tissue from immunized mice. We also analyzed the methylation status and integration of the injected plasmid DNA into the host cellular genome. The bacterial methylation pattern persisted for at least 6 months, indicating that the plasmid DNA-Hsp65 does not replicate in mammalian tissue, and Southern blot analysis showed that plasmid DNA was not integrated. These results have important implications for the use of DNA-Hsp65 vaccine in a clinical setting and open new perspectives for DNA vaccines and new considerations about the inoculation site and delivery system. PMID:16445866
Ni, Lisheng; Jensen, Slade O; Ky Tonthat, Nam; Berg, Tracey; Kwong, Stephen M; Guan, Fiona H X; Brown, Melissa H; Skurray, Ronald A; Firth, Neville; Schumacher, Maria A
2009-11-01
Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partition are critical to the dissemination and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized DNA-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA bound to its cognate operator, ACATGACATG. The structure reveals that ArtA is representative of a new family of ribbon-helix-helix (RHH) DNA-binding proteins that contain extended, N-terminal basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by binding as a dimer-of-dimers and the extended N-terminal regions of ArtA were shown to be essential for this dimer-of-dimer binding mode. Thus, these data indicate that ArtA is a master regulator of genes critical for both horizontal and vertical transmission of pSK41 and that it can recognize DNA utilizing alternate binding modes.
Ni, Lisheng; Jensen, Slade O.; Ky Tonthat, Nam; Berg, Tracey; Kwong, Stephen M.; Guan, Fiona H. X.; Brown, Melissa H.; Skurray, Ronald A.; Firth, Neville; Schumacher, Maria A.
2009-01-01
Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partition are critical to the dissemination and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized DNA-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA bound to its cognate operator, ACATGACATG. The structure reveals that ArtA is representative of a new family of ribbon–helix–helix (RHH) DNA-binding proteins that contain extended, N-terminal basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by binding as a dimer-of-dimers and the extended N-terminal regions of ArtA were shown to be essential for this dimer-of-dimer binding mode. Thus, these data indicate that ArtA is a master regulator of genes critical for both horizontal and vertical transmission of pSK41 and that it can recognize DNA utilizing alternate binding modes. PMID:19759211
Johnson, Timothy J; Siek, Kylie E; Johnson, Sara J; Nolan, Lisa K
2006-01-01
ColV plasmids have long been associated with the virulence of Escherichia coli, despite the fact that their namesake trait, ColV production, does not appear to contribute to virulence. Such plasmids or their associated sequences appear to be quite common among avian pathogenic E. coli (APEC) and are strongly linked to the virulence of these organisms. In the present study, a 180-kb ColV plasmid was sequenced and analyzed. This plasmid, pAPEC-O2-ColV, possesses a 93-kb region containing several putative virulence traits, including iss, tsh, and four putative iron acquisition and transport systems. The iron acquisition and transport systems include those encoding aerobactin and salmochelin, the sit ABC iron transport system, and a putative iron transport system novel to APEC, eit. In order to determine the prevalence of the virulence-associated genes within this region among avian E. coli strains, 595 APEC and 199 avian commensal E. coli isolates were examined for genes of this region using PCR. Results indicate that genes contained within a portion of this putative virulence region are highly conserved among APEC and that the genes of this region occur significantly more often in APEC than in avian commensal E. coli. The region of pAPEC-O2-ColV containing genes that are highly prevalent among APEC appears to be a distinguishing trait of APEC strains.
Johnson, Timothy J.; Siek, Kylie E.; Johnson, Sara J.; Nolan, Lisa K.
2006-01-01
ColV plasmids have long been associated with the virulence of Escherichia coli, despite the fact that their namesake trait, ColV production, does not appear to contribute to virulence. Such plasmids or their associated sequences appear to be quite common among avian pathogenic E. coli (APEC) and are strongly linked to the virulence of these organisms. In the present study, a 180-kb ColV plasmid was sequenced and analyzed. This plasmid, pAPEC-O2-ColV, possesses a 93-kb region containing several putative virulence traits, including iss, tsh, and four putative iron acquisition and transport systems. The iron acquisition and transport systems include those encoding aerobactin and salmochelin, the sit ABC iron transport system, and a putative iron transport system novel to APEC, eit. In order to determine the prevalence of the virulence-associated genes within this region among avian E. coli strains, 595 APEC and 199 avian commensal E. coli isolates were examined for genes of this region using PCR. Results indicate that genes contained within a portion of this putative virulence region are highly conserved among APEC and that the genes of this region occur significantly more often in APEC than in avian commensal E. coli. The region of pAPEC-O2-ColV containing genes that are highly prevalent among APEC appears to be a distinguishing trait of APEC strains. PMID:16385064
pTcGW plasmid vectors 1.1 version: a versatile tool for Trypanosoma cruzi gene characterisation
Kugeratski, Fernanda G; Batista, Michel; Inoue, Alexandre Haruo; Ramos, Bruno Dias; Krieger, Marco Aurelio; Marchini/, Fabricio K
2015-01-01
The functional characterisation of thousands of Trypanosoma cruzi genes remains a challenge. Reverse genetics approaches compatible with high-throughput cloning strategies can provide the tool needed to tackle this challenge. We previously published the pTcGW platform, composed by plasmid vectors carrying different options of N-terminal fusion tags based on Gateway® technology. Here, we present an improved 1.1 version of pTcGW vectors, which is characterised by a fully flexible structure allowing an easy customisation of each element of the vectors in a single cloning step. Additionally, both N and C-terminal fusions are available with new tag options for protein complexes purification. Three of the newly created vectors were successfully used to determine the cellular localisation of four T. cruzi proteins. The 1.1 version of pTcGW platform can be used in a variety of assays, such as protein overexpression, identification of protein-protein interaction and protein localisation. This powerful and versatile tool allows adding valuable functional information to T. cruzi genes and is freely available for scientific community. PMID:26200713
Xylella fastidiosa plasmid-encoded PemK toxin is an endoribonuclease.
USDA-ARS?s Scientific Manuscript database
Stable inheritance of pXF-RIV11 in Xylella fastidiosa is conferred by the pemI/pemK plasmid addiction system. PemK serves as a toxin inhibiting bacterial growth; PemI is the corresponding antitoxin that blocks activity of PemK toxin by direct binding. PemK toxin and PemI antitoxin were over-expre...
USDA-ARS?s Scientific Manuscript database
The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-based clones to expres...
The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit
Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.
2013-01-01
IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419
Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L
2011-12-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.
Method: low-cost delivery of the cotton leaf crumple virus-induced gene silencing system
2012-01-01
Background We previously developed a virus-induced gene silencing (VIGS) vector for cotton from the bipartite geminivirusCotton leaf crumple virus (CLCrV). The original CLCrV VIGS vector was designed for biolistic delivery by a gene gun. This prerequisite limited the use of the system to labs with access to biolistic equipment. Here we describe the adaptation of this system for delivery by Agrobacterium (Agrobacterium tumefaciens). We also describe the construction of two low-cost particle inflow guns. Results The biolistic CLCrV vector was transferred into two Agrobacterium binary plasmids. Agroinoculation of the binary plasmids into cotton resulted in silencing and GFP expression comparable to the biolistic vector. Two homemade low-cost gene guns were used to successfully inoculate cotton (G. hirsutum) and N. benthamiana with either the CLCrV VIGS vector or the Tomato golden mosaic virus (TGMV) VIGS vector respectively. Conclusions These innovations extend the versatility of CLCrV-based VIGS for analyzing gene function in cotton. The two low-cost gene guns make VIGS experiments affordable for both research and teaching labs by providing a working alternative to expensive commercial gene guns. PMID:22853641
Molecular cloning and characterization of the spaB gene of Streptococcus sobrinus.
Holt, R G; Perry, S E
1990-07-01
A gene of Streptococcus sobrinus 6715 (serotype g) designated spaB and encoding a surface protein antigen was isolated from a cosmid gene bank. A 5.4 kb HindIII/AvaI DNA fragment containing the gene was inserted into plasmid pBR322 to yield plasmid pXI404. Analysis of plasmid-encoded gene products showed that the 5.4 kb fragment of pXI404 encoded a 195 kDa protein. Southern blot experiments revealed that the 5.4 kb chromosomal insert DNA had sequence similarity with genomic DNA of S. sobrinus 6715, S. sobrinus B13 (serotype d) and Streptococcus cricetus HS6 (serotype a). The recombinant SpaB protein (rSpaB) was purified and monospecific antiserum was prepared. With immunological techniques and the anti-rSpaB serum, we have shown: (1) that the rSpaB protein has physico-chemical and antigenic identity with the S. sobrinus SpaB protein, (2) the presence of cross-reactive proteins in the extracellular protein of serotypes a and d of the mutans group of streptococci and (3) that the SpaB protein is expressed on the surface of mutans streptococcal serotypes a, d and g.
Method and system for efficient video compression with low-complexity encoder
NASA Technical Reports Server (NTRS)
Chen, Jun (Inventor); He, Dake (Inventor); Sheinin, Vadim (Inventor); Jagmohan, Ashish (Inventor); Lu, Ligang (Inventor)
2012-01-01
Disclosed are a method and system for video compression, wherein the video encoder has low computational complexity and high compression efficiency. The disclosed system comprises a video encoder and a video decoder, wherein the method for encoding includes the steps of converting a source frame into a space-frequency representation; estimating conditional statistics of at least one vector of space-frequency coefficients; estimating encoding rates based on the said conditional statistics; and applying Slepian-Wolf codes with the said computed encoding rates. The preferred method for decoding includes the steps of; generating a side-information vector of frequency coefficients based on previously decoded source data, encoder statistics, and previous reconstructions of the source frequency vector; and performing Slepian-Wolf decoding of at least one source frequency vector based on the generated side-information, the Slepian-Wolf code bits and the encoder statistics.
An efficient procedure for the expression and purification of HIV-1 protease from inclusion bodies.
Nguyen, Hong-Loan Thi; Nguyen, Thuy Thi; Vu, Quy Thi; Le, Hang Thi; Pham, Yen; Trinh, Phuong Le; Bui, Thuan Phuong; Phan, Tuan-Nghia
2015-12-01
Several studies have focused on HIV-1 protease for developing drugs for treating AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. However, large-scale expression and purification of this enzyme is difficult mainly because of its low expression and solubility. In this study, we constructed 9 recombinant plasmids containing a sequence encoding HIV-1 protease along with different fusion tags and examined the expression of the enzyme from these plasmids. Of the 9 plasmids, pET32a(+) plasmid containing the HIV-1 protease-encoding sequence along with sequences encoding an autocleavage site GTVSFNF at the N-terminus and TEV plus 6× His tag at the C-terminus showed the highest expression of the enzyme and was selected for further analysis. The recombinant protein was isolated from inclusion bodies by using 2 tandem Q- and Ni-Sepharose columns. SDS-PAGE of the obtained HIV-1 protease produced a single band of approximately 13 kDa. The enzyme was recovered efficiently (4 mg protein/L of cell culture) and had high specific activity of 1190 nmol min(-1) mg(-1) at an optimal pH of 4.7 and optimal temperature of 37 °C. This procedure for expressing and purifying HIV-1 protease is now being scaled up to produce the enzyme on a large scale for its application. Copyright © 2015 Elsevier Inc. All rights reserved.
Rhizomucor miehei triglyceride lipase is processed and secreted from transformed Aspergillus oryzae.
Huge-Jensen, B; Andreasen, F; Christensen, T; Christensen, M; Thim, L; Boel, E
1989-09-01
The cDNA encoding the precursor of the Rhizomucor miehei triglyceride lipase was inserted in an Aspergillus oryzae expression vector. In this vector the expression of the lipase cDNA is under control of the Aspergillus oryzae alpha-amylase gene promoter and the Aspergillus niger glucoamylase gene terminator. The recombinant plasmid was introduced into Aspergillus oryzae, and transformed colonies were selected and screened for lipase expression. Lipase-positive transformants were grown in a small fermentor, and recombinant triglyceride lipase was purified from the culture broth. The purified enzymatically active recombinant lipase (rRML) secreted from A. oryzae was shown to have the same characteristics with respect to mobility on reducing SDS-gels and amino acid composition as the native enzyme. N-terminal amino acid sequencing indicated that approximately 70% of the secreted rRML had the same N-terminal sequence as the native Rhizomucor miehei enzyme, whereas 30% of the secreted rRML was one amino acid residue shorter in the N-terminal. The recombinant lipase precursor, which has a 70 amino acid propeptide, is thus processed in and secreted from Aspergillus oryzae. We have hereby demonstrated the utility of this organism as a host for the production of recombinant triglyceride lipases.
Avdeeva, S V; Khaĭdarova, N V; Logunov, D Iu; Neugodova, G L; Sevast'ianova, G A; Tarantul, V Z; Naroditskiĭ, B S
2003-01-01
A method was elaborated to evaluate the biological activity of expression products of gene in the plasmid vectors, which are crucial for the synthesis of growth factor of blood vessels. It was proven as possible that the chrioallantonic membrane (CAM) of chicken's embryos could be transfected by recombinant plasmids containing both the reporter and target genes. The efficiency of CAM transfection was assessed by a plasmid carrying the reporter gene of green fluorescent protein (GFP). Finally, it was demonstrated that, at an infiltration of the recombinant plasmid containing the human angiogenine gene, its expression products induce the neovascularization in the CAM cells of chicken's embryos and stimulate an accretion in vessels of the 1st, 2nd and 3d orders.
Unger, Mark D; Pleticha, Josef; Heilmann, Lukas F; Newman, Laura K; Maus, Timothy P; Beutler, Andreas S
2018-05-25
Intrathecal interleukin-10 delivered by plasmid or viral gene vectors has been proposed for clinical testing because it is effective for chronic pain in rodents, a potential therapeutic for various human diseases, and was found to be non-toxic in dogs, when the human interleukin-10 ortholog was tested. However, recent studies in swine testing porcine interleukin-10 demonstrated fatal neurotoxicity. To deliver vector-encoded human interleukin-10 in swine, measure expression of the transgene in cerebrospinal fluid, and monitor animals for signs of neurotoxicity. Human interleukin-10 levels peaked 2 weeks after vector administration followed by a rapid decline that occurred concomitant with the emergence of anti-human interleukin-10 antibodies in the cerebrospinal fluid and serum. Animals remained neurologically healthy throughout the study period. This study suggests that swine are not idiosyncratically sensitive to intrathecal interleukin-10 because, recapitulating previous reports in dogs, they suffered no clinical neurotoxicity from the human ortholog. These results strongly infer that toxicity of intrathecal interleukin-10 in large animal models was previously overlooked because of a species mismatch between transgene and host. The present study further suggests that swine were protected from interleukin-10 by a humoral immune response against the xenogeneic cytokine. Future safety studies of interleukin-10 or related therapeutics may require syngeneic large animal models. This article is protected by copyright. All rights reserved.
Live, attenuated Salmonella typhimurium vectoring Campylobacter antigens.
Sizemore, Donata R; Warner, Beth; Lawrence, Julie; Jones, Amy; Killeen, Kevin P
2006-05-01
We describe the evaluation of three live, attenuated deltaphoP/Q Salmonella enteric serovar Typhimurium strains expressing PEB1 minus its signal sequence (PEB1-ss) from three different plasmids: a pBR-based asd plasmid, an arabinose-based runaway plasmid, which each expressed PEB1-ss in the bacterial cytosol, and a PEB1::HlyA fusion plasmid that directs secretion of PEB1-ss into the extracellular milieu. Serum IgG responses specific for PEB1-ss were induced by pBR-derived and runaway plasmids, with 100 and 90% seroconversion, respectively, at a 1:500 dilution of anti-sera as measured by Western blot analysis, while the PEB1-ss::HlyA fusion plasmid induced serum IgG in only 20% of the mice. Although significant levels of anti-PEB serum IgG were induced, no protection against oral Campylobacter jejuni challenge was observed.
Nucleic acid immunization protects dogs against challenge with virulent canine parvovirus.
Jiang, W; Baker, H J; Swango, L J; Schorr, J; Self, M J; Smith, B F
1998-04-01
Nucleic acid vaccines (NAVs) use expression vectors encoding one or more antigen genes to transfect host cells inducing both humoral and cellular immunity against the expressed antigen. NAV offers major advantages over conventional vaccines for the protection of humans and animals. This study shows that a plasmid DNA (pGT36VP1) encoding the full length VP1 region of canine parvovirus (CPV) induces immunity that protects dogs against challenge with virulent virus. Five dogs without anti-CPV antibodies were injected at 9 months of age with increasing doses of pGT36VP1 or saline. NAV vaccinated dogs showed an increase of serum IgG titer starting 1 week post-injection which peaked at week 2 and remained detectable for at least 14 weeks. A second dose of NAV resulted in an anamnestic response within 1 week. IgG titers peaked at week 3 and 4 after the second injection. All pGT36VP1 vaccinated dogs were protected against infection after virulent CPV challenge regardless of dose and the unvaccinated control dog was fully susceptible. This study demonstrated for the first time that a NAV can protect dogs against an infectious disease.
Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro
2010-01-01
Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].
Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi
2013-04-01
This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.
Intranasal gene delivery for treating Parkinson's disease: overcoming the blood-brain barrier.
Aly, Amirah E-E; Waszczak, Barbara L
2015-01-01
Developing a disease-modifying gene therapy for Parkinson's disease (PD) has been a high priority for over a decade. However, due to the inability of large biomolecules to cross the blood-brain barrier (BBB), the only means of delivery to the brain has been intracerebral infusion. Intranasal administration offers a non-surgical means of bypassing the BBB to deliver neurotrophic factors, and the genes encoding them, directly to the brain. This review summarizes: i) evidence demonstrating intranasal delivery to the brain of a number of biomolecules having therapeutic potential for various CNS disorders; and ii) evidence demonstrating neuroprotective efficacy of a subset of biomolecules specifically for PD. The intersection of these two spheres represents the area of opportunity for development of new intranasal gene therapies for PD. To that end, our laboratory showed that intranasal administration of glial cell line-derived neurotrophic factor (GDNF), or plasmid DNA nanoparticles encoding GDNF, provides neuroprotection in a rat model of PD, and that the cells transfected by the nanoparticle vector are likely to be pericytes. A number of genes encoding neurotrophic factors have therapeutic potential for PD, but few have been tested by the intranasal route and shown to be neuroprotective in a model of PD. Intranasal delivery provides a largely unexplored, promising approach for development of a non-invasive gene therapy for PD.
Abdul-Wahid, Aws; Faubert, Gaétan
2007-12-05
In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.
Iacono-Connors, L C; Schmaljohn, C S; Dalrymple, J M
1990-01-01
The gene encoding Bacillus anthracis protective antigen (PA) was modified by site-directed mutagenesis, subcloned into baculovirus and vaccinia virus plasmid transfer vectors (pAcYM1 and pSC-11, respectively), and inserted via homologous recombinations into baculovirus Autographa californica nuclear polyhedrosis virus or vaccinia virus (strains WR and Connaught). Expression of PA was detected in both systems by immunofluorescence assays with antisera from rabbits immunized with B. anthracis PA. Western blot (immunoblot) analysis showed that the expressed product of both systems was slightly larger (86 kilodaltons) than B. anthracis-produced PA (83.5 kilodaltons). Analysis of trypsin digests of virus-expressed and authentic PA suggested that the size difference was due to the presence of a signal sequence remaining with the virus-expressed protein. Immunization of mice with either recombinant baculovirus-infected Spodoptera frugiperda cells or with vaccinia virus recombinants elicited a high-titer, anti-PA antibody response. Images PMID:2105271
Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A
1987-01-15
The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.
EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology.
Lai, Hung-En; Moore, Simon; Polizzi, Karen; Freemont, Paul
2018-01-01
Development of advanced synthetic biology tools is always in demand since they act as a platform technology to enable rapid prototyping of biological constructs in a high-throughput manner. EcoFlex is a modular cloning (MoClo) kit for Escherichia coli and is based on the Golden Gate principles, whereby Type IIS restriction enzymes (BsaI, BsmBI, BpiI) are used to construct modular genetic elements (biological parts) in a bottom-up approach. Here, we describe a collection of plasmids that stores various biological parts including promoters, RBSs, terminators, ORFs, and destination vectors, each encoding compatible overhangs allowing hierarchical assembly into single transcription units or a full-length polycistronic operon or biosynthetic pathway. A secondary module cloning site is also available for pathway optimization, in order to limit library size if necessary. Here, we show the utility of EcoFlex using the violacein biosynthesis pathway as an example.
Horizontal gene transfer of chromosomal Type II toxin-antitoxin systems of Escherichia coli.
Ramisetty, Bhaskar Chandra Mohan; Santhosh, Ramachandran Sarojini
2016-02-01
Type II toxin-antitoxin systems (TAs) are small autoregulated bicistronic operons that encode a toxin protein with the potential to inhibit metabolic processes and an antitoxin protein to neutralize the toxin. Most of the bacterial genomes encode multiple TAs. However, the diversity and accumulation of TAs on bacterial genomes and its physiological implications are highly debated. Here we provide evidence that Escherichia coli chromosomal TAs (encoding RNase toxins) are 'acquired' DNA likely originated from heterologous DNA and are the smallest known autoregulated operons with the potential for horizontal propagation. Sequence analyses revealed that integration of TAs into the bacterial genome is unique and contributes to variations in the coding and/or regulatory regions of flanking host genome sequences. Plasmids and genomes encoding identical TAs of natural isolates are mutually exclusive. Chromosomal TAs might play significant roles in the evolution and ecology of bacteria by contributing to host genome variation and by moderation of plasmid maintenance. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Plasmids from Food Lactic Acid Bacteria: Diversity, Similarity, and New Developments
Cui, Yanhua; Hu, Tong; Qu, Xiaojun; Zhang, Lanwei; Ding, Zhongqing; Dong, Aijun
2015-01-01
Plasmids are widely distributed in different sources of lactic acid bacteria (LAB) as self-replicating extrachromosomal genetic materials, and have received considerable attention due to their close relationship with many important functions as well as some industrially relevant characteristics of the LAB species. They are interesting with regard to the development of food-grade cloning vectors. This review summarizes new developments in the area of lactic acid bacteria plasmids and aims to provide up to date information that can be used in related future research. PMID:26068451
Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N
2012-10-01
The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.
Electrotransfer of Plasmid Vector DNA into Muscle
NASA Astrophysics Data System (ADS)
Miyazaki, Satsuki; Miyazaki, Jun-Ichi
Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.
Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie
2015-01-01
Municipal wastewater treatment facilities are considered to be “hotspots” for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7–9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3-like plasmids concomitant to phylogenetic analysis of housekeeping genes from host Klebsiella strains, revealed that these plasmids are limited to a predominantly human-associated sub-clade of Klebsiella, suggesting that their host range is very narrow. Conversely, the pGNB2-like plasmids had a much broader host range and appeared to be associated with Klebsiella residing in natural environments. This study suggests that: (A) qnrB-harboring multidrug-resistant pKPN3-like plasmids can endure the rigorous wastewater treatment process and may therefore be disseminated to downstream environments; and (B) that small qnrS-harboring pGNB2-like plasmids are ubiquitous in wastewater treatment facilities and are most likely environmental in origin. PMID:26696974
Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie
2015-01-01
Municipal wastewater treatment facilities are considered to be "hotspots" for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7-9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3-like plasmids concomitant to phylogenetic analysis of housekeeping genes from host Klebsiella strains, revealed that these plasmids are limited to a predominantly human-associated sub-clade of Klebsiella, suggesting that their host range is very narrow. Conversely, the pGNB2-like plasmids had a much broader host range and appeared to be associated with Klebsiella residing in natural environments. This study suggests that: (A) qnrB-harboring multidrug-resistant pKPN3-like plasmids can endure the rigorous wastewater treatment process and may therefore be disseminated to downstream environments; and (B) that small qnrS-harboring pGNB2-like plasmids are ubiquitous in wastewater treatment facilities and are most likely environmental in origin.
Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.
Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina
2011-12-01
Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. © 2011 New York Academy of Sciences.